TY - JOUR
AU1 - Aghbolaghi, Marzieh, Asadi
AU2 - Ahmadzadeh,, Faraham
AU3 - Kiabi,, Bahram
AU4 - Keyghobadi,, Nusha
AB - Abstract The Persian squirrel (Sciurus anomalus) is a keystone species in the Middle East’s woodlands and oak forests. We investigated the phylogeography of the species using two partial mitochondrial (D-loop, Cyt b) and two nuclear (Rag1, Cmyc) markers with extensive sampling throughout the range of the species in the Irano-Anatolian region. Phylogenetic analyses using Bayesian and maximum likelihood methods and haplotype networks demonstrated two well-supported lineages of S. anomalus in the study area, including one lineage (comprising three groups) in Anatolia and another lineage (comprising two groups) in the Levant region and Zagros forests. The Anatolian and Levantine populations are found entirely in humid coastal regions, whereas the Zagros populations are associated with continental climatic conditions. No shared haplotypes and no evidence of gene flow (based on FST statistics) were observed among the groups. Analysis indicated that the ancestral population of the species first evolved in western Anatolia and the Greek islands. Estimated divergence times of less than 1 Mya between the lineages, and among the groups within lineages, suggest that Pleistocene climatic fluctuations may have led to the isolation of the species in refugial areas during ice ages. Signs of population expansion indicate that subsequent postglacial expansion and diversification then shaped the current distribution pattern of the Persian squirrel. evolutionary history, Irano-Anatolian Terrain – molecular phylogeography, Persian squirrel, Sciuridae, Sciurus anomalus INTRODUCTION Keystone species, by definition, have a profound impact on ecosystem patterns and processes. Conservation of keystone species and cultivating knowledge about their distribution and evolution play an important role in ecosystem monitoring and management (Kolar & Lodge, 2002; Bousquet & Le Page, 2004; Tattoni et al., 2005; Genovesi, 2005; Wheatley et al., 2005; Riam et al., 2007). The Persian squirrel or Caucasian squirrel (Sciurus anomalusGüldenstädt, 1785) is a keystone species in temperate forests and woodlands (Karami et al., 2016) and is listed under Annex IV of the European Habitats Directive (Council Directive 92/43/EEC; Riam et al., 2007). The species is a medium-sized tree squirrel and the only representative of the family Sciuridae in the Middle East and extreme south-western Asia (Etemad, 1978; Masseti, 2005; Oshida et al., 2009). It is distributed in forest areas dominated by oak, pine and pistachio in the Irano-Anatolian region, Levant and southern Black Sea up to altitudes of 2000 m (from Greece to Turkey, Armenia, Georgia, Azerbaijan, Iran, Iraq, Palestine, Jordan, Lebanon and Syria; see Hatt, 1959; Osborn, 1964; Harrison & Bates, 1991; Özkurt et al., 1999; Amr, 2006; Yiğit et al., 2006; Arslan et al., 2008; Thorington et al., 2012; Khalili et al., 2016; Koprowski et al., 2016). The Persian squirrel is relatively abundant in protected areas and is listed as ‘Least Concern (LC)’ in the IUCN Red List (Yiğit et al., 2008). However, habitat loss and fragmentation are considered important threats responsible for population decline of the Persian squirrel, especially in Lebanon, Syria and Iran (Harrison et al., 2006; Yigit et al., 2008). According to Thorington et al. (2012), the species shows a discontinuous distribution across its range. Thus far, three subspecies have been recognized: Sciurus anomalus anomalus Gueldenstaedt, 1785, distributed in the Anatolian plateau and Caucasus Mountains (Misonne, 1957; Pavlinov & Ross Olimo, 1987; Masseti, 2010; Koprowski et al., 2016), Sciurus anomalus pallescensGray, 1867 distributed in the Zagros Mountains (Harrison & Bates, 1991), and Sciurus anomalus syriacus Ehrenberg, 1828 distributed in the eastern Mediterranean (Tristram, 1866; Abel, 1933; Lewis et al., 1967; Gavish & Gurnell, 1999; Koprowski et al., 2016). The subspecies display different colour patterns: S. a. syriacus has dark dorsal pelage and the tail and feet are generally dark, while S. a. anomalus has a deep red tail and S. a. pallescens has a pale back and feet and a yellowish brown tail (Ellerman, 1948; Harrison & Bates, 1991; Albayrak & Arsalan, 2006). Fossil records suggest that tree squirrels originated in the Northern Hemisphere and from there became widespread (Mercer & Roth, 2003; Steppan et al., 2004). Squirrels belonging to the genus Sciurus Linnaeus, 1758 are well adapted to subarctic and temperate forests and are widely distributed across the Old and New Worlds (Mercer & Roth, 2003; Oshida et al., 2009). Several environmental factors such as low temperature, vegetation change and limited solar radiation are hypothesized to have affected the historical dispersal patterns of these mammals (Liu et al., 2014). For instance, genetic divergence patterns and the geographical range of populations of tree squirrels in Eurasia have been affected by Pleistocene climatic changes (Wilson & Reeder, 2005). In the Irano-Anatolian area and neighbouring regions where the Persian squirrel occurs, diversification events have been mainly attributed to climatic fluctuations (in particular Pleistocene climatic fluctuations), geological events or a combination of the two in different time periods (Bilgin et al., 2008). The impact of climatic fluctuations on the genetic structure of organisms during the Pleistocene in the Irano-Anatolian region is well documented (Kasapidis et al., 2005; Dubey et al., 2007; Ahmadzadeh et al., 2013; Gür, 2013; Gür et al., 2018). Multiple glacial contractions and expansions have played an important role in shaping biodiversity patterns in the area (Taberlet et al., 1998; Bernatchez et al., 2001; Veith et al., 2003; Bilgin et al., 2008), and several local refugial regions for several taxa of animals and plants have been reported (Rossiter et al., 2007; Dozières et al., 2012). At the same time, geological events have formed barriers to gene flow, resulting in the historical isolation of ancestral lineages in several areas of the region (Kosswigg, 1955; Davis, 1971; Çıplak, 2004; Kornilios et al., 2011). Pleistocene climatic fluctuations along with the geological events make the area a biodiversity hotspot, containing many endemic species and showing complex genetic diversity (Kosswigg, 1955; Rokas et al., 2003; Hewitt, 2004; Mittermeier et al., 2005). The dynamic environmental history and structurally complex habitats across the distribution range of the Persian squirrel, which have the potential to affect intraspecific genetic differentiation in the species, provide an interesting model for surveying phylogeographical structure. Although the Persian squirrel is a common mammal species, very little is known about its population structure or dispersal patterns. Due to a lack of comprehensive studies, the current geographical genetic structure of the species remains ambiguous, despite the potential importance of such information for conservation and setting of action plans. To address this knowledge gap, we conducted an extensive survey of mitochondrial DNA variation, using the D-loop region and cytochrome b (Cyt b) gene, and nuclear genetic variation (Rag1, recombination activating gene; and Cmyc, proto-oncogene) throughout the range of S. anomalus with two main objectives: To elucidate the phylogeography and genetic structure across the range of the species and examine the genetic differences of Persian squirrel populations from different, disjunct areas (e.g. Anatolia and Iran). To explore the species’ evolutionary history, potential population expansion and the divergence dates of different possible lineages. We hypothesized that Pleistocene climatic variation created two or more isolated refugial populations that subsequently expanded and spread when more favourable conditions prevailed. Therefore, we expected to see genetically distinct lineages dating to the Pleistocene epoch, and signs of more recent demographic expansion. MATERIAL AND METHODS Sampling, sequence processing and phylogenetic analyses Our sampling covered the entire geographical distribution range of the Persian squirrel (Fig. 1). Tissues including small pieces of ear, skin and fur were sampled from live animals or carcasses. For sampling of live animals, in cooperation with the Department of Environment in Iran, live squirrels illegally taken by hunters or local people were sampled and tissues were preserved in 100% ethanol at −20 °C (Taberlet et al., 1999). All live squirrels were released after capture. No samples from zoos were considered in this research because of the risk of hybridization in captivity. Figure 1. View largeDownload slide Geographical distribution of two lineages, comprising five groups, in the Persian squirrel. This is a modified distribution map from Thorington et al. (2012) and Koprowski et al. (2016). Large coloured points represent genetic sampling localities and adjacent numbers correspond to location codes provided in Table 1. Small black points are additional occurrence localities of Sciurus anomalus. Localities of groups, identified using phylogenetic analyses, are as follows: G1 (Greek Islands and eastern Anatolia), G2 (northern Anatolia and Pontic forests on the southern coast of the Black Sea), G3 (southern Anatolia), G4 (Levant region on the eastern coast of the Mediterranean Sea and northern Zagros mountains of Iran) and G5 (southern Zagros mountains of Iran). Figure 1. View largeDownload slide Geographical distribution of two lineages, comprising five groups, in the Persian squirrel. This is a modified distribution map from Thorington et al. (2012) and Koprowski et al. (2016). Large coloured points represent genetic sampling localities and adjacent numbers correspond to location codes provided in Table 1. Small black points are additional occurrence localities of Sciurus anomalus. Localities of groups, identified using phylogenetic analyses, are as follows: G1 (Greek Islands and eastern Anatolia), G2 (northern Anatolia and Pontic forests on the southern coast of the Black Sea), G3 (southern Anatolia), G4 (Levant region on the eastern coast of the Mediterranean Sea and northern Zagros mountains of Iran) and G5 (southern Zagros mountains of Iran). Samples from some remote and inaccessible areas (e.g. Syria, Turkey and Greece) were obtained from natural history museum specimens (Natural History Museum Vienna, Austria; Natural History Museum of Crete, Greece; Table 1). Total genomic DNA from each individual was extracted using either standard saline or phenol–chloroform methods (Sambrook et al., 1989). DNA from all museum samples was extracted in a dedicated laboratory. To avoid contamination during extraction of museum samples, scissors were sterilized before use for each sample using sodium hypochloride solution and 99% ethanol, followed by flame sterilization. Additionally, all extraction sessions included a blank control (Madsen et al., 2015). Two mitochondrial DNA fragments, from the D-loop region and cytochrome b (Cyt b), and two nuclear DNA fragments, from Cmyc and Rag1, were amplified (Table 2). Amplifications were carried out in a final volume of 25 µL. The polymerase chain reaction (PCR) mix included 1 U of Taq polymerase (Ampliqon), 10 µm Tris-HCl, 30 µm KCl, 1.5 µm MgCl2, 250 µm of each dNTP and 2 pmol of each primer. Amplifications were performed on a Bio-Rad cycler with an initial step of denaturation at 94 °C for 2 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing for 30 s at a different temperature for each locus (50 °C for D-loop, 48 °C for Cyt b, 61 °C for Cmyc, 51 °C for Rag1) and extension at 72 °C for 60 s, and a final extension of 72 °C for 5 min. Table 1 Collection information and GenBank accession numbers for the samples included in this study Species or Subspecies Sample Code/ Location code on the map/ Group Code Museum Code Locality/ Country/Year Lat (N) Long (E) Origin GenBank accession numbers D-loop- n=26 * Cyt b- n=23 Cmyc- n=26 Rag1- n=26 S. a. pallescens ES1101/1/ G4 - Northern Zagros / Iran /2016 35°35'25.18" 46°12'36.17" This study MK561658 MK561690 MK561632 MK561707 S. a. pallescens ES1102/2/G4 - Northern Zagros / Iran /2016 35°59'42.36" 46°10'36.67" This study MK561659 MK561686 MK561633 MK561708 S. a. pallescens ES1103/3/G4 - Northern Zagros / Iran /2016 35°60'40.48" 45°45'4.916" This study MK561660 MK561687 MK561634 MK561709 S. a. pallescens ES1104/4/G4 - Northern Zagros / Iran /2016 35°31'15.66" 46°23'30.88" This study MK561661 MK561691 MK561635 MK561710 S. a. pallescens ES1105/5/G4 - Northern Zagros / Iran /2016 35°17'58.28" 46°23'30.88" This study MK561662 MK561689 MK561636 MK561711 S. a. pallescens ES1106/6/G5 - Northern Zagros / Iran /2016 34°38'46.83" 46°24'57.78" This study MK561663 MK561699 MK561637 MK561712 S. a. syriacus ES1127/7/G4 NHMC80.5.36.1 East of Mediterranean/ Levant region / Syria /1999 33°10'40.80" 36°29'42.90" This study MK561664 MK561688 MK561638 MK561713 S. a. syriacus ES1128/8/G4 NHMC80.5.36.2 East of Mediterranean/ Levant region / Syria /1999 33°10'40.75" 36°29'42.85" This study MK561665 MK561698 MK561639 MK561714 S. a. anomalus ES1129/9/G1 NHMC80.5.36.4 Greece /Lesvos /2006 39°10'10.20" 26°13'58.80" This study MK561666 MK561693 MK561640 MK561715 S. a. anomalus ES1130/10/G1 NHMC80.5.36.5 Greece/Lesvos /2015 39°10'36.00" 26°14'35.88" This study MK561667 MK561694 MK561641 MK561716 S. a. anomalus ES1146/11/G2 NMW62957 Northern Anatolia / Turkey /1934 40°47'60.00" 31°41'60.00" This study MK561668 MK561700 MK561642 MK561717 S. a. anomalus ES1149/12/G2 NMW62958 Northern Anatolia / Turkey /1934 40°47'60.00" 31°41'60.00" This study MK561669 - MK561643 MK561719 S. a. anomalus ES1159/13/G1 NMW62941 Eastern Anatolia / Turkey /1969 38°16'60.00" 26°52'0.00" This study MK561670 MK561701 MK561644 MK561720 S. a. anomalus ES1160/14/G2 NMW62942 Northern Anatolia / Turkey /1936 40°35'0.00" 31°40'0.00" This study MK561671 MK561702 MK561645 MK561721 S. a. anomalus ES1161/15/G3 NMW62943 Southern Anatolia / Turkey /1936 - - This study MK561672 MK561703 MK561646 MK561722 S. a. anomalus ES1166/16/G2 NMW62948 Northern Anatolia / Turkey/1934 40°47'60.00" 31°52'60.00" This study MK561673 MK561704 MK561647 MK561723 S. a. anomalus ES1167/17/G3 NMW62949 Southern Anatolia/ Turkey /1934 - - This study MK561674 MK561705 MK561648 MK561724 S. a. anomalus ES1169/18/G2 NMW62952 Northern Anatolia / Turkey /1934 40°47'60.00" 31°52'60.00" This study MK561675 - MK561649 MK561725 S. a. anomalus ES1171/19/G3 NMW62954 Southern Anatolia / Turkey /1934 - - This study MK561676 - MK561650 MK561732 S. a. pallescens ES1172/20/G5 - Southern Zagros / Iran /2017 34°48'58.20" 46°08'05.41" This study MK561677 MK561695 MK561651 MK561726 S. a. pallescens ES1173/21/G5 - Southern Zagros / Iran /2017 31°54'50.42" 50°31'21.94" This study MK561678 MK561696 MK561652 MK561727 S. a. pallescens ES1174/22/G5 - Southern Zagros / Iran /2017 34°42'59.70" 48°28'55.78" This study MK561679 MK561706 MK561653 MK561728 S. a. pallescens ES1175/23/G5 - Southern Zagros / Iran /2017 33° 27'19.1" 46°44'43.78" This study MK561680 MK561692 MK561654 MK561729 S. a. pallescens ES1176/24/G4 - Northern Zagros / Iran /2017 33° 27'19.1" 46°44'43.78" This study MK561681 MK561697 MK561655 MK561730 S. a. pallescens ES1177/25/G5 - Southern Zagros / Iran /2017 33°34'15.35" 48°31'14.30" This study MK561682 MK561684 MK561656 MK561731 S. a. pallescens ES1178/26/G5 - Southern Zagros / Iran /2017 33°34'15.35" 48°31'14.30" This study MK561683 MK561685 MK561657 MK561733 S. a. anomalus -/27/G3 - Southern Anatolia/ Turkey - - Oshida et al. 2009 - AB292675 - - S. a. anomalus -/28/G3 - Southern Anatolia / Turkey - - Oshida et al. 2009 - AB292676 - - S. a. anomalus -/29/G3 - Southern Anatolia / Turkey - - Oshida et al. 2009 - AB292677 - - S. stramineus Out qroup - North America - - Oshida et al. 2009,Steppan et al. 2004 - AB292678 AY241518 - S. ignitus Out qroup - North America - - Steppan et al. 2004 - - AY241519 AY241477 S. carolensis Out qroup - North America - - Moncrie et al. 2012 JX104439 JX104410 AY241517 - Species or Subspecies Sample Code/ Location code on the map/ Group Code Museum Code Locality/ Country/Year Lat (N) Long (E) Origin GenBank accession numbers D-loop- n=26 * Cyt b- n=23 Cmyc- n=26 Rag1- n=26 S. a. pallescens ES1101/1/ G4 - Northern Zagros / Iran /2016 35°35'25.18" 46°12'36.17" This study MK561658 MK561690 MK561632 MK561707 S. a. pallescens ES1102/2/G4 - Northern Zagros / Iran /2016 35°59'42.36" 46°10'36.67" This study MK561659 MK561686 MK561633 MK561708 S. a. pallescens ES1103/3/G4 - Northern Zagros / Iran /2016 35°60'40.48" 45°45'4.916" This study MK561660 MK561687 MK561634 MK561709 S. a. pallescens ES1104/4/G4 - Northern Zagros / Iran /2016 35°31'15.66" 46°23'30.88" This study MK561661 MK561691 MK561635 MK561710 S. a. pallescens ES1105/5/G4 - Northern Zagros / Iran /2016 35°17'58.28" 46°23'30.88" This study MK561662 MK561689 MK561636 MK561711 S. a. pallescens ES1106/6/G5 - Northern Zagros / Iran /2016 34°38'46.83" 46°24'57.78" This study MK561663 MK561699 MK561637 MK561712 S. a. syriacus ES1127/7/G4 NHMC80.5.36.1 East of Mediterranean/ Levant region / Syria /1999 33°10'40.80" 36°29'42.90" This study MK561664 MK561688 MK561638 MK561713 S. a. syriacus ES1128/8/G4 NHMC80.5.36.2 East of Mediterranean/ Levant region / Syria /1999 33°10'40.75" 36°29'42.85" This study MK561665 MK561698 MK561639 MK561714 S. a. anomalus ES1129/9/G1 NHMC80.5.36.4 Greece /Lesvos /2006 39°10'10.20" 26°13'58.80" This study MK561666 MK561693 MK561640 MK561715 S. a. anomalus ES1130/10/G1 NHMC80.5.36.5 Greece/Lesvos /2015 39°10'36.00" 26°14'35.88" This study MK561667 MK561694 MK561641 MK561716 S. a. anomalus ES1146/11/G2 NMW62957 Northern Anatolia / Turkey /1934 40°47'60.00" 31°41'60.00" This study MK561668 MK561700 MK561642 MK561717 S. a. anomalus ES1149/12/G2 NMW62958 Northern Anatolia / Turkey /1934 40°47'60.00" 31°41'60.00" This study MK561669 - MK561643 MK561719 S. a. anomalus ES1159/13/G1 NMW62941 Eastern Anatolia / Turkey /1969 38°16'60.00" 26°52'0.00" This study MK561670 MK561701 MK561644 MK561720 S. a. anomalus ES1160/14/G2 NMW62942 Northern Anatolia / Turkey /1936 40°35'0.00" 31°40'0.00" This study MK561671 MK561702 MK561645 MK561721 S. a. anomalus ES1161/15/G3 NMW62943 Southern Anatolia / Turkey /1936 - - This study MK561672 MK561703 MK561646 MK561722 S. a. anomalus ES1166/16/G2 NMW62948 Northern Anatolia / Turkey/1934 40°47'60.00" 31°52'60.00" This study MK561673 MK561704 MK561647 MK561723 S. a. anomalus ES1167/17/G3 NMW62949 Southern Anatolia/ Turkey /1934 - - This study MK561674 MK561705 MK561648 MK561724 S. a. anomalus ES1169/18/G2 NMW62952 Northern Anatolia / Turkey /1934 40°47'60.00" 31°52'60.00" This study MK561675 - MK561649 MK561725 S. a. anomalus ES1171/19/G3 NMW62954 Southern Anatolia / Turkey /1934 - - This study MK561676 - MK561650 MK561732 S. a. pallescens ES1172/20/G5 - Southern Zagros / Iran /2017 34°48'58.20" 46°08'05.41" This study MK561677 MK561695 MK561651 MK561726 S. a. pallescens ES1173/21/G5 - Southern Zagros / Iran /2017 31°54'50.42" 50°31'21.94" This study MK561678 MK561696 MK561652 MK561727 S. a. pallescens ES1174/22/G5 - Southern Zagros / Iran /2017 34°42'59.70" 48°28'55.78" This study MK561679 MK561706 MK561653 MK561728 S. a. pallescens ES1175/23/G5 - Southern Zagros / Iran /2017 33° 27'19.1" 46°44'43.78" This study MK561680 MK561692 MK561654 MK561729 S. a. pallescens ES1176/24/G4 - Northern Zagros / Iran /2017 33° 27'19.1" 46°44'43.78" This study MK561681 MK561697 MK561655 MK561730 S. a. pallescens ES1177/25/G5 - Southern Zagros / Iran /2017 33°34'15.35" 48°31'14.30" This study MK561682 MK561684 MK561656 MK561731 S. a. pallescens ES1178/26/G5 - Southern Zagros / Iran /2017 33°34'15.35" 48°31'14.30" This study MK561683 MK561685 MK561657 MK561733 S. a. anomalus -/27/G3 - Southern Anatolia/ Turkey - - Oshida et al. 2009 - AB292675 - - S. a. anomalus -/28/G3 - Southern Anatolia / Turkey - - Oshida et al. 2009 - AB292676 - - S. a. anomalus -/29/G3 - Southern Anatolia / Turkey - - Oshida et al. 2009 - AB292677 - - S. stramineus Out qroup - North America - - Oshida et al. 2009,Steppan et al. 2004 - AB292678 AY241518 - S. ignitus Out qroup - North America - - Steppan et al. 2004 - - AY241519 AY241477 S. carolensis Out qroup - North America - - Moncrie et al. 2012 JX104439 JX104410 AY241517 - * Because museum specimens were more than 50 years old and were consequently in poor condition, only about 450 bp could be sequenced for Cyt b while 1000 bp of this gene could be sequenced in fresh samples. Each row in the table represents a single sample (n = 1). Group code refers to groups inferred by phylogenetic analyses, as indicated in Figures 1 and 2. For museum codes, NHMC refers to the Natural History Museum of Crete (Greece) and NMW refers to the Natural History Museum Vienna (Austria). View Large Table 1 Collection information and GenBank accession numbers for the samples included in this study Species or Subspecies Sample Code/ Location code on the map/ Group Code Museum Code Locality/ Country/Year Lat (N) Long (E) Origin GenBank accession numbers D-loop- n=26 * Cyt b- n=23 Cmyc- n=26 Rag1- n=26 S. a. pallescens ES1101/1/ G4 - Northern Zagros / Iran /2016 35°35'25.18" 46°12'36.17" This study MK561658 MK561690 MK561632 MK561707 S. a. pallescens ES1102/2/G4 - Northern Zagros / Iran /2016 35°59'42.36" 46°10'36.67" This study MK561659 MK561686 MK561633 MK561708 S. a. pallescens ES1103/3/G4 - Northern Zagros / Iran /2016 35°60'40.48" 45°45'4.916" This study MK561660 MK561687 MK561634 MK561709 S. a. pallescens ES1104/4/G4 - Northern Zagros / Iran /2016 35°31'15.66" 46°23'30.88" This study MK561661 MK561691 MK561635 MK561710 S. a. pallescens ES1105/5/G4 - Northern Zagros / Iran /2016 35°17'58.28" 46°23'30.88" This study MK561662 MK561689 MK561636 MK561711 S. a. pallescens ES1106/6/G5 - Northern Zagros / Iran /2016 34°38'46.83" 46°24'57.78" This study MK561663 MK561699 MK561637 MK561712 S. a. syriacus ES1127/7/G4 NHMC80.5.36.1 East of Mediterranean/ Levant region / Syria /1999 33°10'40.80" 36°29'42.90" This study MK561664 MK561688 MK561638 MK561713 S. a. syriacus ES1128/8/G4 NHMC80.5.36.2 East of Mediterranean/ Levant region / Syria /1999 33°10'40.75" 36°29'42.85" This study MK561665 MK561698 MK561639 MK561714 S. a. anomalus ES1129/9/G1 NHMC80.5.36.4 Greece /Lesvos /2006 39°10'10.20" 26°13'58.80" This study MK561666 MK561693 MK561640 MK561715 S. a. anomalus ES1130/10/G1 NHMC80.5.36.5 Greece/Lesvos /2015 39°10'36.00" 26°14'35.88" This study MK561667 MK561694 MK561641 MK561716 S. a. anomalus ES1146/11/G2 NMW62957 Northern Anatolia / Turkey /1934 40°47'60.00" 31°41'60.00" This study MK561668 MK561700 MK561642 MK561717 S. a. anomalus ES1149/12/G2 NMW62958 Northern Anatolia / Turkey /1934 40°47'60.00" 31°41'60.00" This study MK561669 - MK561643 MK561719 S. a. anomalus ES1159/13/G1 NMW62941 Eastern Anatolia / Turkey /1969 38°16'60.00" 26°52'0.00" This study MK561670 MK561701 MK561644 MK561720 S. a. anomalus ES1160/14/G2 NMW62942 Northern Anatolia / Turkey /1936 40°35'0.00" 31°40'0.00" This study MK561671 MK561702 MK561645 MK561721 S. a. anomalus ES1161/15/G3 NMW62943 Southern Anatolia / Turkey /1936 - - This study MK561672 MK561703 MK561646 MK561722 S. a. anomalus ES1166/16/G2 NMW62948 Northern Anatolia / Turkey/1934 40°47'60.00" 31°52'60.00" This study MK561673 MK561704 MK561647 MK561723 S. a. anomalus ES1167/17/G3 NMW62949 Southern Anatolia/ Turkey /1934 - - This study MK561674 MK561705 MK561648 MK561724 S. a. anomalus ES1169/18/G2 NMW62952 Northern Anatolia / Turkey /1934 40°47'60.00" 31°52'60.00" This study MK561675 - MK561649 MK561725 S. a. anomalus ES1171/19/G3 NMW62954 Southern Anatolia / Turkey /1934 - - This study MK561676 - MK561650 MK561732 S. a. pallescens ES1172/20/G5 - Southern Zagros / Iran /2017 34°48'58.20" 46°08'05.41" This study MK561677 MK561695 MK561651 MK561726 S. a. pallescens ES1173/21/G5 - Southern Zagros / Iran /2017 31°54'50.42" 50°31'21.94" This study MK561678 MK561696 MK561652 MK561727 S. a. pallescens ES1174/22/G5 - Southern Zagros / Iran /2017 34°42'59.70" 48°28'55.78" This study MK561679 MK561706 MK561653 MK561728 S. a. pallescens ES1175/23/G5 - Southern Zagros / Iran /2017 33° 27'19.1" 46°44'43.78" This study MK561680 MK561692 MK561654 MK561729 S. a. pallescens ES1176/24/G4 - Northern Zagros / Iran /2017 33° 27'19.1" 46°44'43.78" This study MK561681 MK561697 MK561655 MK561730 S. a. pallescens ES1177/25/G5 - Southern Zagros / Iran /2017 33°34'15.35" 48°31'14.30" This study MK561682 MK561684 MK561656 MK561731 S. a. pallescens ES1178/26/G5 - Southern Zagros / Iran /2017 33°34'15.35" 48°31'14.30" This study MK561683 MK561685 MK561657 MK561733 S. a. anomalus -/27/G3 - Southern Anatolia/ Turkey - - Oshida et al. 2009 - AB292675 - - S. a. anomalus -/28/G3 - Southern Anatolia / Turkey - - Oshida et al. 2009 - AB292676 - - S. a. anomalus -/29/G3 - Southern Anatolia / Turkey - - Oshida et al. 2009 - AB292677 - - S. stramineus Out qroup - North America - - Oshida et al. 2009,Steppan et al. 2004 - AB292678 AY241518 - S. ignitus Out qroup - North America - - Steppan et al. 2004 - - AY241519 AY241477 S. carolensis Out qroup - North America - - Moncrie et al. 2012 JX104439 JX104410 AY241517 - Species or Subspecies Sample Code/ Location code on the map/ Group Code Museum Code Locality/ Country/Year Lat (N) Long (E) Origin GenBank accession numbers D-loop- n=26 * Cyt b- n=23 Cmyc- n=26 Rag1- n=26 S. a. pallescens ES1101/1/ G4 - Northern Zagros / Iran /2016 35°35'25.18" 46°12'36.17" This study MK561658 MK561690 MK561632 MK561707 S. a. pallescens ES1102/2/G4 - Northern Zagros / Iran /2016 35°59'42.36" 46°10'36.67" This study MK561659 MK561686 MK561633 MK561708 S. a. pallescens ES1103/3/G4 - Northern Zagros / Iran /2016 35°60'40.48" 45°45'4.916" This study MK561660 MK561687 MK561634 MK561709 S. a. pallescens ES1104/4/G4 - Northern Zagros / Iran /2016 35°31'15.66" 46°23'30.88" This study MK561661 MK561691 MK561635 MK561710 S. a. pallescens ES1105/5/G4 - Northern Zagros / Iran /2016 35°17'58.28" 46°23'30.88" This study MK561662 MK561689 MK561636 MK561711 S. a. pallescens ES1106/6/G5 - Northern Zagros / Iran /2016 34°38'46.83" 46°24'57.78" This study MK561663 MK561699 MK561637 MK561712 S. a. syriacus ES1127/7/G4 NHMC80.5.36.1 East of Mediterranean/ Levant region / Syria /1999 33°10'40.80" 36°29'42.90" This study MK561664 MK561688 MK561638 MK561713 S. a. syriacus ES1128/8/G4 NHMC80.5.36.2 East of Mediterranean/ Levant region / Syria /1999 33°10'40.75" 36°29'42.85" This study MK561665 MK561698 MK561639 MK561714 S. a. anomalus ES1129/9/G1 NHMC80.5.36.4 Greece /Lesvos /2006 39°10'10.20" 26°13'58.80" This study MK561666 MK561693 MK561640 MK561715 S. a. anomalus ES1130/10/G1 NHMC80.5.36.5 Greece/Lesvos /2015 39°10'36.00" 26°14'35.88" This study MK561667 MK561694 MK561641 MK561716 S. a. anomalus ES1146/11/G2 NMW62957 Northern Anatolia / Turkey /1934 40°47'60.00" 31°41'60.00" This study MK561668 MK561700 MK561642 MK561717 S. a. anomalus ES1149/12/G2 NMW62958 Northern Anatolia / Turkey /1934 40°47'60.00" 31°41'60.00" This study MK561669 - MK561643 MK561719 S. a. anomalus ES1159/13/G1 NMW62941 Eastern Anatolia / Turkey /1969 38°16'60.00" 26°52'0.00" This study MK561670 MK561701 MK561644 MK561720 S. a. anomalus ES1160/14/G2 NMW62942 Northern Anatolia / Turkey /1936 40°35'0.00" 31°40'0.00" This study MK561671 MK561702 MK561645 MK561721 S. a. anomalus ES1161/15/G3 NMW62943 Southern Anatolia / Turkey /1936 - - This study MK561672 MK561703 MK561646 MK561722 S. a. anomalus ES1166/16/G2 NMW62948 Northern Anatolia / Turkey/1934 40°47'60.00" 31°52'60.00" This study MK561673 MK561704 MK561647 MK561723 S. a. anomalus ES1167/17/G3 NMW62949 Southern Anatolia/ Turkey /1934 - - This study MK561674 MK561705 MK561648 MK561724 S. a. anomalus ES1169/18/G2 NMW62952 Northern Anatolia / Turkey /1934 40°47'60.00" 31°52'60.00" This study MK561675 - MK561649 MK561725 S. a. anomalus ES1171/19/G3 NMW62954 Southern Anatolia / Turkey /1934 - - This study MK561676 - MK561650 MK561732 S. a. pallescens ES1172/20/G5 - Southern Zagros / Iran /2017 34°48'58.20" 46°08'05.41" This study MK561677 MK561695 MK561651 MK561726 S. a. pallescens ES1173/21/G5 - Southern Zagros / Iran /2017 31°54'50.42" 50°31'21.94" This study MK561678 MK561696 MK561652 MK561727 S. a. pallescens ES1174/22/G5 - Southern Zagros / Iran /2017 34°42'59.70" 48°28'55.78" This study MK561679 MK561706 MK561653 MK561728 S. a. pallescens ES1175/23/G5 - Southern Zagros / Iran /2017 33° 27'19.1" 46°44'43.78" This study MK561680 MK561692 MK561654 MK561729 S. a. pallescens ES1176/24/G4 - Northern Zagros / Iran /2017 33° 27'19.1" 46°44'43.78" This study MK561681 MK561697 MK561655 MK561730 S. a. pallescens ES1177/25/G5 - Southern Zagros / Iran /2017 33°34'15.35" 48°31'14.30" This study MK561682 MK561684 MK561656 MK561731 S. a. pallescens ES1178/26/G5 - Southern Zagros / Iran /2017 33°34'15.35" 48°31'14.30" This study MK561683 MK561685 MK561657 MK561733 S. a. anomalus -/27/G3 - Southern Anatolia/ Turkey - - Oshida et al. 2009 - AB292675 - - S. a. anomalus -/28/G3 - Southern Anatolia / Turkey - - Oshida et al. 2009 - AB292676 - - S. a. anomalus -/29/G3 - Southern Anatolia / Turkey - - Oshida et al. 2009 - AB292677 - - S. stramineus Out qroup - North America - - Oshida et al. 2009,Steppan et al. 2004 - AB292678 AY241518 - S. ignitus Out qroup - North America - - Steppan et al. 2004 - - AY241519 AY241477 S. carolensis Out qroup - North America - - Moncrie et al. 2012 JX104439 JX104410 AY241517 - * Because museum specimens were more than 50 years old and were consequently in poor condition, only about 450 bp could be sequenced for Cyt b while 1000 bp of this gene could be sequenced in fresh samples. Each row in the table represents a single sample (n = 1). Group code refers to groups inferred by phylogenetic analyses, as indicated in Figures 1 and 2. For museum codes, NHMC refers to the Natural History Museum of Crete (Greece) and NMW refers to the Natural History Museum Vienna (Austria). View Large Table 2. Primers used for amplification and sequencing of mitochondrial and nuclear loci Gene Primer pairs Sequences (5′–3′) Annealing temperature °C Product size (bp) Sources D-loop DFSloop F CGCAATACTCGACCAATCC 50 400 Moncrief et al. (2010) DFSloop R TGATGATTTCACGGAGGTAGG Cyt b L14724 F GATATGAAAAACCATCGTTG 48 Oshida et al. ( 2009); Smith & Patton (1991); Moncrief et al. (2010) H15910 R GATTTTTGGTTTACAAGACCGAG (For fresh specimens) 1000 *MVZ 04 R GCAGCCCCTCAGAATGATATTTGTCCTC (For musem specimens) 450 Rag1 S76 F CTGACAAAGAAGAAGGTGGAG 51 492 Steppan et al. (2004) S119 R GAAGGGACCATTCAGGTAGTC Cmyc S92 F RRAGCCTCATTAAGTCTTAGGTAAGAA 61 569 bp Steppan et al. (2004); Miyamoto et al. (2000) S93 R TTCCTCCTCTGGCGTTCCAAGACGTTGTG Gene Primer pairs Sequences (5′–3′) Annealing temperature °C Product size (bp) Sources D-loop DFSloop F CGCAATACTCGACCAATCC 50 400 Moncrief et al. (2010) DFSloop R TGATGATTTCACGGAGGTAGG Cyt b L14724 F GATATGAAAAACCATCGTTG 48 Oshida et al. ( 2009); Smith & Patton (1991); Moncrief et al. (2010) H15910 R GATTTTTGGTTTACAAGACCGAG (For fresh specimens) 1000 *MVZ 04 R GCAGCCCCTCAGAATGATATTTGTCCTC (For musem specimens) 450 Rag1 S76 F CTGACAAAGAAGAAGGTGGAG 51 492 Steppan et al. (2004) S119 R GAAGGGACCATTCAGGTAGTC Cmyc S92 F RRAGCCTCATTAAGTCTTAGGTAAGAA 61 569 bp Steppan et al. (2004); Miyamoto et al. (2000) S93 R TTCCTCCTCTGGCGTTCCAAGACGTTGTG *Because museum specimens were more than 50 years old and were consequently in poor condition, MVZ 04 (Reverse primer) was used for Cyt b in museum specimens yielding a smaller, about 450-bp fragment that could be sequenced. View Large Table 2. Primers used for amplification and sequencing of mitochondrial and nuclear loci Gene Primer pairs Sequences (5′–3′) Annealing temperature °C Product size (bp) Sources D-loop DFSloop F CGCAATACTCGACCAATCC 50 400 Moncrief et al. (2010) DFSloop R TGATGATTTCACGGAGGTAGG Cyt b L14724 F GATATGAAAAACCATCGTTG 48 Oshida et al. ( 2009); Smith & Patton (1991); Moncrief et al. (2010) H15910 R GATTTTTGGTTTACAAGACCGAG (For fresh specimens) 1000 *MVZ 04 R GCAGCCCCTCAGAATGATATTTGTCCTC (For musem specimens) 450 Rag1 S76 F CTGACAAAGAAGAAGGTGGAG 51 492 Steppan et al. (2004) S119 R GAAGGGACCATTCAGGTAGTC Cmyc S92 F RRAGCCTCATTAAGTCTTAGGTAAGAA 61 569 bp Steppan et al. (2004); Miyamoto et al. (2000) S93 R TTCCTCCTCTGGCGTTCCAAGACGTTGTG Gene Primer pairs Sequences (5′–3′) Annealing temperature °C Product size (bp) Sources D-loop DFSloop F CGCAATACTCGACCAATCC 50 400 Moncrief et al. (2010) DFSloop R TGATGATTTCACGGAGGTAGG Cyt b L14724 F GATATGAAAAACCATCGTTG 48 Oshida et al. ( 2009); Smith & Patton (1991); Moncrief et al. (2010) H15910 R GATTTTTGGTTTACAAGACCGAG (For fresh specimens) 1000 *MVZ 04 R GCAGCCCCTCAGAATGATATTTGTCCTC (For musem specimens) 450 Rag1 S76 F CTGACAAAGAAGAAGGTGGAG 51 492 Steppan et al. (2004) S119 R GAAGGGACCATTCAGGTAGTC Cmyc S92 F RRAGCCTCATTAAGTCTTAGGTAAGAA 61 569 bp Steppan et al. (2004); Miyamoto et al. (2000) S93 R TTCCTCCTCTGGCGTTCCAAGACGTTGTG *Because museum specimens were more than 50 years old and were consequently in poor condition, MVZ 04 (Reverse primer) was used for Cyt b in museum specimens yielding a smaller, about 450-bp fragment that could be sequenced. View Large Amplified PCR products were visualized by 1% agarose gel electrophoresis, and were subsequently sent to Macrogen (Korea) for sequencing. The original chromatograph data were checked using SeqScape (v.2.7). MUSCLE was used to align sequences (Edgar, 2004). Sequences of all samples for the four genes (total number of sequenced fragments = 101: D-loop, 26; Cyt b, 23; Cmyc, 26; Rag1, 26) have been deposited in GenBank (accession numbers are given in Table 1). Models of nucleotide substitution were chosen using Akaike’s information criterion in MrModeltest (v.2.3; Nylander, 2004). The corresponding sequences of Sciurus stramineus, Sciurus ignites and Sciurus carolinensis were used as outgroups (Table 1). Phylogenetic trees were inferred by Bayesian inference (BI) and maximum likelihood (ML) methods. The Bayesian tree was inferred with MrBayes (v.3.1.2; Huelsenbeck & Ronquist, 2001). The analysis was run for 4 × 106 generations, saving one tree each 100th generation. The log likelihood values of the sample points were plotted against generation time, and all the trees prior to reaching stationary (10%) were discarded, ensuring that burn-in samples were not retained. Remaining trees were combined in a 50% majority consensus tree. ML analyses were carried out using IQ-TREE (v.1.6.1; Stamatakis, 2006). Qualitative evaluation (Wiens, 1998) revealed no strong conflict among the gene regions analysed. Therefore, subsequent analyses were performed using a concatenated data set. Haplotype network Haplotypes, number of shared haplotypes and F statistics were obtained with Arlequin (v.3.11; Excoffier et al., 2005). Haplotype and nucleotide diversity were estimated using DnaSP (v.4.20.2; Rozas et al., 2003). Evolutionary divergence was estimated in MEGA (v.7. 0.26; Tamura et al., 2007). Evolutionary relationships among haplotypes were represented by a median-joining network created with the software Network (v.4.6; Bandelt et al., 1999). Estimating divergence time Divergence times were estimated using BEAST (v.1.6.2; Drummond & Rambaut, 2007). For the mitochondrial sequences, divergence time analyses were based on the estimated substitution rate (9.4E−9 ± 5.0E−9 substitutions/site/year) of the mitochondrial genome for the Sciurus lineage (Pesole et al., 1999; Horn et al., 2011; Madsen et al., 2015). For the nuclear genes (Cmyc, Rag1), substitution rate was co-estimated in BEAST (v.1.6.2; Drummond & Rambaut, 2007) using the mitochondrial substitution rate, and found to be 2.97E−9 ± 0.0016E−9 substitutions/site/year. A strict clock approach was used with the clock model unlinked, a coalescent constant size model, uniform distribution for the tree prior, and HKY model applied for nucleotide substitution (Drummond et al., 2005). Analyses were performed on the concatenated data set containing all four genes. Markov chain Monte Carlo (MCMC) analysis was run in BEAST (v.1.6.2) for 50 million generations with the first 10% of trees/parameters discarded as burn-in. The convergence of the MCMC chains was checked with TRACER (v.1.5; Rambaut & Drummond, 2009). Node heights (i.e. node ages) were calculated as means of the posterior estimates and 95% highest posterior density intervals (HPD). A statistical dispersal–vicariance analysis was performed with S-DIVA and RASP (v. 3.0) to estimate the ancestral range (Yu et al., 2010, 2011). The localities of Sciurus anomalus groups used were as follows: G1 (Greek Islands and eastern Anatolia), G2 (northern Anatolia), G3 (southern Anatolia), G4 (northern Zagros) and G5 (southern Zagros). The BI analyses were then implemented for the combined data set. The output tree files of MrBayes were used as input for S-DIVA and RASP, and each run was executed for 1 000 000 generations using the MCMC method. Demographic analyses Potential demographic changes were inferred by neutrality tests including mismatch distributions, Tajima’s D (Tajima, 1989), and Fu and Li’s D* and F* (Fu & Li, 1993), as estimated in DnaSP (run as default; v.4.20.2). As the nuclear genes did not show enough variability, they were not used for the neutrality tests. To infer historical population dynamics, Bayesian skyline plots (BSPs) were generated in BEAST (v.1.6.2; Heled & Drummond, 2008). We used a strict clock and a mitochondrial substitution rate of 9.4E−9 ± 5.0E−9 substitutions/site/year for the Sciurus lineage and a nuclear substitution rate of 2.97E−9 ± 0.0016E−9 substitutions/site/year, under the HKY model of nucleotide substitution (Pesole et al., 1999; Horn et al., 2011; Madsen et al., 2015). The analysis was run for 50 million generations, following which operator values were adjusted to optimize search settings. All runs were checked for all parameters using TRACER (v.1.5; Rambaut & Drummond, 2009). RESULTS The concatenated multi-locus data set contained 2004–2461 bp [D-loop 400 bp, Cyt b 450 bp (museum specimens) to 1000 bp (fresh specimens), Cmyc 569 bp, Rag1 492 bp; Table 1]. About 1400 bp of the mitochondrial fragments including 24 variable sites, corresponding to 14 sites for D-loop and ten sites for Cyt b, were used. From the 1061 bp of nuclear gene sequences, six variable sites corresponding to three sites for each gene (Rag1 and Cmyc) were detected. The best substitution models, polymorphic sites, transition/transversion ratio, nucleotide diversity (π), haplotype diversity (HD) and number of haplotypes for each gene, as well as the number of shared haplotypes and F statistics are presented in Table 3. Table 3. Properties of the molecular data set and chosen substitution model Marker Locus Substitution model Polymorphic sites Transition/ transversion ratio Number of haplotypes Haplotype diversity (HD) Nucleotide diversity (π) FST Shared haplotypes between lineages D-loop Mitochondrial HKY+I 14 17.23 22 0.960 0.015 0.571 0 Cyt b Mitochondrial HKY 10 8.02 10 0.803 0.004 0.712 0 Cmyc Nuclear (exon–intron) K80 3 0.50 3 0.254 0.000 – – Rag1* Nuclear (exon) K80 3 0.50 3 0.670 0.000 – – Marker Locus Substitution model Polymorphic sites Transition/ transversion ratio Number of haplotypes Haplotype diversity (HD) Nucleotide diversity (π) FST Shared haplotypes between lineages D-loop Mitochondrial HKY+I 14 17.23 22 0.960 0.015 0.571 0 Cyt b Mitochondrial HKY 10 8.02 10 0.803 0.004 0.712 0 Cmyc Nuclear (exon–intron) K80 3 0.50 3 0.254 0.000 – – Rag1* Nuclear (exon) K80 3 0.50 3 0.670 0.000 – – *Cmyc sequences were almost identical for all samples with only three variable gaps (insertions or deletions). Rag1 sequences were also almost identical for all samples with just one polymorphic nucleotide site and two gaps. View Large Table 3. Properties of the molecular data set and chosen substitution model Marker Locus Substitution model Polymorphic sites Transition/ transversion ratio Number of haplotypes Haplotype diversity (HD) Nucleotide diversity (π) FST Shared haplotypes between lineages D-loop Mitochondrial HKY+I 14 17.23 22 0.960 0.015 0.571 0 Cyt b Mitochondrial HKY 10 8.02 10 0.803 0.004 0.712 0 Cmyc Nuclear (exon–intron) K80 3 0.50 3 0.254 0.000 – – Rag1* Nuclear (exon) K80 3 0.50 3 0.670 0.000 – – Marker Locus Substitution model Polymorphic sites Transition/ transversion ratio Number of haplotypes Haplotype diversity (HD) Nucleotide diversity (π) FST Shared haplotypes between lineages D-loop Mitochondrial HKY+I 14 17.23 22 0.960 0.015 0.571 0 Cyt b Mitochondrial HKY 10 8.02 10 0.803 0.004 0.712 0 Cmyc Nuclear (exon–intron) K80 3 0.50 3 0.254 0.000 – – Rag1* Nuclear (exon) K80 3 0.50 3 0.670 0.000 – – *Cmyc sequences were almost identical for all samples with only three variable gaps (insertions or deletions). Rag1 sequences were also almost identical for all samples with just one polymorphic nucleotide site and two gaps. View Large Phylogenetic analyses Both inference methodologies (ML and BI) supported two distinct evolutionary lineages within the distribution range of the species. Lineage one (L1) comprised three groups of samples that were sorted based on geographical location: these were samples from the Lesvos Island of Greece and western Turkey (group 1), samples from northern Turkey (group 2) and samples from southern Turkey (group 3). Lineage two (L2) comprised two less differentiated groups of samples: the first group had a disjunct distribution and included samples from the eastern coast of the Mediterranean Sea and from the northern Zagros, from northern Iraq to western Iran (group 4), while the second group corresponded to samples collected from the southern Zagros Mountain range (group 5) (Fig. 2). Figure 2. View largeDownload slide Dated Bayesian tree of the Sciurus anomalus lineages, inferred from 2461 bp of mitochondrial and nuclear DNA (D-loop, Cyt b, Rag1 and Cmyc), revealing two evolutionary lineages comprising five groups. Grey bar shows 95% highest posterior density intervals of estimated node ages (Mya). Posterior probabilities are shown above and maximum likelihood bootstrap values are shown below branches. The tree is rooted by Sciurus carolinensis, Sciurus starmineus and Sciurus iginitus sequences as outgroups. Figure 2. View largeDownload slide Dated Bayesian tree of the Sciurus anomalus lineages, inferred from 2461 bp of mitochondrial and nuclear DNA (D-loop, Cyt b, Rag1 and Cmyc), revealing two evolutionary lineages comprising five groups. Grey bar shows 95% highest posterior density intervals of estimated node ages (Mya). Posterior probabilities are shown above and maximum likelihood bootstrap values are shown below branches. The tree is rooted by Sciurus carolinensis, Sciurus starmineus and Sciurus iginitus sequences as outgroups. Estimating divergence time and ancestral range Estimated intraspecific divergence times for the Persian squirrel were less than 1 Mya, in the Pleistocene. The two main lineages of Persian squirrel (L1 and L2) diverged about 0.922 Mya (HPD: 0.666–1.214). S-DIVA and RASP analyses proposed western Anatolia and the Greek Islands (locality of G1) to be the ancestral range of Sciurus anomalus, with the highest marginal probability of 58% (Fig. 3). Figure 3. View largeDownload slide Graphical output of S-DIVA analysis for Sciurus anomalus. Pie diagrams show the ancestral distributions. Letters refer to the group membership of the analysed material, based on phylogenetic analyses (A = G1; B = G2; C = G3, D = G4, E = G5, F = out-groups). Colour key indicates possible ancestral ranges; letter combinations indicate a combination of ranges; black represents other ancestral ranges (see text for more details). Figure 3. View largeDownload slide Graphical output of S-DIVA analysis for Sciurus anomalus. Pie diagrams show the ancestral distributions. Letters refer to the group membership of the analysed material, based on phylogenetic analyses (A = G1; B = G2; C = G3, D = G4, E = G5, F = out-groups). Colour key indicates possible ancestral ranges; letter combinations indicate a combination of ranges; black represents other ancestral ranges (see text for more details). Haplotype networks Due to lack of sufficient variability in the nuclear gene sequences (Cmyc and Rag1), haplotype networks were estimated only for the mitochondrial genes. For the D-loop, 22 different haplotypes were identified, whereas for Cyt b ten haplotypes were found among 26 individuals (Tables 4 and 5). For the D-loop region, all individuals from groups G4 and G5 in the Zagros Mountain range and the eastern coast of the Mediterranean Sea are separated at least by five mutational steps from groups G1, G2 and G3 in Anatolia (Turkey). Groups G2 and G3 are separated from each other at least by 9 mutational steps. Also, Groups G2 and G3 are separated from group G1 at least by five mutational steps (Fig. 4A). Table 4. List of D-loop region haplotypes and haplotype frequencies (for sample information see Table 1 and Fig. 4A) D-loop region Haplotype code Sample code Haplotype frequency H 1 ES1101 1 H 2 ES1102 1 H 3 ES1103, ES1105 2 H 4 ES1104 1 H 5 ES1106 1 H 6 ES1127 1 H 7 ES1128 1 H 8 ES1129 1 H 9 ES1130 1 H 10 ES1146, ES1160, ES1166 3 H 11 ES1149 1 H 12 ES1159 1 H 13 ES1161, ES1167 2 H 14 ES1169 1 H 15 ES1171 1 H 16 ES1172 1 H 17 ES1173 1 H 18 ES1174 1 H 19 ES1175 1 H 20 ES1176 1 H 21 ES1177 1 H 22 ES1178 1 D-loop region Haplotype code Sample code Haplotype frequency H 1 ES1101 1 H 2 ES1102 1 H 3 ES1103, ES1105 2 H 4 ES1104 1 H 5 ES1106 1 H 6 ES1127 1 H 7 ES1128 1 H 8 ES1129 1 H 9 ES1130 1 H 10 ES1146, ES1160, ES1166 3 H 11 ES1149 1 H 12 ES1159 1 H 13 ES1161, ES1167 2 H 14 ES1169 1 H 15 ES1171 1 H 16 ES1172 1 H 17 ES1173 1 H 18 ES1174 1 H 19 ES1175 1 H 20 ES1176 1 H 21 ES1177 1 H 22 ES1178 1 View Large Table 4. List of D-loop region haplotypes and haplotype frequencies (for sample information see Table 1 and Fig. 4A) D-loop region Haplotype code Sample code Haplotype frequency H 1 ES1101 1 H 2 ES1102 1 H 3 ES1103, ES1105 2 H 4 ES1104 1 H 5 ES1106 1 H 6 ES1127 1 H 7 ES1128 1 H 8 ES1129 1 H 9 ES1130 1 H 10 ES1146, ES1160, ES1166 3 H 11 ES1149 1 H 12 ES1159 1 H 13 ES1161, ES1167 2 H 14 ES1169 1 H 15 ES1171 1 H 16 ES1172 1 H 17 ES1173 1 H 18 ES1174 1 H 19 ES1175 1 H 20 ES1176 1 H 21 ES1177 1 H 22 ES1178 1 D-loop region Haplotype code Sample code Haplotype frequency H 1 ES1101 1 H 2 ES1102 1 H 3 ES1103, ES1105 2 H 4 ES1104 1 H 5 ES1106 1 H 6 ES1127 1 H 7 ES1128 1 H 8 ES1129 1 H 9 ES1130 1 H 10 ES1146, ES1160, ES1166 3 H 11 ES1149 1 H 12 ES1159 1 H 13 ES1161, ES1167 2 H 14 ES1169 1 H 15 ES1171 1 H 16 ES1172 1 H 17 ES1173 1 H 18 ES1174 1 H 19 ES1175 1 H 20 ES1176 1 H 21 ES1177 1 H 22 ES1178 1 View Large Table 5. List of Cyt b haplotypes and haplotype frequencies (for sample information see Table 1 and Fig. 4B) Cyt b Haplotype code Sample code or accession number Haplotype frequency H 1 AB292675, AB292677, ES1161, ES1167 4 H 2 AB292676 1 H 3 ES1101, ES1102, ES1106, ES1127, ES1128, ES1172, ES1173, ES1174, ES1175, ES1177, ES1178 11 H 4 ES1103, ES1105 2 H 5 ES1104 1 H 6 ES1129, ES1130 2 H 7 ES1146 1 H 8 ES1159 1 H 9 ES1160, ES1166 2 H10 ES1176 1 Cyt b Haplotype code Sample code or accession number Haplotype frequency H 1 AB292675, AB292677, ES1161, ES1167 4 H 2 AB292676 1 H 3 ES1101, ES1102, ES1106, ES1127, ES1128, ES1172, ES1173, ES1174, ES1175, ES1177, ES1178 11 H 4 ES1103, ES1105 2 H 5 ES1104 1 H 6 ES1129, ES1130 2 H 7 ES1146 1 H 8 ES1159 1 H 9 ES1160, ES1166 2 H10 ES1176 1 View Large Table 5. List of Cyt b haplotypes and haplotype frequencies (for sample information see Table 1 and Fig. 4B) Cyt b Haplotype code Sample code or accession number Haplotype frequency H 1 AB292675, AB292677, ES1161, ES1167 4 H 2 AB292676 1 H 3 ES1101, ES1102, ES1106, ES1127, ES1128, ES1172, ES1173, ES1174, ES1175, ES1177, ES1178 11 H 4 ES1103, ES1105 2 H 5 ES1104 1 H 6 ES1129, ES1130 2 H 7 ES1146 1 H 8 ES1159 1 H 9 ES1160, ES1166 2 H10 ES1176 1 Cyt b Haplotype code Sample code or accession number Haplotype frequency H 1 AB292675, AB292677, ES1161, ES1167 4 H 2 AB292676 1 H 3 ES1101, ES1102, ES1106, ES1127, ES1128, ES1172, ES1173, ES1174, ES1175, ES1177, ES1178 11 H 4 ES1103, ES1105 2 H 5 ES1104 1 H 6 ES1129, ES1130 2 H 7 ES1146 1 H 8 ES1159 1 H 9 ES1160, ES1166 2 H10 ES1176 1 View Large Figure 4. View largeDownload slide Unrooted haplotype networks constructed with statistical median-joining network analysis of D-loop haplotypes (A) and Cyt b haplotypes (B). Colours indicate groups identified by independent phylogenetic analyses: blue = G1, yellow = G2, green = G3, red = G4 and purple = G5. The number of mutational steps is indicated along the connection branches (Tables 4 and 5). Figure 4. View largeDownload slide Unrooted haplotype networks constructed with statistical median-joining network analysis of D-loop haplotypes (A) and Cyt b haplotypes (B). Colours indicate groups identified by independent phylogenetic analyses: blue = G1, yellow = G2, green = G3, red = G4 and purple = G5. The number of mutational steps is indicated along the connection branches (Tables 4 and 5). The haplotype network for Cyt b showed two lineages separated by two mutational steps. All samples from the Zagros Mountains and eastern Mediterranean Sea were placed in one lineage and all samples from Anatolia and the Greek Islands occurred in another lineage (Fig. 4B). Demographic history Tajima’s D test for neutrality (Tajima, 1989) was not significant for the D-loop and Cyt b (D-loop: D = −0.641, P > 0.10; Cyt b: D = −0.778, P > 0.10), showing no evidence for non-neutral evolution. Fu’s test for neutrality (Fu, 1997) was likewise not significant for the two mitochondrial markers (D-loop: FS = −7.79, P > 0.10; Cyt b: FS = −3.82, P = P > 0.10). Fu and Li’s D (D-loop = −0.073, P > 0.10; Cyt b = −1.17, P > 0.10) and Fu and Li’s F (D-loop = −0.28, P > 0.10; Cyt b = −1.26, P > 0.10) for the same markers were negative and not significant. Because all lineages showed the same pattern for the pairwise mismatch distribution analysis of the D-loop region, the same data set was used for all individuals. The mismatch distributions for all lineages (D-loop) showed a nearly bimodal curve (Fig. 5A). Figure 5. View largeDownload slide Expected and observed mismatch distributions for haplotypes of Sciurus anomalus based on D-loop (A) and Cyt b (B). Figure 5. View largeDownload slide Expected and observed mismatch distributions for haplotypes of Sciurus anomalus based on D-loop (A) and Cyt b (B). The lineage-specific mismatch distributions also showed a nearly bimodal curve for Cyt b (Fig. 5B). In addition to the mismatch distribution, BSP analysis indicated a significant population expansion, which began approximately 0.34 Mya (Fig. 6). Figure 6. View largeDownload slide Bayesian skyline plot of effective population size, Ne (logarithmic scale), for Sciurus anomalus. The heavy black line is the median estimate, and the blue lines correspond to the 95% highest posterior density estimate. Figure 6. View largeDownload slide Bayesian skyline plot of effective population size, Ne (logarithmic scale), for Sciurus anomalus. The heavy black line is the median estimate, and the blue lines correspond to the 95% highest posterior density estimate. DISCUSSION In the present study, we present the first range-wide assessment of genetic structure for the Persian squirrel, a keystone species in oak forests. Based on mitochondrial and nuclear DNA data, our analyses revealed that Sciurus anomalus populations are divided into two main lineages, comprising five groups that are separated by large geographical distances. The lineages of the Persian squirrel are currently distributed in forest regions that show significant diversity in terms of microclimate and habitat structure (Hewitt, 1999; Seddon et al., 2002; Jakob et al., 2007; Abi-Said et al., 2014; Karami et al., 2016). The Anatolian region hosts lineage L1 of the Persian squirrel, with groups G1 and G3 distributed in the western and southern parts of this region, respectively. Group G2 occupies Pontic forests in the southern coast of the Black Sea. Lineage L2 occupies a disjunct distribution that includes the eastern Mediterranean region and the Zagros Mountains. Within lineage L2, group G4 comprises samples from two distinct areas: the Levant countries in the eastern coast of the Mediterranean Sea (e.g. Syria, Lebanon, Jordan) and the northern part of the Zagros Mountain range (Turkey, Iraq and Iran). group G5 occurs in the southern Zagros in Iran, which has drier and warmer habitat conditions compared with the northern Zagros (Sagheb-Talebi et al., 2014; Fig. 1). Patterns of nucleotide variation indicated high substitution rates in the mitochondrial genomes. Haplotype diversity was estimated for the D-loop region (HD = 0.960) and Cyt b (HD = 0.803). Overall, the number of polymorphic sites, and haplotype and nucleotide diversity in the D-loop region were higher than in the other genes. The five distinct groups do not share any haplotypes for mitochondrial genes. The only exception is haplotype H3 for Cyt b, which was shared between groups G4 and G5. The F-statistic for population structure (FST) was estimated to be 0.57 for the D-loop region and 0.71 for Cyt b, indicating low gene flow (Table 3). Nuclear gene sequences were almost identical in all samples from different areas, and these genes were not able to distinguish among the different lineages. Steppan et al. (2004) previously used Cmyc and Rag1 genes for the phylogenetic study of squirrels. They suggested that these genes, in particular Rag1, have sufficient variability to discriminate among different squirrel species (Steppan et al., 2004). Our findings revealed, however, that these nuclear genes show very limited variability for intraspecific phylogeographical studies, at least for the Persian squirrel. Statistical dispersal–vicariance analysis and the estimated divergence time, consistent with information on recorded fossils (Hordijk & Bruijn, 2009), indicated that the ancestral lineage of the Persian squirrel first evolved in western Anatolia and the Greek Islands (locality of G1). The first fossil record of Sciurus anomalus occurs in the lacustrine deposits of the Florina–Ptolemais–Servia Basin (Greece) in the Pliocene (Hordijk & Bruijn, 2009). Further fossil records are reported from Greece in the early Pleistocene, and from the Near East in the middle and late Pleistocene (Tchernov, 1988; Marder et al., 2011; Tagliacozzo et al., 2016). It appears that the species dispersed from this ancestral region to colonize different areas within the current range. The pattern of intraspecific genetic variation of the Persian squirrel fits pattern II described by Bilgin (2011) for Anatolian species, corresponding to the occurrence of phylogeographical breaks between or among clades within Anatolia. Such genetic diversity patterns can be seen in other mammalian species such as the ground squirrel (Gunduz et al., 2005), the greater horseshoe bat (Rossiter et al., 2007; Bilgin et al., 2008) and the bent-winged bat (Bilgin et al., 2008; Furman et al., 2009). Our geographically broad genetic sampling strategy supports the occurrence of a main phylogeographical break for the Persian squirrel within Anatolia. This break separates the northern (Anatolian and Lesvos groups) and southern (The Mediterranean and Zagros groups) lineages, which are allopatric. Groups G1–G3 in western and northern Anatolia, respectively, appear parapatric. Although group G4 consists of two allopatric patches, its distribution range overlaps with that of group G5 in the middle Zagros in the Ilam Province of Iran. The observed spatial distribution of groups G4 and G5 in the northern and southern Zagros range is a common pattern that has also been documented for other small vertebrates such as the ocellated lizard (Ahmadzadeh et al., 2012). Two main types of climate exist in the distribution range of the Persian squirrel, Mediterranean and continental (Kottek, 2006). Groups G1–G3 and part of G4 are entirely found in humid coastal regions associated with a Mediterranean climate, whereas the remainder of group G4 (the eastern part) and group G5 are associated with the drier continental climate condition. Because the Persian squirrel is adapted to temperate forests and woodlands, expansion of forest ecosystems in certain geological periods must have been a crucial factor allowing the species to expand its range (Wilson & Reeder, 2005; Oshida et al., 2009). Steppe forests and open woodlands became widespread and covered the entire Mediterranean area during the late Miocene to early Pliocene and subsequently spread to the Irano-Anatolian region in the late Pliocene (Jiménez-Moreno et al., 2015). The Mediterranean forests mostly consisted of Olea and evergreen Quercus, but the tree assemblage in the Irano-Anatolian terrain was dominated by Pinus, and temperate deciduous Quercus, Liquidambar, Parrotia and Fraxinus (Hajar et al., 2008; Jiménez-Moreno et al., 2015). Palaeoecological evidence has revealed that during the late Pleistocene, the deciduous woodlands expanded and outnumbered other forest types in Levantine littoral areas and, later, in the Irano-Anatolian region at the beginning of the Holocene (Wright & Thorpe, 2003; Djamali et al., 2012; Asouti & Kabukcu, 2014). Starting 700 kya, during a period characterized by climate fluctuations starting in the late Pleistocene (Richmond & Fullerton, 1986,), most of the Sciurus species such as Sciurus vulgaris in Eurasia and Sciurus niger and Sciurus carolinensis in North America became widespread (Mercer & Roth, 2003; Steppan et al., 2004; Dozières et al., 2012; Moncrief et al., 2010; Liu et al., 2014). The estimated divergence time of the northern and southern lineage of the Persian squirrel was about 1 Mya, but the estimated divergence time among groups within these lineages was less than 700 kya. Given the low genetic divergence among these groups, and young estimated lineage split ages, it appears that the evolution and expansion of these populations were probably affected by Pleistocene climatic fluctuations. Climate conditions in the Irano-Anatolian region shifted from late glacial cold/arid conditions (dominated by steppe vegetation) to warm/humid conditions (dominated by forest) in interglacial periods (Altin et al., 2015; Arz et al., 2015). During cold and semi-arid glacial periods the Persian squirrel probably took refuge in pockets with suitable climate where woodlands persisted at low altitudes. As these areas of suitable habitat would have been allopatric, this eventually led to diversification of lineages during the same period. Following the development of more widespread suitable climate conditions after the Last Glacial Maximum and expansion of woodlands, the species probably dispersed from glacial refugia to its current distribution. Tree squirrels such as S. niger and S. carolinensis are also believed to have taken refuge in temperate forests during glacial periods and expanded during subsequent interglacials (Moncrief et al., 2010). Neutrality tests to check for an excess of rare mutations, as evidence of recent population expansion, were non-significant. Also, the mismatch distribution graph did not provide strong evidence for demographic expansion as it showed a nearly bimodal curve. However, the BSP of effective population size revealed that ‘Ne’ increased starting 0.34 Mya, during the interglacial periods, and therefore could have been affected by climate fluctuations and changing forest distributions. The post-glacial range expansions, and possible contact zones where the current lineages meet, need further investigation. Our findings may also challenge the current taxonomic status of the subspecies of the Persian squirrel. The distribution range of Sciurus anomalous anomalous in Anatolia coincides with the distribution of groups G1–3 within Lineage 1. Sciurus anomalus pallescens occurs in the Zagros mountain range where members of both groups G4 and G5 of Lineage 2 are found. However, the subspecies S. anomalus syriacus, which is distributed in the Levantine littoral areas, grouped with the northern Zagros samples in our analysis, with low genetic differentiation. Therefore, the Levantine samples are part of Lineage 2 and we suggest the subspecies S. anomalus pallescensGray, 1867 could be considered as a synonym of S. anomalus syriacusEhrenberg, 1829, which has priority (Ellerman, 1948; Harrison & Bates, 1991; Koprowski et al., 2016). In conclusion, diversification of the Persian squirrel across its current range can potentially be attributed to Pleistocene climatic fluctuations, with isolation and differentiation having occurred in refugial areas during glacial periods. The species contains two main lineages comprising five separate groups, which may now be largely independently evolving sets of populations. The conservation of these separate populations may be regarded as an important goal in preserving within-species diversity; however, contemporary sampling of populations in Turkey and Syria is needed to confirm this. As the Persian squirrel is a keystone species and the only tree squirrel from the family Sciuridae in the Middle East, conservation of this species, including its intraspecific diversity, should be a priority. ACKNOWLEDGEMENTS This study was performed as part of a PhD thesis in the Environmental Sciences Research Institute, Shahid Beheshti University, and was supported by the Biotechnology Development Council of the Islamic Republic of Iran (grant number: 960801). We thank the many individuals who have assisted this study by providing samples: Dr Petros Lymberakis, Natural History Museum Vienna, Austria; Natural History Museum of Crete, Greece; and Museum für Naturkunde Berlin, Germany. We also thank Dr Mohammad Javidkar and two anonymous reviewers for their helpful comments on an earlier version of the manuscript. REFERENCES Abel PFM . 1933 . Geographie de la Palestine, Vol. 1 . Paris : Librairie Lecoffre , 1933 – 1938 . Abi-Said MR. Khoury JEL , Makhlouf H , Amr ZS . 2014 . Ecology of the Persian squirrel, Sciurus anomalus, in Horsh Ehden Nature Reserve, Lebanon . Vertebrate Zoology 64 : 127 – 135 . Ahmadzadeh F , Carretero MA , Harris DJ , Perera A , Böhme W . 2012 . A molecular phylogeny of the eastern group of ocellated lizard genus Timon (Sauria: Lacertidae) based on mitochondrial and nuclear DNA sequences . Amphibia-Reptilia 33 : 1 – 10 . Google Scholar Crossref Search ADS Ahmadzadeh F , Flecks M , Carretero MA , Bohme W , Engler JO , Harris DJ , Ilgaz C , Uzum N , Rodder D . 2013 . Rapid lizard radiation lacking niche conservatism: phylogeny and ecological diversification within a complex landscape . Journal of Biogeography 40 : 1807 – 1818 . Google Scholar Crossref Search ADS Albayrak I , Arsalan A . 2006 . Contribution to the Taxonomical and Biological Characteristics of Sciuru sanomalus in Turkey (Mammalia: Rodentia) . Turkish Journal of Zoology 30 : 111 – 116 . Altin TB , Ouahabi ME , Fagel N . 2015 . Environmental and climatic changes during the Pleistocene–Holocene in the Bor Plain, Central Anatolia, Turkey . Palaeogeography, Palaeoclimatology, Palaeoecology 440 : 564 – 578 . Google Scholar Crossref Search ADS Amr ZS , Eid E , Qarqaz MA , Abu Baker M . 2006 . The status and distribution of the Persian squirrel, Sciurus anomalus (Mammalia: Rodentia: Sciuridae), in Dibbeen Nature Reserve, Jordan . Zoologische Abhandlungen (Dresden) 55 : 199 – 207 . Arslan A , Albayrak I , Oshida T . 2008 . Banded karyotypes of the Persian squirrel: Sciurus anomalus from Turkey . Caryologia 61 : 139 – 143 . Google Scholar Crossref Search ADS Arz HW , Shumilovskikh LS , Wegwerth A , Fleitmann D , Behling H . 2015 . Environmental and climate dynamics during the last two glacial terminations and interglacials in the Black Sea/Northern Anatolian Region. Integrated Analysis of Interglacial Climate Dynamics (INTERDYNAMIC). M. Schulz and A. Paul. Springer International Publishing , Springer Briefs in Earth System Sciences, 121 – 126 . doi: https://doi.org/10.1007/978-3-319-00693-2_20 . Asouti E , Kabukcu C . 2014 . Holocene semi-arid oak woodlands in the Irano-Anatolian region of Southwest Asia: natural or anthropogenic? Quaternary Science Reviews 90 : 158e182 . Google Scholar Crossref Search ADS Bandelt HJ , Forster P , Röhl A . 1999 . Median-joining networks for inferring intraspecific phylogenies . Molecular Biology and Evolution 16 : 37 – 48 . Google Scholar Crossref Search ADS PubMed Bernatchez L . 2001 . The evolutionary history of brown trout (Salmo trutta L.) inferred for phylogeographic, nested clade, and mismatch analyses of mitochondrial DNA variation . Evolution 55 : 351 – 379 . Google Scholar Crossref Search ADS PubMed Bilgin R . 2011 . Back to the suture: the distribution of intraspecific genetic diversity in and around Anatolia . International Journal of Molecular Sciences 12 : 4080 – 4103 . Google Scholar Crossref Search ADS PubMed Bilgin R , Karatas A , Çoraman E , Disotell T , Morales JC . 2008 . Regionally and climatically restricted patterns of distribution of genetic diversity in a migratory bat species, Miniopterus schreibersii (Chiroptera: Vespertilionidae) . BMC Evolutionary Biology 209 : 1471 – 2148 . Bousquet F , Le Page C . 2004 . Multi-agent simulations and ecosystem management: a review . Ecological Modeling 176 : 313 – 332 . Google Scholar Crossref Search ADS Çıplak B . 2004 . Biogeography of Anatolia: the marker group Orthoptera . Memorie della Societa Entomologica Italiana 82 : 357 – 372 . Davis PH . 1971 . Distribution patterns in Anatolia with particular reference to endemism . In: Davis PH , Harper PC , Hedge IC , eds. Plant life of South-West Asia . Edinburgh : The Botanical Society of Edinburgh , 15 – 27 . Djamali M , Brewer S , Breckle SW , Jackson ST . 2012 . Climatic determinism in phytogeographic regionalization: a test from the Irano-Turanian region, SW and Central Asia . Flora 207 : 237e249 . Google Scholar Crossref Search ADS Dozières A , Chapuis J , Thibault S , Baudry E . 2012 . Genetic structure of the French red squirrel populations: implication for conservation . PLoS ONE 7 : e47607 . Google Scholar Crossref Search ADS PubMed Drummond AJ , Rambaut A . 2007 . BEAST: Bayesian evolutionary analysis by sampling trees . BMC Evolutionary Biology 7 : 214 . Google Scholar Crossref Search ADS PubMed Drummond AJ , Rambaut A , Shapiro B , Pybus OG . 2005 . Bayesian coalescent inference of past population dynamics from molecular sequences . Molecular Biology and Evolution 22 : 1185 – 1192 . Google Scholar Crossref Search ADS PubMed Dubey S , Cosson J , Vohralik V , Krystufek B , Diker E , Vogel P . 2007 . Molecular evidence of Pleistocene bidirectional faunal exchange between Europe and the Near East: the case of the bicoloured shrew (Crocidura leucodon, Soricidae) . Journal of Evolutionary Biology 20 : 1799 – 1808 . Google Scholar Crossref Search ADS PubMed Edgar RC . 2004 . Muscle: multiple sequence alignment with high accuracy and high throughput . Nucleic Acids Research 32 : 1792 – 1797 . Google Scholar Crossref Search ADS PubMed Ehrenberg CG . 1829 . Symbolae physicae. Berlin : Berolini G. Reimeri . Ellerman JR . 1948 . Key to the rodents of south-west Asia in the British museum collection . Proceedings of the Zoological Society of London 118 : 765 – 816 . Google Scholar Crossref Search ADS Etemad E . 1978 . The mammals of Iran, volume I, rodents and the key to their classification . Tehran : National Society the Protection of Natural Resources and Human Environment, Association Press . Excoffier L , Laval G , Schneider S . 2005 . Arlequin ver. 3.0. An integrated software package for population genetics data analysis . Evolutionary Bioinformatics Online 1 : 47 – 50 . Fu YX , Li WH . 1993 . Statistical tests of neutrality of mutations . Genetics 133 : 693 – 707 . Google Scholar PubMed Fu YX . 1997 . Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection . Genetics 147 : 915 – 925 . Google Scholar PubMed Furman A , Çoraman E , Bilgin R , Karataş A . 2009 . Molecular ecology and phylogeography of the bent-wing bat complex (Miniopterus schreibersii) (Chiroptera: Vespertilionidae) in Asia Minor and adjacent regions . Zoologica Scripta 38 : 129 – 141 . Google Scholar Crossref Search ADS Gavish L , Gurnell J . 1999 . Sciurus anomalus Güldenstaedt . In: Mitchell-Jones AJ , et al. ., eds. The atlas of the European mammals , Vol. 1785 . London : Academic Press , 176 – 177 . Genovesi P . 2005 . Eradication of invasive alien species in Europe: a review . Biological Invasion 7 : 127 – 133 . Google Scholar Crossref Search ADS Gray JE . 1867 . Synopsis of the Asiatic squirrels (Sciuridae) in the collection of the British Museum, describing one new genus and some new species . Annals and Magazine of Natural History 20 : 270 – 286 . Google Scholar Crossref Search ADS Güldenstädt JA . 1785 . Sciurus anomalus . In: Schreber JCD , ed. Die säugthiere in abbildungen nach der natur mit beschreibungen, IV . Erlangen , 781 . Gündüz I , Rambau RV , Tez C , Searle JB . 2005 . Mitochondrial DNA variation in the western house mouse (Mus musculus domesticus) close to its site of origin: Studies in Turkey . Biological Journal of the Linnean Society 84 : 473 – 485 . Google Scholar Crossref Search ADS Gür H . 2013 . The effects of the Late Quaternary glacial–interglacial cycles on Anatolian ground squirrels: range expansion during the glacial periods? Biological Journal of the Linnean Society 109 : 19 – 32 . Google Scholar Crossref Search ADS Gür H , Perktaş U , Gür MK . 2018 . Do climate-driven altitudinal range shifts explain the intraspecific diversification of a narrow ranging montane mammal, Taurus ground squirrels? Mammal Research 63 : 197 – 211 . Google Scholar Crossref Search ADS Hajar L , Khater C , Cheddadi R . 2008 . Vegetation changes during the late Pleistocene and Holocene in Lebanon a pollen record from the Bekaa Valley . Holocene 18. 7 : 1089 – 1099 . Google Scholar Crossref Search ADS Harrison DL , Bates PJJ . 1991 . The mammals of Arabia, 2nd edn . London : Ernest Benn Limited . Harrison PA , Berry PM , Butt N , New M . 2006 . Modelling climate change impacts on species’ distributions at the European scale: implications for conservation policy . Environmental Science and Policy 9 : 116 – 128 . Google Scholar Crossref Search ADS Hatt RT . 1959 . The mammals of Iraq, Vol. 106 . Miscellaneous Publications Museum of Zoology University of Michigan , 1 – 113 . Heled J , Drummond AJ . 2008 . Bayesian inference of population size history from multiple loci . BMC Evolutionary Biology 8 : 289 . Google Scholar Crossref Search ADS PubMed Hewitt G . 1999 . Post-glacial re-colonization of the European biota . Biological Journal of the Linnean Society 68 : 87 – 112 . Google Scholar Crossref Search ADS Hewitt G . 2004 . Genetic consequences of climatic oscillations in the Quaternary . Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 359 : 183 – 195 . Google Scholar Crossref Search ADS PubMed Hordijk K , Bruijn HDE . 2009 . The succession of rodent faunas from the Mio/Pliocene lacustrine deposits of the Florina-Ptolemais-Servia Basin (Greece) . Hellenic Journal Geosciences 44 : 21 – 103 . Horn S , Durka W , Wolf R , Ermala A , Stubbe A , Stubbe M , Hofreiter M . 2011 . Mitochondrial genomes reveal slow rates of molecular evolution and the timing of speciation in beavers (Castor), one of the largest rodent species . PLOS ONE 6 : e14622 . Google Scholar Crossref Search ADS PubMed Huelsenbeck JP , Ronquist F . 2001 . MR-BAYES: Bayesian inference of phylogeny . Bioinformatics 17 : 754 – 755 . Google Scholar Crossref Search ADS PubMed Jakob SS , Ihlow A , Blattner FR . 2007 . Combined ecological niche modelling and molecular phylogeography revealed the evolutionary history of Hordeum marinum (Poaceae) – niche differentiation, loss of genetic diversity and speciation in Mediterranean Quaternary refugia . Molecular Ecology 16 : 1713 – 1727 . Google Scholar Crossref Search ADS PubMed Jiménez-Moreno G , Alçiçek H , Alçiçek MC , Ostende LH , Wesselingh FP . 2015 . Vegetation and climate changes during the late Pliocene and early Pleistocene in SW Anatolia, Turkey . Quaternary Research 84 : 448 – 456 . Google Scholar Crossref Search ADS Karami M , Ghadirian T , Faizolahi K . 2016 . The atlas of mammals of Iran . Tehran : University of Tehran Press . Kasapidis P , Suchentrunk F , Magoulas A , Kotoulas G . 2005 . The shaping of mitochondrial DNA phylogeographic patterns of the brown hare (Lepus europaeus) under the combined influence of late Pleistocene climatic fluctuations and anthropogenic translocations . Molecular Phylogenetics and Evolution 34 : 55 – 66 . Google Scholar Crossref Search ADS PubMed Khalili F , Malekian M , Hemami MR . 2016 . Characteristics of den, den tree and sites selected by the Persian squirrel in Zagros forests, western Iran . Mammalia 80 : 567 – 570 . Google Scholar Crossref Search ADS Kolar CS , Lodge DM . 2002 . Ecological predictions and risk assessment for alien fishes in North America . Science 298 : 1233 – 1236 . Google Scholar Crossref Search ADS PubMed Koprowski JL , Gavish L , Doumas SL . 2016 . Sciurus anomalus (Rodentia: Sciuridae) . Mammalian Species 48 : 48 – 58 . Google Scholar Crossref Search ADS Kornilios P , Ilgaz C , Kumlutas Y , Giokas S , Fraguedakis-Tsolis S , Chondropoulos B . 2011 . The role of Anatolian refugia in herpetofaunal diversity: an mtDNA analysis of Typhlops vermicularis Merrem, 1820 (Squamata, Typhlopidae) . Amphibia-Reptilia 32 : 351 – 363 . Google Scholar Crossref Search ADS Kosswigg C . 1955 . Zoogeography of the Near East . Systematic Zoology 4 : 49 – 73 . Google Scholar Crossref Search ADS Kottek M , Grieser J , Beck C , Rudolf B , Rube F . 2006 . World map of the Köppen-Geiger climate classification updated . Meteorologische Zeitschrift 15 : 259 – 263 . Google Scholar Crossref Search ADS Lewis RE , Lewis JH , Atallah SI . 1967 . A review of Lebanese mammals. Lagomorpha and Rodentia . Journal of Zoology 153 : 45 – 70 . Google Scholar Crossref Search ADS Liu Z , Li B , Ma J , Zheng D , Xu Y . 2014 . Phylogeography and genetic diversity of the red squirrel (Sciurus vulgaris) in China: implications for the species’ postglacial expansion history . Mammalian Biology 79 : 247 – 253 . Google Scholar Crossref Search ADS Madsen CL , Vilstrup JT , Fernández R , Marchi N , Håkansson B , Krog M , Asferg T , Baagøe H , Orlando L . 2015 . Mitochondrial genetic diversity of Eurasian Red Squirrels (Sciurus vulgaris) from Denmark . Heredity 106 : 719 – 727 . Google Scholar Crossref Search ADS Marder O , Yeshurun R , Lupu R , Bar-Oz G , Belmaker M , Porat N , Hagai Ron H , Frumki A . 2011 . Mammal remains at Rantis Cave, Israel, and Middle–Late Pleistocene human subsistence and ecology in the Southern Levant . Journal Quaternary Science 26 : 769 – 780 . Google Scholar Crossref Search ADS Masseti M . 2005 . Natural and anthropochorous squirrels and dormice of the Mediterranean region . Hystrix 16 : 3 – 26 . Masseti M . 2010 . Homeless mammals of the Iolian and Aegean islands . Bonn Zoological Bulletin 57 : 367 – 373 . Mercer JM , Roth VL . 2003 . The effects of Cenozoic global change on squirrel phylogeny . Science 299 : 1568 – 1572 . Google Scholar Crossref Search ADS PubMed Misonne X . 1957 . Mammifères de la Turquie sud-orientale ET du nord de la Syrie . Mammalia 21 : 53 – 68 . Google Scholar Crossref Search ADS Mittermeier RA , Gil PR , Hoffman M , Pilgrim J , Brooks T , Mittermeier JC , Lamoreux J , da Fonseca GAB . 2005 . Hotspots revisited: Earth’s biologically richest and most endangered terrestrial ecoregions . Amsterdam : Amsterdam University Press , 392 . Miyamoto MM , Porter CA , Goodman M . 2000 . C-myc gene sequences and the phylogeny of bats and other eutherian mammals . Systematic Biology 49 : 501 – 514 . Google Scholar Crossref Search ADS PubMed Moncrief ND , Lack JB , Van Den Bussche RA . 2010 . Eastern fox squirrel (Sciurus niger) lacks phylogeographic structure: recent range expansion and phenotypic differentiation . Journal of Mammalogy 91 : 1112 – 1123 . Google Scholar Crossref Search ADS Nylander JAA . 2004 . Bayesian phylogenetics and the evolution of Gall wasps. Comprehensive Summaries of Uppsala Dissertations for the Faculty of Science and Technology 937, Uppsala University . Osborn DJ . 1964 . The hare, porcupine, beaver, squirrels, jerboas, and dormice of Turkey . Mammalia 28 : 573 – 592 . Google Scholar Crossref Search ADS Oshida T , Arslan A , Noda M . 2009 . Phylogenetic relationships among the Old World Sciurus squirrels . Folia Zoologica 58 : 14 – 25 . Özkurt S , Sözen M , Yiğit N , Çolak E , Verimli R . 1999 . On the karyology and morphology of Sciurus anomalus (Mammalia: Rodentia) in Turkey . Zoology in the Middle East 18 : 9 – 15 . Google Scholar Crossref Search ADS Pavlinov IY , Ross Olimo OL . 1987 . The systematics of the mammals of the USSR . Moscow : University of Moscow Press . Pesole G , Gissi C , De Chirico A , Saccone C . 1999 . Nucleotide substitution rate of mammalian mitochondrial genomes . Journal of Molecular Evolution 48 : 427 – 434 . Google Scholar Crossref Search ADS PubMed Rambaut A , Drummond A . 2009 . Tracer v1.5: an MCMC trace analysis tool . [Cited August 9 2015]. Available at: http://beast.bio.ed.ac.uk/. Riam P , Aloise G , Cagnin M , Wauters L . 2007 . The use of species-specific cone remains of sympatric arboreal rodents to monitor their distribution . Italian Journal of Zoology 74 : 289 – 296 . Google Scholar Crossref Search ADS Richmond GM , Fullerton DS . 1986 . Summation of Quaternary glaciations in the United States of America . Quaternary Science Reviews 5 : 183 – 196 . Google Scholar Crossref Search ADS Rokas A , Atkinson RJ , Webster L , Csoka G , Stone GN . 2003 . Out of Anatolia: longitudinal gradients in genetic diversity support an eastern origin for a circum-Mediterranean oak gallwasp Andricus quercustozae . Molecular Ecology 12 : 2153 – 2174 . Google Scholar Crossref Search ADS PubMed Rossiter SJ , Benda P , Dietz C , Zhang S , Jones G . 2007 . Rangewide phylogeography in the greater horseshoe bat inferred from microsatellites: implications for population history, taxonomy and conservation . Molecular Ecology 16 : 4699 – 4714 . Google Scholar Crossref Search ADS PubMed Rozas J , Sanchez-DelBarrio JC , Messeguer X , Rozas R . 2003 . DnaSP, DNA polymorphism analyses by the coalescent and other methods . Bioinformatics 19 : 2496 – 2497 . Google Scholar Crossref Search ADS PubMed Sagheb-Talebi K , Sajedi T , Pourhashemi M . 2014 . Forests of Iran: a treasure from the past, a hope for the future . Heidelberg : Springer . Sambrook J , Fritsch EF , Maniatis T . 1989 . Molecular cloning: a laboratory manual . Cold Spring Harbour : Cold Spring Harbour Press . Seddon JM , Santucci F , Reeve N , Hewitt GM . 2002 . Caucasus Mountains divide postulated postglacial colonization routes in the white-breasted hedgehog, Erinaceus concolor . Journal of Evolutionary Biology 15 : 463 – 467 . Google Scholar Crossref Search ADS Smith MF , Patton JL . 1991 . Variation in the mitochondrial cytochrome b sequences in natural populations of South American akodontine rodents (Muridae: Sigmodontinae) . Molecular Biology and Evolution 8 : 85 – 103 . Google Scholar PubMed Stamatakis A . 2006 . RAxML-VI-HPC: maximum likelihood based phylogenetic analyses with thousands of taxa and mixed models . Bioinformatics 22 : 2688 – 2690 . Google Scholar Crossref Search ADS PubMed Steppan SJ , Storz BL , Hoffmann RS . 2004 . Nuclear DNA phylogeny of the squirrels (Mammalia: Rodentia) and the evolution of arboreality from Cmyc and RAG1 . Molecular Phylogenetics and Evolution 30 : 703 – 719 . Google Scholar Crossref Search ADS PubMed Taberlet P , Fumagalli L , Wust-Saucy AG , Cosson JF . 1998 . Comparative phylogeography and postglacial colonization routes in Europe . Molecular Ecology 7 : 453 – 464 . Google Scholar Crossref Search ADS PubMed Taberlet P , Waits LP , Luikart G . 1999 . Noninvasive genetic sampling: look before you leap . Trends in Ecology and Evolution 14 : 323 – 327 . Google Scholar Crossref Search ADS PubMed Tagliacozzo A , Fiore I , Rolfo MF , Silvestri L , Salari L . 2016 . New data on Late Pleistocene and Holocene red squirrel Sciurus vulgaris L., 1758, in Italy . Revue de Paléobiologie, Genève 35 : 417 – 44 . 5. Tajima F . 1989 . Statistical method for testing the neutral mutation hypothesis by DNA polymorphism . Genetics 123 : 585 – 595 . Google Scholar PubMed Tamura K , Dudley J , Nei M , Kumar S . 2007 . MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0 . Molecular Biology and Evolution 24 : 1596 – 1599 . Google Scholar Crossref Search ADS PubMed Tattoni C , Preatoni DG , Martinoli A , Bertolino S , Wauters LA . 2005 . Application of modelling tecniques to manage a population of grey squirrels (Sciurus carolinensis) in Lombardy, Northern Italy, and analysis of parameters estimates used in simulations . Hystrix 16 : 99 – 112 . Tchernov E . 1988 . The paleobiogeographical history of the southern Levant . In: Yom-Tov Y , Tchernov E , eds. The zoogeography of Israel . Dordrecht : W. Junk , 159 – 250 . Thorington RW Jr , Koprowski JL , Steele MA , Whatton JF . 2012 . Squirrels of the world . Baltimore : John Hopkins University Press . Tristram HB . 1866 . Report on the mammals of Palestine . Proceedings of the Zoological Society of London 1866 : 84 – 93 . Veith M , Schmidtler JF , Kosuch J , Baran I , Seitz A . 2003 . Palaeoclimatic changes explain Anatolian mountain frog evolution: a test for alternating vicariance and dispersal events . Molecular Ecology 12 : 185 – 199 . Google Scholar Crossref Search ADS PubMed Wheatley M , Fisher JT , Larsen K , Litke J , Boutin S . 2005 . Using GIS to relate small mammal abundance and landscape structure at multiple spatial extents: the northern flying squirrel in Alberta, Canada . Journal of Applied Ecology 42 : 577 – 586 . Google Scholar Crossref Search ADS Wiens JJ . 1998 . Combining data sets with different phylogenetic histories . Systematic Biology 47 : 568 – 581 . Google Scholar Crossref Search ADS PubMed Wilson DE , Reeder DM . 2005 . Mammal species of the World. A taxonomic and geographic reference, 3rd edn . Baltimore: John Hopkins University Press . Wright Jr HE , Thorpe J . 2003 . Climatic change and the origin of agriculture in the Near East . In: Mackay AW , Battarbee RW , Birks HJ , Oldfield F , eds. Global change in the Holocene . London : Hodder Arnold , 49e62 . Yiğit N , Çolak E , Sözen M , Karataş A . 2006 . Rodents of Türkiye “Türkiye kemiricileri” (A. Demirsoy, ed.). Ankara : Meteksan . Yiğit N , Colak E , Sozen M , Ozkan B , Ozkurt Ş . 2008 . On the Turkish populations of Dryomysnitedula (Pallas, 1779) and Dryomyslaniger Felten and Storch, 1968 (Mammalia: Rodentia) . Acta Zoologica 49 : 147 – 158 . Yu Y , Harris AJ , Xingjin H . 2010 . S-DIVA (Statistical Dispersal-Vicariance Analysis): a tool for inferring biogeographic histories . Molecular Phylogenetics and Evolution 56 : 848 – 850 . Google Scholar Crossref Search ADS PubMed Yu Y , Harris AJ , Xingjin H . 2011 . RASP (Reconstruct Ancestral State in Phylogenies) 1.1 . Available at: http://mnh.scu.edu.cn/ soft. Blog.RASP. © 2019 The Linnean Society of London, Biological Journal of the Linnean Society This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - The permanent inhabitant of the oak trees: phylogeography and genetic structure of the Persian squirrel (Sciurus anomalus)
JF - Biological Journal of the Linnean Society
DO - 10.1093/biolinnean/blz032
DA - 2019-05-22
UR - https://www.deepdyve.com/lp/oxford-university-press/the-permanent-inhabitant-of-the-oak-trees-phylogeography-and-genetic-8VOEI9m2YP
SP - 1
VL - Advance Article
IS - 
DP - DeepDyve
ER -