Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines

Zsófia Kovács; Janka Bedő; Bánk Pápai; Andrea Kitti Tóth-Lencsés; Gábor Csilléry; Antal Szőke; Éva Bányai-Stefanovits; Erzsébet Kiss; Anikó Veres

doi:10.3390/antiox11040637

Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines

Kovács, Zsófia;Bedő, Janka;Pápai, Bánk;Tóth-Lencsés, Andrea Kitti;Csilléry, Gábor;Szőke, Antal;Bányai-Stefanovits, Éva;Kiss, Erzsébet;Veres, Anikó 2022-03-26 00:00:00 antioxidants Article Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines 1 , 1 1 1 2 1 Zsóﬁa Kovács * , Janka Bedo ˝ , Bánk Pápai , Andrea Kitti Tóth-Lencsés , Gábor Csilléry , Antal Szoke ˝ , 3 1 1 Éva Bányai-Stefanovits , Erzsébet Kiss and Anikó Veres Institute of Genetics and Biotechnology, Hungarian University of Agriculture and Life Sciences, 2100 Gödöllo, ˝ Hungary; [email protected] (J.B.); [email protected] (B.P.); [email protected] (A.K.T.-L.); [email protected] (A.S.); [email protected] (E.K.); [email protected] (A.V.) PepGen Kft., 1114 Budapest, Hungary; [email protected] Institute of Food Science and Technology, Hungarian University of Agricultural Sciences, 1118 Budapest, Hungary; [email protected] * Correspondence: kovacs.zsoﬁ[email protected] Abstract: To date, several research studies addressed the topic of phytochemical analysis of the different coloured pepper berries during ripening, but none discussed it in the case of purple peppers. In this study we examine whether the anthocyanin accumulation of the berries in the early stages of ripening could result in a higher antioxidant capacity due to the elevated amount of polyphenolic compounds. Therefore, enzymatic and non-enzymatic antioxidant capacity was measured in four distinct phenophases of fruit maturity. Furthermore, the expression of structural and regulatory Citation: Kovács, Z.; Bedo, ˝ J.; Pápai, genes of the anthocyanin biosynthetic pathway was also investigated. An overall decreasing trend B.; Tóth-Lencsés, A.K.; Csilléry, G.; was observed in the polyphenolic and ﬂavonoid content and antioxidant capacity of the samples Szoke, ˝ A.; Bányai-Stefanovits, É.; towards biological ripeness. Signiﬁcant changes both in between the genotypes and in between the Kiss, E.; Veres, A. Ripening-Induced Changes in the Nutraceutical phenophases were scored, with the genotype being the most affecting factor on the phytonutrients. Compounds of Differently Coloured An extreme purple pepper yielded outstanding results compared to the other genotypes, with its Pepper (Capsicum annuum L.) polyphenolic and ﬂavonoid content as well as its antioxidant capacity being the highest in every Breeding Lines. Antioxidants 2022, 11, phenophase studied. Based on our results, besides MYBa (Ca10g11650) two other putative MYBs 637. https://doi.org/10.3390/ participate in the regulation of the anthocyanin biosynthetic pathway. antiox11040637 Academic Editors: Andrei Mocan Keywords: Capsicum; pepper; anthocyanin; antioxidant; secondary metabolites; gene expression; and Simone Carradori R2R3-MYB Received: 24 February 2022 Accepted: 24 March 2022 Published: 26 March 2022 1. Introduction Publisher’s Note: MDPI stays neutral Pepper (Capsicum annuum L.) is one of the most consumed vegetable and spice crops. with regard to jurisdictional claims in Despite its numerous characteristics that determine the consumer acceptance of the fruit, it published maps and institutional afﬁl- is still highly sought after worldwide. While shape and pungency are also determining iations. factors, colour in particular ranks very high in the perceived palatability and perceived ﬂavour intensity of fruits/vegetables [1–3]. Colours of the immature pepper fruits vary from ivory to green, and newer varieties may even exhibit different shades of purple, whereas the colouration of mature fruits of cultivated peppers ranges from white through Copyright: © 2022 by the authors. yellow, orange and red to even a brownish hue. The main determinants of colour in pepper Licensee MDPI, Basel, Switzerland. fruit are the chlorophyll, carotenoid and anthocyanin pigments [4–7]. These pigments are This article is an open access article stored in different cell compartments; chlorophylls are located within the chloroplasts, distributed under the terms and carotenoids are stored in the chromoplasts, while anthocyanins and other ﬂavonoids are conditions of the Creative Commons accumulated in vacuoles in the cells’ cytoplasm. Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ Fruit colour is of upmost importance since pigments affecting the colouration further 4.0/). contribute to a wide variety of functions such as protection against various abiotic stresses, Antioxidants 2022, 11, 637. https://doi.org/10.3390/antiox11040637 https://www.mdpi.com/journal/antioxidants Antioxidants 2022, 11, 637 2 of 14 e.g., UV light, excess light, cold temperature, and pathogens. More importantly, they contribute to the ﬂavour and nutraceutical properties since most of these compounds exhibit antioxidant activity. Thus, these phytochemicals possess potential health beneﬁts for a human diet. For instance, carotenoids are involved in the scavenging of both peroxyl radicals and singlet oxygen species (O ) [8]. A carotenoid-rich diet could lower risk of several types of cancer and cardiovascular disease. Capsanthin—a red pigment which is synthesized exclusively in Capsicum spp.—proved to suppress hydroperoxide formation, and since they decompose slower than other carotenoids found in peppers, their radical scavenging activity lasts longer [9]. From nutraceutical aspects, various pepper fruits’ carotenoid accumulation is among the highest in plants [10]. A teaspoon of its powder provides the Recommended Dietary Allowance for vitamin A of an adult person after the conversion of the precursor carotenoids to vitamin A [11]. Flavonoids are a large class of compounds that are important antioxidants. Numerous studies indicate that a ﬂavonoid-rich diet reduces the risk of coronary heart disease, stroke and lung/breast cancer [12]. Their antioxidant properties are determined by both the chemical structure and by the redox properties; based on these, they can serve as O quenchers, hydrogen donors or reducing agents. Further, they are efﬁcient against lipid oxidation [13–15]. Health-conscious diets are on the rise, and currently there is an ever-growing interest towards ﬂavonoid/anthocyanin-rich functional foods, hence purple fruits and vegetables are commercially valued. The biosynthesis of ﬂavonoids, and subsequently anthocyanins, is regulated by the MYB transcription factors. The production of anthocyanins branches off from the ﬂavonoid pathway and they are synthesized via the early biosynthetic genes (EBGs), e.g., chalcone synthase (CHS), chalcone isomerase (CHI), ﬂavanone-3-hydroxylase (F3H), and the late biosynthetic genes (LBGs) such as dihydroﬂavonol reductase (DFR), an- 0 0 0 0 thocyanidin synthase (ANS), ﬂavonoid 3 5 -hydroxylase (F3 5 H), glutathion S-transferase (GST), and anthocyanidin 3-O-glucosyltransferase (UFGT) [16]. The regulation of the path- way is well studied, although there are still conﬂicting results which have yet to be clariﬁed. In general, it is agreed that a regulatory complex (MBW), taking up from MYB, bHLH and WD40 transcription factors, initiates the transcription of the LBGs. In the case of pepper, three MYB coding genes are located next to each other on the 10th chromosome. Out of these, so far only the so-called MYBa is said to participate in the biosynthesis [17,18]. Many studies examined the phytochemical composition of different pepper cultivars, but there are only a few which monitor the changes of these compounds upon matura- tion [19]. In this study, we take differently coloured breeding lines to determine how the colouration affects the nutraceutical properties of the peppers, as well as how the phytochemical composition changes during maturation. Furthermore, we investigate the regulatory mechanism of the anthocyanin biosynthesis with emphasis being put on the MYB transcription factors and their putative role. By this, we can rule out whether the anthocyanin build-up, hence the higher amount of polyphenols in the berries, could add to the overall antioxidant capacity of the pepper. This work could not only assist breeders to select for candidate accessions with great nutritional properties as partners in breeding programs but may also shed light on the basis of the transcriptional regulation of the anthocyanin biosynthesis. 2. Materials and Methods Mutant pepper breeding lines used for this study were provided by the PepGen Kft. (Budapest, Hungary). In addition, 5 anthocyanin mutant C. annuum peppers, a C. annuum ‘Soroksári’ cultivar—which does not synthetize anthocyanins—and an extreme purple C. chinense ‘Pimienta de Neyde’ (‘Pim. Ney.’) cultivar were applied (Table 1). Antioxidants 2022, 11, 637 3 of 16 Antioxidants 2022, 11, 637 3 of 16 Antioxidants 2022, 11, 637 3 of 16 Antioxidants 2022, 11, 637 3 of 16 Table 1. Codes, attributes and appearance of the breeding lines. Antioxidants 2022, 11, 637 3 of 16 Table 1. Codes, attributes and appearance of the breeding lines. Table 1. Codes, attributes and appearance of the breeding lines. Name/Code Description Appearance Table 1. Codes, attributes and appearance of the breeding lines. Antioxidants 2022, 11, 637 3 of 14 Name/Code Description Appearance Name/Cod Table 1. e Codes, attributes and appearance of Descr the breeding l iption ines. Appearance C. chinense, extreme purple throughout Name/Code Description Appearance ‘Pim. Ney.’ C. chinense, each phenop extreme purple hase throughout Table 1. Codes, attributes and appearance of the breeding lines. Name/Code Description ‘Pim. Ney.’ Appearance C. chinense, extreme purple throughout each phenophase ‘Pim. Ney.’ Name/Code C. chinense, Description extreme purple throughout Appearance each phenophase ‘Pim. Ney.’ each phenophase C. chinense, extreme purple throughout 11263 C. chinense matures f , extreme rom l purple ilac to red, throughout pax, Leb ‘Pim. Ney.’ ‘Pim. Ney.’ each phenophase each phenophase 11263 matures from lilac to red, pax, Leb 11263 matures from lilac to red, pax, Leb 11263 matures from lilac to red, pax, Leb 11263 matures from lilac to red, pax, Leb 11263 matures from lilac to red, pax, Leb 11270 matures from purple to yellow, pax+, Leb 11270 matures from purple to yellow, pax+, Leb 11270 matures from purple to yellow, pax+, Leb 11270 matures from purple to yellow, pax+, Leb 11270 matures from purple to yellow, pax+, Leb 11270 matures from purple to yellow, pax+, Leb 11274 matures from purple to red, pax+, Leb-s 11274 matures from purple to red, pax+, Leb-s 11274 matures from purple to red, pax+, Leb-s 11274 matures from purple to red, pax+, Leb-s 11274 matures from purple to red, pax+, Leb-s 11278 matures from white to red, pax 1 1127 1288 0 mama tures f tures f rom rom whi whi te to red, te to red, pax pax +, Leb + 11274 matures from purple to red, pax+, Leb-s 11278 matures from white to red, pax 11278 matures from white to red, pax 11280 matures from white to red, pax+, Leb+ 11280 matures from white to red, pax+, Leb+ 11278 matures from white to red, pax 11280 matures from white to red, pax+, Leb+ ‘Soroksári’ matures from white to red, asx ‘Soroksári’ matures from white to red, asx 11280 matures from white to red, pax+, Leb+ ‘Soroksári’ matures from white to red, asx 11278 matures from white to red, pax Note: pax, pax+—partially anthocyanin-less, Leb, Leb+, Leb-s—lilac economically ripe berry, -s: striped, asx— ‘Soroksári’ Note: pax, pax+—partially anthocyanin-less, matures from Leb, whi Leb+, te to red, Leb-s—lilac e asx conomically ripe berry, -s: 11280 matures from white to red, pax+, Leb+ anthocyanin-less ‘Soroksári’ type. ‘Soroksári’ striped, asx—anthocyanin-less ‘Soroksári’ matures f type. rom white to red, asx Note: pax, pax+—partially anthocyanin-less, Leb, Leb+, Leb-s—lilac economically ripe berry, -s: Note: pax, pax+—partially anthocyanin-less, Leb, Leb+, Leb-s—lilac economically ripe berry, -s: striped, asx—anthocyanin-less ‘Soroksári’ type. The plants were grown under greenhouse conditions. Ten fruits were gathered at 4 dis- ‘Soroksári’ matures from white to red, asx striped, Note: pa The plants w asx x, pa —ax+ nthocy —partially anthocyanin-less, ere grown anin-less ‘Sun oroksári’ der greenhouse cond type. Leb, Leb+, Leitb- ions s—lilac e . Ten cfru onom its w ically ere g ripe ath berry ered , at-s 4 : tinct phenophases of the ripening from each genotype. In addition to the two economically striped, asx—anthocyanin-less ‘Soroksári’ type. distinct phenophases of the ripening from each genotype. In addition to the two econom- The plants were grown under greenhouse conditions. Ten fruits were gathered at 4 ripe stages, green stage 1 (GS1)—20 days post anthesis (dpa), green stage 2 (GS2)—30 dpa, Note: pax, pax+—partially anthocyanin-less, Leb, Leb+, Leb-s—lilac economically ripe berry, -s: The plants were grown under greenhouse conditions. Ten fruits were gathered at 4 ically ripe stages, green stage 1 (GS1)—20 days post anthesis (dpa), green stage 2 (GS2)— distinct phenophases of the ripening from each genotype. In addition to the two econom- striped, asx—anthocyanin-less ‘Soroksári’ type. the breaker—40 dpa, when the berries are turning into their biologically ripe colour, and The plants were grown under greenhouse conditions. Ten fruits were gathered at 4 distinct phenophases of the ripening from each genotype. In addition to the two econom- i30 dpa, the br cally ripe stages, eaker green —40 stage 1 ( dpa, when GS1) the berrie —20 days post anthesi s are turning int s (o d t pa) hei , green r biolosta gicg al e 2 ( ly ripe col GS2)—- the full biological ripeness stage—60 dpa, were examined. Fruits were cut, seeds, placenta, distinct phenophases of the ripening from each genotype. In addition to the two econom- ically ripe stages, green stage 1 (GS1)—20 days post anthesis (dpa), green stage 2 (GS2)— 30 dpa, the br our, and the full b eaker iolo —40 gicdpa, when al ripeness stag the berrie e—60 dpa, w s are tur en re exam ing into ined thei . Fruits were c r biologically u ripe col t, seeds, - The plants were grown under greenhouse conditions. Ten fruits were gathered at 4 calyx and pedicel were removed, and the remaining pericarp was ﬂash-frozen in liquid N . ically ripe stages, green stage 1 (GS1)—20 days post anthesis (dpa), green stage 2 (GS2)— 30 dpa, the breaker—40 dpa, when the berries are turning into their biologically ripe col- our, placent and the full b a, calyx and iolo ped gicial cel were ripeness stag remove e—60 dpa, w d, and the re ere exam maining pe ined. Fruits were c ricarp was flash-fro ut, seed zen s, distinct phenophases of the ripening from each genotype. In addition to the two econom- Samples were stored at 70 C until further use. 30 dpa, the breaker—40 dpa, when the berries are turning into their biologically ripe col- our, and the full biological ripeness stage—60 dpa, were examined. Fruits were cut, seeds, in liquid N2. Samples were stored at −70 °C until further use. placenta, calyx and pedicel were removed, and the remaining pericarp was flash-frozen ically ripe stages, green stage 1 (GS1)—20 days post anthesis (dpa), green stage 2 (GS2)— placent our, and the full b a, calyx and iolo ped gicial cel were ripeness stag remove e—60 dpa, w d, and the re ere exam maining pe inedricarp w . Fruits were c as flash-fro ut, seed zen s, 2.1. Sample Preparation in liquid N2. Samples were stored at −70 °C until further use. 30 dpa, the breaker—40 dpa, when the berries are turning into their biologically ripe col- iplacent n liquid a, c Na 2. ly Samples we x and pedire cel were stored remove at −70 °C d, until furth and the reemain r use. ing pericarp was flash-frozen 2.1. Sample Preparation our, and the full biological ripeness stage—60 dpa, were examined. Fruits were cut, seeds, For more precise comparison of the breeding lines, during sample preparation we in liquid N2. Samples were stored at −70 °C until further use. 2.1. Sample Preparation placent opted For more pre a, caly for x and the c most ped ise compa icel were measur ris ement remove on of t sh to e breeding d, be and carried the re line out main s, d from ing pe uring thericarp w samp samele set preparat as flash-fro of extractions. ion zen we For 2.1. Sample Preparation in opted f liqu For more pre the id oN total r the most mea 2. Samples we monomeric cise compa s re urements to be stored anthocyanin rison of t at −70 °C h (TMA), e breeding carri until furth ed out f totalline phenolic r eom the sa r s use. , during content me set of samp(TPC) le preparat extra and ctions. For ferric ion we reduc- 2.1. Sample Preparation For more precise comparison of the breeding lines, during sample preparation we ing ability of plasma (FRAP) assays samples (pericarp) were crushed and homogenized opted f the totao l monomeri r the most mea c anthocya surements to be nin (TMA)ca , tota rrie ld out f phenoli rom the sa c content ( me set of TPC) and extra ferric ctions. For reducing For more precise comparison of the breeding lines, during sample preparation we 2. opted f 1. Samo pr the most mea le Preparation surements to be carried out from the same set of extractions. For abilitin y of liquid plasN ma. (F The RAextraction P) assays sam waspcarried les (peric out arp wi ) were cr th MeOH:H ushedO:HCOOH and homoge (60:39:1 nized v in /v%). the total monomeric anthocyanin (TMA), total phenolic content (TPC) and ferric reducing 2 2 the tota opted fo l monomeri r the most mea c anthocya surements to be nin (TMA),ca tota rrie l phenoli d out from the sa c content (me set of TPC) and extra ferric c reduci tions. For ng Extracts were centrifuged at 4 C at 4300 rpm for 20 min and the resulting supernatant was liquid N2. The extraction was carried out with MeOH:H2O:HCOOH (60:39:1 v/v%). Ex- ability of plasma (FRAP) assays samples (pericarp) were crushed and homogenized in For more precise comparison of the breeding lines, during sample preparation we ab the tota ility of l monomeri plasma (F c a RA nthocya P) assa ni ys n ( sam TMA) ple,s tota (peric l phenoli arp) were cr c content ( ushe Td PC) and an hom d ferri oge c reduci nized ng in used. Until the measurements the prepared samples were stored at 32 C. For the total tracts were centrifuged at 4 °C at 4300 rpm for 20 min and the resulting supernatant was liquid N2. The extraction was carried out with MeOH:H2O:HCOOH (60:39:1 v/v%). Ex- opted for the most measurements to be carried out from the same set of extractions. For ability of plasma (FRAP) assays samples (pericarp) were crushed and homogenized in liquid N ﬂavonoid 2. The extra content ction (TFC) was ca assay rri , e frd out wi uit samples th MeOH:H without 2 seeds O:HCOOH (60:39:1 were sliced andvextracted /v%). Ex- with tused racts. were ce Until the measur ntrifuged em at 4 ents the prep °C at 4300 rp ared m for 2 sample 0 mis were n and t stored he resu at lting s −32 °C. For the tota upernatant wasl the total monomeric anthocyanin (TMA), total phenolic content (TPC) and ferric reducing liquid N2. The extraction was carried out with MeOH:H2O:HCOOH (60:39:1 v/v%). Ex- tractsMilli-Q were ce water ntrifuin ged a ration at 4 °Cof at1:10. 4300 T rp o determine m for 20 mthe in and t totalhcar e res otenoid ulting s content upernat (TC), ant was samples used flavonoid . Until the measur content (TFC) em ass ents the prep ay, fruit samp ared les sample withouts were seeds were sl stored iat ced −32 an °C. For the tota d extracted with l ability of plasma (FRAP) assays samples (pericarp) were crushed and homogenized in tracts were centrifuged at 4 °C at 4300 rpm for 20 min and the resulting supernatant was used. wer Until the measur e extracted with em EtOH:acetone ents the prep(1:1 aredv sample /v%), ﬁlter s were ed and stored kept at in−32 dark °C. For the tota at 32 C until l use. Milli-Q water in a ration of 1:10. To determine the total carotenoid content (TC), samples flavonoid content (TFC) assay, fruit samples without seeds were sliced and extracted with liquid N2. The extraction was carried out with MeOH:H2O:HCOOH (60:39:1 v/v%). Ex- used. Until the measur Samples for the emenzymatic ents the prep activity ared sample of catalase s were (CA stored T) and at per−oxidase 32 °C. For the tota (POD) measur l e- flavonoid content (TFC) assay, fruit samples without seeds were sliced and extracted with were extracted with EtOH:acetone (1:1 v/v%), filtered and kept in dark at −32 °C until use. Milli-Q water in a ration of 1:10. To determine the total carotenoid content (TC), samples tracts were centrifuged at 4 °C at 4300 rpm for 20 min and the resulting supernatant was Mi flavonoid lli-ments Q wa con ter i wer tent ne a ra gr (TFC) ound tion of 1:10 ass in ay, cold fru . To sodium it s determ amples phosphate in wi e the tota thout seeds were sl buf l carotenoi fer (25 mM, d i ccontent ( ed pH and extra 7.8), T C)supplemented , csa ted wi mple th s Samples for the enzymatic activity of catalase (CAT) and peroxidase (POD) measure- were extracted with EtOH:acetone (1:1 v/v%), filtered and kept in dark at −32 °C until use. used. Until the measurements the prepared samples were stored at −32 °C. For the total Milli- with Q wa 0.8 ter i g/l n a ra PVP tion of 1:10 and 1 mM . To EDT determ A, and inwer e the tota e centrifuged l carotenoi for d20 content ( min atT 12,000 C), sa mpl g at es 4 C. were extracted with EtOH:acetone (1:1 v/v%), filtered and kept in dark at −32 °C until use. ments were ground in cold sodium phosphate buffer (25 mM, pH 7.8), supplemented with Samples for the enzymatic activity of catalase (CAT) and peroxidase (POD) measure- flavonoid content (TFC) assay, fruit samples without seeds were sliced and extracted with were extra Supernatant cted wiwas th EtOH:a applied cetone (1 for the studies. :1 v/v%), For filtered the super and kept in d oxide dismutase ark at −32 (SOD) °C until use. assay, 50 mM Samples for the enzymatic activity of catalase (CAT) and peroxidase (POD) measure- ments 0.8 g/l PV were ground P and 1 mM EDTA, in cold sodium phospha and were centri te buffer (2 fuged for 20 5 mM m , pH in at 7.8 12 ),0 , supplemented wit 00 g at 4 °C. Super- h Milli-Q water in a ration of 1:10. To determine the total carotenoid content (TC), samples NaPO buffer was supplemented with 1 mM EDTA and 2 w/v% PVP was applied. Samples Samples for the enzymatic activity of catalase (CAT) and peroxidase (POD) measure- ments were ground 4 in cold sodium phosphate buffer (25 mM, pH 7.8), supplemented with 0 natant was .8 g/l PVP and 1 mM EDTA, applied for the stud and were centri ies. For the superox fuged for 20 ide dismutase min at 12 (SOD ,000 g) assay, 50 mM at 4 °C. Super- were extracted with EtOH:acetone (1:1 v/v%), filtered and kept in dark at −32 °C until use. were centrifuged for 20 min at 12,000 g at 4 C and the supernatant was used for the ments were ground in cold sodium phosphate buffer (25 mM, pH 7.8), supplemented with 0.8 g/l PVP and 1 mM EDTA, and were centrifuged for 20 min at 12,000 g at 4 °C. Super- NaPO4 buffer was supplemented with 1 mM EDTA and 2 w/v% PVP was applied. Samples natant was applied for the studies. For the superoxide dismutase (SOD) assay, 50 mM Samples for the enzymatic activity of catalase (CAT) and peroxidase (POD) measure- studies. Until the measurements, samples were stored at 32 C. For each measurement 3 natant was 0.8 g/l PVP and 1 mM EDTA, applied for the stud anies. d were centri For the superox fuged for 20 ide dismutase min at 12 (SOD ,000 g) assay, 50 mM at 4 °C. Super- were centrifuged for 20 min at 12,000 g at 4 °C and the supernatant was used for the NaPO4 buffer was supplemented with 1 mM EDTA and 2 w/v% PVP was applied. Samples ments were ground in cold sodium phosphate buffer (25 mM, pH 7.8), supplemented with technical replicates were applied. NaPO natant was 4 buffer applied was supp for th leme stud ented with ies. For 1 mM EDTA a the superox nid 2 de dismutase w/v% PVP (SOD was appl ) assay, 50 mM ied. Samples were centrifuged for 20 min at 12,000 g at 4 °C and the supernatant was used for the 0.8 g/l PVP and 1 mM EDTA, and were centrifuged for 20 min at 12,000 g at 4 °C. Super- NaPO4 buffer was supplemented with 1 mM EDTA and 2 w/v% PVP was applied. Samples were centrifuged for 20 min at 12,000 g at 4 °C and the supernatant was used for the natant was applied for the studies. For the superoxide dismutase (SOD) assay, 50 mM 2.2. Total Monomeric Anthocyanin Content (TMA) were centrifuged for 20 min at 12,000 g at 4 °C and the supernatant was used for the NaPO4 buffer was supplemented with 1 mM EDTA and 2 w/v% PVP was applied. Samples Total monomeric anthocyanin content was measured by a pH differential method as were centrifuged for 20 min at 12,000 g at 4 °C and the supernatant was used for the described by Lee et al. [20]. To the samples KOH (pH 1.0) and sodium acetate (NaOAc) (pH 4.5) buffers were measured. After 15 min, absorbance was recorded by a Jenway Antioxidants 2022, 11, 637 4 of 14 6105 UV/Vis spectrophotometer at = 520 nm and = 700 nm. Total monomeric antho- cyanin content was calculated by the following formula: A MW D f 10 TMA (cyanidin 3 glucosyde mg/L) = # l where A = (A A )pH 1.0 (A A )pH 4.5, MW(molecular weight) = 520nm 700nm 520n 700nm 449.2 g/mol for cyanidin-3-glucosyde, D f = Dilution factor, # = 26,900 molar extinction coefﬁcient for cyanidin-3-glucosyde, l = pathlength in cm. Results are expressed as g cyanidin-3-glucosyde/g dry weight (dw) (g cy-3-glu/g). 2.3. Total Polyphenolic Content (TPC) Total soluble polyphenols were measured with Folin–Ciocalteu reagent according to Singleton and Rossi, at = 760 nm with a Jenway 6105 UV/Vis [21]. TPC was calculated based on the calibration curve of 0, 6, 12, 18, 24 and 30 g/mL gallic acid, generating the equation of y = 0.0187x 0.0009, R = 0.9996. The results are expressed as mg gallic acid equivalent (Ga)/g dw. 2.4. Antioxidant Activity (FRAP) The fruits’ antioxidant capacity was measured by the FRAP assay according to Benzie and Strain, at = 593 nm with a Jenway 6105 UV/Vis spectrophotometer [22]. FRAP was calculated based on the calibration curve of 0, 6, 12, 18, 24 and 30 mol/L ascorbic acid, generating the equation of y = 0.0478x + 0.0104, R = 0.9997. The results are expressed as mol ascorbic acid (As) equivalent/g dw. 2.5. Total Flavonoid Content (TFC) Total ﬂavonoid content was determined according to Sytar et al., aluminium chloride colorimetric method [23]. From the supernatant, 500 L was added to 1.5 mL 95% EtOH, 0.1 mLA lCl , 0.1 mL potassium acetate and 2.8 mL water. The absorbance was measured at = 415 nm using a Jenway 6105 UV/Vis spectrophotometer. TFC was calculated on the basis of the calibration curve of quercetin standard for which 0, 20, 40, 80, 120, 160 and 200 g/mL quercetin was used, generating the equation of y = 0.0059x + 0.0361, R = 0.9989. Results are expressed as mg quercetin equivalent (Qe)/g dw. 2.6. Total Carotenoid Content (TC) Total carotenoid content was measured a method described by Hornero-Mendez and Minguez-Mosquera [24]. Absorbance was measured by a Jenway 6105 UV/Vis spectropho- tometer at = 452 nm and = 472 nm, characteristic absorption maximum of red and yellow carotenoids, respectively, results are expressed as mg/kg dw. The total carotenoid content was calculated using the following formula: A V 10 (mL) TC (g/g) = 1% A W (g) 1cm where A = absorbance (measured at either = 452 nm or 472 nm), V = total extract (mL) 1% volume, W = sample weight and A = 2009 or 2144 (extinction coefﬁcient of capsanthin (g) 1cm and -carotene in acetone, respectively). The sum of the two measurements gives the total carotenoid content. 2.7. Catalase Enzyme Activity (CAT) The CAT activity measurement was carried out according to Xing et al. [25]. For the sample extract, sodium phosphate buffer (50 mM, pH 7) and 40 mM H O as a substrate 2 2 was measured. After the addition of the H O the change in the absorbance was monitored 2 2 at = 240 nm in 60 s intervals with a Jenway 6105 UV/Vis spectrophotometer. Results are displayed in U/g dw. Antioxidants 2022, 11, 637 5 of 16 2.7. Catalase Enzyme Activity (CAT) The CAT activity measurement was carried out according to Xing et al. [25]. For the sample extract, sodium phosphate buffer (50 mM, pH 7) and 40 mM H2O2 as a substrate was measured. After the addition of the H2O2 the change in the absorbance was monitored at λ = 240 nm in 60 s intervals with a Jenway 6105 UV/Vis spectrophotometer. Results are displayed in U/g dw. Antioxidants 2022, 11, 637 5 of 14 2.8. Peroxidase Enzyme Activity (POD) The POD activity measurement was carried out according to Xing et al., samples 2.8. Peroxidase Enzyme Activity (POD) were mixed with a buffer containing 8 mM guaiacol and 100 mM sodium phosphate pH The POD activity measurement was carried out according to Xing et al., samples were 6.4. After the addition of 24 mM H2O2 as a substrate, the change in the absorbance was mixed with a buffer containing 8 mM guaiacol and 100 mM sodium phosphate pH 6.4. recorded at λ = 460 nm in 60 s intervals with a Jenway 6105 UV/Vis spectrophotometer. After the addition of 24 mM H O as a substrate, the change in the absorbance was recorded 2 2 Results are displayed in U/g dw. at = 460 nm in 60 s intervals with a Jenway 6105 UV/Vis spectrophotometer. Results are displayed in U/g dw. 2.9. Superoxide Dismutase Enzyme Activity (SOD) SOD activity was assayed by its ability to inhibit the photochemical reduction of ni- 2.9. Superoxide Dismutase Enzyme Activity (SOD) troblue tetrazolium according to Beauchamp and Fridovich [26]. The reaction mixture SOD activity was assayed by its ability to inhibit the photochemical reduction of contained 50 mM sodium phosphate buffer, 10 µM EDTA, 13 mM L-methionine, 75 µM nitroblue tetrazolium according to Beauchamp and Fridovich [26]. The reaction mixture nitroblue tetrazolium (NBT) and 2 µM riboflavin. During the reaction assay preparation, contained 50 mM sodium phosphate buffer, 10 M EDTA, 13 mM L-methionine, 75 M the mixture was kept in dark and to kickstart the reaction, the ready reaction mixture was nitroblue tetrazolium (NBT) and 2 M riboﬂavin. During the reaction assay preparation, illuminated with luminescent light for 10 min. Absorbance was measured at λ = 560 nm the mixture was kept in dark and to kickstart the reaction, the ready reaction mixture was wavelength. Results are displayed in U/g dw. illuminated with luminescent light for 10 min. Absorbance was measured at = 560 nm wavelength. Results are displayed in U/g dw. 2.10. Soluble Solid Content (SSC) and pH 2.10. Soluble Solid Content (SSC) and pH The pH of the berries was measured with LAQUAtwin water quality pocket meter by Horiba (Kyoto, Japan), and their ºBRIX was determined by a digital refractometer, The pH of the berries was measured with LAQUAtwin water quality pocket meter by PR-201 ᾳ , ATAGO . Horiba (Kyoto, Japan), and their ºBRIX was determined by a digital refractometer, PR-201 , ATAGO . 2.11. Determination of Colour Hue 2.11. Determination of Colour Hue Photos of the collected berries were taken in each phenophase upon sample collection Photos of the collected berries were taken in each phenophase upon sample collection with a Pentax GR2 camera. Average colour was determined with Adobe Photoshop CC with a Pentax GR2 camera. Average colour was determined with Adobe Photoshop CC (2019), the HEX values were converted to decimals in MS Excel version 2202 and were (2019), the HEX values were converted to decimals in MS Excel version 2202 and compared to were the results of the other measurements. compared to the results of the other measurements. 2.12. RNA Isolation and Quantitative Real-Time PCR 2.12. RNA Isolation and Quantitative Real-Time PCR Total RNA was isolated from the pericarp of fruits in each phenophase with Omega Total RNA was isolated from the pericarp of fruits in each phenophase with Omega E.Z.N.A. Plant RNA Kit (Norcross, GA, USA). The integrity and quantity of the RNA E.Z.N.A. Plant RNA Kit (Norcross, GA, USA). The integrity and quantity of the RNA samples were verified and measured by agarose gel electrophoresis and Nanodrop 1000 samples were veriﬁed and measured by agarose gel electrophoresis and Nanodrop 1000 spectrophotometer by Thermo Fisher Scientific (Waltham, MA, USA), respectively. From spectrophotometer by Thermo Fisher Scientiﬁc (Waltham, MA, USA), respectively. From the RNA cDNA was synthesized with RevertAid H Minus First Strand cDNA Synthesis the RNA cDNA was synthesized with RevertAid H Minus First Strand cDNA Synthesis Kit Kit by Thermo Fisher Scientific (Waltham, MA, USA) with oligo-dT and random primers by Thermo Fisher Scientiﬁc (Waltham, MA, USA) with oligo-dT and random primers were were applied, according to the manufacturer’s instructions. The qRT-PCR was carried out applied, according to the manufacturer ’s instructions. The qRT-PCR was carried out in a in a Stratagene MX3000p instrument using actin as reference gene. For PCRs we used Stratagene MX3000p instrument using actin as reference gene. For PCRs we used Power Power Up™ SYBR™ Green Master Mix, Applied Biosystems by Thermo Fisher Scientific Up™ SYBR™ Green Master Mix, Applied Biosystems by Thermo Fisher Scientiﬁc (Vilnius, (Vilnius, Lithuania) according to the manufacturer’s instructions. Primers used in this Lithuania) according to the manufacturer ’s instructions. Primers used in this study were study were either published previously by Aza-Gonzalez et al. or were designed by Pri- either published previously by Aza-Gonzalez et al. or were designed by Primer3 using mer3 using Zunla’s genome as a reference (Table 2) [4]. Zunla’s genome as a reference (Table 2) [4]. 2.13. Statistical Analysis The qRT-PCR data were evaluated via the ddCT method. The heatmap was con- structed with TBtools using Eucledian distancing and cladogram branch type [27]. Mi- crosoft Excel and IBM SPSS 25 were applied to calculate means, standard deviation of the means from the repeated measurements as well as Pearson correlation coefﬁcient and F-value from analysis of variance (ANOVA). Antioxidants 2022, 11, 637 6 of 14 Table 2. Primers used for qRT-PCR. 0 0 0 0 Forward 5 –3 Reverse 5 –3 Source ACT GGACTCCGGTGATGGTGT GTCCCTGACAATTTCTCGCTCAG Ca10g11650 TGGCTGCAGTTGGGATCTTT TCCCAACCATCACTTTGTCCT own design Ca10g11690 TACTCGCCTTCTGAGGAAGGTA TGGTACTTGAGAAGTTCCGAGG Ca10g11710 GACAGCGAGCGATGTGAAAA GGCACTTGAGAAGTTCTGTGG CHS AGGAGGTTCGAAGGGAACAA CCATCACCAAAGAGTGCTTG CHI CCTCCTGGTTCTAACACCACC CTTTGCGGCAGGTGAAACTC based on Aza-Gonzalez et al. F3H GGCATGTGTGGATATGGACC CCTCCGGTGCTGGATTCTG 0 0 F3 5 H GATGGGGTGGCCGGTGATTG GCCACCACAACGCGCTCG DFR CTAACACAGGGAAGAGGCTGGTTT AATCGCTCCAGCTGGTCTCATCAT own design ANS ACCAGAACTAGCACTTGGCG ACGCACTTTGCAGTTACCCA UFGT GGATGGTGTCAAACAAGGC GTTCAGTACAACACCATCTGC based on Aza-Gonzalez et al. GST TGATTCTCTCGAGCAGAAAAAACC TGGATAACCTTTGTTCATATATG 3. Results and Discussion The mutant breeding lines used for the study all shared the same genetic background with the ‘Soroksári’. The mutants were selected based on their anthocyanin accumulation patterns in their fruits or in their vegetative parts. Though they share the same genetic background they show large disparity in their nutritional and quality traits. The pH of the berries in the GS1 stage ranged from 5.2 to 6.3 and in their biologically ripe stage from 5.2 to 5.8, hence no signiﬁcant differences were observed between the colouration of the berries and their pH. Thus the berry colour is rather due to other genetic factors or other factors suggested by Láng [28]. Their soluble solid contents in the same phenophases ranged from 4.0 to 7.8 in GS1 and 4.5 to 8.6 ºBRIX in the biologically ripe stage. In accordance with Deepa’s suggestion, all data presented in this study are calculated on dry weight basis (dwb), but wherever is necessary data are also presented on fresh weight basis (fwb) [29]. 3.1. Total Monomer Anthocyanins To determine the presence of anthocyanins in the plant, microscopic pictures using Leica LEITZ DMRXE (Wetzlar, Germany) were taken. In addition to the fruits, from the ‘Pim. Ney.’, a photograph was also taken of its hypocotyl, since this extreme purple genotype accumulates anthocyanin in every phenophase in each organ. Cross-sections of both the hypocotyl and the fruit show that the anthocyanins are located in the vacuoles of the mesocarpic cells, and their intensity dilutes towards the inner mesocarp, corresponding to Lightbourn’s ﬁndings [5]. While in the hypocotyl only the ﬁrst two layers of cells contain anthocyanins, the cross-section of the berry showed that under the cuticle there are ﬁve to six layers of mesocarp cells in the which are contained anthocyanis (Figure 1). Thus far, the delphinidin-3-p-coumaroyl-runtinoside-5-glucoside is the main and only anthocyanidin found in the fruit, foliage and in the ﬂower of pepper [30,31]. TMA was mostly recorded in the early phenophases except for ‘Pim. Ney.’ In two cases, anthocyanin was detected in the white-berried ones as well (11278 at breaker and in the ‘Soroksári’ at GS2 stage), although it could not be seen in the berries (Table 3). Sadilova et al. measured 321.5 g cy-3-glu/g on fresh weight basis (fwb) in the peel of a C. annuum variety, whereas in the case of C. annuum we measured 15 times more (4866.47 g cy-3-glu/g fwb equal to 56,575.27 g cy-3-glu/g dw) and in the case of the C. chinense almost 130 times higher value on fwb (41,366.57 g cy-3-glu/g fwb equal to 517,082.19 g cy-3-glu/g dw) [31]. Antioxidants 2022, 11, 637 7 of 14 Table 3. Means and standard deviation of the means of the enzymatic activity and phytochemicals measured in different phenophases (in dw). TMA TPC FRAP TFC TC CAT SOD POD GS1 g cy-3-glu/g mg Ga/g mol As/g mg Qe/g mg/kg U/g U/g U/g ‘Pim. Ney.’ 134,897.45 723.37 a 116.78 8.32 a 515.55 6.26 a 45.38 0.25 a 341.79 113.45 a,b 8.97 0.76 a,b 46.75 2.53 a 67.90 5.50 a,c 11263 10,222.68 159.52 b 43.73 0.12 b,c 281.67 1.52 b 56.98 0.2 b 273.21 6.50 a,b 8.72 1.12 a,b 42.53 5.27 a 26.60 13.55 b 11270 56,575.27 1445.30 c 43.15 0.13 b,c 359.28 2.30 c 15.78 0.04 c 105.60 6.02 a 4.56 0.68 a,b 64.84 1.93 a 36.18 2.44 a,b 11274 17,929.89 6025.39 b 43.11 0.26 b,c 366.58 3.80 c 86.34 0.54 d 448.47 44.00 b 10.38 2.14 a 58.48 3.07 a 24.07 2.10 b 11278 Nd 60.34 3.64 b 232.84 0.81 d 49.97 0.30 e 489.41 93.06 b,c 4.21 0.83 a,b 48.85 5.60 a 44.59 4.79 a,b,c 11280 Nd 35.08 0.32 c 455.04 1.34 e 65.55 0.16 f 432.05 47.63 a,b 8.77 1.45 a,b 158.46 33.82 b 80,34 6.75 c,d ‘Soroksári’ Nd 84.57 0.56 d 511.03 1.76 a 17.01 0.70 c 193.37 55.77 a,b 3.18 1.10 b 41.18 3.01 a 115.92 9.10 d GS2 ‘Pim. Ney.’ 461,480.11 6274.54 a 107.13 9.77 a 945.29 1.33 a 50.54 0.71 a 1108.41 62.66 a 8.52 1.55 a 163.79 22.15 a 46.88 0.08 a 11263 5615.80 412.52 b 33.07 1.02 b 181.02 0.63 b 34.51 0.03 b 473.84 26.14 b 3.53 0.23 b 55.76 6.22 b 44.99 1.42 a 11270 20543.74 958.88c 25.57 0.42 b 129.29 0.83 c 22.62 0.03 c 825.08 58.10 a 5.14 0.85 a, b 74.58 1.51 b 62.75 1.20 a 11274 7754.45 630.72 b,c 44.75 0.88 b,c 306.80 1.46 d 83.23 0.27 d 1493.24 93.68 c 2.93 0.13 b 28.15 1.98 b 59.83 0.78 a 11278 66.33 5.30 c 358.24 2.86 e 30.07 0.07 e 451.59 44.93 b 1.68 0.12 b 29.37 1.18 b 59.18 5.97 a Nd 11280 61.86 7.26 c,d 411.35 1.13 f 112.50 0.17 f 1495.11 49.65 c 2.32 0.04 b 38.27 0.40 b 145.09 7.72 b Nd ’Soroksári’ 356.25 22.85 b 42.74 1.96 b,c 199.79 0.88 g 10.48 0.04 g 511.38 41.75 b 4.27 0.27 b 30.58 7.84 b 68.89 16.00 a Breaker ‘Pim. Ney.’ 517,082.19 13557.80 a 196.38 2.19 a 1737.93 8.96 a 43.93 0.99 a 583.01 42.03 a 15.60 0.57 a 85.38 9.31 a 129.80 19.58 a 11263 Nd 21.72 0.34 b 153.49 0.27 b 9.39 0.08 b 1085.18 93.27 a,b 4.98 0.72 b 37.09 1.12 b 57.12 0.79 b 11270 3962.81 218.28 b 21.79 0.89 b 108.40 0.16 c 6.45 0.06 c 1201.93 32.17 b 5.45 0.37 b 9.29 4.36 c 64.02 6.93 b 11274 2143.08 318.16 b 24.42 2.31 b,d 266.32 0.33 d 6.29 0.02 c 1129.88 130.97 a,b 6.57 4.74 a,b 14.50 0.95 c 29.82 0.97 b 11278 521.84 60.26 b 87.66 1.68 c 751.18 1.33 e 11.97 0.05 d 679.61 167.51 a,b 3.84 0.63 b 7.13 0.34 c 30.91 0.89 b 11280 30.80 1.16 d,e 199.44 0.38 f 7.15 0.03 c 825.88 73.16 a,b 6.08 1.22 a,b 5.47 0.72 c 33.12 2.97 b Nd ’Soroksári’ 36.10 2.04 e 275.31 0.46 d 10.41 0.07 b,d 1198.05 121.63 b,c 7.17 0.94 a,b 6.83 0.11 c 55.32 14.29 b Nd Ripe ‘Pim. Ney.’ 154,812.58 77.25 a 98.08 5.63 a 1155.14 2.98 a 27.57 0.27 a 717.20 186.46 a 56.90 2.94 a 115.58 8.33 a 74.79 10.59 a,b 11263 Nd 21.12 0.59 b 245.63 0.30 b 5.32 0.02 b 1847.56 366.00 a 8.85 1.24 b 179.60 29.65 a 165.10 24.19 a,b 11270 352.08 29.04 b 23.87 0.49 b 217.02 0.67 c 2.10 0.05 c 1204.84 189.71 a 5.07 0.86 b 202.32 155.68 a 198.94 81.22 a 11274 Nd 21.83 0.98 b 178.77 0.55 d 10.22 0.08 d 1651.30 450.35 a 4.28 0.23 b 16.48 1.40 a 21.03 6.23 b 11278 Nd 17.06 0.75 b 133.71 0.18 e 20.52 0.08 e 2929.87 510.87 a 9.91 1.18 b 79.44 19.74 a 75.59 9.44 a,b 11280 Nd 42.94 1.51 c 466.69 0.63 f 10.55 0.06 d 3874.30 1065.33 a,b 3.41 0.64 b 29.94 15.11 a 25.15 11.95 b,c ’Soroksári’ Nd 22.30 0.84 b 207.80 0.24 g 7.04 0.05 f 6168.53 921.44 b 7.94 1.24 b 5.19 2.07 a 6.18 0.93 b,d Note: Values in the same column and sub-table not sharing the same subscript are signiﬁcantly different at p < 0.05 in the two-sided test of equality for column means. —This category is not used in comparisons because there are no other valid categories to compare; Nd stands for not detected. Antioxidants 2022, 11, 637 7 of 16 Antioxidants 2022, 11, 637 8 of 14 (a) (b) Figure 1. Cross-section of the hypocotyl (a) and berry (b) of ‘Pim. Ney.’. Figure 1. Cross-section of the hypocotyl (a) and berry (b) of ‘Pim. Ney.’. 3.2. Total Polyphenolic Content Thus far, the delphinidin-3-p-coumaroyl-runtinoside-5-glucoside is the main and only ant Forhthe ocyTPC anidmeasur in found ement in thFolin–Ciocalteu e fruit, foliage and assay inwas the fl applied. ower oThe f pepper [ minor3drawback 0,31]. TMA of was most this method ly re is corded that itin the ear also detects ly pheno the additional phases except for ‘Pim. Ney.’ In two ca capsaicinoids, ascorbic acid, ses, ﬂavonoids antho- cyan and in wa minors d phenolics, etected in t ther he efor whit e generates e-berried ones higher as values. well (1 As 127 for 8 at the brTPC eaker values, and ingenerally the ‘So- roks in each ári’ at genotype GS2 stagthe e), alt lowest hough it values could wer not e scor be seen in ed at the the b later erries stages, (Table and 3). S usually adilova higher et al. m values easured wer 32 e 1 observed .5 µg cy-3in -glthe u/geconomically on fresh weight basis ripe GS1(fwb) in the peel of and GS2 stages ona dry C. ann weight uum basis. vari- However, when expressed on fwb an increasing trend was visible. The highest values ety, whereas in the case of C. annuum we measured 15 times more (4866.47 µg cy-3-glu/g were recorded for the ‘Pim. Ney.’, being signiﬁcantly different from the other samples in fwb equal to 56,575.27 µg cy-3-glu/g dw) and in the case of the C. chinense almost 130 times every phenophase, and other studies also concluded that C. chinense varieties exhibit higher higher value on fwb (41,366.57 µg cy-3-glu/g fwb equal to 517,082.19 µg cy-3-glu/g dw) TPC values than C. annuum [32]. Higher values were expected at the GS1 stage in the [31]. lilac-berried mutants due to their elevated anthocyanin accumulation (43.11 to 43.73 mg/g); however, the white-berried genotypes at GS1 stage scored 1.5–2 times higher values (60.34 to 84.57 mg/g) (Table 3). Although there are studies indicating that there is no correlation in between maturity and TPC [33], when expressed on dry weight basis an overall decreasing trend can be seen during ripening, which supports Marín, Navarro, Ghasemnezh and Deepa’s studies [29,34–36]. When expressed on fwb, Chandel et al. measured from 0.621 to 1.690 mg/g, while we detected higher values, from 1.60 to 16.031 mg/g [37]. On the other hand, Howard et al., Sora et al. and Sim et al. found that TPC is greatly dependent on the sample material used and on the genotype studied [38–40]. 3.3. Antioxidant Activity Antioxidant activity of both fruits and vegetables is an important attribute when assessing their nutritional value and measuring it allows the determination of this without the measurement of each compound with antioxidant activity separately. FRAP assay was chosen to detect the antioxidant activity, which measures the antioxidant activity against Antioxidants 2022, 11, 637 9 of 14 the iron reducing capacity of the samples. This method is suitable for the analysis of the antioxidant capacity of water-soluble compounds, such as polyphenols, ﬂavonoids, anthocyanins, ascorbic acid, etc. Most genotypes displayed high values of antioxidant capacity at GS1, followed by a decline at breaker stages, and a slight increase at biological ripeness. The highest antioxidant capacity was recorded in the ‘Pim. Ney.’, 1737.3 mol/g dry weight at its breaker stage, although being the only pungent genotype, capsaicin could also add to the overall high values of AOX [41]. The lowest value was recorded at the breaker stage of the purple-berried mutant (11270), 108.40 mol/g dry weight, which showed a 16-fold difference in between the studied genotypes at different phenophases (Table 3). AOX activity in addition to the GS1 stage differed signiﬁcantly in each genotype, with the highest value recorded for the purple-berried ‘Pim. Ney.’ in each phenophase. Both the genotype and maturity affected the FRAP values signiﬁcantly, e.g., in the case of ‘Pim. Ney.’ a signiﬁcant increase was detected towards full ripeness, whereas a signiﬁcant decrease was detected in 11274 when expressed on dry weight basis (Table 3). 3.4. Total Flavonoid Content Flavonoids form an important group of health-promoting compounds since they exhibit free-radical scavenging activity, thus protecting the human body from oxidative stress. As ripening advances, the detected amount of ﬂavonoids decreases, and this reduction may be due to the conversion to secondary metabolic phenolic compounds which is in agreement with the ﬁndings of Marín et al. and Ghasemnezhad et al. [34,36]. Interestingly, the extreme purple ‘Pim. Ney.’ did not score the highest values, whereas Ghasemnezhad detected the highest amount of ﬂavonoids in a dark purple genotype both at ecological and biological ripeness [36]. Compared to Ana Karina et al., we detected 1.5- to 4.3-fold higher TFC in the red genotypes, 1.2 times higher in the orange genotype and half of the amount in the case of the yellow ripe berry [42]. When expressed on fresh weight, our results coincide with Garra et al., who reported TFC between 3.14 to 8.90 mg/g fresh weight, while we detected 0.18 to 7.89 mg/g on fwb [43]. 3.5. Total Carotenoid Content The ripeness of pepper is associated with the accumulation of carotenoids. A signiﬁ- cant increase can be observed in the carotenoid content as ripening progresses (Table 3). The lowest amount was detected at the GS1 stage of 11270, 105.60 mg/kg, and the highest was scored at the ripe stage of cv. ‘Soroksári’, 6168.53 mg/kg. In this pepper an 8-fold increase was detected. Kilcrease et al. measured from 455.11 to 795.73 g/g fwb in the pericarp of orange and red varieties, which is in line with our ﬁndings: the lowest TC content was 8.49 mg/kg fwb, the 11270 GS1 stage, whereas the highest, the ‘Soroksári’ fully ripe stage, was 697.28 mg/kg fwb [10]. When expressed on dwb, however, they measured from 1235.1 to 3049.1 mg/kg dwb in mature berries, whereas we detected from 717.20 in ‘Pim. Ney.’ to 6168.53 mg/kg dwb in the mature berries of the ‘Soroksári’ (Table 3) [11]. 3.6. Enzymatic Activity Studies are already available on the pattern of change of the non-enzymatic antioxi- dants, such as ﬂavonoids, polyphenols, carotenoids, etc., throughout ripening of the pepper berry. However, there are only a few which deal with the enzymatic antioxidants over the course of maturation. Therefore, CAT, SOD and POD activity were monitored, as they serve as defence barriers against reactive oxygen species. The accumulation of these compounds is determined by several factors, both internal and external. External factors were minimized since the plants were kept under the same semi-controlled conditions, thus differences observed can be contributed to the genotype effect and ripening. The activity of CAT increased—though not signiﬁcantly—in most of the studied genotypes, ‘Pim. Ney.’ being the only one where the increase was signiﬁcant. In case of 11274 and 11280, however, a decrease from ecological to biological ripeness was observed, which is in line with the ﬁndings of Palma [44]. As for SOD activity, in the case of ‘Pim. Ney.’, 11263 and 11270, an Antioxidants 2022, 11, 637 10 of 14 increase was observed from GS1 to GS2, followed by a decrease at breaker stage, then an increase again at full maturity. Compared to GS1, there was an increase at the ripe stage of 11278, whereas in case of 11270, 11280 and ‘Soroksári’, a decrease was seen compared to GS1. Within genotypes, an overall increase was seen toward biological ripeness in the POD activity in the case of ‘Pim. Ney.’ and 11263–11278 breeding lines, whereas in the case of 11280 and ‘Soroksári’, a decrease was detected from GS1 to full ripeness (Table 3). 3.7. Correlation between Phytochemicals and AOX As stated previously, ripening affects the phytochemical composition of the berries. To assess the degree of contribution of these compounds to the overall AOX of the berries, phytochemicals and antioxidant capacity as well as berry colour in each genotype in each phenophase were evaluated (Table 4). The FRAP and TPC values showed a strong positive correlation (r = 0.906), which is lower than that reported by Bogusz or Sora et al. but higher than that obtained by Deepa et al. (Table 4) [29,32,40]. TMA displayed strong positive correlation with both FRAP (r = 0.849) and TPC (r = 0.848), indicating that their presence is linked with the increased antioxidant capacity over the course of ripening. The correlation between carotenoids and FRAP was weaker (r = 0.150). This is due to the nature of the FRAP assay, since it requires acidic conditions (pH 3.6) within which carotenoids tend to undergo isomerization, thus losing their reducing activity [42]. Table 4. Pearson correlation coefﬁcients between the enzymatic activity, phytochemicals and colour of pepper fruits. CAT SOD POD FRAP TPC TMA TFC TC Colour CAT 1 SOD 0.209 1 POD 0.110 0.763 ** 1 FRAP 0.523 ** 0.200 0.097 1 TPC 0.322 ** 0.079 0.001 0.906 ** 1 TMA 0.272 0.301 * 0.226 0.849 ** 0.848 * 1 TFC 0.008 0.064 0.052 0.208 0.281 ** 0.218 1 TC 0.024 0.025 0.143 0.150 0.259 * 0.077 0.194 1 Colour 0.457 ** 0.165 0.036 0.531 ** 0.526 ** 0.609 ** 0.222 * 0.242 * 1 *, ** Correlation is signiﬁcant at the 0.05 level and 0.01 level, respectively. In addition to assessing the contribution of the phytochemicals to the AOX, we also examined the effect of genotype and phenophase and their combination on both the AOX itself and on the related nutraceutical compounds as well. Guilherme et al. found that maturity affects the polyphenolic content and composition to a great extent while Howard et al. concluded that both the amount of phenolics and ﬂavonoids are mostly affected by the cultivar [38,45]. Ghasemnezhad et al. also established the same conclusion, hence the changes in ﬂavonoids depend on the cultivar rather than the maturity [36]. A two-way ANOVA was conducted and resulting F-values are summarized in Table 5. Numbers highlighted are the highest affecting factors in a group. Our results indicate that TMA, TPC and FRAP were affected by the genotype. On the contrary, the TFC was mainly inﬂuenced by the phenophase. Table 5. ANOVA F-value summary of 4 most important nutraceutical traits of 7 genotypes at 4 phenophases. TMA TPC TFC FRAP Genotype (G) 5918.75 438.54 12,311.20 61,209.87 Maturity (M) 537.56 86.37 37,756.75 4501.43 G x M 633.38 46.37 5255.05 9704.27 Note: values in bold are the highest affecting factors in a group. Antioxidants 2022, 11, 637 11 of 14 In the case of the TMA, an interaction between genotype and maturity could be demon- strated, F(18, 56) = 633.38 and p < 0.001. As for the TPC, F(18, 56) = 46.37 and p < 0.001. TFC was also affected signiﬁcantly by both genotype and maturity, where F(18, 56) = 5255.05 and p < 0.001, as well as FRAP, where F(18, 56) = 9704.27 and p < 0.001 (Table 5). Although in most of the cases genotype was the most inﬂuencing factor, adjusted r squared in all four cases are between 0.978 and 1.00, meaning that variance in the phytonutrients is almost entirely attributable to the effect of genotype and maturity. 3.8. Regulation of Anthocyanin Biosynthesis The presence of anthocyanins positively correlated with the accumulation of tran- scripts of both regulatory and structural genes of the anthocyanin biosynthetic pathway (Figure 2, Table 6). Most studies conclude that R2R3-MYBs affect the expression of LBGs 0 0 (F3 5 H, DFR, ANS, UFGT, GST); however, contradictory results are available on their effect on the EBGs (CHI, CHS, F3H) of the pathway [4,18,46]. The expression level of both ANS Antioxidants 2022, 11, 637 and DFR coincided with the higher expression of regulatory MYBs. Their expression 13 of was 16 higher in those stages where the berries are still rich in anthocyanins; furthermore, a great fold of difference was observed in transcript levels between the anthocyanin-pigmented and anthocyanin-less genotypes (Figure 2). Interestingly, the transcript level of EBGs, CHS EBGs, CHS and F3H followed the expression of the studied MYB transcription factors, as and F3H followed the expression of the studied MYB transcription factors, as opposed to opposed to Borovsky et al. and Aza-Gonzalez et al., who found that expression of CHS is Borovsky et al. and Aza-Gonzalez et al., who found that expression of CHS is comparable comparable between the anthocyanin-rich and anthocyanin-less genotypes [4,18]. On the between the anthocyanin-rich and anthocyanin-less genotypes [4,18]. On the other hand, other hand, Stommel et al. detected higher transcript levels of CHS in the anthocyanin- Stommel et al. detected higher transcript levels of CHS in the anthocyanin-pigmented pigmented genotypes; in fact, upon silencing the MYBa, Ochoa-Alejo et al. and Zhang et genotypes; in fact, upon silencing the MYBa, Ochoa-Alejo et al. and Zhang et al. detected al. detected the down regulation of both LBGs and EBGs [46–48]. the down regulation of both LBGs and EBGs [46–48]. Figure 2. Fold expression pattern of the tested genotypes compared to cv. ‘Soroksári’ in 4 pheno- Figure 2. Fold expression pattern of the tested genotypes compared to cv. ‘Soroksári’ in 4 phenopha- phases, pseudo-colour bar is showing the level of fold expression on a normalized scale. ses, pseudo-colour bar is showing the level of fold expression on a normalized scale. After comparing the expression level of the three R2R3-MYB transcription factors, it Table 6. Log2 fold change of R2R3-MYBs compared to the cv. ‘Soroksári’ and extracts’ colouration can be seen that the so-called MYBa (Ca10g11650) and the two other putative regulatory throughout the four tested phenophases. MYBs (Ca10g11690 and Ca10g11710) were expressed at high levels in the lilac-berried genotypes, and their transcript level decreased in genotypes 11263, 11270 and 11274 as Gene ID Phenophase ‘Pim. Ney.’ 11263 11270 11274 11278 11280 ripening advanced and the berries started to turn into their ripe colour. The extreme lilac GS1 1126.61 10.94 9.00 16.87 0.46 0.21 genotype, ‘Pim. Ney.’, showed the highest log2 fold change in every phenophase. This GS2 2893.52 14.47 11.41 9.94 0.21 0.06 Ca10g11650 might suggest that besides MYBa, these two other R2R3-MYBs, or a combination of them, Breaker 35.89 3.66 3.02 4.97 0.23 0.31 regulate the anthocyanin synthesis in the berries of Capsicums (Table 6). Ripe 11.16 5.53 1,57 3.09 0.20 0.10 GS1 17.71 2.37 5.07 2.06 0.02 0.47 GS2 16.35 18.11 23.61 0.20 0.03 0.28 Ca10g11690 Breaker 5.25 1.47 1.53 0.18 0.06 0.44 Ripe 3.36 0.53 0.86 0.05 0.03 0.24 GS1 80.05 8.25 12.12 0.43 0.36 0.47 GS2 302.22 3.54 29.17 0.50 1.23 0.24 Ca10g11710 Breaker 177.36 0.46 1.74 0.32 0.85 0.48 Ripe 171.32 0.36 0.29 0.36 0.67 0.42 Crude sample GS1🠖 Ripe extracts’ colour Note: Purple coloured cells indicate anthocyanin build-up in the berries. After comparing the expression level of the three R2R3-MYB transcription factors, it can be seen that the so-called MYBa (Ca10g11650) and the two other putative regulatory MYBs (Ca10g11690 and Ca10g11710) were expressed at high levels in the lilac-berried gen- otypes, and their transcript level decreased in genotypes 11263, 11270 and 11274 as ripen- ing advanced and the berries started to turn into their ripe colour. The extreme lilac gen- otype, ‘Pim. Ney.’, showed the highest log2 fold change in every phenophase. This might suggest that besides MYBa, these two other R2R3-MYBs, or a combination of them, regu- late the anthocyanin synthesis in the berries of Capsicums (Table 6). Antioxidants Antioxidants 2022 2022,, 11 11,, 637 637 13 of 13 of 16 16 Antioxidants Antioxidants Antioxidants Antioxidants 2022 2022 2022 2022 , 11 , 11 , 11 ,, 637 , 11 637 , 637 , 637 13 of 13 of 13 of 13 of 16 16 16 16 EBGs, CH EBGs, CHS S and F and F3 3H H follo follow wed the expr ed the expression ession of of the studi the studie ed d MYB tra MYB tran nscri scripti ptio on f n fa actors, a ctors, as s EBGs, CH EBGs, CH EBGs, CH EBGs, CH S S and F S and F S and F and F 3 3H H 33 H follo H follo follo follo w wed the expr w ed the expr w ed the expr ed the expr ession ession ession ession of of of of the studi the studi the studi the studi e ed d ee d MYB tra MYB tra d MYB tra MYB tra n nscri scri nn scri scri pti pti pti o pti on f n f oo n f a n f actors, a ctors, a aa ctors, a ctors, a ss ss op op opp p po o osed t sed t sed to o o B B Bo o orov rov rovs s sky ky ky et et et a a al l l... and and and A A Az z za-G a-G a-Go o onza nza nzal l le e ez z z et et et al., al., al., who fo who fo who found th und th und that expression at expression at expression of CHS of CHS of CHS is is is op op op p po o p sed t sed t osed t o o B B oo B orov rov orov ssky ky sky et et et a al a l.. and and l. and A A A z za-G a-G za-G o onza nza onza lle ez lz e et et z et al., al., al., who fo who fo who fo und th und th und th at expression at expression at expression of CHS of CHS of CHS is is is compa compa compa compa rabr r rla a a eb b b b ll le e e e b b b tween the e e etween the tween the tween the anthocya anthocya anthocya anthocya nin- ni ni ni rich a n- n- n-rich a rich a rich a nd n n n ad d d nthocya a a an n nthocya thocya thocya nin-l ni ni nie n-l n-l n-l ss genotypes e e ess genotypes ss genotypes ss genotypes [4,18 [ [ [4 4 4,18 ] ,18 ,18 . On the ] ] ]. On the . On the . On the compa compa rarb alb el b e b etween the etween the anthocya anthocya nini n-n- rich a rich a nd nd an athocya nthocya nini n-l n-l ess genotypes ess genotypes [4[,18 4,18 ]. On the ]. On the otot her hand ot ot ot her hand her hand her hand her hand , S, t, , , ommel et SS S S tommel et tttommel et ommel et ommel et al a . a a a det l.lll det ... det det det ect ee ed h e e ct ct ct ct ed h ed h ed h ed h igh ig iiier t g g g hh h h er t er t er t er t ran rr r an rscript an an an script script script script leve leve leve leve leve ls ls of C ls ls ls of C of C of C of C HS in H H H H S in S in S in S in th t t e t t hh h h ant e e e e ant ant ant ant hocyan hh h h ocyan ocyan ocyan ocyan in- in- iiin- n- n- other hand, Stommel et al. detected higher transcript levels of CHS in the anthocyanin- pigmented genotypes; in fact, upon silencing the MYBa, Ochoa-Alejo et al. and Zhang et pigment pigment pigment pigment pigment e ed ge d ge ee e d ge d ge d ge not not not not not y ypes; in pes; in yy y pes; in pes; in pes; in f fa a f ct f f ct aa a , upon s ct , upon s ct ct , upon s , upon s , upon s ilen ilen ilen ilen ilen ccin in cc c in g the MYB g the MYB in in g the MYB g the MYB g the MYB a a, Ocho , Ocho aa a , Ocho , Ocho , Ocho a-Alej a-Alej a-Alej a-Alej a-Alej o et al. o et al. o et al. o et al. o et al. and Z and Z and Z and Z and Z h hang et ang et hh h ang et ang et ang et al. detected the down regulation of both LBGs and EBGs [46–48]. al al. detected t al . detected t al al . detected t . detected t . detected t h he down re e down re hh h e down re e down re e down re g gu u g lg g lu a a u u tion ltion a l la a tion tion tion o offo both LBGs both LBGs o o f both LBGs f f both LBGs both LBGs and and and and and E EB B E Gs [46–48]. E E Gs [46–48]. BB B Gs [46–48]. Gs [46–48]. Gs [46–48]. Figure 2. Fold expression pattern of the tested genotypes compared to cv. ‘Soroksári’ in 4 phenopha- Figure 2. Figure 2. Figure 2. Figure 2. Figure 2. Fold e Fold e Fold e Fold e Fold e x x pression patte pression patte xx x pression patte pression patte pression patte rn of the te rn of the te rn of the te rn of the te rn of the te sted sted sted sted sted genotype genotype genotype genotype genotype s com s com s com s com s com p p ared to ared to pp p ared to ared to ared to cv cv cv . ‘ . ‘ cv cv S S . ‘ o . ‘ . ‘ o S rr S S ok o ok o o rok r r sári’ in 4 sári’ in 4 ok ok sári’ in 4 sári’ in 4 sári’ in 4 ph ph ph enopha- ph ph enopha- enopha- enopha- enopha- ses ses,, pseu pseudo do-col -colou our bar is r bar is sho show wing ing the leve the level l of fol of fold d ex express pressiion on a norm on on a normal alized ized sca scale. le. ses ses ses ,ses , pseu pseu , pseu , pseu do do do -col -col do -col -col ou ou ou r bar is r bar is ou r bar is r bar is sho sho sho sho w wing w ing w ing ing the leve the leve the leve the leve l l of fol of fol l l of fol of fol d d ex ex dd ex press ex press press press iion on a norm on on a norm ion on a norm ion on a norm al alized al ized al ized ized sca sca sca le. sca le. le. le. Table 6. Table 6. Table 6. Table 6. Table 6. Log Log Log Log Log 2 f2 o 2 2 2 f ld f f f oo o o ld chang ld ld ld chang chang chang chang e of R2R3-MYBs co ee e e of R2R3-MYBs co of R2R3-MYBs co of R2R3-MYBs co of R2R3-MYBs co mp m m m m ared to pp p p ared to ared to ared to ared to the cv. ‘Soroksári’ and the cv. ‘Soroksári’ and the cv. ‘Soroksári’ and the cv. ‘Soroksári’ and the cv. ‘Soroksári’ and extracts’ colouration extracts’ colouration extracts’ colouration extracts’ colouration extracts’ colouration Antioxidants 2022, 11, 637 Table 6. Log2 fold change of R2R3-MYBs compared to the cv. ‘Soroksári’ and extracts’ colouration 12 of 14 throug throughout the four tes hout the four test ted ed ph phenophas enophase es s.. throug throug throug throug hout the four tes hout the four tes hout the four tes hout the four tes tted ed ted t ph ph ed ph ph enophas enophas enophas enophas e ess.e . e s.s . Ge Gene ne ID ID Phe Phen nopha ophase se ‘Pi ‘Pim m. Ne . Ney.’ y.’ 1 1126 1263 3 1 1127 1270 0 1 1127 1274 4 1 1127 1278 8 1 1128 1280 0 Ge Ge Ge Ge ne ne ne ID ne ID ID ID Phe Phe Phe Phe n nopha opha nn opha opha se se se se ‘Pi ‘Pi ‘Pi m ‘Pi mm . Ne . Ne m . Ne . Ne y.’ y.’ y.’ y.’ 1 1126 126 11 126 126 3 3 3 3 1 1127 127 11 127 127 0 0 0 0 1 1127 127 11 127 127 4 4 4 4 1 1127 127 11 127 127 8 8 8 8 1 1128 128 11 128 128 0 0 0 0 Table 6. Log2 fold change of R2R3-MYBs compared to the cv. ‘Soroksári’ and extracts’ colouration GS1 GS1 1 1126 126.6 .61 1 1 10 0.94 .94 9. 9.00 00 1616.8.877 0. 0.4646 0.0.2121 GS1 GS1 GS1 GS1 1 1126 126 11 126 126 .6 .61 .6 1 .6 1 1 1 10 0 1 .94 .94 1 00 .94 .94 9. 9.00 9. 00 9. 00 00 161616.8.8167.87 0. .8 0. 77 0. 0.464646 46 0.0.210.210.21 21 throughout the four tested phenophases. GS2 GS2 2 2893 893.5 .52 2 1 14 4.47 .47 1 11 1.41 .41 9.9.9494 0. 0.2121 0.0.0606 GS2 GS2 GS2 GS2 2 2893 893 22 893 893 .5 .52 .5 2 .5 2 2 1 14 4 1 .47 .47 1 44 .47 .47 1 11 1 1 .41 .41 1 11 .41 .41 9.9.949.949.94 0. 0. 94 0. 0.212121 21 0.0.060.060.06 06 Ca1 Ca10g1 0g1165 1650 0 Ca1 Ca1 Ca1 Ca1 0g1 0g1 0g1 0g1 165 165 165 165 0 0 0 0 Breaker Breaker 3535.8.899 3. 3.6666 3. 3.02 02 4.4.9797 0. 0.2323 0.0.3131 Breaker Breaker Breaker Breaker 353535.8.8359.89 3. .8 3. 99 3. 3.666666 66 3. 3.02 3. 02 3. 02 02 4.4.974.974.97 0. 0. 97 0. 0.232323 23 0.0.310.310.31 31 Gene ID Phenophase ‘Pim. Ney.’ 11263 11270 11274 11278 11280 Ripe Ripe 1111.1.166 5. 5.5353 1,1,5757 3. 3.0909 0.0.2020 0.0.1010 Ripe Ripe Ripe Ripe 111111.1.1116.16 5. .1 5. 66 5. 5.535353 53 1,1,571,571,57 3. 3. 57 3. 3.090909 09 0.0.200.200.20 20 0.0.100.100.10 10 GS1 1126.61 10.94 9.00 16.87 0.46 0.21 GS2 2893.52 14.47 11.41 9.94 0.21 0.06 GS1 GS1 1 17 7.71 .71 2. 2.37 37 5. 5.07 07 2.2.0606 0. 0.0202 0.0.4747 GS1 GS1 GS1 GS1 1 17 7 1 .71 .71 1 77 .71 .71 2. 2.37 2. 37 2. 37 37 5. 5.07 5. 07 5. 07 07 2.2.062.062.06 0. 0. 06 0. 0.020202 02 0.0.470.470.47 47 Ca10g11650 Breaker 35.89 3.66 3.02 4.97 0.23 0.31 GS2 GS2 1 16 6.35 .35 1 18 8.11 .11 2 23 3.61 .61 0.0.2020 0. 0.0303 0.0.2828 GS2 GS2 GS2 GS2 1 16 6 1 .35 .35 1 66 .35 .35 1 18 8 1 .11 .11 1 88 .11 .11 2 23 3 2 .61 .61 2 33 .61 .61 0.0.200.200.20 0. 0. 20 0. 0.030303 03 0.0.280.280.28 28 Ca1 Ca10g1 0g1169 1690 0 Ripe 11.16 5.53 1.57 3.09 0.20 0.10 Ca1 Ca1 Ca1 Ca1 0g1 0g1 0g1 0g1 169 169 169 169 0 0 0 0 Breaker Breaker 5.5.2525 1. 1.4747 1. 1.53 53 0.0.1818 0. 0.0606 0.0.4444 Breaker Breaker Breaker Breaker 5.5.255.255.25 1. 1. 25 1. 1.474747 47 1. 1.53 1. 53 1. 53 53 0.0.180.180.18 0. 0. 18 0. 0.060606 06 0.0.440.440.44 44 GS1 17.71 2.37 5.07 2.06 0.02 0.47 Ripe Ripe 3.3.3636 0. 0.5353 0.0.8686 0. 0.0505 0.0.0303 0.0.2424 Ripe Ripe Ripe Ripe GS2 3.3.363.36 16.353.36 0. 0. 36 0. 0.5353 18.1153 53 0.0.860.86 23.610.86 0. 0. 86 0. 0.05 0.200505 05 0.0. 0.03030.030.03 03 0. 0.280.240.240.24 24 Ca10g11690 Breaker 5.25 1.47 1.53 0.18 0.06 0.44 GS1 GS1 8 80 0.05 .05 8. 8.25 25 1 12 2.12 .12 0.0.4343 0. 0.3636 0.0.4747 GS1 GS1 GS1 GS1 8 80 0 8 .05 .05 8 00 .05 .05 8. 8.25 8. 25 8. 25 25 1 12 2 1 .12 .12 1 22 .12 .12 0.0.430.430.43 0. 0. 43 0. 0.363636 36 0.0.470.470.47 47 Ripe 3.36 0.53 0.86 0.05 0.03 0.24 GS2 GS2 30 302. 2.2 22 2 3. 3.54 54 2 29 9.17 .17 0.0.5050 1. 1.2323 0.0.2424 GS2 GS2 GS2 GS2 30 30 30 2. 2. 30 2 2. 22 2. 2 2 2 22 3. 3.54 3. 54 3. 54 54 2 29 9 2 .17 .17 2 99 .17 .17 0.0.500.500.50 1. 1. 50 1. 1.232323 23 0.0.240.240.24 24 GS1 80.05 8.25 12.12 0.43 0.36 0.47 Ca1 Ca10g1 0g1171 1710 0 Ca1 Ca1 Ca1 Ca1 0g1 0g1 0g1 0g1 171 171 171 171 0 0 0 0 Breaker Breaker 17177.7.3366 0. 0.4646 1. 1.74 74 0.0.3232 0. 0.8585 0.0.4848 Breaker Breaker Breaker Breaker 1717177.7.1737.367.63 0. 0. 366 0. 0.464646 46 1. 1.74 1. 74 1. 74 74 0.0.320.320.32 0. 0. 32 0. 0.858585 85 0.0.480.480.48 48 GS2 302.22 3.54 29.17 0.50 1.23 0.24 Ca10g11710 Br Ripe Ripe eaker 1717 177.361.1.3322 0. 0. 0.463636 0.0. 1.742929 0. 0. 0.323636 0.850.0.6767 0.480.0.4242 Ripe Ripe Ripe Ripe 1717171.1.1731.321.23 0. 0. 322 0. 0.363636 36 0.0.290.290.29 0. 0. 29 0. 0.363636 36 0.0.670.670.67 67 0.0.420.420.42 42 Ripe 171.32 0.36 0.29 0.36 0.67 0.42 Crude sample Crude sample Crude sample Crude sample Crude sample Crude sample Crude sample GS1 GS1 GS1 GS1 🠖 Ri🠖🠖🠖 pe Ri Ri Ripe pe pe GS1 GS1🠖 🠖 Ri Ri pe pe GS1!Ripe extracts’ colour extra extra extra extra extra ccts’ col ts’ col cc c ts’ col ts’ col ts’ col o our ur oo o ur ur ur extracts’ colour Note: Purple coloured cells indicate anthocyanin build-up in the berries. Note: Note: Note: Note: Note: Pu Pu Pu Pu Pu rple rple rple rple rple coc lou c c o co o o lou lou lou lou red ce red ce r r red ce ed ce ed ce lls in llll ll ll s in s in s in s in dicate dicate dicate dicate dicate anthocy anthocy anthocy anthocy anthocy anin bu aa a a nin bu nin bu nin bu nin bu ild-u ild-u ild-u ild-u ild-u p ip i n p i p i p i the berries nn n n the berries the berries the berries the berries . . ... Note: Purple coloured cells indicate anthocyanin build-up in the berries. 4. Conclusions Aft Afte er comp r compar aring t ing th he e expre expression ssion leve level l of of t th he e three R three R2 2R3 R3-MYB -MYB tra tran nscri scripti ptio on f n fa actors, i ctors, it t Aft Aft Aft Aft e er comp r comp ee r comp r comp ar arar ing t ing t ar ing t ing t h he e h expre expre h ee expre expre ssion ssion ssion ssion leve leve leve leve l l of of l l of tof th h t e e h th three R e three R e three R three R 2 2R3 R3 22 R3 -MYB R3 -MYB -MYB -MYB tra tra tra n tra nscri scri nn scri scri pti pti pti o pti on f n f oo n f a n f actors, i ctors, i aa ctors, i ctors, i tt t t can be can be can be Taken se se se together en t en t en th h hat the at the at the , signiﬁcant so-c so-c so-called alled alled changes MYB MYB MYBa a a ( ( (Ca1 Ca1 Ca1 both 0g1 0g1 0g1 in 165 165 165 between 0 0 0) ) ) a a an n nd the two other put d the two other put d the two other put the genotypes and a a ati ti ti in ve ve ve between regula regula regulatory tory tory can be can be can be se se se en t en t en t h hat the at the hat the so-c so-c so-c alled alled alled MYB MYB MYB a a (a (Ca1 Ca1 (Ca1 0g1 0g1 0g1 165 165 165 0 0)) 0 a a )n n ad the two other put d the two other put nd the two other put a ati ti ave ve tive regula regula regula tory tory tory the different phenophases were observed in the case of enzymatic and non-enzymatic MYBs ( MYBs ( MYBs ( MYBs ( Ca1 Ca1 Ca1 Ca1 0g1 0g1 0g1 0g1 169 169 169 169 0 and 0 0 0 and and and Ca1 Ca1 Ca1 Ca1 0g1 0g1 0g1 0g1 171 171 171 171 0) we 0 0 0) ) ) we we we re expre re expre re expre re expre ssesse sse sse d at d d d h at at at igh h h hi i i leve gh gh gh leve leve leve ls in t ls ls ls in t in t in t he l h h h ie e e la l l lc i i il - l la a a berried c c c- - -berried berried berried gen gen gen gen - - - - MYBs ( MYBs ( Ca1 Ca1 0g1 0g1 169 169 0 and 0 and Ca1 Ca1 0g1 0g1 171 171 0)0 we ) we re expre re expre sse sse d d atat h h igh igh leve leve lsls in t in t he h l ei l la ilc a -c berried -berried gen gen - - antioxidants. ‘Pim. Ney.’, the extreme purple genotype, exhibited outstanding results for otypes, otypes, otypes, otypes, otypes, ana d t a a a nn n n d t h d t d t d t ei hh h h r tra ei ei ei ei r tra r tra r tra r tra nscri nn n n scri scri scri scri ptp lp p p e t l t t t vel l l l ee e e vel vel vel vel decreased decreased decreased decreased decreased ini genotypes n i i in n n genotypes genotypes genotypes genotypes 1126 11 1 1 126 126 126 126 3, 112 3, 112 3, 112 3, 112 3, 112 70 a 70 a 70 a 70 a 70 a nd nn n n 11 d d d d 11 274 11 11 11 274 274 274 274 as a ri a a a ss s s ri pen- ri ri ri pen- pen- pen- pen- otypes, and their transcript level decreased in genotypes 11263, 11270 and 11274 as ripen- TPC, TFC and FRAP in each phenophase compared to the rest of the samples. This might be ing advanced and the berries started to turn into their ripe colour. The extreme lilac gen- ing ing ing ing ing adv adv adv adv adv a anced nced aa a nced nced nced an an an an an d d t t d h d d h t e b t t e b hh h e b e b e b e err rr ee e irr ie rr rr es is e i ist e e s st s s art st art st st art e art art ed d e t e e t d o d d o t t t t t o u o o u trn t t rn uu u rn i rn rn in ni to thei to thei n i in n to thei to thei to thei r ri r ri r ri r ri r ri pe col pe col pe col pe col pe col o our. ur. oo o ur. ur. ur. The extreme li The extreme li The extreme li The extreme li The extreme li la lac gen- la c gen- la la c gen- c gen- c gen- due to the elevated amount of anthocyanins, which results in this rich dietary composition. otype, otype, ‘P ‘Pim. Ney.’, im. Ney.’, show showe ed d the the h hi ighe ghes st log t log2 2 fold fold ch change in every ange in every phenophase. This phenophase. This m mi ight ght otype, otype, otype, otype, ‘P ‘P‘P im. Ney.’, im. Ney.’, ‘P im. Ney.’, im. Ney.’, show show show show e ed d e e the d the d the the h hiih ghe ghe h ighe ighe sst log t log ss t log t log 2 2 fold fold 22 fold fold ch ch ch ange in every ange in every ch ange in every ange in every phenophase. This phenophase. This phenophase. This phenophase. This m mm iight m ght ight ight On the other hand, the anthocyanin-pigmented C. annuum breeding lines did not live up suggest tha suggest tha suggest that t t besi besi besides MY des MY des MYBa Ba Ba, these two other R2 , these two other R2 , these two other R2R3 R3 R3-M -M -MY Y YB B Bs, or s, or s, or a com a com a comb b binat inat ination ion ion of of of t t th h hem em em, re , re , regu- gu- gu- suggest tha suggest tha suggest tha tt besi besi t besi des MY des MY des MY Ba Ba Ba , these two other R2 , these two other R2 , these two other R2 R3 R3 R3 -M -M -M Y YB Y Bs, or s, or Bs, or a com a com a com b binat inat binat ion ion ion of of of t th h t em em hem , re , re , re gu- gu- gu- to the expectations, since the white-berried breeding lines usually scored higher values late the l l la a ate the te the te the anthocya a a an n nthocya thocya thocya nin synthesi ni ni nin synthesi n synthesi n synthesi s in s i s i s i the berri n n n the berri the berri the berri es of e e es of s of s of Cap Cap Cap Cap sicums s s sicums icums icums (Tab (Tab (Tab (Tab le 6) l l le e e. 6) 6) 6) ... lalte the ate the an athocya nthocya nini n synthesi n synthesi s i s i n the berri n the berri es of es of Cap Cap sicums sicums (Tab (Tab lel 6) e 6) . . for TPC, TFC and FRAP in the early phenophases. Based on this study, economically- ripe purple-berried breeding lines could not serve as functional food solely due to their anthocyanin build-up; however, other genotypes, such as the extreme purple ‘Pim. Ney.’, may be recommended as a dietary supplement or a partner in breeding programs for functional foods. As for the regulation of anthocyanin biosynthesis, we found that besides Ca10g11650, two other putative regulatory MBYs (Ca10g11690 and Ca10g11710) are also involved in the regulation of the pathway. However, to validate the exact function of the two putative regulatory MYBs, other approaches such as virus-induced gene silencing studies should be applied as well. Author Contributions: Writing—original draft preparation, Z.K.; conceptualization, reviewing, A.S. and É.B.-S.; methodology, É.B.-S. and A.V.; validation, G.C., A.S., A.V. and É.B.-S.; formal analysis, B.P., A.K.T.-L. and J.B.; funding acquisition, E.K. All authors have read and agreed to the published version of the manuscript. Funding: The publication is supported by the EFOP-3.6.3-VEKOP-16-2017-00008 project. The project is co-ﬁnanced by the European Union and the European Social Fund. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: Data contained in the article are original. Acknowledgments: The authors would like to thank lab tech Réka Rédei for her time and assistance in the experiment. Our deepest gratitude goes to Dávid Polgári and Ákos Tarnawa and to the dear colleagues of the Group of Microbial Biotechnology and Microbiomics, Katalin Posta, Ákos Juhász, Zoltán Mayer, Viktor Szentpéteri and Beatrix Rétháti, for their time, knowledge and materials that we received to carry out the research. Conﬂicts of Interest: The authors declare no conﬂict of interest. Antioxidants 2022, 11, 637 13 of 14 References 1. Lang, Y.Q.; Yanagawa, S.; Sasanuma, T.; Sasakuma, T. Orange fruit color in Capsicum due to deletion of capsanthin-capsorubin synthesis gene. Breed. Sci. 2004, 54, 33–39. [CrossRef] 2. Paran, I.; Fallik, E. Breeding for fruit quality in pepper (Capsicum spp.). In Breeding for Fruit Quality; Wiley: Hoboken, NJ, USA, 2011; pp. 307–322. 3. Wadhera, D.; Capaldi-Phillips, E.D. A Review of Visual Cues Associated with Food on Food Acceptance and Consumption. Eat. Behav. 2014, 15, 132–143. [CrossRef] [PubMed] 4. Aza-Gonzalez, C.; Herrera-Isidrón, L.; Núñez-Palenius, H.G.; De La Vega, O.; Ochoa-Alejo, N. Anthocyanin accumulation and expression analysis of biosynthesis-related genes during Chili pepper fruit development. Biol. Plant. 2013, 57, 49–55. [CrossRef] 5. Lightbourn, G.J.; Griesbach, R.J.; Novotny, J.A.; Clevidence, B.A.; Rao, D.D.; Stommel, J.R. Effects of anthocyanin and carotenoid combinations on foliage and immature fruit color of Capsicum annuum L. J. Hered. 2008, 99, 105–111. [CrossRef] [PubMed] 6. Stommel, J.R.; Griesbach, R.J. Inheritance of fruit, foliar, and plant habit attributes in Capsicum. J. Am. Soc. Hortic. Sci. 2008, 133, 396–407. [CrossRef] 7. Li, Z.; Wang, S.; Gui, X.-L.; Chang, X.-B.; Gong, Z.-H. A further analysis of the relationship between yellow ripe-fruit color and the capsanthin-capsorubin synthase gene in pepper (Capsicum sp.) indicated a new mutant variant in C. annuum and a tandem repeat structure in promoter region. PLoS ONE 2013, 8, e61996. [CrossRef] 8. Ha, S.H.; Kim, J.B.; Park, J.S.; Lee, S.W.; Cho, K.J. A comparison of the carotenoid accumulation in Capsicum varieties that show different ripening colours: Deletion of the capsanthin-capsorubin synthase gene is not a prerequisite for the formation of a yellow pepper. J. Exp. Bot. 2007, 58, 3135–3144. [CrossRef] 9. Matsufuji, H.; Nakamura, H.; Chino, M.; Takedas, M. Antioxidant activity of capsanthin and the fatty acid esters in paprika (Capsicum annuum). J. Agric. Food Chem. 1998, 46, 3468–3472. [CrossRef] 10. Kilcrease, J.; Collins, A.M.; Richins, R.D.; Timlin, J.A.; O’connell, M.A. Multiple microscopic approaches demonstrate linkage between chromoplast architecture and carotenoid composition in diverse Capsicum annuum fruit. Plant J. 2013, 76, 1074–1083. [CrossRef] 11. Kilcrease, J.; Rodriguez-Uribe, L.; Richins, R.D.; Arcos, J.M.; Victorino, J.; O’Connell, M.A. Correlations of carotenoid content and transcript abundances for ﬁbrillin and carotenogenic enzymes in Capsicum annuum fruit pericarp. Plant Sci. 2015, 232, 57–66. [CrossRef] 12. Panche, A.N.; Diwan, A.D.; Chandra, S.R. Flavonoids: An overview. J. Nutr. Sci. 2016, 5. [CrossRef] [PubMed] 13. Anaya-Esparza, L.M.; Mora, Z.V.; Vázquez-Paulino, O.; Ascencio, F.; Villarruel-López, A. Bell Peppers (Capsicum annuum L.) Losses and Wastes: Source for Food and Pharmaceutical Applications. Molecules 2021, 26, 5341. [CrossRef] [PubMed] 14. Pietta, P.G. Flavonoids as antioxidants. J. Nat. Prod. 2000, 63, 1035–1042. [CrossRef] [PubMed] 15. Agati, G.; Azzarello, E.; Pollastri, S.; Tattini, M. Flavonoids as antioxidants in plants: Location and functional signiﬁcance. Plant Sci. 2012, 196, 67–76. [CrossRef] 16. Holton, T.A.; Cornish, E.C. Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 1995, 7, 1071. [CrossRef] 17. Ohno, S.; Ueno, M.; Doi, M. Differences in the CaMYBA genome between anthocyanin-pigmented cultivars and non-pigmented cultivars in pepper (Capsicum annuum). Hortic. J. 2020, 89, 30–36. [CrossRef] 18. Borovsky, Y.; Oren-Shamir, M.; Ovadia, R.; De Jong, W.; Paran, I. The A locus that controls anthocyanin accumulation in pepper encodes a MYB transcription factor homologous to Anthocyanin2 of Petunia. Theor. Appl. Genet. 2004, 109, 23–29. [CrossRef] 19. Sun, T.; Xu, Z.; Wu, C.T.; Janes, M.; Prinyawiwatkul, W.; No, H.K. Antioxidant activities of different colored sweet bell peppers (Capsicum annuum L.). J. Food Sci. 2007, 72, 98–102. [CrossRef] 20. Lee, J.; Durst, R.W.; Wrolstad, R.E. Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: Collaborative study. J. AOAC Int. 2005, 88, 1269–1278. [CrossRef] 21. Singleton, V.L.; Rossi, J.A. Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. Am. J. Enol. Vitic. 1965, 16, 144–158. 22. Benzie, I.F.; Strain, J.J. The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: The FRAP assay. Anal. Biochem. 1996, 239, 70–76. [CrossRef] [PubMed] 23. Sytar, O.; Bosko, ´ P.; Živc ˇák, M.; Brestic, M.; Smetanska, I. Bioactive phytochemicals and antioxidant properties of the grains and sprouts of colored wheat genotypes. Molecules 2018, 23, 2282. [CrossRef] 24. Hornero-Méndez, D.; Mínguez-Mosquera, M.I. Rapid spectrophotometric determination of red and yellow isochromic carotenoid fractions in paprika and red pepper oleoresins. J. Agric. Food Chem. 2001, 49, 3584–3588. [CrossRef] [PubMed] 25. Xing, Y.; Li, X.; Xu, Q.; Yun, J.; Lu, Y.; Tang, Y. Effects of chitosan coating enriched with cinnamon oil on qualitative properties of sweet pepper (Capsicum annuum L.). Food Chem. 2011, 124, 1443–1450. [CrossRef] 26. Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 1971, 44, 276–287. [CrossRef] 27. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [CrossRef] 28. Láng, F. Növényélettan, a Növényi Anyagcsere II; ELTE Eötvös Kiadó: Budapest, Hungary, 2007. 29. Deepa, N.; Kaur, C.; George, B.; Singh, B.; Kapoor, H.C. Antioxidant constituents in some sweet pepper (Capsicum annuum L.) genotypes during maturity. LWT-Food Sci. Technol. 2007, 40, 121–129. [CrossRef] Antioxidants 2022, 11, 637 14 of 14 30. Aza-González, C.; Ochoa-Alejo, N. Characterization of anthocyanins from fruits of two Mexican chili peppers (Capsicum annuum L.). J. Mex. Chem. Soc. 2012, 56, 149–151. [CrossRef] 31. Sadilova, E.; Stintzing, F.C.; Carle, R. Anthocyanins, colour and antioxidant properties of eggplant (Solanum melongena L.) and violet pepper (Capsicum annuum L.) peel extracts. Zeitschrift Naturforschung C 2006, 61, 527–535. [CrossRef] [PubMed] 32. Bogusz, S., Jr.; Libardi, S.H.; Dias, F.F.; Coutinho, J.P.; Bochi, V.C.; Rodrigues, D.; Melo, A.M.; Godoy, H.T. Brazilian Capsicum peppers: Capsaicinoid content and antioxidant activity. J. Sci. Food Agric. 2018, 98, 217–224. [CrossRef] [PubMed] 33. Castro-Concha, L.A.; Tuyub-Che, J.; Moo-Mukul, A.; Vazquez-Flota, F.A.; Miranda-Ham, M.L. Antioxidant capacity and total phenolic content in fruit tissues from accessions of Capsicum Chinense Jacq.(Habanero pepper) at different stages of ripening. Sci. World J. 2014. [CrossRef] [PubMed] 34. Marín, A.; Ferreres, F.; Tomás-Barberán, F.A.; Gil, M.I. Characterization and quantitation of antioxidant constituents of sweet pepper (Capsicum annuum L.). J. Agric. Food Chem. 2004, 52, 3861–3869. [CrossRef] [PubMed] 35. Navarro, J.M.; Flores, P.; Garrido, C.; Martinez, V. Changes in the contents of antioxidant compounds in pepper fruits at different ripening stages, as affected by salinity. Food Chem. 2006, 96, 66–73. [CrossRef] 36. Ghasemnezhad, M.; Sherafati, M.; Payvast, G.A. Variation in phenolic compounds, ascorbic acid and antioxidant activity of ﬁve coloured bell pepper (Capsicum annuum) fruits at two different harvest times. J. Funct. Foods 2011, 3, 44–49. [CrossRef] 37. Chandel, C.; Sharma, V.K.; Rana, P.S.; Dabral, M.; Aggrawal, S.; Saklani, P. Assessment of antimicrobial and antioxidant potential of cytoplasmic male sterile lines of pepper. SN Appl. Sci. 2020, 2, 1181. [CrossRef] 38. Howard, L.R.; Talcott, S.T.; Brenes, C.H.; Villalon, B. Changes in phytochemical and antioxidant activity of selected pepper cultivars (Capsicum species) as inﬂuenced by maturity. J. Agric. Food Chem. 2000, 48, 1713–1720. [CrossRef] 39. Sim, K.H.; Sil, H.Y. Antioxidant activities of red pepper (Capsicum annuum) pericarp and seed extracts. Int. J. Food Sci. Technol. 2008, 43, 1813–1823. [CrossRef] 40. Sora, G.T.; Haminiuk, C.W.; da Silva, M.V.; Zielinski, A.A.; Gonçalves, G.A.; Bracht, A.; Peralta, R.M. A comparative study of the capsaicinoid and phenolic contents and in vitro antioxidant activities of the peppers of the genus Capsicum: An application of chemometrics. J. Food Sci. Technol. 2015, 52, 8086–8094. [CrossRef] 41. Rosa, A.; Deiana, M.; Casu, V.; Paccagnini, S.; Appendino, G.; Ballero, M.; Dessí, M.A. Antioxidant activity of capsinoids. J. Agric. Food Chem. 2002, 50, 7396–7401. [CrossRef] 42. Blanco-Ríos, A.K.; Medina-Juárez, L.Á.; González-Aguilar, G.A.; Gámez-Meza, N. Antioxidant activity of the phenolic and oily fractions of different sweet bell peppers. J. Mex. Chem. Soc. 2013, 57, 137–143. [CrossRef] 43. Garra, A.; Alkalai-Tuvia, S.; Telerman, A.; Paran, I.; Fallik, E.; Elmann, A. Anti-proliferative activities, phytochemical levels and fruit quality of pepper (Capsicum spp.) following prolonged storage. Int. J. Food Sci. Technol. 2020, 55, 3574–3584. [CrossRef] 44. Palma, J.M.; Terán, F.; Contreras-Ruiz, A.; Rodríguez-Ruiz, M.; Corpas, F.J. Antioxidant proﬁle of pepper (Capsicum annuum L.) fruits containing diverse levels of capsaicinoids. Antioxidants 2020, 9, 878. [CrossRef] [PubMed] 45. Guilherme, R.; Aires, A.; Rodrigues, N.; Peres, A.M.; Pereira, J.A. Phenolics and Antioxidant Activity of Green and Red Sweet Peppers from Organic and Conventional Agriculture: A Comparative Study. Agriculture 2020, 10, 652. [CrossRef] 46. Stommel, J.R.; Lightbourn, G.J.; Winkel, B.S.; Griesbach, R.J. Transcription factor families regulate the anthocyanin biosynthetic pathway in Capsicum annuum. J. Am. Soc. Hortic. Sci. 2009, 134, 244–251. [CrossRef] 47. Aguilar-Barragán, A.; Ochoa-Alejo, N. Virus-induced silencing of MYB and WD40 transcription factor genes affects the accumula- tion of anthocyanins in Chili pepper fruit. Biol. Plant 2014, 58, 567–574. [CrossRef] 48. Zhang, Z.; Li, D.W.; Jin, J.H.; Yin, Y.X.; Zhang, H.X.; Chai, W.G.; Gong, Z.H. VIGS approach reveals the modulation of anthocyanin biosynthetic genes by CaMYB in Chili pepper leaves. Front. Plant Sci. 2015, 6, 500. [CrossRef] http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Antioxidants Multidisciplinary Digital Publishing Institute http://www.deepdyve.com/lp/multidisciplinary-digital-publishing-institute/ripening-induced-changes-in-the-nutraceutical-compounds-of-differently-0IEACCV10v

Loading next page...

References (51)

César Aza-González, N. Ochoa-Alejo (2017)
Characterization of Anthocyanins from Fruits of Two Mexican Chili Peppers (Capsicum annuum L.)
Revista de la Sociedad Química de Mexico, 56
César Aza-González, L. Herrera-Isidron, Héctor Núñez-Palenius, O. Vega, N. Ochoa-Alejo (2013)
Anthocyanin accumulation and expression analysis of biosynthesis-related genes during chili pepper fruit development
Biologia Plantarum, 57
Yelena Borovsky, M. Oren-Shamir, Rinat Ovadia, W. Jong, I. Paran (2004)
The A locus that controls anthocyanin accumulation in pepper encodes a MYB transcription factor homologous to Anthocyanin2 of Petunia
Theoretical and Applied Genetics, 109
Zhen Zhang, Da-wei Li, Jing-Hao Jin, Yanxu Yin, Huai-Xia Zhang, W. Chai, Z. Gong (2015)
VIGS approach reveals the modulation of anthocyanin biosynthetic genes by CaMYB in chili pepper leaves
Frontiers in Plant Science, 6
J. Kilcrease, A. Collins, R. Richins, J. Timlin, M. O’Connell (2013)
Multiple microscopic approaches demonstrate linkage between chromoplast architecture and carotenoid composition in diverse Capsicum annuum fruit.
The Plant journal : for cell and molecular biology, 76 6
G. Lightbourn, R. Griesbach, J. Novotny, B. Clevidence, David Rao, J. Stommel (2008)
Effects of anthocyanin and carotenoid combinations on foliage and immature fruit color of Capsicum annuum L.
The Journal of heredity, 99 2
J. Navarro, P. Flores, C. Garrido, V. Martínez (2006)
Changes in the contents of antioxidant compounds in pepper fruits at different ripening stages, as affected by salinity
Food Chemistry, 96
D. Hornero‐Méndez, M. Mínguez-Mosquera (2001)
Rapid spectrophotometric determination of red and yellow isochromic carotenoid fractions in paprika and red pepper oleoresins.
Journal of agricultural and food chemistry, 49 8
P. Pietta (2000)
Flavonoids as antioxidants.
Journal of natural products, 63 7
T. Holton, E. Cornish (1995)
Genetics and Biochemistry of Anthocyanin Biosynthesis.
The Plant cell, 7
I. Paran, E. Fallik (2011)
Breeding for Fruit Quality in Pepper (Capsicum spp.)
G. Agati, E. Azzarello, S. Pollastri, M. Tattini (2012)
Flavonoids as antioxidants in plants: location and functional significance.
Plant science : an international journal of experimental plant biology, 196
S. Bogusz, S. Libardi, F. Dias, J. Coutinho, V. Bochi, D. Rodrigues, A. Melo, H. Godoy (2018)
Brazilian Capsicum peppers: capsaicinoid content and antioxidant activity.
Journal of the science of food and agriculture, 98 1
(2007)

Növényélettan, a Növényi Anyagcsere II
A. Rosa, M. Deiana, V. Casu, S. Paccagnini, G. Appendino, M. Ballero, M. Dessì (2002)
Antioxidant activity of capsinoids.
Journal of agricultural and food chemistry, 50 25
(2021)
Villarruel-López, A. Bell Peppers (Capsicum annuum L.) Losses and Wastes: Source for Food and Pharmaceutical Applications
A. Garra, S. Alkalai-Tuvia, A. Telerman, I. Paran, E. Fallik, Anat Elmann (2020)
Anti‐proliferative activities, phytochemical levels and fruit quality of pepper ( Capsicum spp.) following prolonged storage
International Journal of Food Science & Technology
M. Ghasemnezhad, M. Sherafati, G. Payvast (2011)
Variation in phenolic compounds, ascorbic acid and antioxidant activity of five coloured bell pepper (Capsicum annum) fruits at two different harvest times
Journal of Functional Foods, 3
Ya-Qin Lang, S. Yanagawa, T. Sasanuma, T. Sasakuma (2004)
Orange fruit color in Capsicum due to deletion of capsanthin-capsorubin synthesis gene
Breeding Science, 54
A. Marín, F. Ferreres, F. Tomás-Barberán, M. Gil (2004)
Characterization and quantitation of antioxidant constituents of sweet pepper (Capsicum annuum L.).
Journal of agricultural and food chemistry, 52 12
O. Sytar, P. Bośko, Marek Živčák, M. Brestič, I. Smetanska (2018)
Bioactive Phytochemicals and Antioxidant Properties of the Grains and Sprouts of Colored Wheat Genotypes
Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry, 23
A. Aguilar-Barragan, N. Ochoa-Alejo (2014)
Virus-induced silencing of MYB and WD40 transcription factor genes affects the accumulation of anthocyanins in chilli pepper fruit
Biologia Plantarum, 58
S. Ohno, M. Ueno, M. Doi (2020)
Differences in the CaMYBA Genome Between Anthocyanin-pigmented Cultivars and Non-pigmented Cultivars in Pepper (Capsicum annuum)
The Horticulture Journal
L. Anaya-Esparza, Zuamí Mora, O. Vázquez-Paulino, F. Ascencio, A. Villarruel-López (2021)
Bell Peppers (Capsicum annum L.) Losses and Wastes: Source for Food and Pharmaceutical Applications
Molecules, 26
(2020)
Anti-proliferative activities, phytochemical levels and fruit quality of pepper (Capsicum spp.) following prolonged storage
Int. J. Food Sci. Technol., 55
J. Palma, F. Terán, Alba Contreras-Ruíz, Marta Rodríguez-Ruiz, F. Corpas (2020)
Antioxidant Profile of Pepper (Capsicum annuum L.) Fruits Containing Diverse Levels of Capsaicinoids
Antioxidants, 9
C. Beauchamp, I. Fridovich (1971)
Superoxide dismutase: improved assays and an assay applicable to acrylamide gels.
Analytical biochemistry, 44 1
G. Sora, C. Haminiuk, Marcos Silva, A. Zielinski, G. Gonçalves, A. Bracht, R. Peralta (2015)
A comparative study of the capsaicinoid and phenolic contents and in vitro antioxidant activities of the peppers of the genus Capsicum: an application of chemometrics
Journal of Food Science and Technology, 52
J. Stommel, G. Lightbourn, B. Winkel, R. Griesbach (2009)
Transcription Factor Families Regulate the Anthocyanin Biosynthetic Pathway in Capsicum annuum
Journal of the American Society for Horticultural Science, 134
Zheng Li, Shu Wang, Xiao-Ling Gui, Xiao-Bei Chang, Z. Gong (2013)
A Further Analysis of the Relationship between Yellow Ripe-Fruit Color and the Capsanthin-Capsorubin Synthase Gene in Pepper (Capsicum sp.) Indicated a New Mutant Variant in C. annuum and a Tandem Repeat Structure in Promoter Region
PLoS ONE, 8
Ana Blanco-Rios, L. Medina-Juárez, G. González-Aguilar, N. Gámez-Meza (2017)
Antioxidant Activity of the Phenolic and Oily Fractions of Different Sweet Bell Peppers
Revista de la Sociedad Química de Mexico, 57
A. Panche, A. Diwan, Sheela Chandra (2016)
Flavonoids: an overview
Journal of Nutritional Science, 5
J. Kilcrease, L. Rodríguez-Uribe, R. Richins, J. Arcos, Jesús Victorino, M. O’Connell (2015)
Correlations of carotenoid content and transcript abundances for fibrillin and carotenogenic enzymes in Capsicum annum fruit pericarp.
Plant science : an international journal of experimental plant biology, 232
E. Sadilova, F. Stintzing, R. Carle (2006)
Anthocyanins, Colour and Antioxidant Properties of Eggplant (Solanum melongena L.) and Violet Pepper (Capsicum annuum L.) Peel Extracts
Zeitschrift für Naturforschung C, 61
R. Guilherme, A. Aires, Nuno Rodrigues, A. Peres, J. Pereira (2020)
Phenolics and Antioxidant Activity of Green and Red Sweet Peppers from Organic and Conventional Agriculture: A Comparative Study
Agriculture
N. Deepa, C. Kaur, Binoy George, Balraj Singh, H. Kapoor (2007)
Antioxidant constituents in some sweet pepper (Capsicum annuum L.) genotypes during maturity
Lwt - Food Science and Technology, 40
S. Ha, Jung-Bong Kim, Jong-Sug Park, Shin-Woo Lee, Kangjin Cho (2007)
A comparison of the carotenoid accumulation in Capsicum varieties that show different ripening colours: deletion of the capsanthin-capsorubin synthase gene is not a prerequisite for the formation of a yellow pepper.
Journal of experimental botany, 58 12
L. Howard, S. Talcott, C. Brenes, B. Villalón (2000)
Changes in phytochemical and antioxidant activity of selected pepper cultivars (Capsicum species) as influenced by maturity.
Journal of agricultural and food chemistry, 48 5
I. Benzie, J. Strain (1996)
The ferric reducing ability of plasma (FRAP) as a measure of "antioxidant power": the FRAP assay.
Analytical biochemistry, 239 1
Y. Xing, Xihong Li, Q. Xu, J. Yun, Yaqing Lu, Yao Tang (2011)
Effects of chitosan coating enriched with cinnamon oil on qualitative properties of sweet pepper (Capsicum annuum L.)
Food Chemistry, 124
K. Sim, Han Sil (2008)
Antioxidant activities of red pepper (Capsicum annuum) pericarp and seed extracts
International Journal of Food Science and Technology, 43
Chengjie Chen, Hao Chen, Yi Zhang, Hannah Thomas, Margaret Frank, Yehua He, Rui Xia (2020)
TBtools - an integrative toolkit developed for interactive analyses of big biological data.
Molecular plant
V. Singleton, J. Rossi (1965)
Colorimetry of Total Phenolics with Phosphomolybdic-Phosphotungstic Acid Reagents
American Journal of Enology and Viticulture
L. Castro-Concha, Jemina Tuyub-Che, Angel Moo-Mukul, F. Vázquez-Flota, M. Miranda-Ham (2014)
Antioxidant Capacity and Total Phenolic Content in Fruit Tissues from Accessions of Capsicum chinense Jacq. (Habanero Pepper) at Different Stages of Ripening
The Scientific World Journal, 2014
H. Matsufuji, H. Nakamura, M. Chino, M. Takeda (1998)
Antioxidant Activity of Capsanthin and the Fatty Acid Esters in Paprika (Capsicum annuum)
Journal of Agricultural and Food Chemistry, 46
(2007)
Növényélettan, a Növényi
Devina Wadhera, Elizabeth Capaldi-Phillips (2014)
A review of visual cues associated with food on food acceptance and consumption.
Eating behaviors, 15 1
C. Chandel, V. Sharma, Pawan Rana, Manish Dabral, Shreya Aggrawal, Pooja Saklani (2020)
Assessment of antimicrobial and antioxidant potential of cytoplasmic male sterile lines of pepper
SN Applied Sciences, 2
J. Stommel, R. Griesbach (2008)
Inheritance of Fruit, Foliar, and Plant Habit Attributes in Capsicum
Journal of the American Society for Horticultural Science, 133
Jungmin Lee, R. Durst, R. Wrolstad (2005)
Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: collaborative study.
Journal of AOAC International, 88 5
T. Sun, Zhimin Xu, Ct Wu, M. Janes, W. Prinyawiwatkul, H. No (2007)
Antioxidant activities of different colored sweet bell peppers (Capsicum annuum L.).
Journal of food science, 72 2

Publisher: Multidisciplinary Digital Publishing Institute
Copyright: © 1996-2022 MDPI (Basel, Switzerland) unless otherwise stated Disclaimer The statements, opinions and data contained in the journals are solely those of the individual authors and contributors and not of the publisher and the editor(s). MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Terms and Conditions Privacy Policy
ISSN: 2076-3921
DOI: 10.3390/antiox11040637
Publisher site: See Article on Publisher Site

Abstract

antioxidants Article Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines 1 , 1 1 1 2 1 Zsóﬁa Kovács * , Janka Bedo ˝ , Bánk Pápai , Andrea Kitti Tóth-Lencsés , Gábor Csilléry , Antal Szoke ˝ , 3 1 1 Éva Bányai-Stefanovits , Erzsébet Kiss and Anikó Veres Institute of Genetics and Biotechnology, Hungarian University of Agriculture and Life Sciences, 2100 Gödöllo, ˝ Hungary; [email protected] (J.B.); [email protected] (B.P.); [email protected] (A.K.T.-L.); [email protected] (A.S.); [email protected] (E.K.); [email protected] (A.V.) PepGen Kft., 1114 Budapest, Hungary; [email protected] Institute of Food Science and Technology, Hungarian University of Agricultural Sciences, 1118 Budapest, Hungary; [email protected] * Correspondence: kovacs.zsoﬁ[email protected] Abstract: To date, several research studies addressed the topic of phytochemical analysis of the different coloured pepper berries during ripening, but none discussed it in the case of purple peppers. In this study we examine whether the anthocyanin accumulation of the berries in the early stages of ripening could result in a higher antioxidant capacity due to the elevated amount of polyphenolic compounds. Therefore, enzymatic and non-enzymatic antioxidant capacity was measured in four distinct phenophases of fruit maturity. Furthermore, the expression of structural and regulatory Citation: Kovács, Z.; Bedo, ˝ J.; Pápai, genes of the anthocyanin biosynthetic pathway was also investigated. An overall decreasing trend B.; Tóth-Lencsés, A.K.; Csilléry, G.; was observed in the polyphenolic and ﬂavonoid content and antioxidant capacity of the samples Szoke, ˝ A.; Bányai-Stefanovits, É.; towards biological ripeness. Signiﬁcant changes both in between the genotypes and in between the Kiss, E.; Veres, A. Ripening-Induced Changes in the Nutraceutical phenophases were scored, with the genotype being the most affecting factor on the phytonutrients. Compounds of Differently Coloured An extreme purple pepper yielded outstanding results compared to the other genotypes, with its Pepper (Capsicum annuum L.) polyphenolic and ﬂavonoid content as well as its antioxidant capacity being the highest in every Breeding Lines. Antioxidants 2022, 11, phenophase studied. Based on our results, besides MYBa (Ca10g11650) two other putative MYBs 637. https://doi.org/10.3390/ participate in the regulation of the anthocyanin biosynthetic pathway. antiox11040637 Academic Editors: Andrei Mocan Keywords: Capsicum; pepper; anthocyanin; antioxidant; secondary metabolites; gene expression; and Simone Carradori R2R3-MYB Received: 24 February 2022 Accepted: 24 March 2022 Published: 26 March 2022 1. Introduction Publisher’s Note: MDPI stays neutral Pepper (Capsicum annuum L.) is one of the most consumed vegetable and spice crops. with regard to jurisdictional claims in Despite its numerous characteristics that determine the consumer acceptance of the fruit, it published maps and institutional afﬁl- is still highly sought after worldwide. While shape and pungency are also determining iations. factors, colour in particular ranks very high in the perceived palatability and perceived ﬂavour intensity of fruits/vegetables [1–3]. Colours of the immature pepper fruits vary from ivory to green, and newer varieties may even exhibit different shades of purple, whereas the colouration of mature fruits of cultivated peppers ranges from white through Copyright: © 2022 by the authors. yellow, orange and red to even a brownish hue. The main determinants of colour in pepper Licensee MDPI, Basel, Switzerland. fruit are the chlorophyll, carotenoid and anthocyanin pigments [4–7]. These pigments are This article is an open access article stored in different cell compartments; chlorophylls are located within the chloroplasts, distributed under the terms and carotenoids are stored in the chromoplasts, while anthocyanins and other ﬂavonoids are conditions of the Creative Commons accumulated in vacuoles in the cells’ cytoplasm. Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ Fruit colour is of upmost importance since pigments affecting the colouration further 4.0/). contribute to a wide variety of functions such as protection against various abiotic stresses, Antioxidants 2022, 11, 637. https://doi.org/10.3390/antiox11040637 https://www.mdpi.com/journal/antioxidants Antioxidants 2022, 11, 637 2 of 14 e.g., UV light, excess light, cold temperature, and pathogens. More importantly, they contribute to the ﬂavour and nutraceutical properties since most of these compounds exhibit antioxidant activity. Thus, these phytochemicals possess potential health beneﬁts for a human diet. For instance, carotenoids are involved in the scavenging of both peroxyl radicals and singlet oxygen species (O ) [8]. A carotenoid-rich diet could lower risk of several types of cancer and cardiovascular disease. Capsanthin—a red pigment which is synthesized exclusively in Capsicum spp.—proved to suppress hydroperoxide formation, and since they decompose slower than other carotenoids found in peppers, their radical scavenging activity lasts longer [9]. From nutraceutical aspects, various pepper fruits’ carotenoid accumulation is among the highest in plants [10]. A teaspoon of its powder provides the Recommended Dietary Allowance for vitamin A of an adult person after the conversion of the precursor carotenoids to vitamin A [11]. Flavonoids are a large class of compounds that are important antioxidants. Numerous studies indicate that a ﬂavonoid-rich diet reduces the risk of coronary heart disease, stroke and lung/breast cancer [12]. Their antioxidant properties are determined by both the chemical structure and by the redox properties; based on these, they can serve as O quenchers, hydrogen donors or reducing agents. Further, they are efﬁcient against lipid oxidation [13–15]. Health-conscious diets are on the rise, and currently there is an ever-growing interest towards ﬂavonoid/anthocyanin-rich functional foods, hence purple fruits and vegetables are commercially valued. The biosynthesis of ﬂavonoids, and subsequently anthocyanins, is regulated by the MYB transcription factors. The production of anthocyanins branches off from the ﬂavonoid pathway and they are synthesized via the early biosynthetic genes (EBGs), e.g., chalcone synthase (CHS), chalcone isomerase (CHI), ﬂavanone-3-hydroxylase (F3H), and the late biosynthetic genes (LBGs) such as dihydroﬂavonol reductase (DFR), an- 0 0 0 0 thocyanidin synthase (ANS), ﬂavonoid 3 5 -hydroxylase (F3 5 H), glutathion S-transferase (GST), and anthocyanidin 3-O-glucosyltransferase (UFGT) [16]. The regulation of the path- way is well studied, although there are still conﬂicting results which have yet to be clariﬁed. In general, it is agreed that a regulatory complex (MBW), taking up from MYB, bHLH and WD40 transcription factors, initiates the transcription of the LBGs. In the case of pepper, three MYB coding genes are located next to each other on the 10th chromosome. Out of these, so far only the so-called MYBa is said to participate in the biosynthesis [17,18]. Many studies examined the phytochemical composition of different pepper cultivars, but there are only a few which monitor the changes of these compounds upon matura- tion [19]. In this study, we take differently coloured breeding lines to determine how the colouration affects the nutraceutical properties of the peppers, as well as how the phytochemical composition changes during maturation. Furthermore, we investigate the regulatory mechanism of the anthocyanin biosynthesis with emphasis being put on the MYB transcription factors and their putative role. By this, we can rule out whether the anthocyanin build-up, hence the higher amount of polyphenols in the berries, could add to the overall antioxidant capacity of the pepper. This work could not only assist breeders to select for candidate accessions with great nutritional properties as partners in breeding programs but may also shed light on the basis of the transcriptional regulation of the anthocyanin biosynthesis. 2. Materials and Methods Mutant pepper breeding lines used for this study were provided by the PepGen Kft. (Budapest, Hungary). In addition, 5 anthocyanin mutant C. annuum peppers, a C. annuum ‘Soroksári’ cultivar—which does not synthetize anthocyanins—and an extreme purple C. chinense ‘Pimienta de Neyde’ (‘Pim. Ney.’) cultivar were applied (Table 1). Antioxidants 2022, 11, 637 3 of 16 Antioxidants 2022, 11, 637 3 of 16 Antioxidants 2022, 11, 637 3 of 16 Antioxidants 2022, 11, 637 3 of 16 Table 1. Codes, attributes and appearance of the breeding lines. Antioxidants 2022, 11, 637 3 of 16 Table 1. Codes, attributes and appearance of the breeding lines. Table 1. Codes, attributes and appearance of the breeding lines. Name/Code Description Appearance Table 1. Codes, attributes and appearance of the breeding lines. Antioxidants 2022, 11, 637 3 of 14 Name/Code Description Appearance Name/Cod Table 1. e Codes, attributes and appearance of Descr the breeding l iption ines. Appearance C. chinense, extreme purple throughout Name/Code Description Appearance ‘Pim. Ney.’ C. chinense, each phenop extreme purple hase throughout Table 1. Codes, attributes and appearance of the breeding lines. Name/Code Description ‘Pim. Ney.’ Appearance C. chinense, extreme purple throughout each phenophase ‘Pim. Ney.’ Name/Code C. chinense, Description extreme purple throughout Appearance each phenophase ‘Pim. Ney.’ each phenophase C. chinense, extreme purple throughout 11263 C. chinense matures f , extreme rom l purple ilac to red, throughout pax, Leb ‘Pim. Ney.’ ‘Pim. Ney.’ each phenophase each phenophase 11263 matures from lilac to red, pax, Leb 11263 matures from lilac to red, pax, Leb 11263 matures from lilac to red, pax, Leb 11263 matures from lilac to red, pax, Leb 11263 matures from lilac to red, pax, Leb 11270 matures from purple to yellow, pax+, Leb 11270 matures from purple to yellow, pax+, Leb 11270 matures from purple to yellow, pax+, Leb 11270 matures from purple to yellow, pax+, Leb 11270 matures from purple to yellow, pax+, Leb 11270 matures from purple to yellow, pax+, Leb 11274 matures from purple to red, pax+, Leb-s 11274 matures from purple to red, pax+, Leb-s 11274 matures from purple to red, pax+, Leb-s 11274 matures from purple to red, pax+, Leb-s 11274 matures from purple to red, pax+, Leb-s 11278 matures from white to red, pax 1 1127 1288 0 mama tures f tures f rom rom whi whi te to red, te to red, pax pax +, Leb + 11274 matures from purple to red, pax+, Leb-s 11278 matures from white to red, pax 11278 matures from white to red, pax 11280 matures from white to red, pax+, Leb+ 11280 matures from white to red, pax+, Leb+ 11278 matures from white to red, pax 11280 matures from white to red, pax+, Leb+ ‘Soroksári’ matures from white to red, asx ‘Soroksári’ matures from white to red, asx 11280 matures from white to red, pax+, Leb+ ‘Soroksári’ matures from white to red, asx 11278 matures from white to red, pax Note: pax, pax+—partially anthocyanin-less, Leb, Leb+, Leb-s—lilac economically ripe berry, -s: striped, asx— ‘Soroksári’ Note: pax, pax+—partially anthocyanin-less, matures from Leb, whi Leb+, te to red, Leb-s—lilac e asx conomically ripe berry, -s: 11280 matures from white to red, pax+, Leb+ anthocyanin-less ‘Soroksári’ type. ‘Soroksári’ striped, asx—anthocyanin-less ‘Soroksári’ matures f type. rom white to red, asx Note: pax, pax+—partially anthocyanin-less, Leb, Leb+, Leb-s—lilac economically ripe berry, -s: Note: pax, pax+—partially anthocyanin-less, Leb, Leb+, Leb-s—lilac economically ripe berry, -s: striped, asx—anthocyanin-less ‘Soroksári’ type. The plants were grown under greenhouse conditions. Ten fruits were gathered at 4 dis- ‘Soroksári’ matures from white to red, asx striped, Note: pa The plants w asx x, pa —ax+ nthocy —partially anthocyanin-less, ere grown anin-less ‘Sun oroksári’ der greenhouse cond type. Leb, Leb+, Leitb- ions s—lilac e . Ten cfru onom its w ically ere g ripe ath berry ered , at-s 4 : tinct phenophases of the ripening from each genotype. In addition to the two economically striped, asx—anthocyanin-less ‘Soroksári’ type. distinct phenophases of the ripening from each genotype. In addition to the two econom- The plants were grown under greenhouse conditions. Ten fruits were gathered at 4 ripe stages, green stage 1 (GS1)—20 days post anthesis (dpa), green stage 2 (GS2)—30 dpa, Note: pax, pax+—partially anthocyanin-less, Leb, Leb+, Leb-s—lilac economically ripe berry, -s: The plants were grown under greenhouse conditions. Ten fruits were gathered at 4 ically ripe stages, green stage 1 (GS1)—20 days post anthesis (dpa), green stage 2 (GS2)— distinct phenophases of the ripening from each genotype. In addition to the two econom- striped, asx—anthocyanin-less ‘Soroksári’ type. the breaker—40 dpa, when the berries are turning into their biologically ripe colour, and The plants were grown under greenhouse conditions. Ten fruits were gathered at 4 distinct phenophases of the ripening from each genotype. In addition to the two econom- i30 dpa, the br cally ripe stages, eaker green —40 stage 1 ( dpa, when GS1) the berrie —20 days post anthesi s are turning int s (o d t pa) hei , green r biolosta gicg al e 2 ( ly ripe col GS2)—- the full biological ripeness stage—60 dpa, were examined. Fruits were cut, seeds, placenta, distinct phenophases of the ripening from each genotype. In addition to the two econom- ically ripe stages, green stage 1 (GS1)—20 days post anthesis (dpa), green stage 2 (GS2)— 30 dpa, the br our, and the full b eaker iolo —40 gicdpa, when al ripeness stag the berrie e—60 dpa, w s are tur en re exam ing into ined thei . Fruits were c r biologically u ripe col t, seeds, - The plants were grown under greenhouse conditions. Ten fruits were gathered at 4 calyx and pedicel were removed, and the remaining pericarp was ﬂash-frozen in liquid N . ically ripe stages, green stage 1 (GS1)—20 days post anthesis (dpa), green stage 2 (GS2)— 30 dpa, the breaker—40 dpa, when the berries are turning into their biologically ripe col- our, placent and the full b a, calyx and iolo ped gicial cel were ripeness stag remove e—60 dpa, w d, and the re ere exam maining pe ined. Fruits were c ricarp was flash-fro ut, seed zen s, distinct phenophases of the ripening from each genotype. In addition to the two econom- Samples were stored at 70 C until further use. 30 dpa, the breaker—40 dpa, when the berries are turning into their biologically ripe col- our, and the full biological ripeness stage—60 dpa, were examined. Fruits were cut, seeds, in liquid N2. Samples were stored at −70 °C until further use. placenta, calyx and pedicel were removed, and the remaining pericarp was flash-frozen ically ripe stages, green stage 1 (GS1)—20 days post anthesis (dpa), green stage 2 (GS2)— placent our, and the full b a, calyx and iolo ped gicial cel were ripeness stag remove e—60 dpa, w d, and the re ere exam maining pe inedricarp w . Fruits were c as flash-fro ut, seed zen s, 2.1. Sample Preparation in liquid N2. Samples were stored at −70 °C until further use. 30 dpa, the breaker—40 dpa, when the berries are turning into their biologically ripe col- iplacent n liquid a, c Na 2. ly Samples we x and pedire cel were stored remove at −70 °C d, until furth and the reemain r use. ing pericarp was flash-frozen 2.1. Sample Preparation our, and the full biological ripeness stage—60 dpa, were examined. Fruits were cut, seeds, For more precise comparison of the breeding lines, during sample preparation we in liquid N2. Samples were stored at −70 °C until further use. 2.1. Sample Preparation placent opted For more pre a, caly for x and the c most ped ise compa icel were measur ris ement remove on of t sh to e breeding d, be and carried the re line out main s, d from ing pe uring thericarp w samp samele set preparat as flash-fro of extractions. ion zen we For 2.1. Sample Preparation in opted f liqu For more pre the id oN total r the most mea 2. Samples we monomeric cise compa s re urements to be stored anthocyanin rison of t at −70 °C h (TMA), e breeding carri until furth ed out f totalline phenolic r eom the sa r s use. , during content me set of samp(TPC) le preparat extra and ctions. For ferric ion we reduc- 2.1. Sample Preparation For more precise comparison of the breeding lines, during sample preparation we ing ability of plasma (FRAP) assays samples (pericarp) were crushed and homogenized opted f the totao l monomeri r the most mea c anthocya surements to be nin (TMA)ca , tota rrie ld out f phenoli rom the sa c content ( me set of TPC) and extra ferric ctions. For reducing For more precise comparison of the breeding lines, during sample preparation we 2. opted f 1. Samo pr the most mea le Preparation surements to be carried out from the same set of extractions. For abilitin y of liquid plasN ma. (F The RAextraction P) assays sam waspcarried les (peric out arp wi ) were cr th MeOH:H ushedO:HCOOH and homoge (60:39:1 nized v in /v%). the total monomeric anthocyanin (TMA), total phenolic content (TPC) and ferric reducing 2 2 the tota opted fo l monomeri r the most mea c anthocya surements to be nin (TMA),ca tota rrie l phenoli d out from the sa c content (me set of TPC) and extra ferric c reduci tions. For ng Extracts were centrifuged at 4 C at 4300 rpm for 20 min and the resulting supernatant was liquid N2. The extraction was carried out with MeOH:H2O:HCOOH (60:39:1 v/v%). Ex- ability of plasma (FRAP) assays samples (pericarp) were crushed and homogenized in For more precise comparison of the breeding lines, during sample preparation we ab the tota ility of l monomeri plasma (F c a RA nthocya P) assa ni ys n ( sam TMA) ple,s tota (peric l phenoli arp) were cr c content ( ushe Td PC) and an hom d ferri oge c reduci nized ng in used. Until the measurements the prepared samples were stored at 32 C. For the total tracts were centrifuged at 4 °C at 4300 rpm for 20 min and the resulting supernatant was liquid N2. The extraction was carried out with MeOH:H2O:HCOOH (60:39:1 v/v%). Ex- opted for the most measurements to be carried out from the same set of extractions. For ability of plasma (FRAP) assays samples (pericarp) were crushed and homogenized in liquid N ﬂavonoid 2. The extra content ction (TFC) was ca assay rri , e frd out wi uit samples th MeOH:H without 2 seeds O:HCOOH (60:39:1 were sliced andvextracted /v%). Ex- with tused racts. were ce Until the measur ntrifuged em at 4 ents the prep °C at 4300 rp ared m for 2 sample 0 mis were n and t stored he resu at lting s −32 °C. For the tota upernatant wasl the total monomeric anthocyanin (TMA), total phenolic content (TPC) and ferric reducing liquid N2. The extraction was carried out with MeOH:H2O:HCOOH (60:39:1 v/v%). Ex- tractsMilli-Q were ce water ntrifuin ged a ration at 4 °Cof at1:10. 4300 T rp o determine m for 20 mthe in and t totalhcar e res otenoid ulting s content upernat (TC), ant was samples used flavonoid . Until the measur content (TFC) em ass ents the prep ay, fruit samp ared les sample withouts were seeds were sl stored iat ced −32 an °C. For the tota d extracted with l ability of plasma (FRAP) assays samples (pericarp) were crushed and homogenized in tracts were centrifuged at 4 °C at 4300 rpm for 20 min and the resulting supernatant was used. wer Until the measur e extracted with em EtOH:acetone ents the prep(1:1 aredv sample /v%), ﬁlter s were ed and stored kept at in−32 dark °C. For the tota at 32 C until l use. Milli-Q water in a ration of 1:10. To determine the total carotenoid content (TC), samples flavonoid content (TFC) assay, fruit samples without seeds were sliced and extracted with liquid N2. The extraction was carried out with MeOH:H2O:HCOOH (60:39:1 v/v%). Ex- used. Until the measur Samples for the emenzymatic ents the prep activity ared sample of catalase s were (CA stored T) and at per−oxidase 32 °C. For the tota (POD) measur l e- flavonoid content (TFC) assay, fruit samples without seeds were sliced and extracted with were extracted with EtOH:acetone (1:1 v/v%), filtered and kept in dark at −32 °C until use. Milli-Q water in a ration of 1:10. To determine the total carotenoid content (TC), samples tracts were centrifuged at 4 °C at 4300 rpm for 20 min and the resulting supernatant was Mi flavonoid lli-ments Q wa con ter i wer tent ne a ra gr (TFC) ound tion of 1:10 ass in ay, cold fru . To sodium it s determ amples phosphate in wi e the tota thout seeds were sl buf l carotenoi fer (25 mM, d i ccontent ( ed pH and extra 7.8), T C)supplemented , csa ted wi mple th s Samples for the enzymatic activity of catalase (CAT) and peroxidase (POD) measure- were extracted with EtOH:acetone (1:1 v/v%), filtered and kept in dark at −32 °C until use. used. Until the measurements the prepared samples were stored at −32 °C. For the total Milli- with Q wa 0.8 ter i g/l n a ra PVP tion of 1:10 and 1 mM . To EDT determ A, and inwer e the tota e centrifuged l carotenoi for d20 content ( min atT 12,000 C), sa mpl g at es 4 C. were extracted with EtOH:acetone (1:1 v/v%), filtered and kept in dark at −32 °C until use. ments were ground in cold sodium phosphate buffer (25 mM, pH 7.8), supplemented with Samples for the enzymatic activity of catalase (CAT) and peroxidase (POD) measure- flavonoid content (TFC) assay, fruit samples without seeds were sliced and extracted with were extra Supernatant cted wiwas th EtOH:a applied cetone (1 for the studies. :1 v/v%), For filtered the super and kept in d oxide dismutase ark at −32 (SOD) °C until use. assay, 50 mM Samples for the enzymatic activity of catalase (CAT) and peroxidase (POD) measure- ments 0.8 g/l PV were ground P and 1 mM EDTA, in cold sodium phospha and were centri te buffer (2 fuged for 20 5 mM m , pH in at 7.8 12 ),0 , supplemented wit 00 g at 4 °C. Super- h Milli-Q water in a ration of 1:10. To determine the total carotenoid content (TC), samples NaPO buffer was supplemented with 1 mM EDTA and 2 w/v% PVP was applied. Samples Samples for the enzymatic activity of catalase (CAT) and peroxidase (POD) measure- ments were ground 4 in cold sodium phosphate buffer (25 mM, pH 7.8), supplemented with 0 natant was .8 g/l PVP and 1 mM EDTA, applied for the stud and were centri ies. For the superox fuged for 20 ide dismutase min at 12 (SOD ,000 g) assay, 50 mM at 4 °C. Super- were extracted with EtOH:acetone (1:1 v/v%), filtered and kept in dark at −32 °C until use. were centrifuged for 20 min at 12,000 g at 4 C and the supernatant was used for the ments were ground in cold sodium phosphate buffer (25 mM, pH 7.8), supplemented with 0.8 g/l PVP and 1 mM EDTA, and were centrifuged for 20 min at 12,000 g at 4 °C. Super- NaPO4 buffer was supplemented with 1 mM EDTA and 2 w/v% PVP was applied. Samples natant was applied for the studies. For the superoxide dismutase (SOD) assay, 50 mM Samples for the enzymatic activity of catalase (CAT) and peroxidase (POD) measure- studies. Until the measurements, samples were stored at 32 C. For each measurement 3 natant was 0.8 g/l PVP and 1 mM EDTA, applied for the stud anies. d were centri For the superox fuged for 20 ide dismutase min at 12 (SOD ,000 g) assay, 50 mM at 4 °C. Super- were centrifuged for 20 min at 12,000 g at 4 °C and the supernatant was used for the NaPO4 buffer was supplemented with 1 mM EDTA and 2 w/v% PVP was applied. Samples ments were ground in cold sodium phosphate buffer (25 mM, pH 7.8), supplemented with technical replicates were applied. NaPO natant was 4 buffer applied was supp for th leme stud ented with ies. For 1 mM EDTA a the superox nid 2 de dismutase w/v% PVP (SOD was appl ) assay, 50 mM ied. Samples were centrifuged for 20 min at 12,000 g at 4 °C and the supernatant was used for the 0.8 g/l PVP and 1 mM EDTA, and were centrifuged for 20 min at 12,000 g at 4 °C. Super- NaPO4 buffer was supplemented with 1 mM EDTA and 2 w/v% PVP was applied. Samples were centrifuged for 20 min at 12,000 g at 4 °C and the supernatant was used for the natant was applied for the studies. For the superoxide dismutase (SOD) assay, 50 mM 2.2. Total Monomeric Anthocyanin Content (TMA) were centrifuged for 20 min at 12,000 g at 4 °C and the supernatant was used for the NaPO4 buffer was supplemented with 1 mM EDTA and 2 w/v% PVP was applied. Samples Total monomeric anthocyanin content was measured by a pH differential method as were centrifuged for 20 min at 12,000 g at 4 °C and the supernatant was used for the described by Lee et al. [20]. To the samples KOH (pH 1.0) and sodium acetate (NaOAc) (pH 4.5) buffers were measured. After 15 min, absorbance was recorded by a Jenway Antioxidants 2022, 11, 637 4 of 14 6105 UV/Vis spectrophotometer at = 520 nm and = 700 nm. Total monomeric antho- cyanin content was calculated by the following formula: A MW D f 10 TMA (cyanidin 3 glucosyde mg/L) = # l where A = (A A )pH 1.0 (A A )pH 4.5, MW(molecular weight) = 520nm 700nm 520n 700nm 449.2 g/mol for cyanidin-3-glucosyde, D f = Dilution factor, # = 26,900 molar extinction coefﬁcient for cyanidin-3-glucosyde, l = pathlength in cm. Results are expressed as g cyanidin-3-glucosyde/g dry weight (dw) (g cy-3-glu/g). 2.3. Total Polyphenolic Content (TPC) Total soluble polyphenols were measured with Folin–Ciocalteu reagent according to Singleton and Rossi, at = 760 nm with a Jenway 6105 UV/Vis [21]. TPC was calculated based on the calibration curve of 0, 6, 12, 18, 24 and 30 g/mL gallic acid, generating the equation of y = 0.0187x 0.0009, R = 0.9996. The results are expressed as mg gallic acid equivalent (Ga)/g dw. 2.4. Antioxidant Activity (FRAP) The fruits’ antioxidant capacity was measured by the FRAP assay according to Benzie and Strain, at = 593 nm with a Jenway 6105 UV/Vis spectrophotometer [22]. FRAP was calculated based on the calibration curve of 0, 6, 12, 18, 24 and 30 mol/L ascorbic acid, generating the equation of y = 0.0478x + 0.0104, R = 0.9997. The results are expressed as mol ascorbic acid (As) equivalent/g dw. 2.5. Total Flavonoid Content (TFC) Total ﬂavonoid content was determined according to Sytar et al., aluminium chloride colorimetric method [23]. From the supernatant, 500 L was added to 1.5 mL 95% EtOH, 0.1 mLA lCl , 0.1 mL potassium acetate and 2.8 mL water. The absorbance was measured at = 415 nm using a Jenway 6105 UV/Vis spectrophotometer. TFC was calculated on the basis of the calibration curve of quercetin standard for which 0, 20, 40, 80, 120, 160 and 200 g/mL quercetin was used, generating the equation of y = 0.0059x + 0.0361, R = 0.9989. Results are expressed as mg quercetin equivalent (Qe)/g dw. 2.6. Total Carotenoid Content (TC) Total carotenoid content was measured a method described by Hornero-Mendez and Minguez-Mosquera [24]. Absorbance was measured by a Jenway 6105 UV/Vis spectropho- tometer at = 452 nm and = 472 nm, characteristic absorption maximum of red and yellow carotenoids, respectively, results are expressed as mg/kg dw. The total carotenoid content was calculated using the following formula: A V 10 (mL) TC (g/g) = 1% A W (g) 1cm where A = absorbance (measured at either = 452 nm or 472 nm), V = total extract (mL) 1% volume, W = sample weight and A = 2009 or 2144 (extinction coefﬁcient of capsanthin (g) 1cm and -carotene in acetone, respectively). The sum of the two measurements gives the total carotenoid content. 2.7. Catalase Enzyme Activity (CAT) The CAT activity measurement was carried out according to Xing et al. [25]. For the sample extract, sodium phosphate buffer (50 mM, pH 7) and 40 mM H O as a substrate 2 2 was measured. After the addition of the H O the change in the absorbance was monitored 2 2 at = 240 nm in 60 s intervals with a Jenway 6105 UV/Vis spectrophotometer. Results are displayed in U/g dw. Antioxidants 2022, 11, 637 5 of 16 2.7. Catalase Enzyme Activity (CAT) The CAT activity measurement was carried out according to Xing et al. [25]. For the sample extract, sodium phosphate buffer (50 mM, pH 7) and 40 mM H2O2 as a substrate was measured. After the addition of the H2O2 the change in the absorbance was monitored at λ = 240 nm in 60 s intervals with a Jenway 6105 UV/Vis spectrophotometer. Results are displayed in U/g dw. Antioxidants 2022, 11, 637 5 of 14 2.8. Peroxidase Enzyme Activity (POD) The POD activity measurement was carried out according to Xing et al., samples 2.8. Peroxidase Enzyme Activity (POD) were mixed with a buffer containing 8 mM guaiacol and 100 mM sodium phosphate pH The POD activity measurement was carried out according to Xing et al., samples were 6.4. After the addition of 24 mM H2O2 as a substrate, the change in the absorbance was mixed with a buffer containing 8 mM guaiacol and 100 mM sodium phosphate pH 6.4. recorded at λ = 460 nm in 60 s intervals with a Jenway 6105 UV/Vis spectrophotometer. After the addition of 24 mM H O as a substrate, the change in the absorbance was recorded 2 2 Results are displayed in U/g dw. at = 460 nm in 60 s intervals with a Jenway 6105 UV/Vis spectrophotometer. Results are displayed in U/g dw. 2.9. Superoxide Dismutase Enzyme Activity (SOD) SOD activity was assayed by its ability to inhibit the photochemical reduction of ni- 2.9. Superoxide Dismutase Enzyme Activity (SOD) troblue tetrazolium according to Beauchamp and Fridovich [26]. The reaction mixture SOD activity was assayed by its ability to inhibit the photochemical reduction of contained 50 mM sodium phosphate buffer, 10 µM EDTA, 13 mM L-methionine, 75 µM nitroblue tetrazolium according to Beauchamp and Fridovich [26]. The reaction mixture nitroblue tetrazolium (NBT) and 2 µM riboflavin. During the reaction assay preparation, contained 50 mM sodium phosphate buffer, 10 M EDTA, 13 mM L-methionine, 75 M the mixture was kept in dark and to kickstart the reaction, the ready reaction mixture was nitroblue tetrazolium (NBT) and 2 M riboﬂavin. During the reaction assay preparation, illuminated with luminescent light for 10 min. Absorbance was measured at λ = 560 nm the mixture was kept in dark and to kickstart the reaction, the ready reaction mixture was wavelength. Results are displayed in U/g dw. illuminated with luminescent light for 10 min. Absorbance was measured at = 560 nm wavelength. Results are displayed in U/g dw. 2.10. Soluble Solid Content (SSC) and pH 2.10. Soluble Solid Content (SSC) and pH The pH of the berries was measured with LAQUAtwin water quality pocket meter by Horiba (Kyoto, Japan), and their ºBRIX was determined by a digital refractometer, The pH of the berries was measured with LAQUAtwin water quality pocket meter by PR-201 ᾳ , ATAGO . Horiba (Kyoto, Japan), and their ºBRIX was determined by a digital refractometer, PR-201 , ATAGO . 2.11. Determination of Colour Hue 2.11. Determination of Colour Hue Photos of the collected berries were taken in each phenophase upon sample collection Photos of the collected berries were taken in each phenophase upon sample collection with a Pentax GR2 camera. Average colour was determined with Adobe Photoshop CC with a Pentax GR2 camera. Average colour was determined with Adobe Photoshop CC (2019), the HEX values were converted to decimals in MS Excel version 2202 and were (2019), the HEX values were converted to decimals in MS Excel version 2202 and compared to were the results of the other measurements. compared to the results of the other measurements. 2.12. RNA Isolation and Quantitative Real-Time PCR 2.12. RNA Isolation and Quantitative Real-Time PCR Total RNA was isolated from the pericarp of fruits in each phenophase with Omega Total RNA was isolated from the pericarp of fruits in each phenophase with Omega E.Z.N.A. Plant RNA Kit (Norcross, GA, USA). The integrity and quantity of the RNA E.Z.N.A. Plant RNA Kit (Norcross, GA, USA). The integrity and quantity of the RNA samples were verified and measured by agarose gel electrophoresis and Nanodrop 1000 samples were veriﬁed and measured by agarose gel electrophoresis and Nanodrop 1000 spectrophotometer by Thermo Fisher Scientific (Waltham, MA, USA), respectively. From spectrophotometer by Thermo Fisher Scientiﬁc (Waltham, MA, USA), respectively. From the RNA cDNA was synthesized with RevertAid H Minus First Strand cDNA Synthesis the RNA cDNA was synthesized with RevertAid H Minus First Strand cDNA Synthesis Kit Kit by Thermo Fisher Scientific (Waltham, MA, USA) with oligo-dT and random primers by Thermo Fisher Scientiﬁc (Waltham, MA, USA) with oligo-dT and random primers were were applied, according to the manufacturer’s instructions. The qRT-PCR was carried out applied, according to the manufacturer ’s instructions. The qRT-PCR was carried out in a in a Stratagene MX3000p instrument using actin as reference gene. For PCRs we used Stratagene MX3000p instrument using actin as reference gene. For PCRs we used Power Power Up™ SYBR™ Green Master Mix, Applied Biosystems by Thermo Fisher Scientific Up™ SYBR™ Green Master Mix, Applied Biosystems by Thermo Fisher Scientiﬁc (Vilnius, (Vilnius, Lithuania) according to the manufacturer’s instructions. Primers used in this Lithuania) according to the manufacturer ’s instructions. Primers used in this study were study were either published previously by Aza-Gonzalez et al. or were designed by Pri- either published previously by Aza-Gonzalez et al. or were designed by Primer3 using mer3 using Zunla’s genome as a reference (Table 2) [4]. Zunla’s genome as a reference (Table 2) [4]. 2.13. Statistical Analysis The qRT-PCR data were evaluated via the ddCT method. The heatmap was con- structed with TBtools using Eucledian distancing and cladogram branch type [27]. Mi- crosoft Excel and IBM SPSS 25 were applied to calculate means, standard deviation of the means from the repeated measurements as well as Pearson correlation coefﬁcient and F-value from analysis of variance (ANOVA). Antioxidants 2022, 11, 637 6 of 14 Table 2. Primers used for qRT-PCR. 0 0 0 0 Forward 5 –3 Reverse 5 –3 Source ACT GGACTCCGGTGATGGTGT GTCCCTGACAATTTCTCGCTCAG Ca10g11650 TGGCTGCAGTTGGGATCTTT TCCCAACCATCACTTTGTCCT own design Ca10g11690 TACTCGCCTTCTGAGGAAGGTA TGGTACTTGAGAAGTTCCGAGG Ca10g11710 GACAGCGAGCGATGTGAAAA GGCACTTGAGAAGTTCTGTGG CHS AGGAGGTTCGAAGGGAACAA CCATCACCAAAGAGTGCTTG CHI CCTCCTGGTTCTAACACCACC CTTTGCGGCAGGTGAAACTC based on Aza-Gonzalez et al. F3H GGCATGTGTGGATATGGACC CCTCCGGTGCTGGATTCTG 0 0 F3 5 H GATGGGGTGGCCGGTGATTG GCCACCACAACGCGCTCG DFR CTAACACAGGGAAGAGGCTGGTTT AATCGCTCCAGCTGGTCTCATCAT own design ANS ACCAGAACTAGCACTTGGCG ACGCACTTTGCAGTTACCCA UFGT GGATGGTGTCAAACAAGGC GTTCAGTACAACACCATCTGC based on Aza-Gonzalez et al. GST TGATTCTCTCGAGCAGAAAAAACC TGGATAACCTTTGTTCATATATG 3. Results and Discussion The mutant breeding lines used for the study all shared the same genetic background with the ‘Soroksári’. The mutants were selected based on their anthocyanin accumulation patterns in their fruits or in their vegetative parts. Though they share the same genetic background they show large disparity in their nutritional and quality traits. The pH of the berries in the GS1 stage ranged from 5.2 to 6.3 and in their biologically ripe stage from 5.2 to 5.8, hence no signiﬁcant differences were observed between the colouration of the berries and their pH. Thus the berry colour is rather due to other genetic factors or other factors suggested by Láng [28]. Their soluble solid contents in the same phenophases ranged from 4.0 to 7.8 in GS1 and 4.5 to 8.6 ºBRIX in the biologically ripe stage. In accordance with Deepa’s suggestion, all data presented in this study are calculated on dry weight basis (dwb), but wherever is necessary data are also presented on fresh weight basis (fwb) [29]. 3.1. Total Monomer Anthocyanins To determine the presence of anthocyanins in the plant, microscopic pictures using Leica LEITZ DMRXE (Wetzlar, Germany) were taken. In addition to the fruits, from the ‘Pim. Ney.’, a photograph was also taken of its hypocotyl, since this extreme purple genotype accumulates anthocyanin in every phenophase in each organ. Cross-sections of both the hypocotyl and the fruit show that the anthocyanins are located in the vacuoles of the mesocarpic cells, and their intensity dilutes towards the inner mesocarp, corresponding to Lightbourn’s ﬁndings [5]. While in the hypocotyl only the ﬁrst two layers of cells contain anthocyanins, the cross-section of the berry showed that under the cuticle there are ﬁve to six layers of mesocarp cells in the which are contained anthocyanis (Figure 1). Thus far, the delphinidin-3-p-coumaroyl-runtinoside-5-glucoside is the main and only anthocyanidin found in the fruit, foliage and in the ﬂower of pepper [30,31]. TMA was mostly recorded in the early phenophases except for ‘Pim. Ney.’ In two cases, anthocyanin was detected in the white-berried ones as well (11278 at breaker and in the ‘Soroksári’ at GS2 stage), although it could not be seen in the berries (Table 3). Sadilova et al. measured 321.5 g cy-3-glu/g on fresh weight basis (fwb) in the peel of a C. annuum variety, whereas in the case of C. annuum we measured 15 times more (4866.47 g cy-3-glu/g fwb equal to 56,575.27 g cy-3-glu/g dw) and in the case of the C. chinense almost 130 times higher value on fwb (41,366.57 g cy-3-glu/g fwb equal to 517,082.19 g cy-3-glu/g dw) [31]. Antioxidants 2022, 11, 637 7 of 14 Table 3. Means and standard deviation of the means of the enzymatic activity and phytochemicals measured in different phenophases (in dw). TMA TPC FRAP TFC TC CAT SOD POD GS1 g cy-3-glu/g mg Ga/g mol As/g mg Qe/g mg/kg U/g U/g U/g ‘Pim. Ney.’ 134,897.45 723.37 a 116.78 8.32 a 515.55 6.26 a 45.38 0.25 a 341.79 113.45 a,b 8.97 0.76 a,b 46.75 2.53 a 67.90 5.50 a,c 11263 10,222.68 159.52 b 43.73 0.12 b,c 281.67 1.52 b 56.98 0.2 b 273.21 6.50 a,b 8.72 1.12 a,b 42.53 5.27 a 26.60 13.55 b 11270 56,575.27 1445.30 c 43.15 0.13 b,c 359.28 2.30 c 15.78 0.04 c 105.60 6.02 a 4.56 0.68 a,b 64.84 1.93 a 36.18 2.44 a,b 11274 17,929.89 6025.39 b 43.11 0.26 b,c 366.58 3.80 c 86.34 0.54 d 448.47 44.00 b 10.38 2.14 a 58.48 3.07 a 24.07 2.10 b 11278 Nd 60.34 3.64 b 232.84 0.81 d 49.97 0.30 e 489.41 93.06 b,c 4.21 0.83 a,b 48.85 5.60 a 44.59 4.79 a,b,c 11280 Nd 35.08 0.32 c 455.04 1.34 e 65.55 0.16 f 432.05 47.63 a,b 8.77 1.45 a,b 158.46 33.82 b 80,34 6.75 c,d ‘Soroksári’ Nd 84.57 0.56 d 511.03 1.76 a 17.01 0.70 c 193.37 55.77 a,b 3.18 1.10 b 41.18 3.01 a 115.92 9.10 d GS2 ‘Pim. Ney.’ 461,480.11 6274.54 a 107.13 9.77 a 945.29 1.33 a 50.54 0.71 a 1108.41 62.66 a 8.52 1.55 a 163.79 22.15 a 46.88 0.08 a 11263 5615.80 412.52 b 33.07 1.02 b 181.02 0.63 b 34.51 0.03 b 473.84 26.14 b 3.53 0.23 b 55.76 6.22 b 44.99 1.42 a 11270 20543.74 958.88c 25.57 0.42 b 129.29 0.83 c 22.62 0.03 c 825.08 58.10 a 5.14 0.85 a, b 74.58 1.51 b 62.75 1.20 a 11274 7754.45 630.72 b,c 44.75 0.88 b,c 306.80 1.46 d 83.23 0.27 d 1493.24 93.68 c 2.93 0.13 b 28.15 1.98 b 59.83 0.78 a 11278 66.33 5.30 c 358.24 2.86 e 30.07 0.07 e 451.59 44.93 b 1.68 0.12 b 29.37 1.18 b 59.18 5.97 a Nd 11280 61.86 7.26 c,d 411.35 1.13 f 112.50 0.17 f 1495.11 49.65 c 2.32 0.04 b 38.27 0.40 b 145.09 7.72 b Nd ’Soroksári’ 356.25 22.85 b 42.74 1.96 b,c 199.79 0.88 g 10.48 0.04 g 511.38 41.75 b 4.27 0.27 b 30.58 7.84 b 68.89 16.00 a Breaker ‘Pim. Ney.’ 517,082.19 13557.80 a 196.38 2.19 a 1737.93 8.96 a 43.93 0.99 a 583.01 42.03 a 15.60 0.57 a 85.38 9.31 a 129.80 19.58 a 11263 Nd 21.72 0.34 b 153.49 0.27 b 9.39 0.08 b 1085.18 93.27 a,b 4.98 0.72 b 37.09 1.12 b 57.12 0.79 b 11270 3962.81 218.28 b 21.79 0.89 b 108.40 0.16 c 6.45 0.06 c 1201.93 32.17 b 5.45 0.37 b 9.29 4.36 c 64.02 6.93 b 11274 2143.08 318.16 b 24.42 2.31 b,d 266.32 0.33 d 6.29 0.02 c 1129.88 130.97 a,b 6.57 4.74 a,b 14.50 0.95 c 29.82 0.97 b 11278 521.84 60.26 b 87.66 1.68 c 751.18 1.33 e 11.97 0.05 d 679.61 167.51 a,b 3.84 0.63 b 7.13 0.34 c 30.91 0.89 b 11280 30.80 1.16 d,e 199.44 0.38 f 7.15 0.03 c 825.88 73.16 a,b 6.08 1.22 a,b 5.47 0.72 c 33.12 2.97 b Nd ’Soroksári’ 36.10 2.04 e 275.31 0.46 d 10.41 0.07 b,d 1198.05 121.63 b,c 7.17 0.94 a,b 6.83 0.11 c 55.32 14.29 b Nd Ripe ‘Pim. Ney.’ 154,812.58 77.25 a 98.08 5.63 a 1155.14 2.98 a 27.57 0.27 a 717.20 186.46 a 56.90 2.94 a 115.58 8.33 a 74.79 10.59 a,b 11263 Nd 21.12 0.59 b 245.63 0.30 b 5.32 0.02 b 1847.56 366.00 a 8.85 1.24 b 179.60 29.65 a 165.10 24.19 a,b 11270 352.08 29.04 b 23.87 0.49 b 217.02 0.67 c 2.10 0.05 c 1204.84 189.71 a 5.07 0.86 b 202.32 155.68 a 198.94 81.22 a 11274 Nd 21.83 0.98 b 178.77 0.55 d 10.22 0.08 d 1651.30 450.35 a 4.28 0.23 b 16.48 1.40 a 21.03 6.23 b 11278 Nd 17.06 0.75 b 133.71 0.18 e 20.52 0.08 e 2929.87 510.87 a 9.91 1.18 b 79.44 19.74 a 75.59 9.44 a,b 11280 Nd 42.94 1.51 c 466.69 0.63 f 10.55 0.06 d 3874.30 1065.33 a,b 3.41 0.64 b 29.94 15.11 a 25.15 11.95 b,c ’Soroksári’ Nd 22.30 0.84 b 207.80 0.24 g 7.04 0.05 f 6168.53 921.44 b 7.94 1.24 b 5.19 2.07 a 6.18 0.93 b,d Note: Values in the same column and sub-table not sharing the same subscript are signiﬁcantly different at p < 0.05 in the two-sided test of equality for column means. —This category is not used in comparisons because there are no other valid categories to compare; Nd stands for not detected. Antioxidants 2022, 11, 637 7 of 16 Antioxidants 2022, 11, 637 8 of 14 (a) (b) Figure 1. Cross-section of the hypocotyl (a) and berry (b) of ‘Pim. Ney.’. Figure 1. Cross-section of the hypocotyl (a) and berry (b) of ‘Pim. Ney.’. 3.2. Total Polyphenolic Content Thus far, the delphinidin-3-p-coumaroyl-runtinoside-5-glucoside is the main and only ant Forhthe ocyTPC anidmeasur in found ement in thFolin–Ciocalteu e fruit, foliage and assay inwas the fl applied. ower oThe f pepper [ minor3drawback 0,31]. TMA of was most this method ly re is corded that itin the ear also detects ly pheno the additional phases except for ‘Pim. Ney.’ In two ca capsaicinoids, ascorbic acid, ses, ﬂavonoids antho- cyan and in wa minors d phenolics, etected in t ther he efor whit e generates e-berried ones higher as values. well (1 As 127 for 8 at the brTPC eaker values, and ingenerally the ‘So- roks in each ári’ at genotype GS2 stagthe e), alt lowest hough it values could wer not e scor be seen in ed at the the b later erries stages, (Table and 3). S usually adilova higher et al. m values easured wer 32 e 1 observed .5 µg cy-3in -glthe u/geconomically on fresh weight basis ripe GS1(fwb) in the peel of and GS2 stages ona dry C. ann weight uum basis. vari- However, when expressed on fwb an increasing trend was visible. The highest values ety, whereas in the case of C. annuum we measured 15 times more (4866.47 µg cy-3-glu/g were recorded for the ‘Pim. Ney.’, being signiﬁcantly different from the other samples in fwb equal to 56,575.27 µg cy-3-glu/g dw) and in the case of the C. chinense almost 130 times every phenophase, and other studies also concluded that C. chinense varieties exhibit higher higher value on fwb (41,366.57 µg cy-3-glu/g fwb equal to 517,082.19 µg cy-3-glu/g dw) TPC values than C. annuum [32]. Higher values were expected at the GS1 stage in the [31]. lilac-berried mutants due to their elevated anthocyanin accumulation (43.11 to 43.73 mg/g); however, the white-berried genotypes at GS1 stage scored 1.5–2 times higher values (60.34 to 84.57 mg/g) (Table 3). Although there are studies indicating that there is no correlation in between maturity and TPC [33], when expressed on dry weight basis an overall decreasing trend can be seen during ripening, which supports Marín, Navarro, Ghasemnezh and Deepa’s studies [29,34–36]. When expressed on fwb, Chandel et al. measured from 0.621 to 1.690 mg/g, while we detected higher values, from 1.60 to 16.031 mg/g [37]. On the other hand, Howard et al., Sora et al. and Sim et al. found that TPC is greatly dependent on the sample material used and on the genotype studied [38–40]. 3.3. Antioxidant Activity Antioxidant activity of both fruits and vegetables is an important attribute when assessing their nutritional value and measuring it allows the determination of this without the measurement of each compound with antioxidant activity separately. FRAP assay was chosen to detect the antioxidant activity, which measures the antioxidant activity against Antioxidants 2022, 11, 637 9 of 14 the iron reducing capacity of the samples. This method is suitable for the analysis of the antioxidant capacity of water-soluble compounds, such as polyphenols, ﬂavonoids, anthocyanins, ascorbic acid, etc. Most genotypes displayed high values of antioxidant capacity at GS1, followed by a decline at breaker stages, and a slight increase at biological ripeness. The highest antioxidant capacity was recorded in the ‘Pim. Ney.’, 1737.3 mol/g dry weight at its breaker stage, although being the only pungent genotype, capsaicin could also add to the overall high values of AOX [41]. The lowest value was recorded at the breaker stage of the purple-berried mutant (11270), 108.40 mol/g dry weight, which showed a 16-fold difference in between the studied genotypes at different phenophases (Table 3). AOX activity in addition to the GS1 stage differed signiﬁcantly in each genotype, with the highest value recorded for the purple-berried ‘Pim. Ney.’ in each phenophase. Both the genotype and maturity affected the FRAP values signiﬁcantly, e.g., in the case of ‘Pim. Ney.’ a signiﬁcant increase was detected towards full ripeness, whereas a signiﬁcant decrease was detected in 11274 when expressed on dry weight basis (Table 3). 3.4. Total Flavonoid Content Flavonoids form an important group of health-promoting compounds since they exhibit free-radical scavenging activity, thus protecting the human body from oxidative stress. As ripening advances, the detected amount of ﬂavonoids decreases, and this reduction may be due to the conversion to secondary metabolic phenolic compounds which is in agreement with the ﬁndings of Marín et al. and Ghasemnezhad et al. [34,36]. Interestingly, the extreme purple ‘Pim. Ney.’ did not score the highest values, whereas Ghasemnezhad detected the highest amount of ﬂavonoids in a dark purple genotype both at ecological and biological ripeness [36]. Compared to Ana Karina et al., we detected 1.5- to 4.3-fold higher TFC in the red genotypes, 1.2 times higher in the orange genotype and half of the amount in the case of the yellow ripe berry [42]. When expressed on fresh weight, our results coincide with Garra et al., who reported TFC between 3.14 to 8.90 mg/g fresh weight, while we detected 0.18 to 7.89 mg/g on fwb [43]. 3.5. Total Carotenoid Content The ripeness of pepper is associated with the accumulation of carotenoids. A signiﬁ- cant increase can be observed in the carotenoid content as ripening progresses (Table 3). The lowest amount was detected at the GS1 stage of 11270, 105.60 mg/kg, and the highest was scored at the ripe stage of cv. ‘Soroksári’, 6168.53 mg/kg. In this pepper an 8-fold increase was detected. Kilcrease et al. measured from 455.11 to 795.73 g/g fwb in the pericarp of orange and red varieties, which is in line with our ﬁndings: the lowest TC content was 8.49 mg/kg fwb, the 11270 GS1 stage, whereas the highest, the ‘Soroksári’ fully ripe stage, was 697.28 mg/kg fwb [10]. When expressed on dwb, however, they measured from 1235.1 to 3049.1 mg/kg dwb in mature berries, whereas we detected from 717.20 in ‘Pim. Ney.’ to 6168.53 mg/kg dwb in the mature berries of the ‘Soroksári’ (Table 3) [11]. 3.6. Enzymatic Activity Studies are already available on the pattern of change of the non-enzymatic antioxi- dants, such as ﬂavonoids, polyphenols, carotenoids, etc., throughout ripening of the pepper berry. However, there are only a few which deal with the enzymatic antioxidants over the course of maturation. Therefore, CAT, SOD and POD activity were monitored, as they serve as defence barriers against reactive oxygen species. The accumulation of these compounds is determined by several factors, both internal and external. External factors were minimized since the plants were kept under the same semi-controlled conditions, thus differences observed can be contributed to the genotype effect and ripening. The activity of CAT increased—though not signiﬁcantly—in most of the studied genotypes, ‘Pim. Ney.’ being the only one where the increase was signiﬁcant. In case of 11274 and 11280, however, a decrease from ecological to biological ripeness was observed, which is in line with the ﬁndings of Palma [44]. As for SOD activity, in the case of ‘Pim. Ney.’, 11263 and 11270, an Antioxidants 2022, 11, 637 10 of 14 increase was observed from GS1 to GS2, followed by a decrease at breaker stage, then an increase again at full maturity. Compared to GS1, there was an increase at the ripe stage of 11278, whereas in case of 11270, 11280 and ‘Soroksári’, a decrease was seen compared to GS1. Within genotypes, an overall increase was seen toward biological ripeness in the POD activity in the case of ‘Pim. Ney.’ and 11263–11278 breeding lines, whereas in the case of 11280 and ‘Soroksári’, a decrease was detected from GS1 to full ripeness (Table 3). 3.7. Correlation between Phytochemicals and AOX As stated previously, ripening affects the phytochemical composition of the berries. To assess the degree of contribution of these compounds to the overall AOX of the berries, phytochemicals and antioxidant capacity as well as berry colour in each genotype in each phenophase were evaluated (Table 4). The FRAP and TPC values showed a strong positive correlation (r = 0.906), which is lower than that reported by Bogusz or Sora et al. but higher than that obtained by Deepa et al. (Table 4) [29,32,40]. TMA displayed strong positive correlation with both FRAP (r = 0.849) and TPC (r = 0.848), indicating that their presence is linked with the increased antioxidant capacity over the course of ripening. The correlation between carotenoids and FRAP was weaker (r = 0.150). This is due to the nature of the FRAP assay, since it requires acidic conditions (pH 3.6) within which carotenoids tend to undergo isomerization, thus losing their reducing activity [42]. Table 4. Pearson correlation coefﬁcients between the enzymatic activity, phytochemicals and colour of pepper fruits. CAT SOD POD FRAP TPC TMA TFC TC Colour CAT 1 SOD 0.209 1 POD 0.110 0.763 ** 1 FRAP 0.523 ** 0.200 0.097 1 TPC 0.322 ** 0.079 0.001 0.906 ** 1 TMA 0.272 0.301 * 0.226 0.849 ** 0.848 * 1 TFC 0.008 0.064 0.052 0.208 0.281 ** 0.218 1 TC 0.024 0.025 0.143 0.150 0.259 * 0.077 0.194 1 Colour 0.457 ** 0.165 0.036 0.531 ** 0.526 ** 0.609 ** 0.222 * 0.242 * 1 *, ** Correlation is signiﬁcant at the 0.05 level and 0.01 level, respectively. In addition to assessing the contribution of the phytochemicals to the AOX, we also examined the effect of genotype and phenophase and their combination on both the AOX itself and on the related nutraceutical compounds as well. Guilherme et al. found that maturity affects the polyphenolic content and composition to a great extent while Howard et al. concluded that both the amount of phenolics and ﬂavonoids are mostly affected by the cultivar [38,45]. Ghasemnezhad et al. also established the same conclusion, hence the changes in ﬂavonoids depend on the cultivar rather than the maturity [36]. A two-way ANOVA was conducted and resulting F-values are summarized in Table 5. Numbers highlighted are the highest affecting factors in a group. Our results indicate that TMA, TPC and FRAP were affected by the genotype. On the contrary, the TFC was mainly inﬂuenced by the phenophase. Table 5. ANOVA F-value summary of 4 most important nutraceutical traits of 7 genotypes at 4 phenophases. TMA TPC TFC FRAP Genotype (G) 5918.75 438.54 12,311.20 61,209.87 Maturity (M) 537.56 86.37 37,756.75 4501.43 G x M 633.38 46.37 5255.05 9704.27 Note: values in bold are the highest affecting factors in a group. Antioxidants 2022, 11, 637 11 of 14 In the case of the TMA, an interaction between genotype and maturity could be demon- strated, F(18, 56) = 633.38 and p < 0.001. As for the TPC, F(18, 56) = 46.37 and p < 0.001. TFC was also affected signiﬁcantly by both genotype and maturity, where F(18, 56) = 5255.05 and p < 0.001, as well as FRAP, where F(18, 56) = 9704.27 and p < 0.001 (Table 5). Although in most of the cases genotype was the most inﬂuencing factor, adjusted r squared in all four cases are between 0.978 and 1.00, meaning that variance in the phytonutrients is almost entirely attributable to the effect of genotype and maturity. 3.8. Regulation of Anthocyanin Biosynthesis The presence of anthocyanins positively correlated with the accumulation of tran- scripts of both regulatory and structural genes of the anthocyanin biosynthetic pathway (Figure 2, Table 6). Most studies conclude that R2R3-MYBs affect the expression of LBGs 0 0 (F3 5 H, DFR, ANS, UFGT, GST); however, contradictory results are available on their effect on the EBGs (CHI, CHS, F3H) of the pathway [4,18,46]. The expression level of both ANS Antioxidants 2022, 11, 637 and DFR coincided with the higher expression of regulatory MYBs. Their expression 13 of was 16 higher in those stages where the berries are still rich in anthocyanins; furthermore, a great fold of difference was observed in transcript levels between the anthocyanin-pigmented and anthocyanin-less genotypes (Figure 2). Interestingly, the transcript level of EBGs, CHS EBGs, CHS and F3H followed the expression of the studied MYB transcription factors, as and F3H followed the expression of the studied MYB transcription factors, as opposed to opposed to Borovsky et al. and Aza-Gonzalez et al., who found that expression of CHS is Borovsky et al. and Aza-Gonzalez et al., who found that expression of CHS is comparable comparable between the anthocyanin-rich and anthocyanin-less genotypes [4,18]. On the between the anthocyanin-rich and anthocyanin-less genotypes [4,18]. On the other hand, other hand, Stommel et al. detected higher transcript levels of CHS in the anthocyanin- Stommel et al. detected higher transcript levels of CHS in the anthocyanin-pigmented pigmented genotypes; in fact, upon silencing the MYBa, Ochoa-Alejo et al. and Zhang et genotypes; in fact, upon silencing the MYBa, Ochoa-Alejo et al. and Zhang et al. detected al. detected the down regulation of both LBGs and EBGs [46–48]. the down regulation of both LBGs and EBGs [46–48]. Figure 2. Fold expression pattern of the tested genotypes compared to cv. ‘Soroksári’ in 4 pheno- Figure 2. Fold expression pattern of the tested genotypes compared to cv. ‘Soroksári’ in 4 phenopha- phases, pseudo-colour bar is showing the level of fold expression on a normalized scale. ses, pseudo-colour bar is showing the level of fold expression on a normalized scale. After comparing the expression level of the three R2R3-MYB transcription factors, it Table 6. Log2 fold change of R2R3-MYBs compared to the cv. ‘Soroksári’ and extracts’ colouration can be seen that the so-called MYBa (Ca10g11650) and the two other putative regulatory throughout the four tested phenophases. MYBs (Ca10g11690 and Ca10g11710) were expressed at high levels in the lilac-berried genotypes, and their transcript level decreased in genotypes 11263, 11270 and 11274 as Gene ID Phenophase ‘Pim. Ney.’ 11263 11270 11274 11278 11280 ripening advanced and the berries started to turn into their ripe colour. The extreme lilac GS1 1126.61 10.94 9.00 16.87 0.46 0.21 genotype, ‘Pim. Ney.’, showed the highest log2 fold change in every phenophase. This GS2 2893.52 14.47 11.41 9.94 0.21 0.06 Ca10g11650 might suggest that besides MYBa, these two other R2R3-MYBs, or a combination of them, Breaker 35.89 3.66 3.02 4.97 0.23 0.31 regulate the anthocyanin synthesis in the berries of Capsicums (Table 6). Ripe 11.16 5.53 1,57 3.09 0.20 0.10 GS1 17.71 2.37 5.07 2.06 0.02 0.47 GS2 16.35 18.11 23.61 0.20 0.03 0.28 Ca10g11690 Breaker 5.25 1.47 1.53 0.18 0.06 0.44 Ripe 3.36 0.53 0.86 0.05 0.03 0.24 GS1 80.05 8.25 12.12 0.43 0.36 0.47 GS2 302.22 3.54 29.17 0.50 1.23 0.24 Ca10g11710 Breaker 177.36 0.46 1.74 0.32 0.85 0.48 Ripe 171.32 0.36 0.29 0.36 0.67 0.42 Crude sample GS1🠖 Ripe extracts’ colour Note: Purple coloured cells indicate anthocyanin build-up in the berries. After comparing the expression level of the three R2R3-MYB transcription factors, it can be seen that the so-called MYBa (Ca10g11650) and the two other putative regulatory MYBs (Ca10g11690 and Ca10g11710) were expressed at high levels in the lilac-berried gen- otypes, and their transcript level decreased in genotypes 11263, 11270 and 11274 as ripen- ing advanced and the berries started to turn into their ripe colour. The extreme lilac gen- otype, ‘Pim. Ney.’, showed the highest log2 fold change in every phenophase. This might suggest that besides MYBa, these two other R2R3-MYBs, or a combination of them, regu- late the anthocyanin synthesis in the berries of Capsicums (Table 6). Antioxidants Antioxidants 2022 2022,, 11 11,, 637 637 13 of 13 of 16 16 Antioxidants Antioxidants Antioxidants Antioxidants 2022 2022 2022 2022 , 11 , 11 , 11 ,, 637 , 11 637 , 637 , 637 13 of 13 of 13 of 13 of 16 16 16 16 EBGs, CH EBGs, CHS S and F and F3 3H H follo follow wed the expr ed the expression ession of of the studi the studie ed d MYB tra MYB tran nscri scripti ptio on f n fa actors, a ctors, as s EBGs, CH EBGs, CH EBGs, CH EBGs, CH S S and F S and F S and F and F 3 3H H 33 H follo H follo follo follo w wed the expr w ed the expr w ed the expr ed the expr ession ession ession ession of of of of the studi the studi the studi the studi e ed d ee d MYB tra MYB tra d MYB tra MYB tra n nscri scri nn scri scri pti pti pti o pti on f n f oo n f a n f actors, a ctors, a aa ctors, a ctors, a ss ss op op opp p po o osed t sed t sed to o o B B Bo o orov rov rovs s sky ky ky et et et a a al l l... and and and A A Az z za-G a-G a-Go o onza nza nzal l le e ez z z et et et al., al., al., who fo who fo who found th und th und that expression at expression at expression of CHS of CHS of CHS is is is op op op p po o p sed t sed t osed t o o B B oo B orov rov orov ssky ky sky et et et a al a l.. and and l. and A A A z za-G a-G za-G o onza nza onza lle ez lz e et et z et al., al., al., who fo who fo who fo und th und th und th at expression at expression at expression of CHS of CHS of CHS is is is compa compa compa compa rabr r rla a a eb b b b ll le e e e b b b tween the e e etween the tween the tween the anthocya anthocya anthocya anthocya nin- ni ni ni rich a n- n- n-rich a rich a rich a nd n n n ad d d nthocya a a an n nthocya thocya thocya nin-l ni ni nie n-l n-l n-l ss genotypes e e ess genotypes ss genotypes ss genotypes [4,18 [ [ [4 4 4,18 ] ,18 ,18 . On the ] ] ]. On the . On the . On the compa compa rarb alb el b e b etween the etween the anthocya anthocya nini n-n- rich a rich a nd nd an athocya nthocya nini n-l n-l ess genotypes ess genotypes [4[,18 4,18 ]. On the ]. On the otot her hand ot ot ot her hand her hand her hand her hand , S, t, , , ommel et SS S S tommel et tttommel et ommel et ommel et al a . a a a det l.lll det ... det det det ect ee ed h e e ct ct ct ct ed h ed h ed h ed h igh ig iiier t g g g hh h h er t er t er t er t ran rr r an rscript an an an script script script script leve leve leve leve leve ls ls of C ls ls ls of C of C of C of C HS in H H H H S in S in S in S in th t t e t t hh h h ant e e e e ant ant ant ant hocyan hh h h ocyan ocyan ocyan ocyan in- in- iiin- n- n- other hand, Stommel et al. detected higher transcript levels of CHS in the anthocyanin- pigmented genotypes; in fact, upon silencing the MYBa, Ochoa-Alejo et al. and Zhang et pigment pigment pigment pigment pigment e ed ge d ge ee e d ge d ge d ge not not not not not y ypes; in pes; in yy y pes; in pes; in pes; in f fa a f ct f f ct aa a , upon s ct , upon s ct ct , upon s , upon s , upon s ilen ilen ilen ilen ilen ccin in cc c in g the MYB g the MYB in in g the MYB g the MYB g the MYB a a, Ocho , Ocho aa a , Ocho , Ocho , Ocho a-Alej a-Alej a-Alej a-Alej a-Alej o et al. o et al. o et al. o et al. o et al. and Z and Z and Z and Z and Z h hang et ang et hh h ang et ang et ang et al. detected the down regulation of both LBGs and EBGs [46–48]. al al. detected t al . detected t al al . detected t . detected t . detected t h he down re e down re hh h e down re e down re e down re g gu u g lg g lu a a u u tion ltion a l la a tion tion tion o offo both LBGs both LBGs o o f both LBGs f f both LBGs both LBGs and and and and and E EB B E Gs [46–48]. E E Gs [46–48]. BB B Gs [46–48]. Gs [46–48]. Gs [46–48]. Figure 2. Fold expression pattern of the tested genotypes compared to cv. ‘Soroksári’ in 4 phenopha- Figure 2. Figure 2. Figure 2. Figure 2. Figure 2. Fold e Fold e Fold e Fold e Fold e x x pression patte pression patte xx x pression patte pression patte pression patte rn of the te rn of the te rn of the te rn of the te rn of the te sted sted sted sted sted genotype genotype genotype genotype genotype s com s com s com s com s com p p ared to ared to pp p ared to ared to ared to cv cv cv . ‘ . ‘ cv cv S S . ‘ o . ‘ . ‘ o S rr S S ok o ok o o rok r r sári’ in 4 sári’ in 4 ok ok sári’ in 4 sári’ in 4 sári’ in 4 ph ph ph enopha- ph ph enopha- enopha- enopha- enopha- ses ses,, pseu pseudo do-col -colou our bar is r bar is sho show wing ing the leve the level l of fol of fold d ex express pressiion on a norm on on a normal alized ized sca scale. le. ses ses ses ,ses , pseu pseu , pseu , pseu do do do -col -col do -col -col ou ou ou r bar is r bar is ou r bar is r bar is sho sho sho sho w wing w ing w ing ing the leve the leve the leve the leve l l of fol of fol l l of fol of fol d d ex ex dd ex press ex press press press iion on a norm on on a norm ion on a norm ion on a norm al alized al ized al ized ized sca sca sca le. sca le. le. le. Table 6. Table 6. Table 6. Table 6. Table 6. Log Log Log Log Log 2 f2 o 2 2 2 f ld f f f oo o o ld chang ld ld ld chang chang chang chang e of R2R3-MYBs co ee e e of R2R3-MYBs co of R2R3-MYBs co of R2R3-MYBs co of R2R3-MYBs co mp m m m m ared to pp p p ared to ared to ared to ared to the cv. ‘Soroksári’ and the cv. ‘Soroksári’ and the cv. ‘Soroksári’ and the cv. ‘Soroksári’ and the cv. ‘Soroksári’ and extracts’ colouration extracts’ colouration extracts’ colouration extracts’ colouration extracts’ colouration Antioxidants 2022, 11, 637 Table 6. Log2 fold change of R2R3-MYBs compared to the cv. ‘Soroksári’ and extracts’ colouration 12 of 14 throug throughout the four tes hout the four test ted ed ph phenophas enophase es s.. throug throug throug throug hout the four tes hout the four tes hout the four tes hout the four tes tted ed ted t ph ph ed ph ph enophas enophas enophas enophas e ess.e . e s.s . Ge Gene ne ID ID Phe Phen nopha ophase se ‘Pi ‘Pim m. Ne . Ney.’ y.’ 1 1126 1263 3 1 1127 1270 0 1 1127 1274 4 1 1127 1278 8 1 1128 1280 0 Ge Ge Ge Ge ne ne ne ID ne ID ID ID Phe Phe Phe Phe n nopha opha nn opha opha se se se se ‘Pi ‘Pi ‘Pi m ‘Pi mm . Ne . Ne m . Ne . Ne y.’ y.’ y.’ y.’ 1 1126 126 11 126 126 3 3 3 3 1 1127 127 11 127 127 0 0 0 0 1 1127 127 11 127 127 4 4 4 4 1 1127 127 11 127 127 8 8 8 8 1 1128 128 11 128 128 0 0 0 0 Table 6. Log2 fold change of R2R3-MYBs compared to the cv. ‘Soroksári’ and extracts’ colouration GS1 GS1 1 1126 126.6 .61 1 1 10 0.94 .94 9. 9.00 00 1616.8.877 0. 0.4646 0.0.2121 GS1 GS1 GS1 GS1 1 1126 126 11 126 126 .6 .61 .6 1 .6 1 1 1 10 0 1 .94 .94 1 00 .94 .94 9. 9.00 9. 00 9. 00 00 161616.8.8167.87 0. .8 0. 77 0. 0.464646 46 0.0.210.210.21 21 throughout the four tested phenophases. GS2 GS2 2 2893 893.5 .52 2 1 14 4.47 .47 1 11 1.41 .41 9.9.9494 0. 0.2121 0.0.0606 GS2 GS2 GS2 GS2 2 2893 893 22 893 893 .5 .52 .5 2 .5 2 2 1 14 4 1 .47 .47 1 44 .47 .47 1 11 1 1 .41 .41 1 11 .41 .41 9.9.949.949.94 0. 0. 94 0. 0.212121 21 0.0.060.060.06 06 Ca1 Ca10g1 0g1165 1650 0 Ca1 Ca1 Ca1 Ca1 0g1 0g1 0g1 0g1 165 165 165 165 0 0 0 0 Breaker Breaker 3535.8.899 3. 3.6666 3. 3.02 02 4.4.9797 0. 0.2323 0.0.3131 Breaker Breaker Breaker Breaker 353535.8.8359.89 3. .8 3. 99 3. 3.666666 66 3. 3.02 3. 02 3. 02 02 4.4.974.974.97 0. 0. 97 0. 0.232323 23 0.0.310.310.31 31 Gene ID Phenophase ‘Pim. Ney.’ 11263 11270 11274 11278 11280 Ripe Ripe 1111.1.166 5. 5.5353 1,1,5757 3. 3.0909 0.0.2020 0.0.1010 Ripe Ripe Ripe Ripe 111111.1.1116.16 5. .1 5. 66 5. 5.535353 53 1,1,571,571,57 3. 3. 57 3. 3.090909 09 0.0.200.200.20 20 0.0.100.100.10 10 GS1 1126.61 10.94 9.00 16.87 0.46 0.21 GS2 2893.52 14.47 11.41 9.94 0.21 0.06 GS1 GS1 1 17 7.71 .71 2. 2.37 37 5. 5.07 07 2.2.0606 0. 0.0202 0.0.4747 GS1 GS1 GS1 GS1 1 17 7 1 .71 .71 1 77 .71 .71 2. 2.37 2. 37 2. 37 37 5. 5.07 5. 07 5. 07 07 2.2.062.062.06 0. 0. 06 0. 0.020202 02 0.0.470.470.47 47 Ca10g11650 Breaker 35.89 3.66 3.02 4.97 0.23 0.31 GS2 GS2 1 16 6.35 .35 1 18 8.11 .11 2 23 3.61 .61 0.0.2020 0. 0.0303 0.0.2828 GS2 GS2 GS2 GS2 1 16 6 1 .35 .35 1 66 .35 .35 1 18 8 1 .11 .11 1 88 .11 .11 2 23 3 2 .61 .61 2 33 .61 .61 0.0.200.200.20 0. 0. 20 0. 0.030303 03 0.0.280.280.28 28 Ca1 Ca10g1 0g1169 1690 0 Ripe 11.16 5.53 1.57 3.09 0.20 0.10 Ca1 Ca1 Ca1 Ca1 0g1 0g1 0g1 0g1 169 169 169 169 0 0 0 0 Breaker Breaker 5.5.2525 1. 1.4747 1. 1.53 53 0.0.1818 0. 0.0606 0.0.4444 Breaker Breaker Breaker Breaker 5.5.255.255.25 1. 1. 25 1. 1.474747 47 1. 1.53 1. 53 1. 53 53 0.0.180.180.18 0. 0. 18 0. 0.060606 06 0.0.440.440.44 44 GS1 17.71 2.37 5.07 2.06 0.02 0.47 Ripe Ripe 3.3.3636 0. 0.5353 0.0.8686 0. 0.0505 0.0.0303 0.0.2424 Ripe Ripe Ripe Ripe GS2 3.3.363.36 16.353.36 0. 0. 36 0. 0.5353 18.1153 53 0.0.860.86 23.610.86 0. 0. 86 0. 0.05 0.200505 05 0.0. 0.03030.030.03 03 0. 0.280.240.240.24 24 Ca10g11690 Breaker 5.25 1.47 1.53 0.18 0.06 0.44 GS1 GS1 8 80 0.05 .05 8. 8.25 25 1 12 2.12 .12 0.0.4343 0. 0.3636 0.0.4747 GS1 GS1 GS1 GS1 8 80 0 8 .05 .05 8 00 .05 .05 8. 8.25 8. 25 8. 25 25 1 12 2 1 .12 .12 1 22 .12 .12 0.0.430.430.43 0. 0. 43 0. 0.363636 36 0.0.470.470.47 47 Ripe 3.36 0.53 0.86 0.05 0.03 0.24 GS2 GS2 30 302. 2.2 22 2 3. 3.54 54 2 29 9.17 .17 0.0.5050 1. 1.2323 0.0.2424 GS2 GS2 GS2 GS2 30 30 30 2. 2. 30 2 2. 22 2. 2 2 2 22 3. 3.54 3. 54 3. 54 54 2 29 9 2 .17 .17 2 99 .17 .17 0.0.500.500.50 1. 1. 50 1. 1.232323 23 0.0.240.240.24 24 GS1 80.05 8.25 12.12 0.43 0.36 0.47 Ca1 Ca10g1 0g1171 1710 0 Ca1 Ca1 Ca1 Ca1 0g1 0g1 0g1 0g1 171 171 171 171 0 0 0 0 Breaker Breaker 17177.7.3366 0. 0.4646 1. 1.74 74 0.0.3232 0. 0.8585 0.0.4848 Breaker Breaker Breaker Breaker 1717177.7.1737.367.63 0. 0. 366 0. 0.464646 46 1. 1.74 1. 74 1. 74 74 0.0.320.320.32 0. 0. 32 0. 0.858585 85 0.0.480.480.48 48 GS2 302.22 3.54 29.17 0.50 1.23 0.24 Ca10g11710 Br Ripe Ripe eaker 1717 177.361.1.3322 0. 0. 0.463636 0.0. 1.742929 0. 0. 0.323636 0.850.0.6767 0.480.0.4242 Ripe Ripe Ripe Ripe 1717171.1.1731.321.23 0. 0. 322 0. 0.363636 36 0.0.290.290.29 0. 0. 29 0. 0.363636 36 0.0.670.670.67 67 0.0.420.420.42 42 Ripe 171.32 0.36 0.29 0.36 0.67 0.42 Crude sample Crude sample Crude sample Crude sample Crude sample Crude sample Crude sample GS1 GS1 GS1 GS1 🠖 Ri🠖🠖🠖 pe Ri Ri Ripe pe pe GS1 GS1🠖 🠖 Ri Ri pe pe GS1!Ripe extracts’ colour extra extra extra extra extra ccts’ col ts’ col cc c ts’ col ts’ col ts’ col o our ur oo o ur ur ur extracts’ colour Note: Purple coloured cells indicate anthocyanin build-up in the berries. Note: Note: Note: Note: Note: Pu Pu Pu Pu Pu rple rple rple rple rple coc lou c c o co o o lou lou lou lou red ce red ce r r red ce ed ce ed ce lls in llll ll ll s in s in s in s in dicate dicate dicate dicate dicate anthocy anthocy anthocy anthocy anthocy anin bu aa a a nin bu nin bu nin bu nin bu ild-u ild-u ild-u ild-u ild-u p ip i n p i p i p i the berries nn n n the berries the berries the berries the berries . . ... Note: Purple coloured cells indicate anthocyanin build-up in the berries. 4. Conclusions Aft Afte er comp r compar aring t ing th he e expre expression ssion leve level l of of t th he e three R three R2 2R3 R3-MYB -MYB tra tran nscri scripti ptio on f n fa actors, i ctors, it t Aft Aft Aft Aft e er comp r comp ee r comp r comp ar arar ing t ing t ar ing t ing t h he e h expre expre h ee expre expre ssion ssion ssion ssion leve leve leve leve l l of of l l of tof th h t e e h th three R e three R e three R three R 2 2R3 R3 22 R3 -MYB R3 -MYB -MYB -MYB tra tra tra n tra nscri scri nn scri scri pti pti pti o pti on f n f oo n f a n f actors, i ctors, i aa ctors, i ctors, i tt t t can be can be can be Taken se se se together en t en t en th h hat the at the at the , signiﬁcant so-c so-c so-called alled alled changes MYB MYB MYBa a a ( ( (Ca1 Ca1 Ca1 both 0g1 0g1 0g1 in 165 165 165 between 0 0 0) ) ) a a an n nd the two other put d the two other put d the two other put the genotypes and a a ati ti ti in ve ve ve between regula regula regulatory tory tory can be can be can be se se se en t en t en t h hat the at the hat the so-c so-c so-c alled alled alled MYB MYB MYB a a (a (Ca1 Ca1 (Ca1 0g1 0g1 0g1 165 165 165 0 0)) 0 a a )n n ad the two other put d the two other put nd the two other put a ati ti ave ve tive regula regula regula tory tory tory the different phenophases were observed in the case of enzymatic and non-enzymatic MYBs ( MYBs ( MYBs ( MYBs ( Ca1 Ca1 Ca1 Ca1 0g1 0g1 0g1 0g1 169 169 169 169 0 and 0 0 0 and and and Ca1 Ca1 Ca1 Ca1 0g1 0g1 0g1 0g1 171 171 171 171 0) we 0 0 0) ) ) we we we re expre re expre re expre re expre ssesse sse sse d at d d d h at at at igh h h hi i i leve gh gh gh leve leve leve ls in t ls ls ls in t in t in t he l h h h ie e e la l l lc i i il - l la a a berried c c c- - -berried berried berried gen gen gen gen - - - - MYBs ( MYBs ( Ca1 Ca1 0g1 0g1 169 169 0 and 0 and Ca1 Ca1 0g1 0g1 171 171 0)0 we ) we re expre re expre sse sse d d atat h h igh igh leve leve lsls in t in t he h l ei l la ilc a -c berried -berried gen gen - - antioxidants. ‘Pim. Ney.’, the extreme purple genotype, exhibited outstanding results for otypes, otypes, otypes, otypes, otypes, ana d t a a a nn n n d t h d t d t d t ei hh h h r tra ei ei ei ei r tra r tra r tra r tra nscri nn n n scri scri scri scri ptp lp p p e t l t t t vel l l l ee e e vel vel vel vel decreased decreased decreased decreased decreased ini genotypes n i i in n n genotypes genotypes genotypes genotypes 1126 11 1 1 126 126 126 126 3, 112 3, 112 3, 112 3, 112 3, 112 70 a 70 a 70 a 70 a 70 a nd nn n n 11 d d d d 11 274 11 11 11 274 274 274 274 as a ri a a a ss s s ri pen- ri ri ri pen- pen- pen- pen- otypes, and their transcript level decreased in genotypes 11263, 11270 and 11274 as ripen- TPC, TFC and FRAP in each phenophase compared to the rest of the samples. This might be ing advanced and the berries started to turn into their ripe colour. The extreme lilac gen- ing ing ing ing ing adv adv adv adv adv a anced nced aa a nced nced nced an an an an an d d t t d h d d h t e b t t e b hh h e b e b e b e err rr ee e irr ie rr rr es is e i ist e e s st s s art st art st st art e art art ed d e t e e t d o d d o t t t t t o u o o u trn t t rn uu u rn i rn rn in ni to thei to thei n i in n to thei to thei to thei r ri r ri r ri r ri r ri pe col pe col pe col pe col pe col o our. ur. oo o ur. ur. ur. The extreme li The extreme li The extreme li The extreme li The extreme li la lac gen- la c gen- la la c gen- c gen- c gen- due to the elevated amount of anthocyanins, which results in this rich dietary composition. otype, otype, ‘P ‘Pim. Ney.’, im. Ney.’, show showe ed d the the h hi ighe ghes st log t log2 2 fold fold ch change in every ange in every phenophase. This phenophase. This m mi ight ght otype, otype, otype, otype, ‘P ‘P‘P im. Ney.’, im. Ney.’, ‘P im. Ney.’, im. Ney.’, show show show show e ed d e e the d the d the the h hiih ghe ghe h ighe ighe sst log t log ss t log t log 2 2 fold fold 22 fold fold ch ch ch ange in every ange in every ch ange in every ange in every phenophase. This phenophase. This phenophase. This phenophase. This m mm iight m ght ight ight On the other hand, the anthocyanin-pigmented C. annuum breeding lines did not live up suggest tha suggest tha suggest that t t besi besi besides MY des MY des MYBa Ba Ba, these two other R2 , these two other R2 , these two other R2R3 R3 R3-M -M -MY Y YB B Bs, or s, or s, or a com a com a comb b binat inat ination ion ion of of of t t th h hem em em, re , re , regu- gu- gu- suggest tha suggest tha suggest tha tt besi besi t besi des MY des MY des MY Ba Ba Ba , these two other R2 , these two other R2 , these two other R2 R3 R3 R3 -M -M -M Y YB Y Bs, or s, or Bs, or a com a com a com b binat inat binat ion ion ion of of of t th h t em em hem , re , re , re gu- gu- gu- to the expectations, since the white-berried breeding lines usually scored higher values late the l l la a ate the te the te the anthocya a a an n nthocya thocya thocya nin synthesi ni ni nin synthesi n synthesi n synthesi s in s i s i s i the berri n n n the berri the berri the berri es of e e es of s of s of Cap Cap Cap Cap sicums s s sicums icums icums (Tab (Tab (Tab (Tab le 6) l l le e e. 6) 6) 6) ... lalte the ate the an athocya nthocya nini n synthesi n synthesi s i s i n the berri n the berri es of es of Cap Cap sicums sicums (Tab (Tab lel 6) e 6) . . for TPC, TFC and FRAP in the early phenophases. Based on this study, economically- ripe purple-berried breeding lines could not serve as functional food solely due to their anthocyanin build-up; however, other genotypes, such as the extreme purple ‘Pim. Ney.’, may be recommended as a dietary supplement or a partner in breeding programs for functional foods. As for the regulation of anthocyanin biosynthesis, we found that besides Ca10g11650, two other putative regulatory MBYs (Ca10g11690 and Ca10g11710) are also involved in the regulation of the pathway. However, to validate the exact function of the two putative regulatory MYBs, other approaches such as virus-induced gene silencing studies should be applied as well. Author Contributions: Writing—original draft preparation, Z.K.; conceptualization, reviewing, A.S. and É.B.-S.; methodology, É.B.-S. and A.V.; validation, G.C., A.S., A.V. and É.B.-S.; formal analysis, B.P., A.K.T.-L. and J.B.; funding acquisition, E.K. All authors have read and agreed to the published version of the manuscript. Funding: The publication is supported by the EFOP-3.6.3-VEKOP-16-2017-00008 project. The project is co-ﬁnanced by the European Union and the European Social Fund. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: Data contained in the article are original. Acknowledgments: The authors would like to thank lab tech Réka Rédei for her time and assistance in the experiment. Our deepest gratitude goes to Dávid Polgári and Ákos Tarnawa and to the dear colleagues of the Group of Microbial Biotechnology and Microbiomics, Katalin Posta, Ákos Juhász, Zoltán Mayer, Viktor Szentpéteri and Beatrix Rétháti, for their time, knowledge and materials that we received to carry out the research. Conﬂicts of Interest: The authors declare no conﬂict of interest. Antioxidants 2022, 11, 637 13 of 14 References 1. Lang, Y.Q.; Yanagawa, S.; Sasanuma, T.; Sasakuma, T. Orange fruit color in Capsicum due to deletion of capsanthin-capsorubin synthesis gene. Breed. Sci. 2004, 54, 33–39. [CrossRef] 2. Paran, I.; Fallik, E. Breeding for fruit quality in pepper (Capsicum spp.). In Breeding for Fruit Quality; Wiley: Hoboken, NJ, USA, 2011; pp. 307–322. 3. Wadhera, D.; Capaldi-Phillips, E.D. A Review of Visual Cues Associated with Food on Food Acceptance and Consumption. Eat. Behav. 2014, 15, 132–143. [CrossRef] [PubMed] 4. Aza-Gonzalez, C.; Herrera-Isidrón, L.; Núñez-Palenius, H.G.; De La Vega, O.; Ochoa-Alejo, N. Anthocyanin accumulation and expression analysis of biosynthesis-related genes during Chili pepper fruit development. Biol. Plant. 2013, 57, 49–55. [CrossRef] 5. Lightbourn, G.J.; Griesbach, R.J.; Novotny, J.A.; Clevidence, B.A.; Rao, D.D.; Stommel, J.R. Effects of anthocyanin and carotenoid combinations on foliage and immature fruit color of Capsicum annuum L. J. Hered. 2008, 99, 105–111. [CrossRef] [PubMed] 6. Stommel, J.R.; Griesbach, R.J. Inheritance of fruit, foliar, and plant habit attributes in Capsicum. J. Am. Soc. Hortic. Sci. 2008, 133, 396–407. [CrossRef] 7. Li, Z.; Wang, S.; Gui, X.-L.; Chang, X.-B.; Gong, Z.-H. A further analysis of the relationship between yellow ripe-fruit color and the capsanthin-capsorubin synthase gene in pepper (Capsicum sp.) indicated a new mutant variant in C. annuum and a tandem repeat structure in promoter region. PLoS ONE 2013, 8, e61996. [CrossRef] 8. Ha, S.H.; Kim, J.B.; Park, J.S.; Lee, S.W.; Cho, K.J. A comparison of the carotenoid accumulation in Capsicum varieties that show different ripening colours: Deletion of the capsanthin-capsorubin synthase gene is not a prerequisite for the formation of a yellow pepper. J. Exp. Bot. 2007, 58, 3135–3144. [CrossRef] 9. Matsufuji, H.; Nakamura, H.; Chino, M.; Takedas, M. Antioxidant activity of capsanthin and the fatty acid esters in paprika (Capsicum annuum). J. Agric. Food Chem. 1998, 46, 3468–3472. [CrossRef] 10. Kilcrease, J.; Collins, A.M.; Richins, R.D.; Timlin, J.A.; O’connell, M.A. Multiple microscopic approaches demonstrate linkage between chromoplast architecture and carotenoid composition in diverse Capsicum annuum fruit. Plant J. 2013, 76, 1074–1083. [CrossRef] 11. Kilcrease, J.; Rodriguez-Uribe, L.; Richins, R.D.; Arcos, J.M.; Victorino, J.; O’Connell, M.A. Correlations of carotenoid content and transcript abundances for ﬁbrillin and carotenogenic enzymes in Capsicum annuum fruit pericarp. Plant Sci. 2015, 232, 57–66. [CrossRef] 12. Panche, A.N.; Diwan, A.D.; Chandra, S.R. Flavonoids: An overview. J. Nutr. Sci. 2016, 5. [CrossRef] [PubMed] 13. Anaya-Esparza, L.M.; Mora, Z.V.; Vázquez-Paulino, O.; Ascencio, F.; Villarruel-López, A. Bell Peppers (Capsicum annuum L.) Losses and Wastes: Source for Food and Pharmaceutical Applications. Molecules 2021, 26, 5341. [CrossRef] [PubMed] 14. Pietta, P.G. Flavonoids as antioxidants. J. Nat. Prod. 2000, 63, 1035–1042. [CrossRef] [PubMed] 15. Agati, G.; Azzarello, E.; Pollastri, S.; Tattini, M. Flavonoids as antioxidants in plants: Location and functional signiﬁcance. Plant Sci. 2012, 196, 67–76. [CrossRef] 16. Holton, T.A.; Cornish, E.C. Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 1995, 7, 1071. [CrossRef] 17. Ohno, S.; Ueno, M.; Doi, M. Differences in the CaMYBA genome between anthocyanin-pigmented cultivars and non-pigmented cultivars in pepper (Capsicum annuum). Hortic. J. 2020, 89, 30–36. [CrossRef] 18. Borovsky, Y.; Oren-Shamir, M.; Ovadia, R.; De Jong, W.; Paran, I. The A locus that controls anthocyanin accumulation in pepper encodes a MYB transcription factor homologous to Anthocyanin2 of Petunia. Theor. Appl. Genet. 2004, 109, 23–29. [CrossRef] 19. Sun, T.; Xu, Z.; Wu, C.T.; Janes, M.; Prinyawiwatkul, W.; No, H.K. Antioxidant activities of different colored sweet bell peppers (Capsicum annuum L.). J. Food Sci. 2007, 72, 98–102. [CrossRef] 20. Lee, J.; Durst, R.W.; Wrolstad, R.E. Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: Collaborative study. J. AOAC Int. 2005, 88, 1269–1278. [CrossRef] 21. Singleton, V.L.; Rossi, J.A. Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. Am. J. Enol. Vitic. 1965, 16, 144–158. 22. Benzie, I.F.; Strain, J.J. The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: The FRAP assay. Anal. Biochem. 1996, 239, 70–76. [CrossRef] [PubMed] 23. Sytar, O.; Bosko, ´ P.; Živc ˇák, M.; Brestic, M.; Smetanska, I. Bioactive phytochemicals and antioxidant properties of the grains and sprouts of colored wheat genotypes. Molecules 2018, 23, 2282. [CrossRef] 24. Hornero-Méndez, D.; Mínguez-Mosquera, M.I. Rapid spectrophotometric determination of red and yellow isochromic carotenoid fractions in paprika and red pepper oleoresins. J. Agric. Food Chem. 2001, 49, 3584–3588. [CrossRef] [PubMed] 25. Xing, Y.; Li, X.; Xu, Q.; Yun, J.; Lu, Y.; Tang, Y. Effects of chitosan coating enriched with cinnamon oil on qualitative properties of sweet pepper (Capsicum annuum L.). Food Chem. 2011, 124, 1443–1450. [CrossRef] 26. Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 1971, 44, 276–287. [CrossRef] 27. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [CrossRef] 28. Láng, F. Növényélettan, a Növényi Anyagcsere II; ELTE Eötvös Kiadó: Budapest, Hungary, 2007. 29. Deepa, N.; Kaur, C.; George, B.; Singh, B.; Kapoor, H.C. Antioxidant constituents in some sweet pepper (Capsicum annuum L.) genotypes during maturity. LWT-Food Sci. Technol. 2007, 40, 121–129. [CrossRef] Antioxidants 2022, 11, 637 14 of 14 30. Aza-González, C.; Ochoa-Alejo, N. Characterization of anthocyanins from fruits of two Mexican chili peppers (Capsicum annuum L.). J. Mex. Chem. Soc. 2012, 56, 149–151. [CrossRef] 31. Sadilova, E.; Stintzing, F.C.; Carle, R. Anthocyanins, colour and antioxidant properties of eggplant (Solanum melongena L.) and violet pepper (Capsicum annuum L.) peel extracts. Zeitschrift Naturforschung C 2006, 61, 527–535. [CrossRef] [PubMed] 32. Bogusz, S., Jr.; Libardi, S.H.; Dias, F.F.; Coutinho, J.P.; Bochi, V.C.; Rodrigues, D.; Melo, A.M.; Godoy, H.T. Brazilian Capsicum peppers: Capsaicinoid content and antioxidant activity. J. Sci. Food Agric. 2018, 98, 217–224. [CrossRef] [PubMed] 33. Castro-Concha, L.A.; Tuyub-Che, J.; Moo-Mukul, A.; Vazquez-Flota, F.A.; Miranda-Ham, M.L. Antioxidant capacity and total phenolic content in fruit tissues from accessions of Capsicum Chinense Jacq.(Habanero pepper) at different stages of ripening. Sci. World J. 2014. [CrossRef] [PubMed] 34. Marín, A.; Ferreres, F.; Tomás-Barberán, F.A.; Gil, M.I. Characterization and quantitation of antioxidant constituents of sweet pepper (Capsicum annuum L.). J. Agric. Food Chem. 2004, 52, 3861–3869. [CrossRef] [PubMed] 35. Navarro, J.M.; Flores, P.; Garrido, C.; Martinez, V. Changes in the contents of antioxidant compounds in pepper fruits at different ripening stages, as affected by salinity. Food Chem. 2006, 96, 66–73. [CrossRef] 36. Ghasemnezhad, M.; Sherafati, M.; Payvast, G.A. Variation in phenolic compounds, ascorbic acid and antioxidant activity of ﬁve coloured bell pepper (Capsicum annuum) fruits at two different harvest times. J. Funct. Foods 2011, 3, 44–49. [CrossRef] 37. Chandel, C.; Sharma, V.K.; Rana, P.S.; Dabral, M.; Aggrawal, S.; Saklani, P. Assessment of antimicrobial and antioxidant potential of cytoplasmic male sterile lines of pepper. SN Appl. Sci. 2020, 2, 1181. [CrossRef] 38. Howard, L.R.; Talcott, S.T.; Brenes, C.H.; Villalon, B. Changes in phytochemical and antioxidant activity of selected pepper cultivars (Capsicum species) as inﬂuenced by maturity. J. Agric. Food Chem. 2000, 48, 1713–1720. [CrossRef] 39. Sim, K.H.; Sil, H.Y. Antioxidant activities of red pepper (Capsicum annuum) pericarp and seed extracts. Int. J. Food Sci. Technol. 2008, 43, 1813–1823. [CrossRef] 40. Sora, G.T.; Haminiuk, C.W.; da Silva, M.V.; Zielinski, A.A.; Gonçalves, G.A.; Bracht, A.; Peralta, R.M. A comparative study of the capsaicinoid and phenolic contents and in vitro antioxidant activities of the peppers of the genus Capsicum: An application of chemometrics. J. Food Sci. Technol. 2015, 52, 8086–8094. [CrossRef] 41. Rosa, A.; Deiana, M.; Casu, V.; Paccagnini, S.; Appendino, G.; Ballero, M.; Dessí, M.A. Antioxidant activity of capsinoids. J. Agric. Food Chem. 2002, 50, 7396–7401. [CrossRef] 42. Blanco-Ríos, A.K.; Medina-Juárez, L.Á.; González-Aguilar, G.A.; Gámez-Meza, N. Antioxidant activity of the phenolic and oily fractions of different sweet bell peppers. J. Mex. Chem. Soc. 2013, 57, 137–143. [CrossRef] 43. Garra, A.; Alkalai-Tuvia, S.; Telerman, A.; Paran, I.; Fallik, E.; Elmann, A. Anti-proliferative activities, phytochemical levels and fruit quality of pepper (Capsicum spp.) following prolonged storage. Int. J. Food Sci. Technol. 2020, 55, 3574–3584. [CrossRef] 44. Palma, J.M.; Terán, F.; Contreras-Ruiz, A.; Rodríguez-Ruiz, M.; Corpas, F.J. Antioxidant proﬁle of pepper (Capsicum annuum L.) fruits containing diverse levels of capsaicinoids. Antioxidants 2020, 9, 878. [CrossRef] [PubMed] 45. Guilherme, R.; Aires, A.; Rodrigues, N.; Peres, A.M.; Pereira, J.A. Phenolics and Antioxidant Activity of Green and Red Sweet Peppers from Organic and Conventional Agriculture: A Comparative Study. Agriculture 2020, 10, 652. [CrossRef] 46. Stommel, J.R.; Lightbourn, G.J.; Winkel, B.S.; Griesbach, R.J. Transcription factor families regulate the anthocyanin biosynthetic pathway in Capsicum annuum. J. Am. Soc. Hortic. Sci. 2009, 134, 244–251. [CrossRef] 47. Aguilar-Barragán, A.; Ochoa-Alejo, N. Virus-induced silencing of MYB and WD40 transcription factor genes affects the accumula- tion of anthocyanins in Chili pepper fruit. Biol. Plant 2014, 58, 567–574. [CrossRef] 48. Zhang, Z.; Li, D.W.; Jin, J.H.; Yin, Y.X.; Zhang, H.X.; Chai, W.G.; Gong, Z.H. VIGS approach reveals the modulation of anthocyanin biosynthetic genes by CaMYB in Chili pepper leaves. Front. Plant Sci. 2015, 6, 500. [CrossRef]

Journal

Antioxidants – Multidisciplinary Digital Publishing Institute

Published: Mar 26, 2022

Keywords: Capsicum; pepper; anthocyanin; antioxidant; secondary metabolites; gene expression; R2R3-MYB

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines

Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines

Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines

Ripening-Induced Changes in the Nutraceutical Compounds of Differently Coloured Pepper (Capsicum annuum L.) Breeding Lines

References (51)

Abstract

Journal

Recommended Articles

There are no references for this article.

Our policy towards the use of cookies