Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Effects of intermittent hydrostatic pressure magnitude on the chondrogenesis of MSCs without biochemical agents under 3D co-culture

Effects of intermittent hydrostatic pressure magnitude on the chondrogenesis of MSCs without... J Mater Sci: Mater Med (2012) 23:2773–2781 DOI 10.1007/s10856-012-4718-z Effects of intermittent hydrostatic pressure magnitude on the chondrogenesis of MSCs without biochemical agents under 3D co-culture • • • Jae Young Jeong So Hee Park Ji Won Shin • • Yun Gyeong Kang Ki-Ho Han Jung-Woog Shin Received: 16 March 2012 / Accepted: 3 July 2012 / Published online: 17 July 2012 Springer Science+Business Media, LLC 2012 Abstract Without using biochemical agents, in this and co-culturing for the proliferation and differentiation of study, we sought to investigate the potential of controlling MSCs, even without biochemical agents. the differentiation of mesenchymal stem cells (MSCs) into a specific cell type through the use of 3D co-culturing and 1 Introduction mechanical stimuli. MSCs and primary cultured chondro- cytes were separately encapsulated into alginate beads, and Compared with other stem cells, mesenchymal stem cells the two types of beads were separated by a membrane. For the investigation a computer-controllable bioreactor was (MSCs) are easy to obtain, involve fewer ethical issues, and have greater potential for clinical application. How- designed and used to engage intermittent hydrostatic pressure (IHP). Five different magnitudes (0.20, 0.10, 0.05, ever, further studies are needed on methodologies for controlling the differentiation of MSCs, which typically 0.02 MPa and no stimulation) of IHP were applied. The involves biochemical agents or mechanical stimuli. stimulation pattern was the same for all groups: 2 h/day for 7 days starting at 24 h after seeding; 2 and 15 min cycles of Recently, co-culture was introduced, and this may involve two- or 3D culture. stimulating and resting, respectively. Biochemical (DNA and GAG contents), histological (Alcian blue), and RT- The basis of each technique is to provide the stem cells with a bio-mimetic environment. The efficacy of bio- PCR (Col II, SOX9, AGC) analyses were performed on days 1, 5, 10, and 20. The results from these analyses chemical agents or growth factors has been widely acknowledged [1–4], although side effects have been showed that stimulation with higher magnitudes of IHP (C0.10 MPa) were more effective on the proliferation and reported [5, 6]. Short-term investigations of stem cell dif- ferentiation in vitro still use various biochemical agents. differentiation of co-cultured MSCs. Together, these data The use of mechanical stimuli in the control of stem cell demonstrate the potential of using mechanical stimulation differentiation relies on the fact that most cells, tissues, and organs continuously experience a mechanical environment. For example, articular chondrocytes are exposed to a J. Y. Jeong  S. H. Park  J. W. Shin  Y. G. Kang compressive environment while walking, and the endothe- J.-W. Shin (&) lial cells in arterial blood vessels experience shear stress due Department of Biomedical Engineering, Inje University, 607 to the blood flow and tension due to a compliance effect. Obang-Dong, Gimhae, Gyeongnam, Republic of Korea e-mail: [email protected] Various reports have examined mechanical stimuli. For example, tension [7, 8], dynamic compressive loading [9], K.-H. Han and hydrostatic pressure [10, 11] are reported effective at School of Nano Engineering, Inje University, 607 Obang-Dong, promoting the differentiation of stem cells into a certain cell Gimhae, Gyeongnam, Republic of Korea lineage such as smooth muscle cells and chondrocytes. In J.-W. Shin these reports, the magnitude, frequency, and duration of First Research Team/Institute of Aged Life Redesign/ their application vary widely [12–15]. For chondrocytes, the Cardiovascular and Metabolic Disease Center/UHRC, reported magnitude of compression ranged from \0.2 MPa Inje University, Gimhae, Gyongnam, Republic of Korea 123 2774 J Mater Sci: Mater Med (2012) 23:2773–2781 [15–18]to *10.0 MPa [11, 19]. Therefore, the optimal 2.2 3D co-culture system stimulation pattern should be studied further for each cell type. For 3D co-culturing, MSCs and chondrocytes were sepa- The co-culturing technique is based on the fact that stem rately encapsulated into alginate beads. First, the alginate solution was sterilized at 121 C for 15 min using an cells are affected by neighboring cells. Perhaps something secreted by the neighboring cells affects the differentiation autoclave (HB-506, Hanbek Science, Gyeonggi, Korea). After gently dissolving the 1.2 % low viscosity alginate gel of stem cells into the targeted cell type. In two-dimensional culture, the culture on the plate affects the cellular responses. (A0682, Sigma, St. Louis, MO, USA) in 0.15 M NaCl at room temperature, MSCs or chondrocytes were mixed with Chondrocytes, the targeted cell in this work, tend to lose their phenotype when cultured on a plate and should be cultured in gel solution. Then the solution was dropped into 102 mM three dimensions [20–22]. Various 3D scaffolds for chon- CaCl using a 26-gauge syringe. Each bead contained 3 3 drocyte-based tissue engineering from various stem cell 1.0 9 10 and 2.0 9 10 cells for MSCs and chondrocytes, sources were also addressed and summarized [23]. In addi- respectively. After washing the beads three times with tion 3D co-culture studies have also been reported [24, 25], DMEM-LG, the beads containing MSCs were placed first but these did not consider the mechanical environment. into a self-designed well, which was the same size as a commercially available 24-well plate (Fig. 1a). Then, a In this study, two types of cell (primary cultured chon- drocytes and MSCs) were encapsulated in alginate beads polyethylene terephthalate track-etched membrane of 3 lm pore size (24-well plate insert, 35106, SPL, Gyeonggi, separately for 3D culture. Then, they were separated with a Transwell membrane. Finally, various hydrostatic pres- Korea) was laid over the well. Finally, other beads con- sures were imposed using a hydrostatic pressurizing taining chondrocytes were placed on the membrane. Thus, system. Additionally, a positive control group with chon- a 3D co-culture system was achieved that avoided direct drocytes in alginate beads and a negative group with MSCs contact between the two different cell types (Fig. 1b). were established. Both groups were cultured in basal Additionally, chondrocytes and MSCs in beads were cul- medium without stimulation. A third control group con- tured separately in different wells, as controls. Co-cultured sisted of MSCs in alginate beads in chondrogenic medium cells were maintained in basal media (DMEM-LG) at without stimulation. 37 C and 5 % CO . The cell density ratio of MSCs to chondrocytes was 1:2 in this co-culturing system (Table 1). In this work, we investigated the potential of the 3D co- culture method combined with mechanical stimulation and Other three groups without mechanical stimuli were also set for comparison: MSCs in beads under basal or chon- the effect of the pressure magnitude. drogenic media, chondrocytes in beads under basal media (Table 1). 2 Materials and methods 2.3 Intermittent hydrostatic pressure (IHP) system 2.1 Preparation of cells and media for mechanical stimulation Two types of cells, MSCs and chondrocytes, were pre- To apply IHP to MSCs, a novel bioreactor was designed pared. MSCs and chondrocytes were obtained aseptically and fabricated (Fig. 1c). With this system, four different patterns of IHP can be engaged on four different chambers from tibias and femurs of male New Zealand White Rab- bits (*1.5 kg, 6–8 weeks). The basal medium was Dul- where the cells in alginate beads reside. IHP can be con- trolled independently through the designed system. The becco’s Modified Eagle Medium-low glucose (DMEM- LG; GibcoBRL, Grand Island, NY, USA) containing 10 % system consisted of a DAQ board (NI9485, NI9215, fetal bovine serum (FBS; GibcoBRL) and antibiotics National Instruments, Austin, Texas, USA), pressure sen- (100 U/mL penicillin, 100 lg/mL streptomycin, Gib- sors (ISE30, SMC, Tokyo, Japan), solenoid valves (SY100- coBRL). The chondrogenic medium consisted of DMEM- K, SMC), a compressor (LN2501, Jae-il Compressor, HG containing 1.0 % ITS ? Premix (BD, Sciences, Korea), and filters (Millex Vent Filter Unit, Millipore -7 Franklin Lakes, NJ, USA), 10 M dexamethasone, and Corp., Bedford, MA, USA). All processes were controlled 10 ng/mL TGF-b3 (AF-100-36E, PeproTech Inc., Rocky using LabVIEW 8.5 (National Instruments). Each chamber Hill, NJ, USA). After 7 days of primary culture, non- contained 40 wells. The size of each well was the same as that of a commercially available 24-well plate. Based on adherent cells were removed and adherent cells were cul- tured at 37 C in a humidified incubator with 5 % CO . our previous work, the pattern of IHP applied to all groups was 2 and 15 min for stimulating and resting, respectively The medium was replaced every 3 days and MSCs were used at passage 3–4. Cultured cells were harvested on days [26]. IHP was engaged 2 h/day for 7 days, starting 24 h 1, 5, 10, and 20 for chemical and histological analyses. after seeding. All experimental data were collected up to 123 J Mater Sci: Mater Med (2012) 23:2773–2781 2775 Fig. 1 a Culture chamber. Each chamber contains 40 wells. The size c Schematic diagram of the IHP bioreactor used in this study. The of each well was the same as that of a commercially available 24-well DAQ board with LabVIEW can control the pressure of each chamber plate. b Schematic drawing of the 3D co-culturing system showing independently how each cell type in alginate beads was placed and separated. Table 1 Experimental group classification Group CDR concentration (cells/mL) MSC concentration (cells/mL) Stimuli pattern Stimuli (MPa) Medium 5 4 0.20MC 1.0 9 10 5.0 9 10 (2 min/15 min) 0.20 Basal 0.10MC (2 min/15 min) 0.10 Basal 0.05MC (2 min/15 min) 0.05 Basal 0.02MC > (2 min/15 min) 0.02 Basal MC – – Basal M – 5.0 9 10 – – Basal MGF – – Chondrogenic C 1.0 9 10 – – – Basal M: mesenchymal stem cells, C: chondrocytes, GF: growth factors, numeric: pressure magnitude, 0.20MC: co-culture of M and C under 0.20 MPa, MC: co-culture of M and C without stimulation, MGF: culture of M alone with growth factors, M or C: cultured alone without stimulation day 20, enabling us to investigate the ongoing effects of the (Molecular Probes, Eugene, OR, USA). PicoGreen dye mechanical stimuli, even after IHP treatment was stopped. binds to nucleic acids, and the measured fluorescence Five different magnitudes of IHP, ranging from 0.00 to intensity reflects the concentration of DNA. The cells were 0.20 MPa, were applied to the co-cultured groups. These released from alginate beads with solubilization solution conditions are summarized in Table 1. (55 mM sodium citrate, 150 mM NaCl). Then cell membranes were dissolved using detergent 2.4 DNA content (Triton X-100, USB, Cleveland, OH, USA) and samples were centrifuged (13,000 rpm, 5 min, 4 C). PicoGreen Cell proliferation was assessed by measuring the DNA (100 lL at 1:200 in TE buffer) reagent was added to 100 content using the Quant-iT PicoGreen dsDNA reagent kit lL of each sample. After incubating for 5 min in the dark, 123 2776 J Mater Sci: Mater Med (2012) 23:2773–2781 the samples were excited at 480 nm and the fluorescence 2.8 Statistical analyses emission intensity was measured at 520 nm using a Multi- Detection Microplate Reader (Synergy HT BioTek, Wi- All measured data were analyzed statistically using anal- nooski, VT, USA). ysis of variance (ANOVA). When the ANOVA indicated a significant difference (P B 0.05) between groups, the dif- 2.5 GAG assay ference was evaluated using the least significant difference (LSD) utilizing the SPSS software (SPSS 10.0K, Lead The cells in the beads were released as described above. Technologies Inc., Haddonfield, NJ, USA). The amount of GAG was quantified using a Blyscan Assay Kit (Biocolor, Northern Ireland). Sulfated GAGs were extracted from the test samples by incubation with papain 3 Results solution (1 % w/v papain, 5 mM Na EDTA2H O, 2 2 100 mM Na HPO 7H O, 5 mM L-cysteine HCl) for 16 h The experimental results presented here focus on MSCs 2 4 2 at 60 C, and were then reacted with the dye reagent for (except for data from the control group C), because we 30 min. A 100 lg/mL sulfated GAG solution was used as a were interested in the proliferation and differentiation of MSCs. The data from Group C represent primary cultured working standard. The absorbance of each sample was analyzed using a microplate reader (Thermo Electron chondrocytes cultured alone. Corp., China) at 650 nm. 3.1 DNA content 2.6 Staining (Alcian blue) The proliferation data for MSCs and chondrocytes over time are presented in Fig. 2a. The mechanical stimuli Alginate beads harvested on days 5, 10, and 20 were clearly contributed to the higher proliferation of MSCs, embedded in optimal cutting temperature (OCT) embed- even when IHP was stopped at day 8. In the absence of ding medium (Tissue-Tek; Sakura Finetechnical Co., Ltd., mechanical stimulation, MSCs proliferated gradually dur- Tokyo, Japan) and frozen in liquid nitrogen. Frozen sec- ing the experimental period (MC, M, and MGF). However, tions (10 lm) were cut and mounted on coated glass slides. no significant difference was found between groups of MC Sulfated GAGs were visualized by incubation with 1 % and M. This suggested that the co-culturing system did not Alcian blue (pH 2.5, 3 % acetic acid, 5 g Alcian blue 89, contribute to the proliferation of MSCs, whereas IHP A5268, Sigma) for 30 min. After washing in distilled water treatment did. The MGF data indicated that growth factors for 2 min, sections were counterstained with 50 mL of were suppressed and the cells proliferated as expected. nuclear fast red solution (0.05 g nuclear fast red, 2.5 g ammonium sulfate, H O) for 5 min. Each sample was 3.2 Synthesis of GAG observed under microscope (CX70, Olympus, Tokyo, Japan). Amounts of GAG, normalized to the average quantity of DNA, are presented in Fig. 2b. The amount of GAG 2.7 RT-PCR increased over time in all groups. Up to day 5, no signifi- cant difference was found among the groups under IHP. Gene expression was assessed by RT-PCR. Total cellular However, in Groups 0.10MC and 0.20MC, significant increases in GAG were detected starting at day 10, 2 days RNA was extracted using the RNease Qiagen Mini Kit (Qiagen, Chatsworth, CA, USA). cDNA was synthesized after IHP treatment was stopped. Also, the amount of GAG using the Omniscript RT Kit (Qiagen) with 2 lL oligo(dT) synthesized in Group MC was significantly higher than that primer. The total RNA/primer mixture (2 lg total RNA, in Group M at day 20. Dramatic increases of GAG amounts 109 RT buffer, 5 mM dNTP mix, 10 unit/lL RNase in Groups MGF and C were observed over time, especially inhibitor, 10 lM oligo(dT), Omniscript RT, RNase-free after day 10. However, the proliferation of cells in these water) in a final volume of 20 lL was incubated at 37 C two groups was not as high as that in the stimulated groups. Thus, total amounts of GAG synthesized were comparable for 1 h. PCR conditions were as follows: 3 min at 94 C, followed by 30 cycles of 30 s at 94 C, 30 s at a primer- with those in the stimulated groups (data not shown). specific temperature, 1 min at 72 C, followed by a final extension at for 10 min at 72 C. The primers used in this 3.3 Histological analyses study are described in Table 2. All assessments described above were carried out four Alcian blue staining for proteoglycan (PG) in ECM revealed positive staining in alginate beads (Fig. 3). PG times, from 24 h up to 20 days of culture. 123 J Mater Sci: Mater Med (2012) 23:2773–2781 2777 Table 2 RT-PCR primers used Primer Forward (F) and reverse (R) PCR product size (bp) in this study 0 0 (5 ? 3 ) Type II collagen GCACCCATGGACATTGGAGGG 366 GACACGGAGTAGCACCATCG SOX9 CGTGGTGACAAGGGTGAGAC 827 TAGGTGATGTTCTGGGAGGC Aggrecan TTCATGAAGATGACCGACGA 326 CACACCATGAAGGCGTTCAT GAPDH CCACTTTGTGAAGCTCATTTCCT 140 TCGTCCTCCTCTGGTGCTCT Fig. 2 a Proliferation was assessed by DNA content for MSCs up to day 20. DNA levels in MSCs increased when MSCs were cultured under IHP (n = 5, *P \ 0.05). b ECM synthesis was assessed by the amount of GAG normalized by DNA content for MSCs up to day 20. GAG synthesis increased in all groups, especially for the groups under IHP (n = 5, *P \ 0.05) 123 2778 J Mater Sci: Mater Med (2012) 23:2773–2781 Fig. 3 The Alcian blue staining revealed that PG deposition in the deposition of MSCs under 0.20 MPa IHP (0.2MC) was the highest, groups treated with IHP (0.20MC, 0.10MC, 0.05MC, 0.02MC) was comparable with that in the positive control Group C at day 20. higher than that of group MC at days 10 and 20. Especially PG Original magnification: 9200 deposition showed no difference among the groups at Regarding the expression of AGC, the effect of higher day 5 (data not shown). Comparatively, PG deposition in IHP was observable even without chondrogenic media. At the mechanically stimulated groups (0.20MC, 0.10MC, day 20, the expression of AGC in the 0.01MC group was 0.05MC, 0.02MC) was higher than that of un-stimulated co- higher than that in MGF, and was even comparable with cultured group (MC) at days 10 and 20. In particular, PG that in group C. deposition of MSCs under 0.20 MPa IHP (0.20MC) was the highest and was comparable with that in the positive control Group C at day 20. 4 Discussion 3.4 Gene expression in chondrogenic differentiation This in vitro study used two major methods to investigate of MSCs the potential of regulating stem cell differentiation without biochemical agents: 3D co-culture and mechanical stimu- To further evaluate the effects of mechanical stimulation lation. Together with the groups without biochemical and co-culture on the differentiation of MSCs, the agents, a group with chondrogenic medium (MGF) was expression of genes involved in chondrogenic differentia- used to compare our results with those of the conventional tion was examined using reverse transcriptase PCR. Data method utilizing biochemical agents only. We chose the are presented in Fig. 4; typical expression including 3D co-culturing technique because we targeted chondro- GAPDH is presented in Fig. 4a. Generally, expression of cytes. The rationale for co-culture is that stem cells in the Col II, SOX9, and AGC in MSCs when stimulated was body are obviously in contact with fully developed cells, comparable with that in MSCs in chondrogenic media and there is likely communication among cells, which (Group MGF). results in stem cell differentiation. We also applied various Regarding the expression of Col II, significantly higher compressive mechanical stimuli because most cells or tis- expression was observed when MSCs were co-cultured sues experience mechanical stimulation. For example, under 0.20 and 0.10 MPa. These levels were comparable endothelial cells experience blood flow-induced shear with those of Group MGF and even with those in Group C. stress, and bone cells experience compressive forces. We In groups 0.05MC and 0.02MC, Col II expression at day 20 adopted IHP because chondrocytes in articular cartilage are was less than that at day 10, suggesting that IHP magni- predominantly exposed to compression. There are few tudes below 0.10 MPa did not provide a lasting effect after reports on 3D co-culture with mechanical stimuli. There- IHP treatment was stopped. A similar trend was observed fore, we could examine the synergic, combined effect of in the MC group. 3D co-culture and mechanical stimuli. Expression of SOX9 showed trends similar to the Among the eight groups examined (Table 1), the expression of Col II for the experimental period. SOX9 potential of co-culture can be demonstrated from the results expression was significantly higher in the higher IHP obtained for groups MC, M, MGF, and C. Regarding the groups (0.10MC, 0.20MC) than the lower IHP groups DNA content, we observed no positive or negative effects (0.05MC, 0.02MC) and the non-stimulated group (MC) at on the proliferation of MSCs. Regarding the differentiation day 20. Again, the expression levels in the 0.20MC and of the stem cells, most data including histological obser- 0.10MC groups were comparable with those in the MGF vations obtained from group MC showed a positive effect group, which was treated with chondrogenic media. compared with group M, the negative control group. 123 J Mater Sci: Mater Med (2012) 23:2773–2781 2779 Fig. 4 a Gene expression profiles for chondrogenic markers with/ the experimental period, whereas no difference was observed among without IHP, co-culture, or growth factor. The expression level of the groups of 0.05MC, 0.02MC, and MC in the absence of IHP. AGC each gene was normalized relative to the expression of GAPDH: was highly expressed under 0.10 MPa compared to other groups b type II collagen, c SOX9, d aggrecan (AGC). Expression of Col II under IHP (n = 3, *P \ 0.05) and SOX9 under 0.10 and 0.20 MPa IHP showed large increases in However, the results for the co-cultured group (MC) still Next, we investigated the effect of IHP by varying the fell short of those obtained for groups MGF and C. magnitude. Note that the IHP treatment was started 24 h Therefore, the co-culture method alone may not be suffi- after seeding and continued for 7 days. The pressurizing cient for the differentiation of MSCs into chondrocytes, pattern consisted of 2 min of pressure and a 15 min rest for although a small positive effect was observed. 2 h/day. The effect of IHP was observed readily on day 10 123 2780 J Mater Sci: Mater Med (2012) 23:2773–2781 and thereafter. Most data obtained from the four pressur- References ized groups showed positive results compared with those 1. Wang D, Park JS, Chu JS, Krakowski A, Luo K, Chen DJ, Li S. for groups MC and M. In particular, the groups exposed to Proteomic profiling of bone marrow mesenchymal stem cells higher pressure (0.10 MPa) showed significantly positive upon transforming growth factor beta 1 stimulation. J Biol Chem. results compared with those exposed to lower pressure. The 2004;279:43725–34. data from the 0.10 MC and 0.20MC groups were compa- 2. Johnstone B, Hering TM, Caplan AI, Goldberg VM, Yoo JU. In vitro chondrogenesis of bone marrow-derived mesenchymal rable to those for the positive control group, C. These progenitor cells. Exp Cell Res. 1998;238:265–72. results were confirmed by PG staining. 3. Shirasawa S, Sekiya I, Sakaguchi Y, Yagishita K, Ichinose S, Taken together, our findings confirmed that the combi- Muneta T. In vitro chondrogenesis of human synovium-derived nation of co-culture and IHP is a useful method for dif- mesenchymal stem cells: optimal condition and comparison with bone marrow-derived cells. J Cell Biochem. 2006;97:84–97. ferentiating MSCs into a designated specific cell type 4. Diekman BO, Rowland CR, Lennon DP, Caplan AI, Guilak F. without using biochemical agents, although our study was Chondrogenesis of adult stem cells from adipose tissue and bone limited to chondrocytes. marrow: induction by growth factors and cartilage-derived This study has some limitations. First, we used only one matrix. Tissue Eng Part A. 2010;16:523–33. 5. Skobe M, Hawighorst T, Jackson DG, Prevo R, Janes L, Velasco pressurizing pattern (2 min/15 min for pressurizing/rest- P, Riccardo L, Alitalo K, Claffey K, Detmar M. Induction of ing), although the magnitude of pressure was varied. The tumor lymphangiogenesis by VEGF-C promotes breast cancer pressurizing pattern was selected based on a previous study metastasis. Nat Med. 2001;7:192–8. 6. Girling JE, Donoghue JF, Lederman FL, Cann LM, Achen MG, [26]. Pressurization may induce a change in the CO con- Stacker SA, Rogers PA. Vascular endothelial growth factor-D centration in the medium, although 2 min is a relatively over-expressing tumor cells induce differential effects on uterine short period. Regarding the magnitude of the pressure, a vasculature in a mouse model of endometrial cancer. Reprod Biol wide range of magnitudes has been studied from Endocrinol. 2010;8:1–14. *10.0 MPa [12, 19]to *0.20 MPa [15–18]. However, the 7. Gwak SJ, Bhang SH, Kim IK, Kim SS, Cho SW, Jeon O, Yoo KJ, Putnam AJ, Kim BS. The effect of cyclic strain on embryonic stem physical environment of the cells in this in vitro study is cell-derived cardiomyocytes. Biomaterials. 2008;29:844–56. not the same as that in vivo. There is no extracellular 8. Kurpinski K, Chu J, Wang D, Li S. Proteomic profiling of mes- matrix surrounding the cells in vitro. Additionally, the enchymal stem cell responses to mechanical strain and TGF-b1. higher pressure should induce a change in the CO con- Cell Mol Bioeng. 2009;2:606–14. 9. Huang AH, Farrell MJ, Kim M, Mauck RL. Long-term dynamic centration in the medium. Therefore, we chose a lower loading improves the mechanical properties of chondrogenic pressure, although the relevance of lower pressure cannot mesenchymal stem cell-laden hydrogel. Eur Cell Mater. 2010; be explained clearly. Therefore, the pressurizing conditions 19:72–85. should be examined further to investigate any negative 10. Gavenis K, Kremer A, VonWalter M, Hollander DA, Schneider U, Schmidt-Rohlfing B. Effects of cyclic hydrostatic pressure on effects on the cells. Second, our study used an indirect co- the metabolism of human osteoarthritic chondrocytes cultivated culture method. To achieve a truly biomimetic environ- in a collagen gel. Artif Organs. 2007;31:91–8. ment, a direct co-culture method should be used, provided 11. Miyanishi K, Trindade MC, Linsey DP, Beaupre GS, Carter DR, that pure MSCs are studied. Finally, further systematic Goodman SB, Schurman DJ, Smith RL. Effects of hydrostatic pressure and transforming growth factor-beta 3 on adult human studies using the co-culture method should investigate the mesenchymal stem cell chondrogenesis in vitro. Tissue Eng. communication between stem cells and fully differentiated 2006;12:1419–28. cells. 12. Miyanishi K, Trindade MC, Lindsey DP, Beaupre GS, Carter DR, Goodman SB, Schurman DJ, Smith RL. Dose- and time-depen- dent effects of cyclic hydrostatic pressure on transforming growth factor-b3-induced chondrogenesis by adult human mesenchymal stem cells in vitro. Tissue Eng. 2006;12:2253–62. 5 Conclusions 13. Sah RL, Grodzinsky AJ, Plaas AH, Sandy JD. Effects of tissue compression on the hyaluronate-binding properties of newly In engaging hydrostatic pressure to have MSCs differen- synthesized proteoglycans in cartilage explants. Biochem J. tiated into chondrocytes when 3D co-cultured higher 1990;267:803–8. 14. Sah RL, Doong JY, Grodzinsky AJ, Plaas AH, Sandy JD. Effects pressure (C0.10 MPa) is effective. Therefore we could of compression on loss of newly synthesized proteoglycans and confirm that co-culturing method combined with proper proteins from cartilage explants. Arch Biochem Biophys. 1991; mechanical stimulation has potential of controlling stem 286:20–9. cell differentiation even without biochemical agents. 15. Bachrach NM, Valhmu WB, Stazzone E, Ratcliffe A, Lai WM, Mow VC. Changes in proteoglycan synthesis of chondrocytes in articular cartilage are associated with the time-dependent changes Acknowledgments This work was supported by the grants of in their mechanical environment. J Biomech. 1995;28:1561–9. Technology Innovation Program (10038667, Ministry of Knowledge 16. Kavas A, Ozdemir M, Gu ¨ rses S, Keskin D, Tezcaner A. In vitro Economy, ROK) and Priority Research Centers Program (2010- investigation and biomechanical modeling of the effects of PLF- 0020224, The Ministry of Education, Science and Technology). 123 J Mater Sci: Mater Med (2012) 23:2773–2781 2781 68 on osteoarthritis in a three-dimensional model. Biomech 22. Mauck RL, Yuan X, Tuan RS. Chondrogenic differentiation and Model Mechanobiol. 2010;10:641–50. functional maturation of bovine mesenchymal stem cells in long- 17. Kisiday JD, Frisbie DD, McIlwraith CW, Grodzinsky AJ. term agarose culture. Osteoarthritis Cartilage. 2006;14:179–89. Dynamic compression stimulates proteoglycan synthesis by 23. Huang AH, Farrell MJ, Mauck RL. Mechanics and mechanobi- mesenchymal stem cells in the absence of chondrogenic cyto- ology of mesenchymal stem cell-based engineered cartilage. kines. Tissue Eng Part A. 2009;15:1–8. J Biomech. 2010;43:128–36. 18. Scherer K, Schu ¨ nke M, Sellckau R, Hassenpflug J, Kurz B. The 24. Bian L, Zhai DY, Mauck RL, Burdick JA. Coculture of human influence of oxygen and hydrostatic pressure on articular chon- mesenchymal stem cells and articular chondrocytes reduces drocytes and adherent bone marrow cells in vitro. Biorheology. hypertrophy and enhances functional properties of engineered 2004;41:323–33. cartilage. Tissue Eng Part A. 2011;17:1137–45. 19. Ikenoue T, Trindade MCD, Lee MS, Lin EY, David J. Mecha- 25. Tortelli F, Cancedda R. Three-dimensional cultures of osteogenic noregulation of human articular chondrocyte aggrecan and type and chondrogenic cells: a tissue engineering approach to mimic I1 collagen expression by intermittent hydrostatic pressure in bone and cartilage in vitro. Eur Cells Mater. 2009;17:1–14. vitro. J Orthop Res. 2003;21:110–6. 26. Kim YJ, Park S, Lee YJ, Shin JW, Kim DH, Heo SJ, Park KD, Shin 20. Villar-Suarez V, Colaco B, Calles-Venal I, Bravo IG, Fernandez- JW. Effects of intermittent hydrostatic pressure on cell adhesive Alvarez JG, Fernandez-Caso M, Villar-Lacilla JM. Effects of extra- forces and other related parameters under various resting periods. cellular matrix on the morphology and behaviour of rabbit auricular J Biomed Mater Res B Appl Biomater. 2008;85:353–60. chondrocytes in culture. J Biomed Biotechnol. 2005;4:364–73. 21. Kessler MW, Grande DA. Tissue engineering and cartilage. Organogenesis. 2008;4:28–32. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Materials Science: Materials in Medicine Springer Journals

Effects of intermittent hydrostatic pressure magnitude on the chondrogenesis of MSCs without biochemical agents under 3D co-culture

Download PDF
9 pages

Loading next page...
 
/lp/springer-journals/effects-of-intermittent-hydrostatic-pressure-magnitude-on-the-0R40RDVb1Y

References (29)

Publisher
Springer Journals
Copyright
Copyright © 2012 by Springer Science+Business Media, LLC
Subject
Materials Science; Biomaterials; Biomedical Engineering; Regenerative Medicine/Tissue Engineering; Polymer Sciences; Ceramics, Glass, Composites, Natural Materials; Surfaces and Interfaces, Thin Films
ISSN
0957-4530
eISSN
1573-4838
DOI
10.1007/s10856-012-4718-z
pmid
22802107
Publisher site
See Article on Publisher Site

Abstract

J Mater Sci: Mater Med (2012) 23:2773–2781 DOI 10.1007/s10856-012-4718-z Effects of intermittent hydrostatic pressure magnitude on the chondrogenesis of MSCs without biochemical agents under 3D co-culture • • • Jae Young Jeong So Hee Park Ji Won Shin • • Yun Gyeong Kang Ki-Ho Han Jung-Woog Shin Received: 16 March 2012 / Accepted: 3 July 2012 / Published online: 17 July 2012 Springer Science+Business Media, LLC 2012 Abstract Without using biochemical agents, in this and co-culturing for the proliferation and differentiation of study, we sought to investigate the potential of controlling MSCs, even without biochemical agents. the differentiation of mesenchymal stem cells (MSCs) into a specific cell type through the use of 3D co-culturing and 1 Introduction mechanical stimuli. MSCs and primary cultured chondro- cytes were separately encapsulated into alginate beads, and Compared with other stem cells, mesenchymal stem cells the two types of beads were separated by a membrane. For the investigation a computer-controllable bioreactor was (MSCs) are easy to obtain, involve fewer ethical issues, and have greater potential for clinical application. How- designed and used to engage intermittent hydrostatic pressure (IHP). Five different magnitudes (0.20, 0.10, 0.05, ever, further studies are needed on methodologies for controlling the differentiation of MSCs, which typically 0.02 MPa and no stimulation) of IHP were applied. The involves biochemical agents or mechanical stimuli. stimulation pattern was the same for all groups: 2 h/day for 7 days starting at 24 h after seeding; 2 and 15 min cycles of Recently, co-culture was introduced, and this may involve two- or 3D culture. stimulating and resting, respectively. Biochemical (DNA and GAG contents), histological (Alcian blue), and RT- The basis of each technique is to provide the stem cells with a bio-mimetic environment. The efficacy of bio- PCR (Col II, SOX9, AGC) analyses were performed on days 1, 5, 10, and 20. The results from these analyses chemical agents or growth factors has been widely acknowledged [1–4], although side effects have been showed that stimulation with higher magnitudes of IHP (C0.10 MPa) were more effective on the proliferation and reported [5, 6]. Short-term investigations of stem cell dif- ferentiation in vitro still use various biochemical agents. differentiation of co-cultured MSCs. Together, these data The use of mechanical stimuli in the control of stem cell demonstrate the potential of using mechanical stimulation differentiation relies on the fact that most cells, tissues, and organs continuously experience a mechanical environment. For example, articular chondrocytes are exposed to a J. Y. Jeong  S. H. Park  J. W. Shin  Y. G. Kang compressive environment while walking, and the endothe- J.-W. Shin (&) lial cells in arterial blood vessels experience shear stress due Department of Biomedical Engineering, Inje University, 607 to the blood flow and tension due to a compliance effect. Obang-Dong, Gimhae, Gyeongnam, Republic of Korea e-mail: [email protected] Various reports have examined mechanical stimuli. For example, tension [7, 8], dynamic compressive loading [9], K.-H. Han and hydrostatic pressure [10, 11] are reported effective at School of Nano Engineering, Inje University, 607 Obang-Dong, promoting the differentiation of stem cells into a certain cell Gimhae, Gyeongnam, Republic of Korea lineage such as smooth muscle cells and chondrocytes. In J.-W. Shin these reports, the magnitude, frequency, and duration of First Research Team/Institute of Aged Life Redesign/ their application vary widely [12–15]. For chondrocytes, the Cardiovascular and Metabolic Disease Center/UHRC, reported magnitude of compression ranged from \0.2 MPa Inje University, Gimhae, Gyongnam, Republic of Korea 123 2774 J Mater Sci: Mater Med (2012) 23:2773–2781 [15–18]to *10.0 MPa [11, 19]. Therefore, the optimal 2.2 3D co-culture system stimulation pattern should be studied further for each cell type. For 3D co-culturing, MSCs and chondrocytes were sepa- The co-culturing technique is based on the fact that stem rately encapsulated into alginate beads. First, the alginate solution was sterilized at 121 C for 15 min using an cells are affected by neighboring cells. Perhaps something secreted by the neighboring cells affects the differentiation autoclave (HB-506, Hanbek Science, Gyeonggi, Korea). After gently dissolving the 1.2 % low viscosity alginate gel of stem cells into the targeted cell type. In two-dimensional culture, the culture on the plate affects the cellular responses. (A0682, Sigma, St. Louis, MO, USA) in 0.15 M NaCl at room temperature, MSCs or chondrocytes were mixed with Chondrocytes, the targeted cell in this work, tend to lose their phenotype when cultured on a plate and should be cultured in gel solution. Then the solution was dropped into 102 mM three dimensions [20–22]. Various 3D scaffolds for chon- CaCl using a 26-gauge syringe. Each bead contained 3 3 drocyte-based tissue engineering from various stem cell 1.0 9 10 and 2.0 9 10 cells for MSCs and chondrocytes, sources were also addressed and summarized [23]. In addi- respectively. After washing the beads three times with tion 3D co-culture studies have also been reported [24, 25], DMEM-LG, the beads containing MSCs were placed first but these did not consider the mechanical environment. into a self-designed well, which was the same size as a commercially available 24-well plate (Fig. 1a). Then, a In this study, two types of cell (primary cultured chon- drocytes and MSCs) were encapsulated in alginate beads polyethylene terephthalate track-etched membrane of 3 lm pore size (24-well plate insert, 35106, SPL, Gyeonggi, separately for 3D culture. Then, they were separated with a Transwell membrane. Finally, various hydrostatic pres- Korea) was laid over the well. Finally, other beads con- sures were imposed using a hydrostatic pressurizing taining chondrocytes were placed on the membrane. Thus, system. Additionally, a positive control group with chon- a 3D co-culture system was achieved that avoided direct drocytes in alginate beads and a negative group with MSCs contact between the two different cell types (Fig. 1b). were established. Both groups were cultured in basal Additionally, chondrocytes and MSCs in beads were cul- medium without stimulation. A third control group con- tured separately in different wells, as controls. Co-cultured sisted of MSCs in alginate beads in chondrogenic medium cells were maintained in basal media (DMEM-LG) at without stimulation. 37 C and 5 % CO . The cell density ratio of MSCs to chondrocytes was 1:2 in this co-culturing system (Table 1). In this work, we investigated the potential of the 3D co- culture method combined with mechanical stimulation and Other three groups without mechanical stimuli were also set for comparison: MSCs in beads under basal or chon- the effect of the pressure magnitude. drogenic media, chondrocytes in beads under basal media (Table 1). 2 Materials and methods 2.3 Intermittent hydrostatic pressure (IHP) system 2.1 Preparation of cells and media for mechanical stimulation Two types of cells, MSCs and chondrocytes, were pre- To apply IHP to MSCs, a novel bioreactor was designed pared. MSCs and chondrocytes were obtained aseptically and fabricated (Fig. 1c). With this system, four different patterns of IHP can be engaged on four different chambers from tibias and femurs of male New Zealand White Rab- bits (*1.5 kg, 6–8 weeks). The basal medium was Dul- where the cells in alginate beads reside. IHP can be con- trolled independently through the designed system. The becco’s Modified Eagle Medium-low glucose (DMEM- LG; GibcoBRL, Grand Island, NY, USA) containing 10 % system consisted of a DAQ board (NI9485, NI9215, fetal bovine serum (FBS; GibcoBRL) and antibiotics National Instruments, Austin, Texas, USA), pressure sen- (100 U/mL penicillin, 100 lg/mL streptomycin, Gib- sors (ISE30, SMC, Tokyo, Japan), solenoid valves (SY100- coBRL). The chondrogenic medium consisted of DMEM- K, SMC), a compressor (LN2501, Jae-il Compressor, HG containing 1.0 % ITS ? Premix (BD, Sciences, Korea), and filters (Millex Vent Filter Unit, Millipore -7 Franklin Lakes, NJ, USA), 10 M dexamethasone, and Corp., Bedford, MA, USA). All processes were controlled 10 ng/mL TGF-b3 (AF-100-36E, PeproTech Inc., Rocky using LabVIEW 8.5 (National Instruments). Each chamber Hill, NJ, USA). After 7 days of primary culture, non- contained 40 wells. The size of each well was the same as that of a commercially available 24-well plate. Based on adherent cells were removed and adherent cells were cul- tured at 37 C in a humidified incubator with 5 % CO . our previous work, the pattern of IHP applied to all groups was 2 and 15 min for stimulating and resting, respectively The medium was replaced every 3 days and MSCs were used at passage 3–4. Cultured cells were harvested on days [26]. IHP was engaged 2 h/day for 7 days, starting 24 h 1, 5, 10, and 20 for chemical and histological analyses. after seeding. All experimental data were collected up to 123 J Mater Sci: Mater Med (2012) 23:2773–2781 2775 Fig. 1 a Culture chamber. Each chamber contains 40 wells. The size c Schematic diagram of the IHP bioreactor used in this study. The of each well was the same as that of a commercially available 24-well DAQ board with LabVIEW can control the pressure of each chamber plate. b Schematic drawing of the 3D co-culturing system showing independently how each cell type in alginate beads was placed and separated. Table 1 Experimental group classification Group CDR concentration (cells/mL) MSC concentration (cells/mL) Stimuli pattern Stimuli (MPa) Medium 5 4 0.20MC 1.0 9 10 5.0 9 10 (2 min/15 min) 0.20 Basal 0.10MC (2 min/15 min) 0.10 Basal 0.05MC (2 min/15 min) 0.05 Basal 0.02MC > (2 min/15 min) 0.02 Basal MC – – Basal M – 5.0 9 10 – – Basal MGF – – Chondrogenic C 1.0 9 10 – – – Basal M: mesenchymal stem cells, C: chondrocytes, GF: growth factors, numeric: pressure magnitude, 0.20MC: co-culture of M and C under 0.20 MPa, MC: co-culture of M and C without stimulation, MGF: culture of M alone with growth factors, M or C: cultured alone without stimulation day 20, enabling us to investigate the ongoing effects of the (Molecular Probes, Eugene, OR, USA). PicoGreen dye mechanical stimuli, even after IHP treatment was stopped. binds to nucleic acids, and the measured fluorescence Five different magnitudes of IHP, ranging from 0.00 to intensity reflects the concentration of DNA. The cells were 0.20 MPa, were applied to the co-cultured groups. These released from alginate beads with solubilization solution conditions are summarized in Table 1. (55 mM sodium citrate, 150 mM NaCl). Then cell membranes were dissolved using detergent 2.4 DNA content (Triton X-100, USB, Cleveland, OH, USA) and samples were centrifuged (13,000 rpm, 5 min, 4 C). PicoGreen Cell proliferation was assessed by measuring the DNA (100 lL at 1:200 in TE buffer) reagent was added to 100 content using the Quant-iT PicoGreen dsDNA reagent kit lL of each sample. After incubating for 5 min in the dark, 123 2776 J Mater Sci: Mater Med (2012) 23:2773–2781 the samples were excited at 480 nm and the fluorescence 2.8 Statistical analyses emission intensity was measured at 520 nm using a Multi- Detection Microplate Reader (Synergy HT BioTek, Wi- All measured data were analyzed statistically using anal- nooski, VT, USA). ysis of variance (ANOVA). When the ANOVA indicated a significant difference (P B 0.05) between groups, the dif- 2.5 GAG assay ference was evaluated using the least significant difference (LSD) utilizing the SPSS software (SPSS 10.0K, Lead The cells in the beads were released as described above. Technologies Inc., Haddonfield, NJ, USA). The amount of GAG was quantified using a Blyscan Assay Kit (Biocolor, Northern Ireland). Sulfated GAGs were extracted from the test samples by incubation with papain 3 Results solution (1 % w/v papain, 5 mM Na EDTA2H O, 2 2 100 mM Na HPO 7H O, 5 mM L-cysteine HCl) for 16 h The experimental results presented here focus on MSCs 2 4 2 at 60 C, and were then reacted with the dye reagent for (except for data from the control group C), because we 30 min. A 100 lg/mL sulfated GAG solution was used as a were interested in the proliferation and differentiation of MSCs. The data from Group C represent primary cultured working standard. The absorbance of each sample was analyzed using a microplate reader (Thermo Electron chondrocytes cultured alone. Corp., China) at 650 nm. 3.1 DNA content 2.6 Staining (Alcian blue) The proliferation data for MSCs and chondrocytes over time are presented in Fig. 2a. The mechanical stimuli Alginate beads harvested on days 5, 10, and 20 were clearly contributed to the higher proliferation of MSCs, embedded in optimal cutting temperature (OCT) embed- even when IHP was stopped at day 8. In the absence of ding medium (Tissue-Tek; Sakura Finetechnical Co., Ltd., mechanical stimulation, MSCs proliferated gradually dur- Tokyo, Japan) and frozen in liquid nitrogen. Frozen sec- ing the experimental period (MC, M, and MGF). However, tions (10 lm) were cut and mounted on coated glass slides. no significant difference was found between groups of MC Sulfated GAGs were visualized by incubation with 1 % and M. This suggested that the co-culturing system did not Alcian blue (pH 2.5, 3 % acetic acid, 5 g Alcian blue 89, contribute to the proliferation of MSCs, whereas IHP A5268, Sigma) for 30 min. After washing in distilled water treatment did. The MGF data indicated that growth factors for 2 min, sections were counterstained with 50 mL of were suppressed and the cells proliferated as expected. nuclear fast red solution (0.05 g nuclear fast red, 2.5 g ammonium sulfate, H O) for 5 min. Each sample was 3.2 Synthesis of GAG observed under microscope (CX70, Olympus, Tokyo, Japan). Amounts of GAG, normalized to the average quantity of DNA, are presented in Fig. 2b. The amount of GAG 2.7 RT-PCR increased over time in all groups. Up to day 5, no signifi- cant difference was found among the groups under IHP. Gene expression was assessed by RT-PCR. Total cellular However, in Groups 0.10MC and 0.20MC, significant increases in GAG were detected starting at day 10, 2 days RNA was extracted using the RNease Qiagen Mini Kit (Qiagen, Chatsworth, CA, USA). cDNA was synthesized after IHP treatment was stopped. Also, the amount of GAG using the Omniscript RT Kit (Qiagen) with 2 lL oligo(dT) synthesized in Group MC was significantly higher than that primer. The total RNA/primer mixture (2 lg total RNA, in Group M at day 20. Dramatic increases of GAG amounts 109 RT buffer, 5 mM dNTP mix, 10 unit/lL RNase in Groups MGF and C were observed over time, especially inhibitor, 10 lM oligo(dT), Omniscript RT, RNase-free after day 10. However, the proliferation of cells in these water) in a final volume of 20 lL was incubated at 37 C two groups was not as high as that in the stimulated groups. Thus, total amounts of GAG synthesized were comparable for 1 h. PCR conditions were as follows: 3 min at 94 C, followed by 30 cycles of 30 s at 94 C, 30 s at a primer- with those in the stimulated groups (data not shown). specific temperature, 1 min at 72 C, followed by a final extension at for 10 min at 72 C. The primers used in this 3.3 Histological analyses study are described in Table 2. All assessments described above were carried out four Alcian blue staining for proteoglycan (PG) in ECM revealed positive staining in alginate beads (Fig. 3). PG times, from 24 h up to 20 days of culture. 123 J Mater Sci: Mater Med (2012) 23:2773–2781 2777 Table 2 RT-PCR primers used Primer Forward (F) and reverse (R) PCR product size (bp) in this study 0 0 (5 ? 3 ) Type II collagen GCACCCATGGACATTGGAGGG 366 GACACGGAGTAGCACCATCG SOX9 CGTGGTGACAAGGGTGAGAC 827 TAGGTGATGTTCTGGGAGGC Aggrecan TTCATGAAGATGACCGACGA 326 CACACCATGAAGGCGTTCAT GAPDH CCACTTTGTGAAGCTCATTTCCT 140 TCGTCCTCCTCTGGTGCTCT Fig. 2 a Proliferation was assessed by DNA content for MSCs up to day 20. DNA levels in MSCs increased when MSCs were cultured under IHP (n = 5, *P \ 0.05). b ECM synthesis was assessed by the amount of GAG normalized by DNA content for MSCs up to day 20. GAG synthesis increased in all groups, especially for the groups under IHP (n = 5, *P \ 0.05) 123 2778 J Mater Sci: Mater Med (2012) 23:2773–2781 Fig. 3 The Alcian blue staining revealed that PG deposition in the deposition of MSCs under 0.20 MPa IHP (0.2MC) was the highest, groups treated with IHP (0.20MC, 0.10MC, 0.05MC, 0.02MC) was comparable with that in the positive control Group C at day 20. higher than that of group MC at days 10 and 20. Especially PG Original magnification: 9200 deposition showed no difference among the groups at Regarding the expression of AGC, the effect of higher day 5 (data not shown). Comparatively, PG deposition in IHP was observable even without chondrogenic media. At the mechanically stimulated groups (0.20MC, 0.10MC, day 20, the expression of AGC in the 0.01MC group was 0.05MC, 0.02MC) was higher than that of un-stimulated co- higher than that in MGF, and was even comparable with cultured group (MC) at days 10 and 20. In particular, PG that in group C. deposition of MSCs under 0.20 MPa IHP (0.20MC) was the highest and was comparable with that in the positive control Group C at day 20. 4 Discussion 3.4 Gene expression in chondrogenic differentiation This in vitro study used two major methods to investigate of MSCs the potential of regulating stem cell differentiation without biochemical agents: 3D co-culture and mechanical stimu- To further evaluate the effects of mechanical stimulation lation. Together with the groups without biochemical and co-culture on the differentiation of MSCs, the agents, a group with chondrogenic medium (MGF) was expression of genes involved in chondrogenic differentia- used to compare our results with those of the conventional tion was examined using reverse transcriptase PCR. Data method utilizing biochemical agents only. We chose the are presented in Fig. 4; typical expression including 3D co-culturing technique because we targeted chondro- GAPDH is presented in Fig. 4a. Generally, expression of cytes. The rationale for co-culture is that stem cells in the Col II, SOX9, and AGC in MSCs when stimulated was body are obviously in contact with fully developed cells, comparable with that in MSCs in chondrogenic media and there is likely communication among cells, which (Group MGF). results in stem cell differentiation. We also applied various Regarding the expression of Col II, significantly higher compressive mechanical stimuli because most cells or tis- expression was observed when MSCs were co-cultured sues experience mechanical stimulation. For example, under 0.20 and 0.10 MPa. These levels were comparable endothelial cells experience blood flow-induced shear with those of Group MGF and even with those in Group C. stress, and bone cells experience compressive forces. We In groups 0.05MC and 0.02MC, Col II expression at day 20 adopted IHP because chondrocytes in articular cartilage are was less than that at day 10, suggesting that IHP magni- predominantly exposed to compression. There are few tudes below 0.10 MPa did not provide a lasting effect after reports on 3D co-culture with mechanical stimuli. There- IHP treatment was stopped. A similar trend was observed fore, we could examine the synergic, combined effect of in the MC group. 3D co-culture and mechanical stimuli. Expression of SOX9 showed trends similar to the Among the eight groups examined (Table 1), the expression of Col II for the experimental period. SOX9 potential of co-culture can be demonstrated from the results expression was significantly higher in the higher IHP obtained for groups MC, M, MGF, and C. Regarding the groups (0.10MC, 0.20MC) than the lower IHP groups DNA content, we observed no positive or negative effects (0.05MC, 0.02MC) and the non-stimulated group (MC) at on the proliferation of MSCs. Regarding the differentiation day 20. Again, the expression levels in the 0.20MC and of the stem cells, most data including histological obser- 0.10MC groups were comparable with those in the MGF vations obtained from group MC showed a positive effect group, which was treated with chondrogenic media. compared with group M, the negative control group. 123 J Mater Sci: Mater Med (2012) 23:2773–2781 2779 Fig. 4 a Gene expression profiles for chondrogenic markers with/ the experimental period, whereas no difference was observed among without IHP, co-culture, or growth factor. The expression level of the groups of 0.05MC, 0.02MC, and MC in the absence of IHP. AGC each gene was normalized relative to the expression of GAPDH: was highly expressed under 0.10 MPa compared to other groups b type II collagen, c SOX9, d aggrecan (AGC). Expression of Col II under IHP (n = 3, *P \ 0.05) and SOX9 under 0.10 and 0.20 MPa IHP showed large increases in However, the results for the co-cultured group (MC) still Next, we investigated the effect of IHP by varying the fell short of those obtained for groups MGF and C. magnitude. Note that the IHP treatment was started 24 h Therefore, the co-culture method alone may not be suffi- after seeding and continued for 7 days. The pressurizing cient for the differentiation of MSCs into chondrocytes, pattern consisted of 2 min of pressure and a 15 min rest for although a small positive effect was observed. 2 h/day. The effect of IHP was observed readily on day 10 123 2780 J Mater Sci: Mater Med (2012) 23:2773–2781 and thereafter. Most data obtained from the four pressur- References ized groups showed positive results compared with those 1. Wang D, Park JS, Chu JS, Krakowski A, Luo K, Chen DJ, Li S. for groups MC and M. In particular, the groups exposed to Proteomic profiling of bone marrow mesenchymal stem cells higher pressure (0.10 MPa) showed significantly positive upon transforming growth factor beta 1 stimulation. J Biol Chem. results compared with those exposed to lower pressure. The 2004;279:43725–34. data from the 0.10 MC and 0.20MC groups were compa- 2. Johnstone B, Hering TM, Caplan AI, Goldberg VM, Yoo JU. In vitro chondrogenesis of bone marrow-derived mesenchymal rable to those for the positive control group, C. These progenitor cells. Exp Cell Res. 1998;238:265–72. results were confirmed by PG staining. 3. Shirasawa S, Sekiya I, Sakaguchi Y, Yagishita K, Ichinose S, Taken together, our findings confirmed that the combi- Muneta T. In vitro chondrogenesis of human synovium-derived nation of co-culture and IHP is a useful method for dif- mesenchymal stem cells: optimal condition and comparison with bone marrow-derived cells. J Cell Biochem. 2006;97:84–97. ferentiating MSCs into a designated specific cell type 4. Diekman BO, Rowland CR, Lennon DP, Caplan AI, Guilak F. without using biochemical agents, although our study was Chondrogenesis of adult stem cells from adipose tissue and bone limited to chondrocytes. marrow: induction by growth factors and cartilage-derived This study has some limitations. First, we used only one matrix. Tissue Eng Part A. 2010;16:523–33. 5. Skobe M, Hawighorst T, Jackson DG, Prevo R, Janes L, Velasco pressurizing pattern (2 min/15 min for pressurizing/rest- P, Riccardo L, Alitalo K, Claffey K, Detmar M. Induction of ing), although the magnitude of pressure was varied. The tumor lymphangiogenesis by VEGF-C promotes breast cancer pressurizing pattern was selected based on a previous study metastasis. Nat Med. 2001;7:192–8. 6. Girling JE, Donoghue JF, Lederman FL, Cann LM, Achen MG, [26]. Pressurization may induce a change in the CO con- Stacker SA, Rogers PA. Vascular endothelial growth factor-D centration in the medium, although 2 min is a relatively over-expressing tumor cells induce differential effects on uterine short period. Regarding the magnitude of the pressure, a vasculature in a mouse model of endometrial cancer. Reprod Biol wide range of magnitudes has been studied from Endocrinol. 2010;8:1–14. *10.0 MPa [12, 19]to *0.20 MPa [15–18]. However, the 7. Gwak SJ, Bhang SH, Kim IK, Kim SS, Cho SW, Jeon O, Yoo KJ, Putnam AJ, Kim BS. The effect of cyclic strain on embryonic stem physical environment of the cells in this in vitro study is cell-derived cardiomyocytes. Biomaterials. 2008;29:844–56. not the same as that in vivo. There is no extracellular 8. Kurpinski K, Chu J, Wang D, Li S. Proteomic profiling of mes- matrix surrounding the cells in vitro. Additionally, the enchymal stem cell responses to mechanical strain and TGF-b1. higher pressure should induce a change in the CO con- Cell Mol Bioeng. 2009;2:606–14. 9. Huang AH, Farrell MJ, Kim M, Mauck RL. Long-term dynamic centration in the medium. Therefore, we chose a lower loading improves the mechanical properties of chondrogenic pressure, although the relevance of lower pressure cannot mesenchymal stem cell-laden hydrogel. Eur Cell Mater. 2010; be explained clearly. Therefore, the pressurizing conditions 19:72–85. should be examined further to investigate any negative 10. Gavenis K, Kremer A, VonWalter M, Hollander DA, Schneider U, Schmidt-Rohlfing B. Effects of cyclic hydrostatic pressure on effects on the cells. Second, our study used an indirect co- the metabolism of human osteoarthritic chondrocytes cultivated culture method. To achieve a truly biomimetic environ- in a collagen gel. Artif Organs. 2007;31:91–8. ment, a direct co-culture method should be used, provided 11. Miyanishi K, Trindade MC, Linsey DP, Beaupre GS, Carter DR, that pure MSCs are studied. Finally, further systematic Goodman SB, Schurman DJ, Smith RL. Effects of hydrostatic pressure and transforming growth factor-beta 3 on adult human studies using the co-culture method should investigate the mesenchymal stem cell chondrogenesis in vitro. Tissue Eng. communication between stem cells and fully differentiated 2006;12:1419–28. cells. 12. Miyanishi K, Trindade MC, Lindsey DP, Beaupre GS, Carter DR, Goodman SB, Schurman DJ, Smith RL. Dose- and time-depen- dent effects of cyclic hydrostatic pressure on transforming growth factor-b3-induced chondrogenesis by adult human mesenchymal stem cells in vitro. Tissue Eng. 2006;12:2253–62. 5 Conclusions 13. Sah RL, Grodzinsky AJ, Plaas AH, Sandy JD. Effects of tissue compression on the hyaluronate-binding properties of newly In engaging hydrostatic pressure to have MSCs differen- synthesized proteoglycans in cartilage explants. Biochem J. tiated into chondrocytes when 3D co-cultured higher 1990;267:803–8. 14. Sah RL, Doong JY, Grodzinsky AJ, Plaas AH, Sandy JD. Effects pressure (C0.10 MPa) is effective. Therefore we could of compression on loss of newly synthesized proteoglycans and confirm that co-culturing method combined with proper proteins from cartilage explants. Arch Biochem Biophys. 1991; mechanical stimulation has potential of controlling stem 286:20–9. cell differentiation even without biochemical agents. 15. Bachrach NM, Valhmu WB, Stazzone E, Ratcliffe A, Lai WM, Mow VC. Changes in proteoglycan synthesis of chondrocytes in articular cartilage are associated with the time-dependent changes Acknowledgments This work was supported by the grants of in their mechanical environment. J Biomech. 1995;28:1561–9. Technology Innovation Program (10038667, Ministry of Knowledge 16. Kavas A, Ozdemir M, Gu ¨ rses S, Keskin D, Tezcaner A. In vitro Economy, ROK) and Priority Research Centers Program (2010- investigation and biomechanical modeling of the effects of PLF- 0020224, The Ministry of Education, Science and Technology). 123 J Mater Sci: Mater Med (2012) 23:2773–2781 2781 68 on osteoarthritis in a three-dimensional model. Biomech 22. Mauck RL, Yuan X, Tuan RS. Chondrogenic differentiation and Model Mechanobiol. 2010;10:641–50. functional maturation of bovine mesenchymal stem cells in long- 17. Kisiday JD, Frisbie DD, McIlwraith CW, Grodzinsky AJ. term agarose culture. Osteoarthritis Cartilage. 2006;14:179–89. Dynamic compression stimulates proteoglycan synthesis by 23. Huang AH, Farrell MJ, Mauck RL. Mechanics and mechanobi- mesenchymal stem cells in the absence of chondrogenic cyto- ology of mesenchymal stem cell-based engineered cartilage. kines. Tissue Eng Part A. 2009;15:1–8. J Biomech. 2010;43:128–36. 18. Scherer K, Schu ¨ nke M, Sellckau R, Hassenpflug J, Kurz B. The 24. Bian L, Zhai DY, Mauck RL, Burdick JA. Coculture of human influence of oxygen and hydrostatic pressure on articular chon- mesenchymal stem cells and articular chondrocytes reduces drocytes and adherent bone marrow cells in vitro. Biorheology. hypertrophy and enhances functional properties of engineered 2004;41:323–33. cartilage. Tissue Eng Part A. 2011;17:1137–45. 19. Ikenoue T, Trindade MCD, Lee MS, Lin EY, David J. Mecha- 25. Tortelli F, Cancedda R. Three-dimensional cultures of osteogenic noregulation of human articular chondrocyte aggrecan and type and chondrogenic cells: a tissue engineering approach to mimic I1 collagen expression by intermittent hydrostatic pressure in bone and cartilage in vitro. Eur Cells Mater. 2009;17:1–14. vitro. J Orthop Res. 2003;21:110–6. 26. Kim YJ, Park S, Lee YJ, Shin JW, Kim DH, Heo SJ, Park KD, Shin 20. Villar-Suarez V, Colaco B, Calles-Venal I, Bravo IG, Fernandez- JW. Effects of intermittent hydrostatic pressure on cell adhesive Alvarez JG, Fernandez-Caso M, Villar-Lacilla JM. Effects of extra- forces and other related parameters under various resting periods. cellular matrix on the morphology and behaviour of rabbit auricular J Biomed Mater Res B Appl Biomater. 2008;85:353–60. chondrocytes in culture. J Biomed Biotechnol. 2005;4:364–73. 21. Kessler MW, Grande DA. Tissue engineering and cartilage. Organogenesis. 2008;4:28–32.

Journal

Journal of Materials Science: Materials in Medicine – Springer Journals

Published: Jul 17, 2012

There are no references for this article.