Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Conservation of sequence in recombination signal sequence spacers

Conservation of sequence in recombination signal sequence spacers Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 © 1994 Oxford University Press Nucleic Acids Research, 1994, Vol. 22, No. 10 1785-1796 Conservation of sequence in recombination signal sequence spacers Dale A.Ramsden+, Kristin Baetz and Gillian E.Wu* Department of Immunology, University of Toronto, Toronto, Ontario M5S 1A8 and The Wellesley Hospital Research Institute, 160 Wellesley Street East, Toronto, Ontario M4Y 1J3, Canada Received October 21, 1993; Revised and Accepted April 13, 1994 ABSTRACT The variable domains of immunoglobulins and T cell resulting in a definition of two classes of RSS, both possessing receptors are assembled through the somatic, site identical conserved seven bp (heptamer) and nine bp (nonamer) specific recombination of multiple germline segments motifs. One class has an approximately 12 bp spacer of non- (V, D, and J segments) or V(D)J rearrangement. The conserved sequence separating the heptamer and nonamer motifs, while the other class has an approximately 23 bp spacer [5] recombination signal sequence (RSS) is necessary and sufficient for cell type specific targeting of the V(D)J V(D)J rearrangement occurs efficiently only between a 12 bp rearrangement machinery to these germline segments. spacer RSS and a 23 bp spacer RSS. Previously, the RSS has been described as possessing The RSS spacers, as previously discussed, are generally both a conserved heptamer and a conserved nonamer assumed to lack conserved sequence. The overall sequence motif. The heptamer and nonamer motifs are separated composition of the spacer was considered as potentially signifi- by a 'spacer' that was not thought to possess cant, however, as early mechanisms of V(D)J rearrangement significant sequence conservation, however the length suggested that a recombination intermediate required melting of of the spacer could be either 12 +/ - 1 bp or 23 +/ - RSS DNA [1]. Two experiments, involving complete substitution 1 bp long. In this report we have assembled and of spacer sequence with GC base pairs, attempted to address this analyzed an extensive data base of published RSS. We question, and have conflicting results. Experiments by Sakano have derived, through extensive consensus and colleagues suggested that GC substitution of an RSS spacer comparison, a more detailed description of the RSS resulted in an impairment of recombination frequency [3], while than has previously been reported. Our analysis in experiments by Lieber and colleagues the authors suggest that indicates that RSS spacers possess significant GC substitution of RSS spacers made no significant difference [6] conservation of sequence, and that the conserved Previous consensus analysis of RSS have concentrated on the sequence in 12 bp spacers is similar to the conserved heptamer and nonamer [7] We have used the considerable sequence in the first half of 23 bp spacers. increase in the number of sequenced RSS present in the data bases to analyse the spacer sequences. We have constructed a large database of aligned, functional RSS from different species and INTRODUCTION different loci, classified according to the size of the RSS spacer. A comprehensive RSS consensus, based upon classification by The adaptive immune response in vertebrates combats RSS spacer size and including heptamer and nonamer motifs as environmental pathogens by the use of a vast repertoire of antigen well as the spacer, is presented. In contrast to previous definitions specific receptors (immunoglobulins and T cell receptors). The of RSS, we observed significant conservation of sequence in RSS diversity of this repertoire is resident in the variable domain, spacers. Moreover, the conserved sequence for 12 bp spacers which is assembled though a somatic, cell type specific process is similar to the conserved sequence in the first half of 23 bp involving the site specific recombination of germline V, D and spacers. J segments [V(D)J rearrangement]. Adjacent to the coding sequence of all V, D and J segments that are capable of V(D)J rearrangement is a conserved non- MATERIALS AND METHODS coding sequence that functions as a targeting signal for RSS analysis recombination, termed the recombination signal sequence (RSS) Alignment of RSS. We have obtained 453 examples of RSS, from [1,2] Recombination substrates have demonstrated that RSS are both necessary and sufficient for targeting of V(D)J different species and different loci (see Tables 1 and 2). Sequences rearrangement to lymphoid cell types [3, 4] RSS were originally were retrieved from GenBank (release 67.0) or the specified defined through alignment and comparison of multiple examples, references using 'lineup', a Genetics Computer Group [8] (GCG) *To whom correspondence should be addressed +Presem address: National Institutes of Health, NIDDK, Room 312, Building 5, Bethesda, MD 20892, USA Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1786 Nucleic Acids Research, 1994, Vol. 22, No. 10 Table 1. Sources of 12 RSS program that allows visual alignment of multiple sequences. As our primary goal is to relate sequence conservation to function, Species we exclude RSS that are associated with a pseudo-gene segment Mus Hum Chk Rab Hef Xel Rat Bov Shp Duk totals Locus (as defined by the ability to contribute to a functional, mature - - - - 94 IGHD 20 32 16 12 12 2 protein), and classified the RSS solely on the length of the spacer. IGK V 30 17 5 2 3 57 IGXJ 3 4 1 - . 1 1 1 11 Care was taken to include only one example of a given gene TcRaJ 46 5 51 segment's RSS when multiple versions of the same gene segment . . . 25 TcRpj 12 13 were present in GenBank. We note that while considerable effort 2 2 - - 4 TcRpD has been expended to ensure this database is comprehensive, it - 1 - - 5 TCRYJ 2 2 is not complete. We define here an abbreviation to aid in future TcR6D 2 2 4 description of the RSS: RSS derived from 12 bp spacer RSS will - . - - . 4 TcR6J 2 2 be referred to as 12 RSS, while RSS derived from 23 bp spacer 3 1 1 1 totals 119 79 17 17 14 3 255 RSS will be referred to as 23 RSS. Abbreviations: IG; immunoglobulin. TcR; T cell receptor. H; heavy chain, x; Sequences were aligned using 'pileup', a GCG program that light chain of the kappa isotype. X; light chain of the lambda isotype. Isotype classification for Xel and Hef chains is not clear, however they are grouped with aligns groups of sequences based on comparison of the closest whatever light chain isotype has the same sized RSS spacer for the purposes of related pairs, and introduces gaps to promote optimal alignment. these tables, a; T cell receptor alpha chain. 0; T cell receptor beta chain. 7; As experiments suggest that RSS function efficiently only if the T cell receptor gamma chain. 8; T cell receptor delta chain. V; variable gene first three nucleotides of the heptamer are fixed at CAC, and segment. D; diversity gene segment. J; joining gene segment. Species are Mus; the heptamer and nonamer are separated by a spacer with Mouse (Mus musculus). Hum; Human (Homo sapiens). Xel; Frog (Xenopus laevis). Shp; Sheep (Ovis aries). Hef; Horned shark (Heterodontus francisats). variation in length of 11 — 13 bp or 22 - 24 bp only [7], gaps were Rab; Rabbit (Oryctolagus cuniculus). Chk; Chicken (Gallus gallus). Bov; Cow inserted for optimal alignment based on these criteria. This was (Bos taunts). Rat; Rat, (Rattus norvegicus). Duk; Muscovy duck. achieved using the pileup parameters 'gap weight' set at three, and 'gap length weight' set at 0.2. (see Tables 3 and 4). As similar sequences are often grouped together in these tables, gap position Table 2. Sources of 23 RSS may occasionally appear somewhat idiosyncratic when limited Species portions of the database are observed. Moreover, while the gap Locus Mus Hum Xel Shp Hef Rab Chk Rat Ouk totals weight and gap length parameters applied resulted in largely 12 IGHV 32 25 16 4 5 1 83 and 23 bp spacers, as hoped, RSS that appear to have longer - - IGHD 4 4 spacers than 12 or 24 bp cannot accommodate extensive gaps IGHJ 4 5 - 4 4 1 1 19 without high penalty, and thus may appear misaligned. IGKJ 4 5 2 1 5 17 3 9 14 1 1 2 30 IGXV - . . TcRaV 9 2 11 Consensus determination. Consensus sequences were determined TcR&V 8 8 16 using the 'plurality' rule [9] (Tables 5 and 6). This method TCRP D 2 2 4 determines a consensus result with varying degrees of ambiguity, TcRyV 3 5 - . 8 such that for each position the degree of ambiguity is related to - - . TcR6V 2 2 the significance of the observed nucleotide conservation. A 2 2 - - - . 4 TcR&D consensus result may consist of only one nucleotide and thus be 67 65 16 14 3 2 totals 14 10 7 198 unambiguous, indicating a highly conserved position, or may be Abbreviations: IG; immunoglobulin. TcR; T cell receptor. H; heavy chain, x; ambiguous for up to all four nucleotides. A position with a light chain of the kappa isotype. X; light chain of the lambda isotype. Isotype consensus result ambiguous for all four nucleotides has a classification for Xel and Hef chains is not clear, however they are grouped with whatever light chain isotype has the same sized RSS spacer for the purposes of nucleotide distribution indistinguishable from random. Analysis these tables, a; T cell receptor alpha chain. /3; T cell receptor beta chain. 7; of the properties of this rule indicate that when there are at least T cell receptor gamma chain. 6; T cell receptor delta chain. V; variable gene 100 sequences in a database (both 12 RSS 23 RSS sets have over segment. D; diversity gene segment. J; joining gene segment. Species are Mus; 100 sequences), the probability that a randomly generated Mouse (Mus musculus). Hum; Human (Homo sapiens). Xel; Frog (Xenopus database would produce a consensus result ambiguous for less laevis). Shp; Sheep (Ovis aries). Hef; Horned shark (Heterodontus franciscus). Rab; Rabbit (Oryctolagus cuniculus). Chk; Chicken (Gallus gallus). Bov; Cow than four nucleotides is less than 1% [10]. We further define (Bos taunts). Rat; Rat, (Rattus norvegicus). Duk; Muscovy duck. consensus results ambiguous for more than one nucleotide by reporting the nucleotides in order of the frequency that they are observed, from the most frequent to the least frequent. 22 bp separating the heptamer and nonamer, two (1% with 21 bp separating the heptamer and nonamer, and 17 (9%) with 24 RESULTS bp separating the heptamer and nonamer. Alignment of RSS The results of the sequence analysis of these alignments will refer to the positions in each alignment as belonging to one of 255 examples of 12 RSS were obtained, largely derived from IgH D and Igx V loci (Table 1). As described in the Materials the three elements (heptamer, nonamer, and spacer), and the 5' and Methods, gaps were inserted for optimal alignment, although terminus of each element will be referred to as the first position gaps were rarely required for the alignment of 12 RSS (Tables of each element. 3 and 5). 198 examples of 23 RSS were obtained (Table 2). Gaps Conservation of sequence in the heptamer and nonamer were introduced such that there are 24 positions between the heptamer and the nonamer (see Tables 4 and 6). 80% of RSS The consensus sequence for all positions of the heptamer, for (159/198) contained a single one base pair gap, and therefore both 12 RSS and 23 RSS, was unambiguous (Tables 5a and 6a). possessed 23 bp spacers. There were 20 (10%) sequences with The first three nucleotides of the heptamer were almost perfectly Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1994, Vol. 22, No. 10 1787 Table 3. Alignment of 12 bp spacer RSS Species Locus Segment Heptamer Spacer Nonamer Reference MUS GH 0 052 CACTGTG GTGCTCCGCTTA GTCAAAACC 171 DQ52 CACGGTG ACGCGTGGCTCA ACAAAAACC 171 0 SP2-2 CACAGTA GTAGATCCCTTG ACAAAAATC ACAAAAACC 0 SP2-2 CACAGTG ATATATCCAGCA [181 ACAAAAATC DSP2-3 CACAGTA GTAGATCCCTTG 19 DSP2-3 CACAGTG ATATATCCAGCA ACAAAAACC 19 DSP2-4 CACAGTA GTAGATCCCTTG ACAAAAATC 19 DSP2-4 CACAGTG ATATATCCAGCA ACAAAAACC M91 ACAAAAATC DSP2-5 CACAGTA GTAGATACCTTG (191 ACAAAAACC DSP2-5 CACAGTG ATATATCCAGCA M9l DSP2-6 CACAGTA GTAGATCCCTTG ACAAAAATC M9l DSP2-6 CACAGTG ATATATCCAGCA ACAAAAACC M9I D SP2-7 CACAGTA GTAGATCCCTTG ACAAAAATC [191 D SP2-7 CACAGTG ATATATCCAGCA ACAAAAACC [191 D SP2-8 CACAGTA GTAGATCCCTTG ACAAAAATC DSP2-8 CACAGTG ATATATCCAGCA ACAAAAACC ACAAAAAGC D FL16.1 CACAGTA GTAGATCCCTTC 19 D FL16.1 CACAGTG CTATATCCATCA GCAAAAACC 191 D FL16.2 CACAGTA GTAGATCCCTTC ACAAAAAGC [191 0 FL16.2 CACAGTG CTATATCCAGCA ACAAAAATC 191 IGK V 18.1 CACAGTG ATGCAGACCCTA ACAAAAACA 20 VK1A5 CACAGTG ATACAGACCCTA ACAAAAATA V5.1 CACAGTG ATACAGACCCTA ACAAAAATA [201 ACAAAAACC VK24C CACGGTG ATACAGCCCTGA 21) V K24A (Pa) CACAGTG ATACAAACCTGA ACAAAAACC 21 VK24.1 CACATTG ATACTGCACTGG ACAAAAACC V-Ser CACAGTG CTTCAGCCTCCT ACACAAACC [221 V167 CACAGTG ATAGAGCCCTGA ACAAAAACC [23 VMOPC173b CACAGTG ATACAAATCACA ACATAAACC VK41 CACAGTG ACATAAACC ATACAAATCATA 25 VK2 CACAGTG ATTCAAGCCATG ACATAAACC 26 VK1.6(21x) CACAGTG CTCCAGGGCTGA ACAAAAACC 271 VK21E CACAGTG CTCCAGGGCTGA ACAAAAACA [271 VK21B CACAGTG CTCCAGGGCTGA ACAAAAACC 27 VK21C CACAGTG CTCCAGGGCTGA ACAAAAACC 27 VK18 CACAGTG CTCCAGGGCTGA ACAAAAACC 27 VK24A CACAGTG ATGCAGCCCTGA ACAAAAACC VK24B CACACTG ATACAGCCCTGA ACAAAAACA CACAGTG V1B ATACAGACCCTA ACAAAAATA 29 V1C CACAGTG ATACAGACCCTA ACAAAAATA 29 VR11 CACAGTG ATACAGGCTGGA ACAAAAAC. 30 VR1 CACAGTG CTACATACTGAA ACAAAAACA 30 CACAGTG CTACAGACTGGA ACAAAAACA 30 VLB CACAGTG ATACAGACTGGA ACAAAAACC [301 VH6 VH1 CACAGTG CTACAGACTAGA ACAAAAACC [301 VH4 CACAGTG ATACAGACTGGA ACAAAAACC [301 VH9 CACAGTG ATACAGACTGGA ACAAAAACC 30 VR9 CACAGTG ATACAGACTGGA ACAAAAACC 30 VH13 CACAGTG ATACAGACTGGA ACAAAAACC 30 CACAGTG ATACAGACTGGA ACAAAAACC VH3 30 CACTGTG ATATAGACTCAT GCAAAAAA. MUS IGX J1 31 CACAATG ACTAAAACCCAA CCCAAAACC J2 31] J3 CACAGTG ACTGAAACCCAA CCCTAAACC 31 TCRa JTA65 CACTGTG ACAATAACCTCA ACAAAAACC [32 Jnew2 CACAGCA AATCAACCCTTT ACAAAAAAC 33 JTA91 CACACGT CTCTTCGTGAGA AGACACTGT 33 JC5A CACTGTA ACACGGGCCTTT ACAAAAACA 33 Jnewi CACAGCC TGGGGAGGCTTT ACAAAAACA J2b4A CACAATG ACACGGGACTCT ACAAAAACT 33 JTA27 CACACCC ACACACTGCCTT ACAAATACT 33 JTA1 CACACTG CACTGAAGGGCT TTGCAAAAA 33 J45 CACACTG CACTGAAGGGCT TTGCAAAAA 34 JBOFUI CACAGTG ATTTGTCCTGTG ACAAAATGG 33 JPHDS GCTGACTCTACA ACAAAAACT 32 CACAGTG JTA84 ACAAAAACT 32 CACAGTG ATCTCTTCCACC JT2C CACAGTG ATATCATGTTCT ACAAAAACC 35 JTA31 CACAGTG TGCCAAGCCATT ACAAAATCC 33 Jnew3 CACTGTC TCCAATAACAGC ACAGAAAAC 33 JTA80 ACATAAACC 32 CACCCTG AGGCAAGCCTTG JTA46 CACTGTG AGACACTCCATA TCAGAAACC 33 Jnew4 CACAGTA ATACACACTCTA ACAAAAACT 33 J newS CACAGTC ATTTGGGGCCTT ACAATAACC 33 JTA19 CACAGTG TTCTGTGTCTCT ACATAAACC 32 JTA37 ATCTCCAGCTCA GCAAAAACC 33 CACAGtTG JNAT1 CACAGTT ATAGAGAGCTTT ACAGAAATG 33 JTAS7 CACCCCA ATGCTGCACTTT ACAAAAACT 33 Jnew6 CACAGTG ATATCATGTTCT ACAAAAACC 33 Jnew7 CACAGAC ACAAAAACCTTA ACAAAAACA 33 JTT11 CACAGCC CTGCAGAGCCTT ACAATAACT 32 JTA20 TCTCTTGCCTTT ACTGAAACC 33 CACATCA Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1788 Nucleic Acids Research, 1994, Vol. 22, No. 10 Table 3. (com.) Species Locus Segment -teptamer Spacer Nonamer Reference J BM10-37 CACACTG TACCCAAAA TGATTGGGACCA [33 JnewiO CACAGTG ATCTGAAGCCAA GCAAAAACA 33 Jb12 CACAGTG CCAGCCCCCTTT ACACAAATC 33 CACAATG ACAGAAAGC J14-4 GTTAGCACCATT 33 JTA28 CACTGTG ATTTGCTCAACA ACAAGAACC 33 JBM2T3-1 CACTGTG TTACATACCCTG TCAAAAACA 33 Jnew9 CACACTG TGACAAACACGT CTACAAAAT J 112-2 CACAGTG GGTTTCCTCTTA GCAAAAACT CACAGTG CTCCGTGCTATT GCAATAACC JTA61 33 Jnow8 CACAGAA TTTCCTTTCTTT GCAAAAACT 33 JTA26 CACTGCA GGTGACACCTTT ACAGAAGCC 33 Jnew14 CACAGTA GAAAGGTGCTTT ACAAGAATT 33 Jnew13 CACAGTG AGGAAAGCCTTT GATGAAACC CACTCTG J new12 AGTAAGTGCTTC ACAAAAACG 33 JTA72 CACAGTG ATTTGTCCTGTG ACAAAATGG 33 J newii CACAGCA GCAAACCTCTCC ACAAAAATG 33 CACTGTA AGTGAGGTCTTT ACAAAATGG JTA39 33 CACAGTG JDK1 AAACGAGGCCCT GCAAATTCT 33 JLB2A CACAGTG CCAGCCCCCTTT ACACAAATC 33 TCRP J1.1 CACAGTG CCATAGGATGAG GAGAAAAAT MUS 36J CACATCA GAATACAGATAC TGCAATATG J1.2 36 TCRP J1.3 CACAGCC TCCCGGGTTCAC TTCAAAACC MUS 36 J1.4 CACAACA TTAAAGCCTAGT GGTAAAACT 36] CACAGTA CAACATGAGGGT GACAAACTC J1.5 36 CACAGCT GCAGGTGACCTT GGTAAAACC J1.6 36 CAAGAATTC J2.1 CACAGCA GAAAAGGGCTAC 37 J2.2 CACAGTC TTGGAAATGCTG GCACAAACC [371 J2.3 CACAGCC TCCAGGCTCAGG ACAAAAACT 371 J2.4 CACAGCC TCTTGGTACAGG ACAAAAACT 37] J2.5 CACAGCC CCAGAACCCAAC ACAAAAACT 37 J2.7 CACAGTG GCTCAACCCCAC ACACAAACC 37 CACAATG TTACAGCTTTAT ACAAAAAAG 38 TCRP D M CACAATG TTACATCGTGAT ACAAAAAAG 38 D2-1 CACAGTG CTCACAGCTTCT ACAAAAATC 39 TCR Y J1 J2 CACAGTG CTCACAGCTTCT ACAAAAATC CACGGTG TCR6 D2 CTACAGAGCTTT GCAAAAACC 4£ D1 CACAGTG AAACACAGCCGT ACAAAAACA 40; TCR5 CACGTTA TAATCTTGCTTT GCAGATAAC 40 J2 CACAGCT ACTGAGGCCCAT TCCAAAAAC 40 J1 CACAGTG 41 HUM IGH DHQ52 ATTGGCAGCTCT ACAAAAACC DMQ52 CACAGTG GTTCTCAGCTCA GCCAAAAAC 41 DLR1 CACAGTG ACACAGCCCCAT TCCCAAAGC 42 DLR1 CACAGTG ACACGAGCCCCC ACAAAATCC 42 DLR2 CACAGTG ACACGAGCCCCC ACAAAATCC 42 DLR2 CACAGTG ACACAGACCCAT TCCCAAAGC 42 CACAGTG ACACAACCCCAT TCCTAAAGC 42 DLR3 DLR3 CACAGTG ACACGAGCCCCC ACAAAATCC 42 DLH4 CACAGTG ACACGAGCCCCC ACAAAATCC 142 DLH4 CACAGTG ACACAGCCCCAT TCCCAAAGC 42 DXP4 CACAGTG ACACAGACCTCA CCCCAAACC 43 DXP4 CACAGTG TCACAGAGTCCA TCAAAAACC 43 CACAGTG DXP1 ACACAGACCTCA CCCCAAACC 43 CACAGTG DXP1 TCACAGAGTCCA TCAAAAACC 43 DXP1 CACAGTG ACACAGACCTCA CCCCAAACC 43 DXF1 CACAGTG TCACAGAGTCCA TCAAAAACC 43 CATAGTG ATGAACCCAGTG GCAAAAACT 43 DAI CACAGCA GGAGGGCCCTTC 43 ACAAAAAGC DAI CACAGTG ATGAACCCAGCA 43 DA4 GCAAAAACT DA4 CACAGTA GGAGGACCCTTC ACAAAAAGC 43 CACAGTG GTGCTGCCCATA GCAGCAACC 43 D M CACAGTC TGACACCCCCTG ACAATAACC 43 DK4 CACAGTG GTGCCGCCCATA GCAGCAACC 43 DK1 CACAGTC DK1 TGACATCGCCTG ACAATAACC 43 DN4 CACAGTG ACACTCGCCAGG CCAGAAACC 43 DN4 CACTGTG ACACAGACACCT TCAGAAACG 43 DN1 CACAGTG ACACTCACCCAG CCAGAAACC 43 CACAGTG ACACAGACACCT TCAGAAACC 43 DN1 CACTGTG DM1 AGAAAAGCTTCG TCCAAAACG [43 CACTGTG DM1 ACTCGGGGCTGT TCAGAATCC 43 CACTGTC AGAATAGCTACG TCAAAAACT 43 DM2 CGCTGTG DM2 ACTCGGGGCTGT TCGGAATCC 431 GK V321 CACAGTG ATTCAGCTTGAA ACAAAAACC 441 HUM IG* V305 CACAGTG ATTCAGCTTGAA ACAAAAACC [441 V328-h2 CACAGTG ATTCAACATGAA ACAAAAACC [451 CACAGTG ATTCAACATGAA V328 ACAAAAACC [4S1 Vb CACAGTG TTACCAACCCGA ACATAAACC [461 Vb1 CACAGTG TTACCAACCCGA ACATAAACC [461 V HK1O1 CACAGTG TTACACACCCAA ACATAAACC [471 VHK1O2 CACAGTG TTACACACCCGA ACATAAACC [471 Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1994, Vol. 22, No. 10 1789 Table 3. (com.) Segment Heptamer Spacer Nonamer Species Locus Reference CACAGTG VHK146 TTACACACCCAA ACATAAACC f48 CACAGTG ACATAAACC V HK137 TTACACACCCAA [48 VHK166 CACAGTG TTACACACCCAA ACATAAACC 48 VHK189 CACAGTG TTACACACCCAA ACATAAACC 48 Va' CACAGTG TTACAAACCCGA ACATAAACC 46 CACAGTG TTACAAACCTGA ACATAAACC 46 Vd CACAGTG TTACACACCCAA ACAAAAACC Ve [46 Vg CACAGTG ATTCCACATGAA ACAAAAACC 49) V-h CACAGTG ATTCAACATGAA ACAAAAACC 49 IGX. CACAGTG ACTGAGGCTCAG ACCAAAACC 50 J1 CACTGTG ACACAGGCTCAT ACAAAAACC 50 J2 CACTGTG ACAAAAACC J3 ACACAGGCTCAT 50 CACAGTG ACACAAACC J7 ACACAGCCCCAC T511 CACTATG ACAAAACCA TCRa JC ATTTGCTCAACA f52| JB CACAGTG TTTCTTAGTCAG TCAAAAACA f52] CACAGTG ATACTGAGATCT ACAAAAACC JAB rs3i JRP CACTGTG AGATGCTTCATA ACAGAAACC T531 CACAGTG TTATGTGTCTCT ACATAAACC 53 JAA J1.1 CACAGTG ACAGGGGTCAAG GTGAAAATC 54 TCRB CACATAA GAATATAGCCAC TCTAAAAGG J1.2 541 J1.3 CACAGCC TCCCAGGGCCAC TTCAAAACC [551 J1.4 CACAACA TTAAAGACTGGA AGGAAAACC [551 J1.5 CACAGTG CATCATGAGTGT GGCAAACCC f55] J1.6 CACAGCT GCAGAGGCTTAG ATAAAACCC fSSl J2.1 CACAGTG GGAAGGGGCTGC CCAGAATTC [561 CACAGCC GCGCAAACC J2.2 CTGGGGACCCTG [561 J2.3 CACAGCC TGGAGGCCCAGG ACAAAAACC [561 J2.4 CACAGCC CCGAGACGCGGC ACAGAAACT [561 J2.5 CACGGCC CCCGAGCCCCGC ACAAAAACC [561 J2.6 CACAGCC CGGGGACTCCCC GCAAAAACC [56 J2.7 CACGGAG GTGCACCCCCGC ATGCAAACC TCR0 CACAATG D1.1 TTACAGCTTTGT ACAAAAACA 55 D2.1 CACAATG TTACACCATGAT ACAAAAATG 55 J1 CACAGTG ATTCAGTCCATA TCAAAAACT 57 TCRy CACAGTG ATTCAGTCCATA TCAAAAACT 57 J2 TCR4 CACAATG AAACACATCAGT D1 ATAAAAACC 58 CACAGTG D2 CTACAGAGCTTT ACAAAAACT 58 TCR8 J2 CACATTA TGACAGTGCCTC ACAGGTAAC [591 HUM J1 CACAGCA CTTGAGGACGTT CCAAAAACC [59 GH 01 CACGGTG CTCCATCCCATA ACAAAAACC 60 CHK D1 CACAGTG ATACAACGTTGA CCAAAATCC 60 CACGGTG D2 CTCCATCCCATA ACAAAAACC 60 CACGGTG D2 ACACGACGTTGA CCAAAATCC 60J D3 CACGGTG ATCCATCCCATA ACAAAAACC 60 IGH 03 CACGGTG ACACAACGTTGA CCAAAATCC CHK §9J 04 CACAATG CTCCATCCCATA ACAAAAACC 60 CACGGTG ACACAACGTTGA CCAAAATCC D4 60 CACGGTG CTCCATCCCATA D5 ACAAAAACC 60 CACGGTG ACACAACGTTGA D5 CCAAAATCC 60 D6 CACGGTG CTCCATCCCATA ACAAAAACC 60 06 CACGGTG ACACAACGTTGA CCAAAATCC [60] D7 CACGGTG CTCCATCCCATA ACAAAAACC [601 CACAGTG D7 ATACAACGTTGA CCAAAATCC [601 CACAATG D8 CTCCATCCCATA ACAAAAACC [601 38 CACGGTG ACACAACGTTGA CCAAAATCC [601 IGX J CACAGTG ATACGGAGCAAT GCAAAAACC [611 GGTTGGCCCTTC RAB IGH 01a CACGGTG ACAAAATCC T621 Ola CACAGTG GTGCA.CCCAGC ACAAAAACC [621 31b CACGGTG GGTCGGCTCTTC ACAAAATCC [62 D1b CACAGTG GTGCA.CCCAGC ACAAAAACC 62 CACGGTG GGTCGGCCCTTC 01c ACAAAATCC 62 01c CACAGTG GTGCA.CCCAGC ACAAAAACC 62 Old CACGGTG GGTCGGCCCTTC ACAAAATCC [62 Did CACAGTG GTGCA.CCCAGC ACAAAAACC [621 CACCATG CTGCAGACCAGT 02a ACAAAATCC 62 02a CACAGTG CCTCA.GGCCTC ACATAAAAC 62 02b CACTGTG TCTCAGACCAGC ACAAAATCC 62 D2b CACAGTG CCTCA.GGCCTC ACATAAAAC 62 GK V20 CACAGTG ATACAAGCCCTA ACAAAAACC [631 V18a CACAGTG ATACAAGCCCTT ACAAAAACC [641 V 18b CACAGTG TTAGAAGCCCTA ACAAAACCA (641 V19a CACAGTG TTCCAAGCCCTA ACAAAAACC [641 V19b CACAGTG TTCCAAGCCCTA ACAACTCCC 64] HEF IGH 0 2 1403 CACAGCA GTTACTGTCAGT ACAAAAAGT 65 0 2 2807 CACAGCA GTTACTGTCAAT ACAAAAAGC 65 D1 1113 CACAGTG AGACACACCGTG TCAAATACT D1 1113 CACTGTG ACACGAACCCGC ACAAATACT 65 D1 2807 CACAGTG ACACGAACCAGC ACAAATACT 35 D1 1403 CACAGTG GACTTCAAAGCT GTACAAATA 35 0 1 1315 CACAGTG ACACGAACCTGC ACAAATACT 65 Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1790 Nucleic Acids Research, 1994, Vol. 22, No. 10 Table 3.(cont.) Segment -leptamer Nonamer Reference Species Locus Spacer D 2 2807 CACAGTG AGACACACCGTG TCAAATACC 65 0 2 1403 CACAGTG AGACAAACCGTG TCAAATACT 65 CACAGTG 0 2 1315 AGACAAACCGTG TCAAATACT 65 CACAGCA 0 2 1315 GTTACTGTCAAT ACAAAAACT 65 D21113 CACAGCA GTTACTGTCAAT ACAAAAAGT 65 V122 CACAGTG AGACAGGGCAAT ACAAAAACT IGL 66 CACAGTG AGACAGGGCAAT ACAAAAACT V141 [66 ATACAGAGCTGA IGK V1 CACAGTG ACAAAAACC 67 XEL V2 CACAGTG ATACAGAGCTGA ACAAAAACC 67 V3 CACAGTG ATACAGAGCTGA ACAAAAACC 67 K3H CACAGTG ACTTGTGGCTCA ACAAAAACC 68 RAT D 0 CACAGTG ATGCTTTGCTTA GTCAAAACC 68] IGX J2 CACAGTG ACTGAGACTCAA CCCAAAACC 69] TCAAAAACT BOV TCRy J CACAGTG ATTCAAGTCATA 70 ACACAGGCTTGC SHP IGX J CACAGTG ACAAAAACC 71 IGX J CACAGTG ATACAGGGCCAT GCAAAAACC DUK 1721 Abbreviations: IG; immunoglobulin. TcR; T cell receptor. H; heavy chain, x; light chain of the kappa isotype. X; light chain of the lambda isotype. Isotype classification for Xel and Hef chains is not clear, however they are grouped with whatever light chain isotype has the same sized RSS spacer for the purposes of these tables, a; T cell receptor alpha chain. /3; T cell receptor beta chain. 7; T cell receptor gamma chain. S; T cell receptor delta chain. V; variable gene segment. D; diversity gene segment. J; joining gene segment. Species are Mus; Mouse (Mus musculus). Hum; Human (Homo sapiens). Xel; Frog (Xenopus laevis). Shp; Sheep (Ovis aries). Hef; Horned shark (Heterodontus franciscus). Rab; Rabbit (Oryaolagus cuniculus). Chk; Chicken (Gallus gallus). Bov; Cow (Bos taunts). Rat; Rat, (Rattus norvegicus). Duk; Muscovy duck. Periods in sequences designate a gap inserted for best alignment. conserved. While this high conservation is derived to some degree heptamer, A, T, A, C, and A ('A5'), found in 50%, 56%, 58%, from alignment considerations (see Materials and Methods), it 62%, and 67% of 12 RSS respectively. The next two positions is consistent with a previous analysis, which indicated that these possess a more random distribution of nucleotide composition positions were both highly conserved and critical for efficient than the preceding positions. C is the most frequently observed function of RSS [7]. nucleotide at the following two positions, the eighth and ninth positions, in 59% and 68% of 12 RSS, respectively, 23 bp spacers The fifth and sixth positions of the nonamers of 12 RSS are have almost the same pattern, however the extent of conservation also almost perfectly conserved (Table 5c). The sixth position is required for efficient RSS function, however the fifth position is much lower. The most frequently observed nucleotides from the first base 3' of the heptamer in 23 RSS are A, T, G, C and is not [7]. In 23 RSS, only this functionally important sixth A (A5), found in 45%, 44%, 40%, 36%, and 64% of 23 RSS, position is highly conserved (Table 6c). The nonamer appears respectively. At the eighth and ninth positions the most frequently to have much more variability in the degree to which individual observed nucleotide is again C, found in 44% and 38% of 23 positions are conserved as in both 12 RSS and 23 RSS the first position, the fourth position, and the ninth positions of the RSS respectively. nonamer are relatively poorly conserved. This is particularly true The spacers of 12 RSS and 23 RSS therefore maintain of the fourth position of 23 bp spacer nonamers, where the most significant sequence conservation. Surprisingly, the 12 bp spacer frequently observed nucleotide (A) is found in only 56% of the and the first half of the 23 bp spacer possess six positions where aligned 23 RSS. The functional consequences of consensus the most conserved nucleotide is the same. In 12 bp spacers the substitution at these relatively poorly conserved positions has not most conserved nucleotides 3' of the heptamer are, from 5' to been evaluated. 3' , ATACA--CC; the most conserved nucleotides at the analogous positions in 23 bp spacers are ATGCA--CC. Conservation of sequence in RSS spacers The latter half of 23 bp spacer possess a high frequency of Analysis of aligned RSS revealed significant conservation of TG and AG dinucleotides, often tandemly repeated, as well as sequence in both 12 and 23 bp spacers (Tables 5b and 6b). Of occasional runs of Cs or Gs (4—5 bp long). This results in a particular significance is an A located at the fifth position 3 ' of number of positions (the 14th, 16th, and 19th through to the 22nd positions) where the consensus results are ambiguous for two the heptamer in both spacers (this position is hereafter referred nucleotides. to as A5). An A is observed at this position in 67% of all 12 bp spacers and in 64% of all 23 spacers. Both spacers often have a G at this position whenever there is not an A. The plurality rule therefore returns a consensus result for this position that is DISCUSSION ambiguous for either purine, A or G. 12 bp spacers and 23 bp spacers have a G at this position in 19% and 25% of spacers, In this report, we have used the considerable increase in size respectively. of the available database of RSS to redefine the RSS consensus, particularly with respect to spacer sequences. We found that: 1) The most frequently occurring nucleotide is the same for 12 The consensus heptamer and nonamer was the same for both the bp spacers and the heptamer proximal half of 23 bp spacers at types of RSS (the 12 bp spacer RSS and the 23 bp spacer RSS); several other positions as well. In 12 bp spacers the most 2) There is a significant sequence conservation in both the 12 frequently observed nucleotides are, from the first base 3 ' of the Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1994, Vol. 22, No. 10 1791 Tabl e 4 Alignment of 2 3 bp spacer Recombination Signal Sequences Species _ocus Seqmen t Heptamer Spacer Nonamer Reference MUS GH /AR10 0 CACAGTG TTCT AA. CCACATCCTGAGTGTGT .CAGAAACC f731 /H1 6 CACAGTG GTGCAA. CCACATCCCGACTGTGT .CACAAACC /H12 4 CACAGTG TTGTAA.CCACATTCTGAGAGTGT .TAGAAACC /PJ1 4 CACAGTG AGGGAAGTCCAATGTGAGCCT. GC ACAAATACC r76i / 108 A CACAGTG rTACAA. ACACATCCTGAGTGTGT .CAGAAACC R71 • 108 B CACAGCG TTGTAA. CCACAGGCTGAGTGTGT .CAGAAACC 1771 /H44 1 CACAGTG AGGAAATCTCAGTTTGTACCCA. G ACATGAACC nrsi • H4A- 3 CACAGTG ITGCAA. CCACATCCTGAGTGTGT .CAGAAACC r79i • H3 0 CACAGTG GTGCAA. CCACATCCCGACTGTGT .CACAAACC R41 /Hid1 1 CACAGTG TTTTAA. CCACATCCTGAGTGTGT ACAGAAACC 1801 /H10 1 CACAGTG AGGGAAGTCCATTGTGAACTT. GA ACAAAAATT (811 / A1/A 4 CACAGTG TTGTAA. CCACATCCTGAGTGTGT .CAGAAACC [821 • H104 A CACAGTG TTGTAA. CCACATCCTGAGTGTGT .CAGAAACC 83 • H1 0 CACAGTG TTGCAA. CCACATCCTGAGCGTCT .CAGAAACC 79 CACAGTG AGAGGACGTCATTGTGAGCCCA.G ACACAAACC »/1 rsi • 1 3 CACAGTG AGGGTACTTCAGTGTGAGCCTA. G ACACAAACC T841 • 1 1 CACAGTG AGGGTACTTCAGTGTGAGCCTA. G ACACAAACC rs4i • H2B- 3 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAACC r79i • 186- 1 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAAAC f85) • 186- 2 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAAAC 1851 • 14 5 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAACC 85 S/ 2 3 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAAAC 85 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAAAC 85 • 3 CACAGCG rTGTAA. CCACATCCTGAGAGTGT .CAGAAACC • H102 CACAGTG TTGTAA. CCACATCCTGAGAGTGT .CAGAAACC 85 • 81X CACAATG AGCAAAAGTTACTGTGAGCTCA. A ACTAAAACC [86 • 283 CACAGTG AGTGAATGTTACTGTGAGCTCA. A ACTAAAACC 187 • 5A CACAGTG AGGGGAGGTCAGTGTGAGCCCA.G ACACAAACC R4 • RV10 CACAGTG AGGGGCCCTCAGGC.GAGTCCT.G ACACAAACC 74 • 105 CACAGTG TTGTAA. CCACATCCTGAGTGTGT .CAGAAACC • H26-6 CACAGTG TTGCAA. CCACATCCTGAGTGTGT .CAGAAATC • DFL1 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAAAAATA 1881 GH 14 CACAATA GTGGGTTTTTCCTCTGTACCC..G ACAAAAACC f761 13 CACATTG TGACAACAATGATTAGACCCCTGA CAATAAATG r761 12 CACACTA TCATAGACCCCTTTAGTGGGTG. T ACAAAAACC r761 CACAGT. CTCTGTTCTGCCTCTGTTCCTA ^ 11 ACTAAAACT 1761 CACAGTG AGGACTATGACA.TGCCCCTCTCT ACAAAAACC Gx IS (21 14 CACAGTG ATTCATATCACTGCGCCCCCCTTT ACAAAAACC [21 12 CACACTG GTGTCCCTTCAC.TCAACCCCCAT ACAAAAACT [21 M CACAGTG GTAGTACTCCAC.TGTCTGGCTGT ACAAAAACC [21 • 1 CACAATG ACATGTGTAGATGGGGAAGTAG.A ACAAGAACA GX 89 • 2 CACAATG ACATGTGTAGATGGGGAAGTAG.A ACAAGAACA 90 • x CACAGTA ACGGAGATAAAGGAGGAAGCAG. G ACAGAAACT 91 rCRa • 5 H CACAGTG . . TCCCAGACAC. CTGCAGCCTGTATGTAAACC 32] • 1-8.2 CACAGTG . . TCCCCAGGAC. CTGCAGCCTGCACCTAAACC 92) • 1-8.1 CACAGTG CTCTCCAGGCAC.CTGCAGGCTGC ACCCAAACC (921 • 2 C CACAGTG TGTGGGGCTGC AGGGGGAGCTG. A ACACAAACA [35] • F3. 2 CACAGTG AGGGAGACTGCAGGGGAAGCTG.C ACATGAACC [931 • F3. 3 CACAGTG AGGGAGACTGCAGGGGAAGCTG. C ACATGAACC [931 /F3. 4 CACAGTG AGGGAGACTGCAGGGGAAGCTG.C ACATGAACC [931 TCRa • F3. 5 CACAGTG AGGGAGACTGCAGGGGAAGCTG. C ACATGAACC [93 VF3. 6 CACAGTG AGGGAGACTGCAGGGGAAGCTG. C ACATGAACC • 8. 3 CACAGTG ATGTGTGG. CTTCCTTCCCTTTGC ACAGAAAGT rcRp • 8. 2 CACAGTG ATGTGGGG. TTTCCTCCCCTCTGC ACAGAAAGG 94 ACAGAAAGG [941 • 8. 1 CACAGTG ATGTGTGG. CTTCCTTCACTCTGC GCGAGAACT [951 • 1 8 CACAGTG CTGG. .TTCAAGGGAGAAATCTCA • 1 9 CACAGTG GTGACTACT. . GGCTTTTCTCAGA ACACAAACT [951 • 10- 8 CACAGTG GTGCAGAGTCA. CTGTTTCCCTGT GCACAAACC [921 • 5.1 CACAGCC TTACAGAGCTACTGGCTTTCTGTA ACTTAATC. [941 • 5.2 CACAGCC TTACAAAGCTACTGGCTTTCTGTA ACTTAATC. (941 CACAATG ATTCAACT. GGAAGAGGTGCTTTT ACAAAAAGC 38 D2 CACGGTG ATTCAATT. CTATGGGAAGCCTTT ACAAAAACC 38 TCRY • 108A CACAACA TTAGAGCCTCTAGACT. AGCCTGC ATAAGAACC • 108B CACAACA TTAGAGCCTCTAGACT. AGCCTGC ATAAGAACC [391 • 4 CACTCTA TCAAGAT. ACTGCACTGTTAACAA ACAAAACCC [961 TCR 4 CACAGGT TGAAGT AT. ATTAAACCTCTGTTC AGAAACACT [401 CACAGTG TTGCAAAC. CCCATAGGGACCTGT ACAAAAACT 40 IGH • 251 CACAGTG AGAGAAACCAGCCCCGAGCCC. GT CTAAAACCC HUM /12G-1 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACACAAACC 98 • 2-1 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACACAAACC 98 • 79 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACACAAACC 98 /7-2 CACAGTG TGAAAACCCACATCCTGAGACCGT .CAGAAACC 99 CACAGTG TGAAAACCCACATCCTGAGGGTGT .CAGAAACC 100 /35 /71-4 101 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACAAAAACC /58 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACAAAAACC [98| 71-2 CACAGTG AGGGGAGGTGAGTGTGAGCCCAGG ACACAAACC 101 CACAGTG AG. GGAAGTCATTGTGAGCCCA. G ACACAAACC H26 02 CACAGTG AG. GGAAGTC AGTGTGAGCCCA. G ACACAAACC H52 02 AG. GGAAGTCAATGTGAGCCCA. G H11 CACAGTG ACACAAACC 03 H105 CACAGTG AGGGGAGGTCAGTGTGCGCCCA. G ACACAAACC P«l Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1792 Nucleic Acids Research, 1994, Vol. 22, No. 10 Tabl e 4. (com Species -OCUS Heptamef Reference Segment Spacer Nonamer • 6-1G1 CACAGTG AGGGGAAGTCAGTGTGAGCCCA. G ACACAAACC (99 • 1.911 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACACAAACC CACAGTG • 1.9111 AGGGGAAGTCATTGTGCGCCCA. G ACACAAACC 99 • 9-1 CACAGTG AGGGGAGGTCAGTGTGAGCCCG. G ACACAAACC 99] • 12-2 CACAGCG AGGGGAGGTCAGTGTGAGCCCG. G ACACAAACC 99 • 13-2 CACAGTG AGGGGAAGTCAGTATGAGCCCA. G ACACAAACC «/ 8-18 CACAGTG AGGGGAGGCCATTGTGCGCCCA. G ACACAAACC 99 • 15-2B CAGAGTG AGGGGAAGTCAGTGAGAGCCCAGG .CACAAACC 99 • 22-2B CACAGTG AGGGGAAGTCAGTGTGAGCCCA. G ACACAAACC J99 • HG 3 CACAGTG TGAGAAACCACATCCTCAGA. TGT .CAGAAACC [1041 • 21- 2 CACAGTG TGAGAAACCACATCCTCAGAGTGT .CAGAAACC 99] • 3- 1 CACAGTG TGAGAAACCACATCCTCAGAGTGT .CAGAAACC 99 J6 CACAATG GCAGAATGTCCATCCTCACCC..C ACAAAAACC 41 GH IS CACATTG TGAC AACAATG. CCAGACCCCGAC 41 AAAGAACCG CACATTG 14 TGGGAGGCCCCATTAAGGGGTG. C ACAAAAACC 41 CACAGGG 13 ACACAGTCCGTTCCTAGACCCA. G ACACAAACC 41] 12 CACAGTC CTCTGCCCTCCTGCTTCTCCCA.T ACAAAAACA 41j GK JS CACAGTG TTAACT.TAATTACTTTCCCCTTA ACAAAAATC 105 CACAGTG 14 AGGGATCTCACC. CTTTCCCCTCA ACAAAAACC 105 CACAGTG J3 ATTCGTCTTAA. . CTTTTCCCTTT ACAAAAACC 105 CACAATG J2 GTTCCTCTTAAC. TTCCCTCCTAT ACAAAAACT 105 GK CACAGTG AGAGCTCTCCAT. TGTCTTGCTGA ACAGAAACC 105 HUM 11 CACAGTG ACACAGACAGATGGGGAAGTGA. G ACAGAAACC GX • 3S 1 106 /7.1 CACAGTG &CAGACTCATAAGAGGAACCAA. G ACATAAACC J07] CACAGTG CTCCAGCCCAATGGGGAACTGA. G ACAAGAACC 108 / 117 CACAGTG CTCCAGCCCAATGGGGAACTGA.G • 119 ACAAGAACC JJ08 CACAGTG CTCAGGCCGGGGTGGGAACTGA. G ACAAGAACC J109 /3S2 CACAGTG GTCCAAGTTCATGGGGAACTGA. G 110] */ 2.1 ACCAAAACC • 418 CACAGTG ACACAGACAGATGGGGAAGTGA. G ACAGAAACC 111] ACACAGGCAGATGAGGAAGTGA. G [111] • 318 CACGGTG ACAAAAACA • 1.1 CACAGTG CTCCAGGCCAATGGGGAACTGA.G ACAAGAACC [107] •j)Y14.2 CACAGTG CCTGAGACTGCAGGAG.AGCTG.A ACACAAACC [52] fCRa CACAGTG CTCCCCAGGCAC. CTGAAGCCTGT ACCCAAACC • 13.1 [59] CACAGTG CTTCACAGTCGTGC. CCTTGCTGT TCR8 • 16 GCAAAACCA (1121 • 8.1 CACAGCG CTGCAGAATCA.CCCCTTTCCTGT GCAGAAAAC 113] • 8.2 CACAGCG CTGCAGAATCA. CCCCTTTCCTGT GCAGAAACC 113 • 8.3 CACAGCG CTGCAGAATCA. CCTGCTCCCTGT GCAGAAACC 113 • M3-2 CACAGCG CTGCAGAATCA.CCCCTTTCCTGT GCAGAAACC [54] • MT1-1 CACAGCG CCAGGAGGGGA. TCAGACACCGCG GCAAGAACC 1141 •ATL12-2 CACAGCA TGGCACAGTTG. CCTCCTTCCTGT TCACAAACC 114 • ATT. 2-1 CACAGTG CTTCTTGG. CCACCTGCTCTCTAC ACAGAAAGA [114 CACGATG ATTC AGGT . AGAGGAGGTGCTTTT ACAAAAACC 3 2.1 [55 rcRp CACAATG 3 1.1 ATTCAACT. CTACGGGAAACCTTT ACAAAAACC (55 CACAGTG rCR • 2 ATTCAGATCCGCCCTACACCACAC TGAAAATC. [115 • 3 CACAGTG ATTCAGACCTGTCCTACACCACAC TGAAAATC. [115 • 8 CACAGTG MTCAGACCTGTGCTACACCACAC TGAAAATC. [115 • 9 CACAGCA GCAGACAGTTTGAGCCATCCCATT TCAATAAAA 116 CACATAC TAGAA. CTGTTGAAACAACATGC. • 1 0 ACAAAATCC 116 'CRfi • DS 6 CACAGTG ACAGAACTGTCGGAGGGAGGTG. T ACAAAAGCC 117 • 1 CACAGTG ttTTGAAGTGATAGTAAAAGCAA. A ACAAAAACC 59 TCR6 31 CACACAG GTTGGAGT. GCATTAAGCCTTTGT CCAAAAACA 58 32 CACAGTG CTACAAAA. CCTACAGAGACCTGT ACAAAAACT 58 • LL3. 1 CACAGTG GGACATAT. ATTGTGAAAACATGT XEL GH ATAAAAACA 118 CACAGTG • LL3. 4 GGAAATAT. ATTATGAAAACATGT ATAAAAACA 118 CACAGTG • LL3. 5 GGAC AAAT . ATTAAGAAAGCCTGT GTAAAAACA 118 • LG2. 1 CACAGTG ACAGAAGAGAATGAGGAAGTCA. G ACAATAACT 118 • LG2. 2 CACAGTG ACAGAAGAGAATGAGGAACTCA. G ACAATATCT 118 • LGZ 4 CACAGTG ACTAAATATACTGAGGAAGTGA. G ACAATAACA 118 CACAGTG ACAGAAAAAAATAAGGAGGTCA. G 118] VLG2. 7 ACAATATCA VLG2. 8 CACAGTG ACAGAACAAAATAAGGAAGTCA. G ACAATATCA 118 VLL1.1 CACAGTG ACAAATAGTCTCAGAGCAGTGC. A ACAAAAACA 118 V LL1.2 CACAGTG ACAAATAGTCTCAGAGCAGTGC. A GCAAAAACA V LL1.3 CACAGTG ACAAATAGTCTCAGAGCAGTGC. A ACAAAAACA V U.1.4 ACAAAGAATCCCAGAGTCATGT. A CACAGTG GAAAATACA 118] ^/LL1.6 CACAGTG ACAAAGAAACACAGAGCAGTGC. A ACAAAAACA 118 VU.1.7 CACACTG ACAAATAGTCTCAGAGCAGTGC. A ACAAAAACA 118 • LL1.8 CACAGTG ACAAATAGTCTCAGAGCAGTGC. A GCAAAAACA 118 • U.1.9 CACAGTG ACAAATAGTCTCAGAGCAGTGC. A 118) ACAAAAACA • 6.2 CACACTG GTTCAAGTTCATGGGGAAGTGA. C GCCAAAACC SHP GX t71 • 12.2 CACAGTG CTCCAGGCCAGGGGGGAAGCGA. C ACAAAAACC 71 CTCCAGGCCAGGGGGGAAGTGA. C • 4.2 CACGGTG GCGAAACCC 71 • 5.2 CACGGTG- CTCCAGGCCAGGGGGGAAGTGA. C ACCAAAGCC 71 • 17 CACGGTG CTCCAGGCCAGGGGGGAAGTGA. C ACCAAAGCC • 10 CACGGTG CTCCAGGCCAGGTGGGAAGTGA. C ACCAAAGCC [71 • 9 CACGGTG CTCCAGGCCAGGTGGGAAGTGA. C ACCAAAGCC f71 • 18 CACAGTG CTCCAGGTCAAGGGGGAAGTGA. C ACAAAAACC [71 • 26.3 CACAGTG CTCCAGGCCAAGGGGGAAGTGA. C ACAAAAACC • 3 CACAGTG CTCCAGGCCAGGGGGGAAGTGA. C ACAAAAACC [71] • 4.1 CACAGTG CTCCAGGCCAGCGGGGAAGTGA. C ACAAAAACC [711 • 16.1 CACAGTG CTCCAGGCCAGGGGGGAAGTGA. C ACAAAAACC f711 Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1994, Vol. 22, No. 10 1793 Table 4.(com. -OCUS segment Heptamer Spacer Nonamer Reference Species ^26.1 CACAGTG CTCCAGGCCAGGGGGGAAGCGA. C ACAAAAACC SHP GX 71] ^ S.I CACAGTG CTCCAGGCCAGGGGGGAAGTGA.C ACAAAAACC 7>l CACTGCC ACCCAAGCAAATCCTGGGCTCC. T ACAGAAACA 6Sj >/ 1113 HEF GH ACAAGAACA V2807 CACAATG AGAGGAACCAGGGCTGGACCC. GT 65 >/ 1403 CACAGCG AGAGGAACCAGGGCTGGACCC. GT ACAAGAACA 65 / 1315 CACAACG AGAGGAACCAGGGCTGGACAT. GT ACAATAACA 65 321113 CACGGTA CTGTACAGAGCGAGTTT. CTTA. TACAAAAACC 65 CACGGTG CTGTACAGAACGAGTTC. CTCA. TACAAAAACC 65 3 1 2807 CTGTACAGAGCGAGTTC.CTCA.T ACAAAAACC 3 1 1403 CACGGTG 65 CTGTACAGAGCGAGATC. TTCA. T 3 1 1315 CACGGTG ACAAAAACC 65 I 1315 CACAGTG TTACATTCCCTGGGCTGGGTCA. C ACAATAACC res 1 1403 CACAGTG TTACATTCCCCGGGCTGGTTCA.G ACAATAACC [6S 12807 CACAGTG TTACATTCCCTGGGCTGGGTCA.G ACAATAACT [65 1 1113 CACAGTG TTACATTCCCTGGGCTGGGTCA. C ACAATAACC 65 */ 122 CACAGTG CAGTGTTTTAAATGGGACGGGTCA CTTAAAACC 66 GL >/141 CACAGTG CAGTGTTTTAAATGGGACGGGTCA CTTAAAACT 66 */H1(a3) CACAGTG AGGGGCCCTCAGGCTGAGCCCA. G ACACAAACC 119] RAB GH W3(a3) CACAGTG RGGGTCCCTCAGGCTGAGCCCA. G ACACAAACC 119) */H4(a3) CACAGTG AGGGGCCCTAGGGCTGAACCCA.G ACACAAACC 119 W6(a3) CACAGTG AGGTG.CCTCAGGCTGAGCCCA.G ACACAAACC 119 Y832 CACAGTG AGGGGCCCTAGGGCGCA.. CCTAG ACACAAACA 120 12 CACAGGG GCACA. TCCCCTGTTGCTGCCCAG ACACAAACC 121 13 CACTGTG ACGACCGTGCCAGGACCCCCGGCA AGAACCGGT 121 14 CACATTG CTGTAGACACCTT. .AGGGGGCGT GCAAAAACC [121 CACATTG TGATGACCGTGCCAGGACCCCA.G GCAAGAACC [1211 IS CACAGTG GTTCCTCCTAAC. CTCCCTCCTGT ACAAAAACT Gx J2 [1221 CACGGTG ACACCGATCCCCAGCACGGTGG.C ACAAAACCC 60 CHK GH CACAATG CCCCAAAATCCGCCTTTTTTCA. C CCAAAAACT 60 ACACAAAGCAATGGGGAAATGA. T CACGGTG ACAAAAACC 61 GX V CACAGT. CTCTGTTCTGCCACTGTTCCT. GT ACTAAAACT 68 RAT GH J Gtc CACAGTG GTAGTTCTCCAT. TGTCTGGCTGT ACAAAAACC 123| J1 CACACTG GTATCCCTTGACTCACCACCGA. T 123 J2 ACAAAAACT J2a CACACTG GTTTCCCTTGACTCACCCCCCA.T ACAAAAACT [123 J3 CACAGTG ATTCATGTCAAAGC. CCCCC. TTTACAAAAACC [123 J4 CACAGTG AAGACTC. TGACATATGCACCTCT ACAAAAACC (123 CACAATG GCATGT. C A. GATGAGGAAGT AGGACAAAAACC 69 GX CACAGTG ACACAGAGC. AATGGGGAAGTGAT ACAAAAACC 72 DUK GX YL5 ^ LI CACAGTG ACACAAAGC. AATGGGGAAGTGAT ACAAAAACC [72 Abbreviations: IG; immunoglobulin. TcR; T cell receptor. H; heavy chain, x; light chain of the kappa isotype. X; light chain of the lambda isotype. lsotype classification for Xel and Hef chains is not clear, however they are grouped with whatever light chain isotype has the same sized RSS spacer for the purposes of these tables, a; T cell receptor alpha chain. 0; T cell receptor beta chain. 7; T cell receptor gamma chain. 6; T cell receptor delta chain. V; variable gene segment. D; diversity gene segment. J; joining gene segment. Species are Mus; Mouse {Mus musculus). Hum; Human (Homo sapiens). Xel; Frog (Xenopus laevis). Shp; Sheep (Ovis aries). Hef; Horned shark (Heterodontus franciscus). Rab; Rabbit (Oryctolagus cuniculus). Chk; Chicken (Gallus gallus). Bov; Cow (Bos taurus). Rat; Rat, (Rattus norvegicus). Duk; Muscovy duck. Periods in sequences designate a gap inserted for best alignment. in [11]). The inclusion of spacer sequences in our analysis of and the 23 bp spacers; and, 3) The conserved sequence in the 12 bp spacer is similar to the conserved sequence in the heptamer RSS has yielded conservation that has not previously been proximal half of the 23 bp spacer. observed. Upon separating the RSS on the basis of whether they were To best assess the relevance of sequence conservation, we made derived from 12 or 23 RSS, we determined that the heptamers our consensus determination using the plurality rule. The plurality and nonamers appear equivalent, irrespective of which type of rule returns a result for all positions analyzed in an aligned set RSS they are derived from. They possess the same consensus of sequences. The result, however, may have ambiguity varying profile, in that equivalent positions are conserved to an equivalent from one (highly conserved) to all four (indistinguishable from degree, regardless of classification by size of spacer. For random) possible nucleotides [9] There is less than a 1 % chance example, the first, fourth, and ninth positions of the nonamer of randomly getting a plurality rule result with ambiguity for less are relatively poorly conserved in both 12 and 23 RSS. This than all four nucleotides at any one position, in the databases observation provides further support for the hypothesis that the observed here [10]. It is with some surprise, therefore, that most heptamer and nonamer function in an identical manner (e.g., positions in 12 and 23 bp spacers demonstrate consensus results serving as recognition sites for the same protein) for both 12 RSS with ambiguity for less than all four nucleotides. and 23 RSS. Some of the sequence conservation observed in this manner may be due to the inclusion of many members of a gene segment Previous examinations of the RSS consensus have concentrated family that has been expanded only recently in evolution. The on the heptamer and nonamer, relying on early studies that suggested that the intervening sequence is truly a spacer, fact that the conserved sequence motif (heptamer proximal) in conserved in length (12 of 23 bp), but not sequence (reviewed 12 bp spacers is similar to the conserved sequence motif in the Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1794 Nucleic Acids Research, 1994, Vol. 22, No. 10 Table 5. Consensus sequences for 12 RSS Table 6. Consensus sequences for 23 RSS 1 2 3 4 5 6 7 1 2 3 4 5 6 7 Position2 Position2 C A A G T G Consensus' C A C A G 1 G Consensus' c %G 85 0 0 1 7 2 91 %G 0 0 0 9 88 0 77 %A 0 100 0 91 8 1 5 %A 0 100 0 81 S 2 13 %7 0 0 0 9 2 86 2 %T 0 0 0 2 3 89 1 %C 00 0 100 1 4 12 8 %C 100 0 99 0 4 9 3 Positions 1 2 3 4 5 6 7 8 9 10 11 12 Position 1 2 3 4 5 6 7 8 9 10 11 A/T/C/G T/C A/r A/G G/A/T/C C/A/Q C/G 0C/A/G r/G/C/A A/T/C/G Consensus A/T/C/G I/ W G/A/C C/G/T V/G VGTOC A/G/C/T C/G/T/A C/T/A VC/G/T/. A/C/T7G Consensus' c/r en %G 16 13 10 13 19 38 26 25 2 16 26 13 %G 11 29 40 31 !S 25 27 26 7 16 15 %A 50 5 58 10 67 25 33 6 8 20 19 43 %A 31 >4 39 9 11 36 42 45 2 11 45 %T 18 56 20 14 7 21 7 10 22 36 35 27 %T 23 44 13 15 3 19 11 21 38 7 13 %C 16 26 13 62 7 15 34 59 68 28 20 16 34 32 %C 20 18 14 36 8 11 21 44 38 %qap 0 0 0 0 0 2 0 0 0 0 0 0 %gap 1 8 2 8 0 1 2 1 5 7 1 Table 6b cont. Position 12 13 14 15 16 17 18 19 20 21 22 23 24 Consensus 3/A/T/C T/G/A/C TC/C/A A/G/T/C U/C C/T » « A/I r/G/C/A 1 2 3 4 5 6 7 8 9 'X a/T A/G/C/T ./ U Position4 %G 29 32 15 24 21 12 34 27 29 57 44 8 33 A C A A A A A C C Consensus1 %A 29 13 7 43 53 7 9 6 38 b 14 9 15 %G 12 2 3 8 1 0 0 7 5 %T 21 38 10 32 25 9 13 8 35 14 37 6 39 %A 68 2 86 76 95 95 87 6 9 %C 16 10 )7 22 11 23 11 42 48 47 8 5 20 %T 12 5 2 8 2 5 11 10 14 %aap 5 7 1 2 0 2 3 1 C 0 5 50 1 %C 8 91 9 8 2 0 2 77 71 %nap 0 0 0 0 0 0 0 0 2 a. Consensus1 and nucleotide frequencies in 12 RSS heptamers b. Consensus and nucleotide frequencies in 12 RSS spacers Position 1 2 3 4 5 6 7 8 9 c. Consensus and nucleotide frequencies in 12 RSS nonamers Consensus A C A A/G/C A A A C C 'Consensus as determined by the plurality rule (see text and reference [9]). We %G 2 8 3 19 3 0 3 3 3 further define consensus results ambiguous for more than one nucleotide by %A / 3 2 90 56 89 98 89 3 15 reporting the nucleotides in order of the frequency that they are observed, from %T 3 5 4 6 5 1 5 3 11 %C 3 91 5 19 3 1 3 91 71 the most frequent to the least frequent. %gap 14 0 0 0 0 0 0 0 3 2bases numbered beginning at the first base of the heptamer 3bases numbered beginning at the first base 3 ' of the last base of the heptamer a. Consensus1 and nucleotide frequencies in 23 RSS heptamers 4bases numbered beginning at the first base 3' of the last base of the spacer b. Consensus1 and nucleotide frequencies in 23 RSS spacers A period in place of a nucleotide code represents a gap c. Consensus1 and nucleotide frequencies in 23 RSS nonamers 'Consensus as determined by the plurality rule (see text and reference [9]). We further define consensus results ambiguous for more than one nucleotide by reporting the nucleotides in order of the frequency that they are observed, from first half of 23 bp spacers argues that the origin of this motif the most frequent to the least frequent. is distinct from a recent expansion of gene segment families, 2bases numbered beginning at the first base of the heptamer however. 3bases numbered beginning at the first base 3' of the last base of the heptamer 4bases numbered beginning at the first base 3' of the last base of the spacer The conserved sequence common to both RSS spacers could A period in place of a nucleotide code represents a gap be derived from two possible sources. Firstly, both 12 and 23 RSS may have a common ancestral origin. For example, early RSS may have all possessed 12 bp spacers. A requirement for the directed joining of one type of segment (e.g. a V segment) however, that the Lieber report does demonstrate a significant to a second type of segment (e.g. a J segment) might have resulted loss of recombination frequency (p<0.05, using a two tailed in an adaptation of this early version of the V(D)J rearrangement Mann-Whitney test) when comparing a substrate where both machinery to include a 12/23 rule, and an accompanying change the 12 and 23 bp spacers were substituted with GC base pairs of the spacer length of one type to 23 bp. to a substrate with unsubstituted RSS spacers [6]. Thus the available data are consistent with the conclusion that differences A second, more likely possibility is that this sequence is in RSS spacer sequence contribute to minor differences in the conserved because it contributes to RSS function. In support of efficiency with which the RSS mediates recombination. this hypothesis, we found, using extra chromosomal recombination substrates, that a single substitution of the most We suggest two possible methods by which the conserved conserved position (replacement of the conserved A at the 5th sequence in RSS spacers could contribute to RSS function. One position of a 12 bp spacer with a C) resulted in a significant, possibility is that this sequence may represent a functional though modest (approx. 15%) drop in the frequency with which extension of the heptamer. Thus while the element of recombinase the substituted RSS mediated recombination (unpublished results). that recognizes RSS likely makes critical contacts with the highly This observation appears to contradict a previous report from conserved heptamer, contact with the RSS may extend into the Lieber and colleagues, where the authors concluded that complete spacer. This possibility is supported by the fact that conservation replacement of a spacer with GC base pairs did not appear to in both the 12 and 23 bp spacers peak at the fourth and fifth influence the frequency with which the substituted RSS mediated positions 3 ' of the heptamer, which is located approximately one recombination [6]. In the study by Lieber and colleagues, the turn of a B DNA helix from the critical first three nucleotides substituted and unsubstituted RSS were tested in separate of the heptamer. Moreover, in 12 bp spacers this position is also substrates, rather than in a competitive substrate as was used in one turn of a B DNA helix from the beginning of the nonamer. our experiment, and thus subtle differences in recombination Thus the sequence recognition component of recombinase could frequency may have been less readily observable. We note, lie along one face of the 12 RSS DNA helix, making sequence Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1994, Vol. 22, No. 10 1795 specific contacts at the heptamer, the fourth and fifth positions 12. Barber, A. M. and V. B. Zhurkin. (1990) J. Biomol. Struct. Dyn., 8, 213-232 . of the spacer, as well as the nonamer. 13. Patel, D. J., L. Shapiro and D. Hare. (1987). In R. D. WeUs and S. C. Alternatively, the observed conserved sequence may induce Harvey (ed.), Unusual DNA structures. Springer publishing, New York, functionally important structural changes in RSS DNA. In 12 USA. bp spacers the most conserved positions are C and A, four and 14. Timsit, Y., E. Vilbois and D. Moras. (1991) Nature, 354, 167-170. five bp 3 ' of the heptamer, respectively. Polymeric CA sequences 15. Bolshoy, A., P. McNamara, R. E. Harrington and E. N. Trifonov. (1991) Proc. Nail. Acad. Sci., 88, 2312-2316. have been linked with sequences active in recombination and 16. Ramsden, D. A. and G. E. Wu. (1991) Proc. Natl. Acad. Sci. USA., 88, transcription [12]. This has been attributed to the fact that CA 10721-10725. tracts cause unusual perturbations in DNA structure, including 17. Sakano, H., Y. Kurosawa, M. Weigert and S. Tonegawa. (1981) Nature, the de-stacking of bases and the formation of non-Watson—Crick 290, 562-565. base pairs [13, 14], as well as a reduced electrophoretic mobility 18. Kurosawa, Y., H. Von Boehmer, W. Haas, H. Sakano, A. Traunecker and S. Tonegawa. (1981) Nature, 290, 565-570. associated with helical kinking [15]. It is unknown if the structural 19. Kurosawa, Y. and S. Tonegawa. (1982) J. Exp. Med., 155, 201-218. alterations described above would necessarily be associated with 20. Corbet, S., M. Milili, M. Fougereau and C. Schiff. (1989) J. Immunol, a single CA dinucleotide, in the context of the 12 bp spacer. It 138, 932-939. is worth noting, however, that 23 bp spacers are generally rich 21. Jouvin-Marche, E. and S. Rudikoff. (1986) Invnunogenetics, 24, 191 -201 . in CA, as well as the complementary dinucleotide, TG (data not 22. Boyd, R. T., M. M. Goldrick and P. D. Gottlieb. (1986) Proc. Natl. Acad. Sci. U.S.A., 83, 9134-9138. shown). 23. Seising, E. and U. Storb. (1981) Cell, 25, 47-58 . We have demonstrated here that, contrary to previous analysis, 24. Max, E. E., J. G. Seidman, H. MiUer and P. Leder. (1980) Cell, 21 , the RSS spacer does possess significant conservation of sequence. 793-799 . The degree of conservation, as well as experiments using 25. Seidman, J. G., E. E. Max and P. Leder. (1979) Nature, 280, 370-375 . 26. Seidman, J. G., A. Leder, M. H. Edgell, F. Polsky, S. M. Tilghman, D. recombination substrates, suggests that, though significant, C. Tiemeier and P. Leder. (1978) Proc. Nail. Acad. Sci. U.S.A., 75, conserved sequences in RSS spacers are not as critical to RSS 3881-3885. function as the heptamer and nonamer motifs. As has been 27. Heinrich, G., A. Traunecker and S. Tonegawa. (1984) J. Exp. Med., 159, demonstrated with kappa and lambda RSS, however, multiple, 417-435 . 'non-critical' substitutions can still result in a dramatic reduction 28. Joho,R.,H.GershenfeldandI.L.Ceissman.(1984)£AfBOy.,3, 185-191. 29. Ng, K. H., A. Lavigueur, L. Ricard, M. Bouvrette, S. MacLean, D. Cloutier in recombination frequency [16] Thus differences in the and D. M. Gibson. (1989) J. Immunol., 143, 638-648. sequence of RSS spacers may also make a significant contribution 30. Milstein, C , J. Even, J. M. Jarvis, A. gonzalez-Femandez and E. Gherardi. to the frequencies with which endogenous gene segments (1992) Eur. J. Immunol., 22, 1627-1634. rearrange. The possibility that portions of the RSS spacer could 31. Miller, J., E. Seising and U. Storb. (1982) Nature, 295, 428-430. 32. Winoto, A., S. Mjolsness and L. Hood. (1985) Nature, 316, 832-836. aid in RSS function, through direct sequence specific contacts 33. WUson, R. K., B. F. Koop, C. Chen, N. Halloran, R. Sciammis and L. or through DNA structural effects, warrants continued Hood. (1992) Genomics, 13, 1198-1208. investigation with extra chromosomal constructs. 34. Arden, B., J. L. Klotz, G. Siu and L. E. Hood. (1985) Nature, 316, 783-787 . 35. Hayday, A. C , D. J. Diamond, G. Tanigawa, J. S. HeUig, V. Folsom, H. Saito and S. Tonegawa. (1985) Nature, 316, 828-832. ACKNOWLEDGEMENTS 36. Gascoigne, N. R. J., Y. Chien, D. M. Becker, K. J. and M. M. Davis. (1984) Nature, 310, 387-390. We would like to thank Helen Garrioch for assistance in 37. Chien, Y., N. R. J. Gascoigne, J. Kavaler, N. E. Lee and M. M. Davis. completing the recombination assay. We would also like to thank (1984) Nature, 309, 322-326. Dr Marc Shulman and Matthew Binney for critical reading of 38. Siu, G., M. Kronenburg, E. Strauss, R. Haars and T. W. Mak. (1984) Nature, 311, 344-350. the manuscript. This work was supported by grants from the 39. Hayday, A. C , H. Saito, S. D. Gillies, D. M. Kranz, G. Tanigawa, H. National Cancer Institute of Canada and the Medical Research N. Eisen and S. Tonegawa. (1985) Cell, 40, 259-269. Council of Canada. G.E.Wu is a Medical Research Council of 40. Elliot, J. F., E. K. Rock, P. A. Patten and M. M. Davis. (1988) Nature, Canada Scholar, and D.A.Ramsden is the recipient of a National 331, 627-631. Cancer Institute of Canada Steve Fonyo Studentship. 41 . Ravetch, J. V., U. Siebenlist, S. Korsmeyer, T. Waldmann and P. Leder. (1981) ail, 27, 583-591. 42. Siebenlist, U., J. V. Ravetch, S. Korsmeyer, T. Waldmann and P. Leder. (1981) Nature, 294, 631-635. REFERENCES 43. Ichihara, Y., H. Matsuoka and Y. Kurosawa. (1988) EMBO J., 7, 1. Sakano, H., K. Huppi, G. Heinrich and S. Tonegawa. (1979) Nature, 280, 4141-4150. 288-294. 44. Chen, P. P., K. Albrandt, N. K. Orida, V. Radoux, E. Y. Chen, R. 2. Max, E. E., J. G. Seidman and P. Leder. (1979) Proc. Nail. Acad. Sci. Schrantz, F.-T. Liu and D. A. Carson. (1986) Proc. Natl. Acad. Sci. U.S.A., USA, 76, 3450-3454. 83, 8318-8322. 3. Akira, S., K. Okazaki and H. Sakano. (1987) Science, 238, 1134-1138. 45. Liu, M.-F., D. L. Robbins, J. J. Crowley, S. Sinha, F. Kozin, T. J. Kipps, 4. Hesse, J. E., M. R. Lieber, M. GeUert and K. Mizuuchi. (1987) Cell, D. A. Carson and P. P. Chen. (1989) J. Immunol., 142, 688-694. 49, 775-783. 46. Pech, M., H.-R. Jaenichen, H.-D. Pohlenz, P. S. Neumaier, H.-G. Klobeck and H. G. Zachau. (1984) J. Mol. Biol., 176, 189-204. 5. Early, P., H. Huang, M. Davis, Calame and L. E. Hood. (1980) Cell, 19, 981-992. 47. Bentley, D. L. and T. H. Rabbitts. (1980) Nature, 288, 730-733. 6. Wei, Z. and M. R. Lieber. (1993) / Biol. Chem., 268, 3180-3183. 48. Bentley, D. L. and T. H. Rabbitts. (1983) Cell, 32, 181-189. 7. Hesse, J. E., M. R. Lieber, K. Mizuuchi and M. GeUert. (1989) Genes 49. Pech, M. and H. G. Zachau. (1984) Nucleic Adds Res., 12, 9229-9236. Dev., 3, 1053-1061. 50. Udey, J. A. and B. Blomberg. (1987) Immunogenetics, 25, 63-70. 8. Devereux, Haeberli and Smithies. (1984) Nucleic Acids Research, 12(1), 51 . Vasicek, T. J. and P. Leder. (1990) J. Exp. Med., 172, 609-620. 387-395 . 52. Yoshikai, Y., S. P. Clark, S. Taylor, U. Sohn, B. I. WUson, M. D. Minden 9. McMorris, F. R. and W. H. E. Day. (1992) Nucleic Acids Res., 20, and T. W. Mak. (1985) Nature, 316, 837-940. 1093-1099. 53. Baer, R., T. Boehm, H. Yssel, H. Spits and T. H. Rabbitts. (1988) EMBO 10. Day, W. H. E. and F. R. McMorris. (1992) Math. Biosci., 111, 231 -247 . J., 7, 1661-1668. 11. GeUert, M. (1992) Anna. Rev. Genet., 22, 425-446. 54. Siu, G., S. P. Clark, Y. Yoxhikai, M. M., Y. Yanagi, E. Strauss, T. W. Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1796 Nucleic Acids Research, 1994, Vol. 22, No. 10 Mak and L. Hood. (1984) Cell, 37, 393-401. 94. Chou, H. S., S. J. Anderson, M. C. Louie, S. A. Godambe and M. R. Pozzi. (1987) Proc. Natl Acad. Sci. U.S.A., 84, 1992-1996. 55. Toyonaga, B., Y. Yoshikai, V. Vadasz, B. Chin and M. T.W. (1985) Proc. Nad. Acad. Sci. USA, 82, 8624-8628. 95. Louie, M. C , C. A. Nelson and D. Y. Loh. (1989) J. Exp. Med., 170, 1987-1998. 56. Tunnacliffe, A. and T. H. Rabbitts. (1985) Nucleic Acids Res., 13, 6651-6671 . 96. Garman, R. D., P. J. Doherty and D. H. Raulet. (1986) Cell, 45, 733-742. 57. LeFranc, M.-P., A. Forster and T. H. Rabins. (1986) Nature, 319, 97. Shen, A., C. Humprhies, P. Tucker and F. Blattner. (1987) Proc. Natl. 420-422 . Acad. Sci. U.S.A., 84, 8563-8567. 58. Hockett, R. D., J. de Villartay, K. PoUock, D. G. Poplack, D. I. Cohen 98. Lee, K. H., F. Matsuda, T. Kinashi, M. Kodaira and T. Honjo. (1987) and S. J. Korsmeyer. (1988) Proc. Natl. Acad. Sci. USA, 85, 9694-9698. / Mol Biol, 195, 761-768. 59. Satyanarayana, K., S. Hata, P. Devlin, M. G. Roncarlo, J. E. De Vries, 99. Berman, J. E., S. J. Mellis, R. PoUock, S. C.L., H. Suh, B. Heinke, C. H. Spits, J. L. Strominger and M. S. Krangel. (1988) Proc. Natl. Acad. Kowal, U. Surti, L. Chess, C. R. Cantor and F. W. Alt. (1988) EMBO Sci. USA, 85, 8166-8170. J., 7, 727-738. 60. Reynaud, C.-A., A. Dahan, V. Anquez and J.-C. Weill. (1989) Cell, 59, 100. Matsuda, F., K. H. lee, S. Makai, T. Sato, M. Kodaira, S. Q. Zong, 171-183 . H. Ohno, S. Fukuhara and T. Honzo. (1988) EMBOJ., 7, 1047-1051. 61. Renaud, C.-A., A. Anquez, A. Dahan and J.-C. Weill. (1985) Cell, 40, 101. Kodaira, M., T. Kinashi, I. Umemura, F. Matsuda, T. Noma, Y. Ono 283-291 . and T. Honjo. (1986) / Mol. Biol, 190, 529-541. 62. Becker, R. S., M. Suter and K. L. Knight. (1990) Eur. J. Immunol., 20, 102. Matthyssens, G. and T. H. Rabbitts. (1980) Proc. Natl. Acad. Sci. USA, 397-402 . 77, 6561 -6565 . 63. Leiberman, R., L. Emorine and E. E. Max. (1984) J. Immunol., 133, 103. Rechavi, G., B. Bienz, D. Ram, Y. Ben-Neriah, J. B. Cohen, R. Zakut 2753-2756. and D. Givol. (1982) Proc. Natl. Acad. Sci. USA, 79, 4405-4409. 64. Heidmann, O. and F. Rougeon. (1984) Nature, 311, 74-76 . 104. Rechavi, G., D. Ram, L. Glazer, R. Zakut and D. Givol. (1983) Proc. 65. Kokubu, F., R. Litman, M. J. Shamblott, K. Hinds and G. W. Litman. Natl, Acad. Sci, USA, 80, 855. (1988) EMBO J., 7, 3413-3422. 105. Heiter, P. A., J. Maizel J.V. and P. Leder. (1982) J. Biol. Chem., 257, 66. Shamblott, M. J. and G. W. Litman. (1989) EMBO J., 8, 3733-3739. 1516-1522. 67. Zezza, D. J., S. E. Stewart and L. A. Steiner. (1992) J. Immunol, 149, 106. Frippiat, J. P., P. Chuchanan, F. Bernard, L. Buluwela, G. Lefranc and 3968-3977. M. P. Lefranc. (1990) Nucleic Acids Res., 18, 7134-7134. 68. Brueggemann, B., J. Free, A. Diamond, J. Howard, S. Cobbold and H. 107. Alexandre, D., P. Chuchana, F. Brockly, G. Lefranc and M.-P. Lefranc. Waldmann. (1986) Proc. Natl. Acad. Sci. U.S.A., 83, 6075-6079. (1989) Nucleic Acids Res., 17, 3975-3975. 69. Steen, M.-L., L. Hellman and U. Pettersson. (1987) Gene, 55, 75-84. 108. Siminovitch, K. A., V. Misener, P. C. Kwong, Q.-L. Song and P. P. Chen. (1989) J. Clin. Invest., 84, 1675-1678. 70. Takeuchi, N., N. Ishiguro and M. Shinagawa. (1992) Immunogenetics, 35, 89-96 . 109. Bernard, F., P. Chuchana, J. P. Frippiat, L. Buluwela and M. P. Lefranc. 71. Renaud, C.-A., C. R. Mackay, R. G. Muller and J.-C. Weill. (1991) Cell, (1990) Nucleic Acids Res., 18, 7139-7139. 64,995-1005 . 110. Brockley, F., D. Alexandra, P. Chuchana, S. Huck, G. Lefranc and M.- P. Lefranc. (1989) Nucleic Acids Res., 17, 3976. 72. McCormack, W. T., L. M. Carlson, L. W. Tjoelker and C. B. Thompson. (1989) Int. Immunol, 1, 332-341. 111. Daley, M. D., H. Peng, V. Misener, X. Liu, P. P. Chen and K. A. Siminovitch. (1992) Mol. Immunol, 29, 1515-1518. 73. Blankenstein, T., F. Bonhomme and U. Krawinkel. (1987)Immunogenetics, 26, 237-248. 112. Smith, W. J., A. Tunnacliffe and T. H. Rabitts. (1987) Nucleic Acids Res., 15, 4991. 74. Schroeder, H. W., J. L. Hillson and R. M. Perlmutter. (1989) Int. Immunol, 113. Siu, G., E. C. Strauss, E. Lai and L. E. Hood. (1986) J. Exp. Med., 2, 41-50. 164, 1600-1614. 75. Cohen, J. B. and D. Givol. (1983) EMBO J., 2, 2013-2018. 114. Dcuta, K., T. Ogura, A. Shimizu and T. Honjo. (1985) Proc. Natl. Acad. 76. Sakano, H., R. Maki, Y. Kurosawa, W. Roederand S. Tonegawa. (1980) Name, 286, 676-683. Sci. U.S.A., 82, 7701-7705. 77. Givoli, D., R. Zakut, K. Effron, G. Rechavi, D. Ram and J. B. Cohen. 115. Lefranc, M.-P., A. Forster, R. Baer, M. A. StinsonandT. H. Rabbitts. (1981) Nature, 292, 426-430. (1986) Cell, 45, 237-246. 78. Olio, R., C. Auffray, J.-L. Sikorav and F. Rougeon. (1981) Nucleic Acids 116. Huck, S., P. Dariavach and M.-P. Lefranc. (1988) EMBOJ., 7, 719-726. Res., 9, 4099-4109. 117. Guglielmi, P., F. Davi, L. d'Auriol, J.-C. Bories, J. Dausset and A. 79. Schiff, C , M. Milili, I. Hue, S. Rudikoff and M. Fougereau. (1986) J. Bensussan. (1988) Proc. Natl. Acad. Sci. U.S.A., 85, 5634-5638. Exp. Med., 163, 573-587. 118. Schwager, J., N. Burckert, M. Courtet and L. D. Du Pasquier. (1989) 80. Siekevitz, M., S. Y. Huang and M. L. Gefter. (1983) Eur. J. Immunol, EMBO J., 8, 2989-3001. 13, 123-132. 119. Knight, K. L. and R. S. Becker. (1990) Cell, 60, 963-970. 81. Kataoka, T., T. Nikaido, T. Miyata, K. Moriwaki and T. Honjo. (1982) 120. McCormack, W. T., S. M. Laster, W. F. Marzluff and K. H. Roux. J. Biol. Chem., 257, 277-285. (1985) Nucleic Adds. Res., 13, 7041-7045. 82. Yancopoulos, G. D. and F. W. Alt. (1985) Cell, 40, 271. 121. Becker, R. S., S. K. Zhai, S. J. Currier and K. L. Knight. (1989) J. 83. Cohen, J. B., K. Effron, G. Rechavi, Y. Ben-Nenah, R. Zakut and D. Immunol, 142, 1351-1355. Givol. (1982) Nucleic Acids Res., 10, 3353-3370. 122. Heidmann, O. and F. Rougeon. (1983) Cell, 34, 767-777. 123. Gutman, G. A., R. M. Besta, M. B. Frank and P. R. Baverstock. (1987) 84. Crews, S., G. J., H. Huang, K. Calame and L. E. Hood. (1981) Cell, Immunogenetics, 26, 14-20. 25, 59-66. 85. Bothwell, A. L., M. Parking, M. Reth, T. Imanishi-kari, K. Rajewsky and D. Baltimore. (1981) Cell, 24, 625. 86. Yancopoulos, G. D., S. V. Desiderio, M. Paskind, J. F. Kearney, D. Baltimore and F. W. Alt. (1984) Nature, 311, 727-733. 87. Olio, R., J.-L. Sikorav and F. Rougeon. (1983) Nucleic Acids Res., 11, 7887-7897. 88. Ucker, D. S., Y. Kurwawaand S. Tonegawa. (1985)/ Immunol.., 135, 89. Bernard, O., N. Hozumi and S. Tonegawa. (1978) Cell, 15, 1133-1144. 90. Tonegawa, S., A. M. Maxam, R. Tizard, O. Bernard and W. Gilbert. (1978) Proc. Natl Acad. Sci. U.S.A., 75, 1485-1489. 91. Sanchez, P., P. N. Marche, D. Rueff-Juy and P.-A. Cazenave. (1990) / . Immunol, 144, 2816-2820. 92. Hirama, T., S. Takeshita, Y. Matsubayashi, M. Iwashiro, T. Masuda, K. Kuribayashi, Y. Yoshida and H. Yamagishi. (1990) Eur. J. Immunol ,21 , 483-488 . 93. Chou, H. S., M. A. Behlke, S. A. Godambe, J. H. Russell, C. G. Brooks and D. Y. Loh. (1986) EMBO J., 5, 2149-2155. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nucleic Acids Research Oxford University Press

Conservation of sequence in recombination signal sequence spacers

Download PDF
12 pages

Loading next page...
 
/lp/oxford-university-press/conservation-of-sequence-in-recombination-signal-sequence-spacers-1T39rGA3bc

References (0)

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Oxford University Press
Copyright
© Oxford University Press
ISSN
0305-1048
eISSN
1362-4962
DOI
10.1093/nar/22.10.1785
Publisher site
See Article on Publisher Site

Abstract

Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 © 1994 Oxford University Press Nucleic Acids Research, 1994, Vol. 22, No. 10 1785-1796 Conservation of sequence in recombination signal sequence spacers Dale A.Ramsden+, Kristin Baetz and Gillian E.Wu* Department of Immunology, University of Toronto, Toronto, Ontario M5S 1A8 and The Wellesley Hospital Research Institute, 160 Wellesley Street East, Toronto, Ontario M4Y 1J3, Canada Received October 21, 1993; Revised and Accepted April 13, 1994 ABSTRACT The variable domains of immunoglobulins and T cell resulting in a definition of two classes of RSS, both possessing receptors are assembled through the somatic, site identical conserved seven bp (heptamer) and nine bp (nonamer) specific recombination of multiple germline segments motifs. One class has an approximately 12 bp spacer of non- (V, D, and J segments) or V(D)J rearrangement. The conserved sequence separating the heptamer and nonamer motifs, while the other class has an approximately 23 bp spacer [5] recombination signal sequence (RSS) is necessary and sufficient for cell type specific targeting of the V(D)J V(D)J rearrangement occurs efficiently only between a 12 bp rearrangement machinery to these germline segments. spacer RSS and a 23 bp spacer RSS. Previously, the RSS has been described as possessing The RSS spacers, as previously discussed, are generally both a conserved heptamer and a conserved nonamer assumed to lack conserved sequence. The overall sequence motif. The heptamer and nonamer motifs are separated composition of the spacer was considered as potentially signifi- by a 'spacer' that was not thought to possess cant, however, as early mechanisms of V(D)J rearrangement significant sequence conservation, however the length suggested that a recombination intermediate required melting of of the spacer could be either 12 +/ - 1 bp or 23 +/ - RSS DNA [1]. Two experiments, involving complete substitution 1 bp long. In this report we have assembled and of spacer sequence with GC base pairs, attempted to address this analyzed an extensive data base of published RSS. We question, and have conflicting results. Experiments by Sakano have derived, through extensive consensus and colleagues suggested that GC substitution of an RSS spacer comparison, a more detailed description of the RSS resulted in an impairment of recombination frequency [3], while than has previously been reported. Our analysis in experiments by Lieber and colleagues the authors suggest that indicates that RSS spacers possess significant GC substitution of RSS spacers made no significant difference [6] conservation of sequence, and that the conserved Previous consensus analysis of RSS have concentrated on the sequence in 12 bp spacers is similar to the conserved heptamer and nonamer [7] We have used the considerable sequence in the first half of 23 bp spacers. increase in the number of sequenced RSS present in the data bases to analyse the spacer sequences. We have constructed a large database of aligned, functional RSS from different species and INTRODUCTION different loci, classified according to the size of the RSS spacer. A comprehensive RSS consensus, based upon classification by The adaptive immune response in vertebrates combats RSS spacer size and including heptamer and nonamer motifs as environmental pathogens by the use of a vast repertoire of antigen well as the spacer, is presented. In contrast to previous definitions specific receptors (immunoglobulins and T cell receptors). The of RSS, we observed significant conservation of sequence in RSS diversity of this repertoire is resident in the variable domain, spacers. Moreover, the conserved sequence for 12 bp spacers which is assembled though a somatic, cell type specific process is similar to the conserved sequence in the first half of 23 bp involving the site specific recombination of germline V, D and spacers. J segments [V(D)J rearrangement]. Adjacent to the coding sequence of all V, D and J segments that are capable of V(D)J rearrangement is a conserved non- MATERIALS AND METHODS coding sequence that functions as a targeting signal for RSS analysis recombination, termed the recombination signal sequence (RSS) Alignment of RSS. We have obtained 453 examples of RSS, from [1,2] Recombination substrates have demonstrated that RSS are both necessary and sufficient for targeting of V(D)J different species and different loci (see Tables 1 and 2). Sequences rearrangement to lymphoid cell types [3, 4] RSS were originally were retrieved from GenBank (release 67.0) or the specified defined through alignment and comparison of multiple examples, references using 'lineup', a Genetics Computer Group [8] (GCG) *To whom correspondence should be addressed +Presem address: National Institutes of Health, NIDDK, Room 312, Building 5, Bethesda, MD 20892, USA Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1786 Nucleic Acids Research, 1994, Vol. 22, No. 10 Table 1. Sources of 12 RSS program that allows visual alignment of multiple sequences. As our primary goal is to relate sequence conservation to function, Species we exclude RSS that are associated with a pseudo-gene segment Mus Hum Chk Rab Hef Xel Rat Bov Shp Duk totals Locus (as defined by the ability to contribute to a functional, mature - - - - 94 IGHD 20 32 16 12 12 2 protein), and classified the RSS solely on the length of the spacer. IGK V 30 17 5 2 3 57 IGXJ 3 4 1 - . 1 1 1 11 Care was taken to include only one example of a given gene TcRaJ 46 5 51 segment's RSS when multiple versions of the same gene segment . . . 25 TcRpj 12 13 were present in GenBank. We note that while considerable effort 2 2 - - 4 TcRpD has been expended to ensure this database is comprehensive, it - 1 - - 5 TCRYJ 2 2 is not complete. We define here an abbreviation to aid in future TcR6D 2 2 4 description of the RSS: RSS derived from 12 bp spacer RSS will - . - - . 4 TcR6J 2 2 be referred to as 12 RSS, while RSS derived from 23 bp spacer 3 1 1 1 totals 119 79 17 17 14 3 255 RSS will be referred to as 23 RSS. Abbreviations: IG; immunoglobulin. TcR; T cell receptor. H; heavy chain, x; Sequences were aligned using 'pileup', a GCG program that light chain of the kappa isotype. X; light chain of the lambda isotype. Isotype classification for Xel and Hef chains is not clear, however they are grouped with aligns groups of sequences based on comparison of the closest whatever light chain isotype has the same sized RSS spacer for the purposes of related pairs, and introduces gaps to promote optimal alignment. these tables, a; T cell receptor alpha chain. 0; T cell receptor beta chain. 7; As experiments suggest that RSS function efficiently only if the T cell receptor gamma chain. 8; T cell receptor delta chain. V; variable gene first three nucleotides of the heptamer are fixed at CAC, and segment. D; diversity gene segment. J; joining gene segment. Species are Mus; the heptamer and nonamer are separated by a spacer with Mouse (Mus musculus). Hum; Human (Homo sapiens). Xel; Frog (Xenopus laevis). Shp; Sheep (Ovis aries). Hef; Horned shark (Heterodontus francisats). variation in length of 11 — 13 bp or 22 - 24 bp only [7], gaps were Rab; Rabbit (Oryctolagus cuniculus). Chk; Chicken (Gallus gallus). Bov; Cow inserted for optimal alignment based on these criteria. This was (Bos taunts). Rat; Rat, (Rattus norvegicus). Duk; Muscovy duck. achieved using the pileup parameters 'gap weight' set at three, and 'gap length weight' set at 0.2. (see Tables 3 and 4). As similar sequences are often grouped together in these tables, gap position Table 2. Sources of 23 RSS may occasionally appear somewhat idiosyncratic when limited Species portions of the database are observed. Moreover, while the gap Locus Mus Hum Xel Shp Hef Rab Chk Rat Ouk totals weight and gap length parameters applied resulted in largely 12 IGHV 32 25 16 4 5 1 83 and 23 bp spacers, as hoped, RSS that appear to have longer - - IGHD 4 4 spacers than 12 or 24 bp cannot accommodate extensive gaps IGHJ 4 5 - 4 4 1 1 19 without high penalty, and thus may appear misaligned. IGKJ 4 5 2 1 5 17 3 9 14 1 1 2 30 IGXV - . . TcRaV 9 2 11 Consensus determination. Consensus sequences were determined TcR&V 8 8 16 using the 'plurality' rule [9] (Tables 5 and 6). This method TCRP D 2 2 4 determines a consensus result with varying degrees of ambiguity, TcRyV 3 5 - . 8 such that for each position the degree of ambiguity is related to - - . TcR6V 2 2 the significance of the observed nucleotide conservation. A 2 2 - - - . 4 TcR&D consensus result may consist of only one nucleotide and thus be 67 65 16 14 3 2 totals 14 10 7 198 unambiguous, indicating a highly conserved position, or may be Abbreviations: IG; immunoglobulin. TcR; T cell receptor. H; heavy chain, x; ambiguous for up to all four nucleotides. A position with a light chain of the kappa isotype. X; light chain of the lambda isotype. Isotype consensus result ambiguous for all four nucleotides has a classification for Xel and Hef chains is not clear, however they are grouped with whatever light chain isotype has the same sized RSS spacer for the purposes of nucleotide distribution indistinguishable from random. Analysis these tables, a; T cell receptor alpha chain. /3; T cell receptor beta chain. 7; of the properties of this rule indicate that when there are at least T cell receptor gamma chain. 6; T cell receptor delta chain. V; variable gene 100 sequences in a database (both 12 RSS 23 RSS sets have over segment. D; diversity gene segment. J; joining gene segment. Species are Mus; 100 sequences), the probability that a randomly generated Mouse (Mus musculus). Hum; Human (Homo sapiens). Xel; Frog (Xenopus database would produce a consensus result ambiguous for less laevis). Shp; Sheep (Ovis aries). Hef; Horned shark (Heterodontus franciscus). Rab; Rabbit (Oryctolagus cuniculus). Chk; Chicken (Gallus gallus). Bov; Cow than four nucleotides is less than 1% [10]. We further define (Bos taunts). Rat; Rat, (Rattus norvegicus). Duk; Muscovy duck. consensus results ambiguous for more than one nucleotide by reporting the nucleotides in order of the frequency that they are observed, from the most frequent to the least frequent. 22 bp separating the heptamer and nonamer, two (1% with 21 bp separating the heptamer and nonamer, and 17 (9%) with 24 RESULTS bp separating the heptamer and nonamer. Alignment of RSS The results of the sequence analysis of these alignments will refer to the positions in each alignment as belonging to one of 255 examples of 12 RSS were obtained, largely derived from IgH D and Igx V loci (Table 1). As described in the Materials the three elements (heptamer, nonamer, and spacer), and the 5' and Methods, gaps were inserted for optimal alignment, although terminus of each element will be referred to as the first position gaps were rarely required for the alignment of 12 RSS (Tables of each element. 3 and 5). 198 examples of 23 RSS were obtained (Table 2). Gaps Conservation of sequence in the heptamer and nonamer were introduced such that there are 24 positions between the heptamer and the nonamer (see Tables 4 and 6). 80% of RSS The consensus sequence for all positions of the heptamer, for (159/198) contained a single one base pair gap, and therefore both 12 RSS and 23 RSS, was unambiguous (Tables 5a and 6a). possessed 23 bp spacers. There were 20 (10%) sequences with The first three nucleotides of the heptamer were almost perfectly Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1994, Vol. 22, No. 10 1787 Table 3. Alignment of 12 bp spacer RSS Species Locus Segment Heptamer Spacer Nonamer Reference MUS GH 0 052 CACTGTG GTGCTCCGCTTA GTCAAAACC 171 DQ52 CACGGTG ACGCGTGGCTCA ACAAAAACC 171 0 SP2-2 CACAGTA GTAGATCCCTTG ACAAAAATC ACAAAAACC 0 SP2-2 CACAGTG ATATATCCAGCA [181 ACAAAAATC DSP2-3 CACAGTA GTAGATCCCTTG 19 DSP2-3 CACAGTG ATATATCCAGCA ACAAAAACC 19 DSP2-4 CACAGTA GTAGATCCCTTG ACAAAAATC 19 DSP2-4 CACAGTG ATATATCCAGCA ACAAAAACC M91 ACAAAAATC DSP2-5 CACAGTA GTAGATACCTTG (191 ACAAAAACC DSP2-5 CACAGTG ATATATCCAGCA M9l DSP2-6 CACAGTA GTAGATCCCTTG ACAAAAATC M9l DSP2-6 CACAGTG ATATATCCAGCA ACAAAAACC M9I D SP2-7 CACAGTA GTAGATCCCTTG ACAAAAATC [191 D SP2-7 CACAGTG ATATATCCAGCA ACAAAAACC [191 D SP2-8 CACAGTA GTAGATCCCTTG ACAAAAATC DSP2-8 CACAGTG ATATATCCAGCA ACAAAAACC ACAAAAAGC D FL16.1 CACAGTA GTAGATCCCTTC 19 D FL16.1 CACAGTG CTATATCCATCA GCAAAAACC 191 D FL16.2 CACAGTA GTAGATCCCTTC ACAAAAAGC [191 0 FL16.2 CACAGTG CTATATCCAGCA ACAAAAATC 191 IGK V 18.1 CACAGTG ATGCAGACCCTA ACAAAAACA 20 VK1A5 CACAGTG ATACAGACCCTA ACAAAAATA V5.1 CACAGTG ATACAGACCCTA ACAAAAATA [201 ACAAAAACC VK24C CACGGTG ATACAGCCCTGA 21) V K24A (Pa) CACAGTG ATACAAACCTGA ACAAAAACC 21 VK24.1 CACATTG ATACTGCACTGG ACAAAAACC V-Ser CACAGTG CTTCAGCCTCCT ACACAAACC [221 V167 CACAGTG ATAGAGCCCTGA ACAAAAACC [23 VMOPC173b CACAGTG ATACAAATCACA ACATAAACC VK41 CACAGTG ACATAAACC ATACAAATCATA 25 VK2 CACAGTG ATTCAAGCCATG ACATAAACC 26 VK1.6(21x) CACAGTG CTCCAGGGCTGA ACAAAAACC 271 VK21E CACAGTG CTCCAGGGCTGA ACAAAAACA [271 VK21B CACAGTG CTCCAGGGCTGA ACAAAAACC 27 VK21C CACAGTG CTCCAGGGCTGA ACAAAAACC 27 VK18 CACAGTG CTCCAGGGCTGA ACAAAAACC 27 VK24A CACAGTG ATGCAGCCCTGA ACAAAAACC VK24B CACACTG ATACAGCCCTGA ACAAAAACA CACAGTG V1B ATACAGACCCTA ACAAAAATA 29 V1C CACAGTG ATACAGACCCTA ACAAAAATA 29 VR11 CACAGTG ATACAGGCTGGA ACAAAAAC. 30 VR1 CACAGTG CTACATACTGAA ACAAAAACA 30 CACAGTG CTACAGACTGGA ACAAAAACA 30 VLB CACAGTG ATACAGACTGGA ACAAAAACC [301 VH6 VH1 CACAGTG CTACAGACTAGA ACAAAAACC [301 VH4 CACAGTG ATACAGACTGGA ACAAAAACC [301 VH9 CACAGTG ATACAGACTGGA ACAAAAACC 30 VR9 CACAGTG ATACAGACTGGA ACAAAAACC 30 VH13 CACAGTG ATACAGACTGGA ACAAAAACC 30 CACAGTG ATACAGACTGGA ACAAAAACC VH3 30 CACTGTG ATATAGACTCAT GCAAAAAA. MUS IGX J1 31 CACAATG ACTAAAACCCAA CCCAAAACC J2 31] J3 CACAGTG ACTGAAACCCAA CCCTAAACC 31 TCRa JTA65 CACTGTG ACAATAACCTCA ACAAAAACC [32 Jnew2 CACAGCA AATCAACCCTTT ACAAAAAAC 33 JTA91 CACACGT CTCTTCGTGAGA AGACACTGT 33 JC5A CACTGTA ACACGGGCCTTT ACAAAAACA 33 Jnewi CACAGCC TGGGGAGGCTTT ACAAAAACA J2b4A CACAATG ACACGGGACTCT ACAAAAACT 33 JTA27 CACACCC ACACACTGCCTT ACAAATACT 33 JTA1 CACACTG CACTGAAGGGCT TTGCAAAAA 33 J45 CACACTG CACTGAAGGGCT TTGCAAAAA 34 JBOFUI CACAGTG ATTTGTCCTGTG ACAAAATGG 33 JPHDS GCTGACTCTACA ACAAAAACT 32 CACAGTG JTA84 ACAAAAACT 32 CACAGTG ATCTCTTCCACC JT2C CACAGTG ATATCATGTTCT ACAAAAACC 35 JTA31 CACAGTG TGCCAAGCCATT ACAAAATCC 33 Jnew3 CACTGTC TCCAATAACAGC ACAGAAAAC 33 JTA80 ACATAAACC 32 CACCCTG AGGCAAGCCTTG JTA46 CACTGTG AGACACTCCATA TCAGAAACC 33 Jnew4 CACAGTA ATACACACTCTA ACAAAAACT 33 J newS CACAGTC ATTTGGGGCCTT ACAATAACC 33 JTA19 CACAGTG TTCTGTGTCTCT ACATAAACC 32 JTA37 ATCTCCAGCTCA GCAAAAACC 33 CACAGtTG JNAT1 CACAGTT ATAGAGAGCTTT ACAGAAATG 33 JTAS7 CACCCCA ATGCTGCACTTT ACAAAAACT 33 Jnew6 CACAGTG ATATCATGTTCT ACAAAAACC 33 Jnew7 CACAGAC ACAAAAACCTTA ACAAAAACA 33 JTT11 CACAGCC CTGCAGAGCCTT ACAATAACT 32 JTA20 TCTCTTGCCTTT ACTGAAACC 33 CACATCA Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1788 Nucleic Acids Research, 1994, Vol. 22, No. 10 Table 3. (com.) Species Locus Segment -teptamer Spacer Nonamer Reference J BM10-37 CACACTG TACCCAAAA TGATTGGGACCA [33 JnewiO CACAGTG ATCTGAAGCCAA GCAAAAACA 33 Jb12 CACAGTG CCAGCCCCCTTT ACACAAATC 33 CACAATG ACAGAAAGC J14-4 GTTAGCACCATT 33 JTA28 CACTGTG ATTTGCTCAACA ACAAGAACC 33 JBM2T3-1 CACTGTG TTACATACCCTG TCAAAAACA 33 Jnew9 CACACTG TGACAAACACGT CTACAAAAT J 112-2 CACAGTG GGTTTCCTCTTA GCAAAAACT CACAGTG CTCCGTGCTATT GCAATAACC JTA61 33 Jnow8 CACAGAA TTTCCTTTCTTT GCAAAAACT 33 JTA26 CACTGCA GGTGACACCTTT ACAGAAGCC 33 Jnew14 CACAGTA GAAAGGTGCTTT ACAAGAATT 33 Jnew13 CACAGTG AGGAAAGCCTTT GATGAAACC CACTCTG J new12 AGTAAGTGCTTC ACAAAAACG 33 JTA72 CACAGTG ATTTGTCCTGTG ACAAAATGG 33 J newii CACAGCA GCAAACCTCTCC ACAAAAATG 33 CACTGTA AGTGAGGTCTTT ACAAAATGG JTA39 33 CACAGTG JDK1 AAACGAGGCCCT GCAAATTCT 33 JLB2A CACAGTG CCAGCCCCCTTT ACACAAATC 33 TCRP J1.1 CACAGTG CCATAGGATGAG GAGAAAAAT MUS 36J CACATCA GAATACAGATAC TGCAATATG J1.2 36 TCRP J1.3 CACAGCC TCCCGGGTTCAC TTCAAAACC MUS 36 J1.4 CACAACA TTAAAGCCTAGT GGTAAAACT 36] CACAGTA CAACATGAGGGT GACAAACTC J1.5 36 CACAGCT GCAGGTGACCTT GGTAAAACC J1.6 36 CAAGAATTC J2.1 CACAGCA GAAAAGGGCTAC 37 J2.2 CACAGTC TTGGAAATGCTG GCACAAACC [371 J2.3 CACAGCC TCCAGGCTCAGG ACAAAAACT 371 J2.4 CACAGCC TCTTGGTACAGG ACAAAAACT 37] J2.5 CACAGCC CCAGAACCCAAC ACAAAAACT 37 J2.7 CACAGTG GCTCAACCCCAC ACACAAACC 37 CACAATG TTACAGCTTTAT ACAAAAAAG 38 TCRP D M CACAATG TTACATCGTGAT ACAAAAAAG 38 D2-1 CACAGTG CTCACAGCTTCT ACAAAAATC 39 TCR Y J1 J2 CACAGTG CTCACAGCTTCT ACAAAAATC CACGGTG TCR6 D2 CTACAGAGCTTT GCAAAAACC 4£ D1 CACAGTG AAACACAGCCGT ACAAAAACA 40; TCR5 CACGTTA TAATCTTGCTTT GCAGATAAC 40 J2 CACAGCT ACTGAGGCCCAT TCCAAAAAC 40 J1 CACAGTG 41 HUM IGH DHQ52 ATTGGCAGCTCT ACAAAAACC DMQ52 CACAGTG GTTCTCAGCTCA GCCAAAAAC 41 DLR1 CACAGTG ACACAGCCCCAT TCCCAAAGC 42 DLR1 CACAGTG ACACGAGCCCCC ACAAAATCC 42 DLR2 CACAGTG ACACGAGCCCCC ACAAAATCC 42 DLR2 CACAGTG ACACAGACCCAT TCCCAAAGC 42 CACAGTG ACACAACCCCAT TCCTAAAGC 42 DLR3 DLR3 CACAGTG ACACGAGCCCCC ACAAAATCC 42 DLH4 CACAGTG ACACGAGCCCCC ACAAAATCC 142 DLH4 CACAGTG ACACAGCCCCAT TCCCAAAGC 42 DXP4 CACAGTG ACACAGACCTCA CCCCAAACC 43 DXP4 CACAGTG TCACAGAGTCCA TCAAAAACC 43 CACAGTG DXP1 ACACAGACCTCA CCCCAAACC 43 CACAGTG DXP1 TCACAGAGTCCA TCAAAAACC 43 DXP1 CACAGTG ACACAGACCTCA CCCCAAACC 43 DXF1 CACAGTG TCACAGAGTCCA TCAAAAACC 43 CATAGTG ATGAACCCAGTG GCAAAAACT 43 DAI CACAGCA GGAGGGCCCTTC 43 ACAAAAAGC DAI CACAGTG ATGAACCCAGCA 43 DA4 GCAAAAACT DA4 CACAGTA GGAGGACCCTTC ACAAAAAGC 43 CACAGTG GTGCTGCCCATA GCAGCAACC 43 D M CACAGTC TGACACCCCCTG ACAATAACC 43 DK4 CACAGTG GTGCCGCCCATA GCAGCAACC 43 DK1 CACAGTC DK1 TGACATCGCCTG ACAATAACC 43 DN4 CACAGTG ACACTCGCCAGG CCAGAAACC 43 DN4 CACTGTG ACACAGACACCT TCAGAAACG 43 DN1 CACAGTG ACACTCACCCAG CCAGAAACC 43 CACAGTG ACACAGACACCT TCAGAAACC 43 DN1 CACTGTG DM1 AGAAAAGCTTCG TCCAAAACG [43 CACTGTG DM1 ACTCGGGGCTGT TCAGAATCC 43 CACTGTC AGAATAGCTACG TCAAAAACT 43 DM2 CGCTGTG DM2 ACTCGGGGCTGT TCGGAATCC 431 GK V321 CACAGTG ATTCAGCTTGAA ACAAAAACC 441 HUM IG* V305 CACAGTG ATTCAGCTTGAA ACAAAAACC [441 V328-h2 CACAGTG ATTCAACATGAA ACAAAAACC [451 CACAGTG ATTCAACATGAA V328 ACAAAAACC [4S1 Vb CACAGTG TTACCAACCCGA ACATAAACC [461 Vb1 CACAGTG TTACCAACCCGA ACATAAACC [461 V HK1O1 CACAGTG TTACACACCCAA ACATAAACC [471 VHK1O2 CACAGTG TTACACACCCGA ACATAAACC [471 Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1994, Vol. 22, No. 10 1789 Table 3. (com.) Segment Heptamer Spacer Nonamer Species Locus Reference CACAGTG VHK146 TTACACACCCAA ACATAAACC f48 CACAGTG ACATAAACC V HK137 TTACACACCCAA [48 VHK166 CACAGTG TTACACACCCAA ACATAAACC 48 VHK189 CACAGTG TTACACACCCAA ACATAAACC 48 Va' CACAGTG TTACAAACCCGA ACATAAACC 46 CACAGTG TTACAAACCTGA ACATAAACC 46 Vd CACAGTG TTACACACCCAA ACAAAAACC Ve [46 Vg CACAGTG ATTCCACATGAA ACAAAAACC 49) V-h CACAGTG ATTCAACATGAA ACAAAAACC 49 IGX. CACAGTG ACTGAGGCTCAG ACCAAAACC 50 J1 CACTGTG ACACAGGCTCAT ACAAAAACC 50 J2 CACTGTG ACAAAAACC J3 ACACAGGCTCAT 50 CACAGTG ACACAAACC J7 ACACAGCCCCAC T511 CACTATG ACAAAACCA TCRa JC ATTTGCTCAACA f52| JB CACAGTG TTTCTTAGTCAG TCAAAAACA f52] CACAGTG ATACTGAGATCT ACAAAAACC JAB rs3i JRP CACTGTG AGATGCTTCATA ACAGAAACC T531 CACAGTG TTATGTGTCTCT ACATAAACC 53 JAA J1.1 CACAGTG ACAGGGGTCAAG GTGAAAATC 54 TCRB CACATAA GAATATAGCCAC TCTAAAAGG J1.2 541 J1.3 CACAGCC TCCCAGGGCCAC TTCAAAACC [551 J1.4 CACAACA TTAAAGACTGGA AGGAAAACC [551 J1.5 CACAGTG CATCATGAGTGT GGCAAACCC f55] J1.6 CACAGCT GCAGAGGCTTAG ATAAAACCC fSSl J2.1 CACAGTG GGAAGGGGCTGC CCAGAATTC [561 CACAGCC GCGCAAACC J2.2 CTGGGGACCCTG [561 J2.3 CACAGCC TGGAGGCCCAGG ACAAAAACC [561 J2.4 CACAGCC CCGAGACGCGGC ACAGAAACT [561 J2.5 CACGGCC CCCGAGCCCCGC ACAAAAACC [561 J2.6 CACAGCC CGGGGACTCCCC GCAAAAACC [56 J2.7 CACGGAG GTGCACCCCCGC ATGCAAACC TCR0 CACAATG D1.1 TTACAGCTTTGT ACAAAAACA 55 D2.1 CACAATG TTACACCATGAT ACAAAAATG 55 J1 CACAGTG ATTCAGTCCATA TCAAAAACT 57 TCRy CACAGTG ATTCAGTCCATA TCAAAAACT 57 J2 TCR4 CACAATG AAACACATCAGT D1 ATAAAAACC 58 CACAGTG D2 CTACAGAGCTTT ACAAAAACT 58 TCR8 J2 CACATTA TGACAGTGCCTC ACAGGTAAC [591 HUM J1 CACAGCA CTTGAGGACGTT CCAAAAACC [59 GH 01 CACGGTG CTCCATCCCATA ACAAAAACC 60 CHK D1 CACAGTG ATACAACGTTGA CCAAAATCC 60 CACGGTG D2 CTCCATCCCATA ACAAAAACC 60 CACGGTG D2 ACACGACGTTGA CCAAAATCC 60J D3 CACGGTG ATCCATCCCATA ACAAAAACC 60 IGH 03 CACGGTG ACACAACGTTGA CCAAAATCC CHK §9J 04 CACAATG CTCCATCCCATA ACAAAAACC 60 CACGGTG ACACAACGTTGA CCAAAATCC D4 60 CACGGTG CTCCATCCCATA D5 ACAAAAACC 60 CACGGTG ACACAACGTTGA D5 CCAAAATCC 60 D6 CACGGTG CTCCATCCCATA ACAAAAACC 60 06 CACGGTG ACACAACGTTGA CCAAAATCC [60] D7 CACGGTG CTCCATCCCATA ACAAAAACC [601 CACAGTG D7 ATACAACGTTGA CCAAAATCC [601 CACAATG D8 CTCCATCCCATA ACAAAAACC [601 38 CACGGTG ACACAACGTTGA CCAAAATCC [601 IGX J CACAGTG ATACGGAGCAAT GCAAAAACC [611 GGTTGGCCCTTC RAB IGH 01a CACGGTG ACAAAATCC T621 Ola CACAGTG GTGCA.CCCAGC ACAAAAACC [621 31b CACGGTG GGTCGGCTCTTC ACAAAATCC [62 D1b CACAGTG GTGCA.CCCAGC ACAAAAACC 62 CACGGTG GGTCGGCCCTTC 01c ACAAAATCC 62 01c CACAGTG GTGCA.CCCAGC ACAAAAACC 62 Old CACGGTG GGTCGGCCCTTC ACAAAATCC [62 Did CACAGTG GTGCA.CCCAGC ACAAAAACC [621 CACCATG CTGCAGACCAGT 02a ACAAAATCC 62 02a CACAGTG CCTCA.GGCCTC ACATAAAAC 62 02b CACTGTG TCTCAGACCAGC ACAAAATCC 62 D2b CACAGTG CCTCA.GGCCTC ACATAAAAC 62 GK V20 CACAGTG ATACAAGCCCTA ACAAAAACC [631 V18a CACAGTG ATACAAGCCCTT ACAAAAACC [641 V 18b CACAGTG TTAGAAGCCCTA ACAAAACCA (641 V19a CACAGTG TTCCAAGCCCTA ACAAAAACC [641 V19b CACAGTG TTCCAAGCCCTA ACAACTCCC 64] HEF IGH 0 2 1403 CACAGCA GTTACTGTCAGT ACAAAAAGT 65 0 2 2807 CACAGCA GTTACTGTCAAT ACAAAAAGC 65 D1 1113 CACAGTG AGACACACCGTG TCAAATACT D1 1113 CACTGTG ACACGAACCCGC ACAAATACT 65 D1 2807 CACAGTG ACACGAACCAGC ACAAATACT 35 D1 1403 CACAGTG GACTTCAAAGCT GTACAAATA 35 0 1 1315 CACAGTG ACACGAACCTGC ACAAATACT 65 Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1790 Nucleic Acids Research, 1994, Vol. 22, No. 10 Table 3.(cont.) Segment -leptamer Nonamer Reference Species Locus Spacer D 2 2807 CACAGTG AGACACACCGTG TCAAATACC 65 0 2 1403 CACAGTG AGACAAACCGTG TCAAATACT 65 CACAGTG 0 2 1315 AGACAAACCGTG TCAAATACT 65 CACAGCA 0 2 1315 GTTACTGTCAAT ACAAAAACT 65 D21113 CACAGCA GTTACTGTCAAT ACAAAAAGT 65 V122 CACAGTG AGACAGGGCAAT ACAAAAACT IGL 66 CACAGTG AGACAGGGCAAT ACAAAAACT V141 [66 ATACAGAGCTGA IGK V1 CACAGTG ACAAAAACC 67 XEL V2 CACAGTG ATACAGAGCTGA ACAAAAACC 67 V3 CACAGTG ATACAGAGCTGA ACAAAAACC 67 K3H CACAGTG ACTTGTGGCTCA ACAAAAACC 68 RAT D 0 CACAGTG ATGCTTTGCTTA GTCAAAACC 68] IGX J2 CACAGTG ACTGAGACTCAA CCCAAAACC 69] TCAAAAACT BOV TCRy J CACAGTG ATTCAAGTCATA 70 ACACAGGCTTGC SHP IGX J CACAGTG ACAAAAACC 71 IGX J CACAGTG ATACAGGGCCAT GCAAAAACC DUK 1721 Abbreviations: IG; immunoglobulin. TcR; T cell receptor. H; heavy chain, x; light chain of the kappa isotype. X; light chain of the lambda isotype. Isotype classification for Xel and Hef chains is not clear, however they are grouped with whatever light chain isotype has the same sized RSS spacer for the purposes of these tables, a; T cell receptor alpha chain. /3; T cell receptor beta chain. 7; T cell receptor gamma chain. S; T cell receptor delta chain. V; variable gene segment. D; diversity gene segment. J; joining gene segment. Species are Mus; Mouse (Mus musculus). Hum; Human (Homo sapiens). Xel; Frog (Xenopus laevis). Shp; Sheep (Ovis aries). Hef; Horned shark (Heterodontus franciscus). Rab; Rabbit (Oryaolagus cuniculus). Chk; Chicken (Gallus gallus). Bov; Cow (Bos taunts). Rat; Rat, (Rattus norvegicus). Duk; Muscovy duck. Periods in sequences designate a gap inserted for best alignment. conserved. While this high conservation is derived to some degree heptamer, A, T, A, C, and A ('A5'), found in 50%, 56%, 58%, from alignment considerations (see Materials and Methods), it 62%, and 67% of 12 RSS respectively. The next two positions is consistent with a previous analysis, which indicated that these possess a more random distribution of nucleotide composition positions were both highly conserved and critical for efficient than the preceding positions. C is the most frequently observed function of RSS [7]. nucleotide at the following two positions, the eighth and ninth positions, in 59% and 68% of 12 RSS, respectively, 23 bp spacers The fifth and sixth positions of the nonamers of 12 RSS are have almost the same pattern, however the extent of conservation also almost perfectly conserved (Table 5c). The sixth position is required for efficient RSS function, however the fifth position is much lower. The most frequently observed nucleotides from the first base 3' of the heptamer in 23 RSS are A, T, G, C and is not [7]. In 23 RSS, only this functionally important sixth A (A5), found in 45%, 44%, 40%, 36%, and 64% of 23 RSS, position is highly conserved (Table 6c). The nonamer appears respectively. At the eighth and ninth positions the most frequently to have much more variability in the degree to which individual observed nucleotide is again C, found in 44% and 38% of 23 positions are conserved as in both 12 RSS and 23 RSS the first position, the fourth position, and the ninth positions of the RSS respectively. nonamer are relatively poorly conserved. This is particularly true The spacers of 12 RSS and 23 RSS therefore maintain of the fourth position of 23 bp spacer nonamers, where the most significant sequence conservation. Surprisingly, the 12 bp spacer frequently observed nucleotide (A) is found in only 56% of the and the first half of the 23 bp spacer possess six positions where aligned 23 RSS. The functional consequences of consensus the most conserved nucleotide is the same. In 12 bp spacers the substitution at these relatively poorly conserved positions has not most conserved nucleotides 3' of the heptamer are, from 5' to been evaluated. 3' , ATACA--CC; the most conserved nucleotides at the analogous positions in 23 bp spacers are ATGCA--CC. Conservation of sequence in RSS spacers The latter half of 23 bp spacer possess a high frequency of Analysis of aligned RSS revealed significant conservation of TG and AG dinucleotides, often tandemly repeated, as well as sequence in both 12 and 23 bp spacers (Tables 5b and 6b). Of occasional runs of Cs or Gs (4—5 bp long). This results in a particular significance is an A located at the fifth position 3 ' of number of positions (the 14th, 16th, and 19th through to the 22nd positions) where the consensus results are ambiguous for two the heptamer in both spacers (this position is hereafter referred nucleotides. to as A5). An A is observed at this position in 67% of all 12 bp spacers and in 64% of all 23 spacers. Both spacers often have a G at this position whenever there is not an A. The plurality rule therefore returns a consensus result for this position that is DISCUSSION ambiguous for either purine, A or G. 12 bp spacers and 23 bp spacers have a G at this position in 19% and 25% of spacers, In this report, we have used the considerable increase in size respectively. of the available database of RSS to redefine the RSS consensus, particularly with respect to spacer sequences. We found that: 1) The most frequently occurring nucleotide is the same for 12 The consensus heptamer and nonamer was the same for both the bp spacers and the heptamer proximal half of 23 bp spacers at types of RSS (the 12 bp spacer RSS and the 23 bp spacer RSS); several other positions as well. In 12 bp spacers the most 2) There is a significant sequence conservation in both the 12 frequently observed nucleotides are, from the first base 3 ' of the Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1994, Vol. 22, No. 10 1791 Tabl e 4 Alignment of 2 3 bp spacer Recombination Signal Sequences Species _ocus Seqmen t Heptamer Spacer Nonamer Reference MUS GH /AR10 0 CACAGTG TTCT AA. CCACATCCTGAGTGTGT .CAGAAACC f731 /H1 6 CACAGTG GTGCAA. CCACATCCCGACTGTGT .CACAAACC /H12 4 CACAGTG TTGTAA.CCACATTCTGAGAGTGT .TAGAAACC /PJ1 4 CACAGTG AGGGAAGTCCAATGTGAGCCT. GC ACAAATACC r76i / 108 A CACAGTG rTACAA. ACACATCCTGAGTGTGT .CAGAAACC R71 • 108 B CACAGCG TTGTAA. CCACAGGCTGAGTGTGT .CAGAAACC 1771 /H44 1 CACAGTG AGGAAATCTCAGTTTGTACCCA. G ACATGAACC nrsi • H4A- 3 CACAGTG ITGCAA. CCACATCCTGAGTGTGT .CAGAAACC r79i • H3 0 CACAGTG GTGCAA. CCACATCCCGACTGTGT .CACAAACC R41 /Hid1 1 CACAGTG TTTTAA. CCACATCCTGAGTGTGT ACAGAAACC 1801 /H10 1 CACAGTG AGGGAAGTCCATTGTGAACTT. GA ACAAAAATT (811 / A1/A 4 CACAGTG TTGTAA. CCACATCCTGAGTGTGT .CAGAAACC [821 • H104 A CACAGTG TTGTAA. CCACATCCTGAGTGTGT .CAGAAACC 83 • H1 0 CACAGTG TTGCAA. CCACATCCTGAGCGTCT .CAGAAACC 79 CACAGTG AGAGGACGTCATTGTGAGCCCA.G ACACAAACC »/1 rsi • 1 3 CACAGTG AGGGTACTTCAGTGTGAGCCTA. G ACACAAACC T841 • 1 1 CACAGTG AGGGTACTTCAGTGTGAGCCTA. G ACACAAACC rs4i • H2B- 3 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAACC r79i • 186- 1 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAAAC f85) • 186- 2 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAAAC 1851 • 14 5 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAACC 85 S/ 2 3 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAAAC 85 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAGAAAAC 85 • 3 CACAGCG rTGTAA. CCACATCCTGAGAGTGT .CAGAAACC • H102 CACAGTG TTGTAA. CCACATCCTGAGAGTGT .CAGAAACC 85 • 81X CACAATG AGCAAAAGTTACTGTGAGCTCA. A ACTAAAACC [86 • 283 CACAGTG AGTGAATGTTACTGTGAGCTCA. A ACTAAAACC 187 • 5A CACAGTG AGGGGAGGTCAGTGTGAGCCCA.G ACACAAACC R4 • RV10 CACAGTG AGGGGCCCTCAGGC.GAGTCCT.G ACACAAACC 74 • 105 CACAGTG TTGTAA. CCACATCCTGAGTGTGT .CAGAAACC • H26-6 CACAGTG TTGCAA. CCACATCCTGAGTGTGT .CAGAAATC • DFL1 CACAGTG TTGCAA. CCACATCCTGAGAGTGT .CAAAAATA 1881 GH 14 CACAATA GTGGGTTTTTCCTCTGTACCC..G ACAAAAACC f761 13 CACATTG TGACAACAATGATTAGACCCCTGA CAATAAATG r761 12 CACACTA TCATAGACCCCTTTAGTGGGTG. T ACAAAAACC r761 CACAGT. CTCTGTTCTGCCTCTGTTCCTA ^ 11 ACTAAAACT 1761 CACAGTG AGGACTATGACA.TGCCCCTCTCT ACAAAAACC Gx IS (21 14 CACAGTG ATTCATATCACTGCGCCCCCCTTT ACAAAAACC [21 12 CACACTG GTGTCCCTTCAC.TCAACCCCCAT ACAAAAACT [21 M CACAGTG GTAGTACTCCAC.TGTCTGGCTGT ACAAAAACC [21 • 1 CACAATG ACATGTGTAGATGGGGAAGTAG.A ACAAGAACA GX 89 • 2 CACAATG ACATGTGTAGATGGGGAAGTAG.A ACAAGAACA 90 • x CACAGTA ACGGAGATAAAGGAGGAAGCAG. G ACAGAAACT 91 rCRa • 5 H CACAGTG . . TCCCAGACAC. CTGCAGCCTGTATGTAAACC 32] • 1-8.2 CACAGTG . . TCCCCAGGAC. CTGCAGCCTGCACCTAAACC 92) • 1-8.1 CACAGTG CTCTCCAGGCAC.CTGCAGGCTGC ACCCAAACC (921 • 2 C CACAGTG TGTGGGGCTGC AGGGGGAGCTG. A ACACAAACA [35] • F3. 2 CACAGTG AGGGAGACTGCAGGGGAAGCTG.C ACATGAACC [931 • F3. 3 CACAGTG AGGGAGACTGCAGGGGAAGCTG. C ACATGAACC [931 /F3. 4 CACAGTG AGGGAGACTGCAGGGGAAGCTG.C ACATGAACC [931 TCRa • F3. 5 CACAGTG AGGGAGACTGCAGGGGAAGCTG. C ACATGAACC [93 VF3. 6 CACAGTG AGGGAGACTGCAGGGGAAGCTG. C ACATGAACC • 8. 3 CACAGTG ATGTGTGG. CTTCCTTCCCTTTGC ACAGAAAGT rcRp • 8. 2 CACAGTG ATGTGGGG. TTTCCTCCCCTCTGC ACAGAAAGG 94 ACAGAAAGG [941 • 8. 1 CACAGTG ATGTGTGG. CTTCCTTCACTCTGC GCGAGAACT [951 • 1 8 CACAGTG CTGG. .TTCAAGGGAGAAATCTCA • 1 9 CACAGTG GTGACTACT. . GGCTTTTCTCAGA ACACAAACT [951 • 10- 8 CACAGTG GTGCAGAGTCA. CTGTTTCCCTGT GCACAAACC [921 • 5.1 CACAGCC TTACAGAGCTACTGGCTTTCTGTA ACTTAATC. [941 • 5.2 CACAGCC TTACAAAGCTACTGGCTTTCTGTA ACTTAATC. (941 CACAATG ATTCAACT. GGAAGAGGTGCTTTT ACAAAAAGC 38 D2 CACGGTG ATTCAATT. CTATGGGAAGCCTTT ACAAAAACC 38 TCRY • 108A CACAACA TTAGAGCCTCTAGACT. AGCCTGC ATAAGAACC • 108B CACAACA TTAGAGCCTCTAGACT. AGCCTGC ATAAGAACC [391 • 4 CACTCTA TCAAGAT. ACTGCACTGTTAACAA ACAAAACCC [961 TCR 4 CACAGGT TGAAGT AT. ATTAAACCTCTGTTC AGAAACACT [401 CACAGTG TTGCAAAC. CCCATAGGGACCTGT ACAAAAACT 40 IGH • 251 CACAGTG AGAGAAACCAGCCCCGAGCCC. GT CTAAAACCC HUM /12G-1 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACACAAACC 98 • 2-1 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACACAAACC 98 • 79 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACACAAACC 98 /7-2 CACAGTG TGAAAACCCACATCCTGAGACCGT .CAGAAACC 99 CACAGTG TGAAAACCCACATCCTGAGGGTGT .CAGAAACC 100 /35 /71-4 101 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACAAAAACC /58 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACAAAAACC [98| 71-2 CACAGTG AGGGGAGGTGAGTGTGAGCCCAGG ACACAAACC 101 CACAGTG AG. GGAAGTCATTGTGAGCCCA. G ACACAAACC H26 02 CACAGTG AG. GGAAGTC AGTGTGAGCCCA. G ACACAAACC H52 02 AG. GGAAGTCAATGTGAGCCCA. G H11 CACAGTG ACACAAACC 03 H105 CACAGTG AGGGGAGGTCAGTGTGCGCCCA. G ACACAAACC P«l Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1792 Nucleic Acids Research, 1994, Vol. 22, No. 10 Tabl e 4. (com Species -OCUS Heptamef Reference Segment Spacer Nonamer • 6-1G1 CACAGTG AGGGGAAGTCAGTGTGAGCCCA. G ACACAAACC (99 • 1.911 CACAGTG AGGGGAGGTGAGTGTGAGCCCA. G ACACAAACC CACAGTG • 1.9111 AGGGGAAGTCATTGTGCGCCCA. G ACACAAACC 99 • 9-1 CACAGTG AGGGGAGGTCAGTGTGAGCCCG. G ACACAAACC 99] • 12-2 CACAGCG AGGGGAGGTCAGTGTGAGCCCG. G ACACAAACC 99 • 13-2 CACAGTG AGGGGAAGTCAGTATGAGCCCA. G ACACAAACC «/ 8-18 CACAGTG AGGGGAGGCCATTGTGCGCCCA. G ACACAAACC 99 • 15-2B CAGAGTG AGGGGAAGTCAGTGAGAGCCCAGG .CACAAACC 99 • 22-2B CACAGTG AGGGGAAGTCAGTGTGAGCCCA. G ACACAAACC J99 • HG 3 CACAGTG TGAGAAACCACATCCTCAGA. TGT .CAGAAACC [1041 • 21- 2 CACAGTG TGAGAAACCACATCCTCAGAGTGT .CAGAAACC 99] • 3- 1 CACAGTG TGAGAAACCACATCCTCAGAGTGT .CAGAAACC 99 J6 CACAATG GCAGAATGTCCATCCTCACCC..C ACAAAAACC 41 GH IS CACATTG TGAC AACAATG. CCAGACCCCGAC 41 AAAGAACCG CACATTG 14 TGGGAGGCCCCATTAAGGGGTG. C ACAAAAACC 41 CACAGGG 13 ACACAGTCCGTTCCTAGACCCA. G ACACAAACC 41] 12 CACAGTC CTCTGCCCTCCTGCTTCTCCCA.T ACAAAAACA 41j GK JS CACAGTG TTAACT.TAATTACTTTCCCCTTA ACAAAAATC 105 CACAGTG 14 AGGGATCTCACC. CTTTCCCCTCA ACAAAAACC 105 CACAGTG J3 ATTCGTCTTAA. . CTTTTCCCTTT ACAAAAACC 105 CACAATG J2 GTTCCTCTTAAC. TTCCCTCCTAT ACAAAAACT 105 GK CACAGTG AGAGCTCTCCAT. TGTCTTGCTGA ACAGAAACC 105 HUM 11 CACAGTG ACACAGACAGATGGGGAAGTGA. G ACAGAAACC GX • 3S 1 106 /7.1 CACAGTG &CAGACTCATAAGAGGAACCAA. G ACATAAACC J07] CACAGTG CTCCAGCCCAATGGGGAACTGA. G ACAAGAACC 108 / 117 CACAGTG CTCCAGCCCAATGGGGAACTGA.G • 119 ACAAGAACC JJ08 CACAGTG CTCAGGCCGGGGTGGGAACTGA. G ACAAGAACC J109 /3S2 CACAGTG GTCCAAGTTCATGGGGAACTGA. G 110] */ 2.1 ACCAAAACC • 418 CACAGTG ACACAGACAGATGGGGAAGTGA. G ACAGAAACC 111] ACACAGGCAGATGAGGAAGTGA. G [111] • 318 CACGGTG ACAAAAACA • 1.1 CACAGTG CTCCAGGCCAATGGGGAACTGA.G ACAAGAACC [107] •j)Y14.2 CACAGTG CCTGAGACTGCAGGAG.AGCTG.A ACACAAACC [52] fCRa CACAGTG CTCCCCAGGCAC. CTGAAGCCTGT ACCCAAACC • 13.1 [59] CACAGTG CTTCACAGTCGTGC. CCTTGCTGT TCR8 • 16 GCAAAACCA (1121 • 8.1 CACAGCG CTGCAGAATCA.CCCCTTTCCTGT GCAGAAAAC 113] • 8.2 CACAGCG CTGCAGAATCA. CCCCTTTCCTGT GCAGAAACC 113 • 8.3 CACAGCG CTGCAGAATCA. CCTGCTCCCTGT GCAGAAACC 113 • M3-2 CACAGCG CTGCAGAATCA.CCCCTTTCCTGT GCAGAAACC [54] • MT1-1 CACAGCG CCAGGAGGGGA. TCAGACACCGCG GCAAGAACC 1141 •ATL12-2 CACAGCA TGGCACAGTTG. CCTCCTTCCTGT TCACAAACC 114 • ATT. 2-1 CACAGTG CTTCTTGG. CCACCTGCTCTCTAC ACAGAAAGA [114 CACGATG ATTC AGGT . AGAGGAGGTGCTTTT ACAAAAACC 3 2.1 [55 rcRp CACAATG 3 1.1 ATTCAACT. CTACGGGAAACCTTT ACAAAAACC (55 CACAGTG rCR • 2 ATTCAGATCCGCCCTACACCACAC TGAAAATC. [115 • 3 CACAGTG ATTCAGACCTGTCCTACACCACAC TGAAAATC. [115 • 8 CACAGTG MTCAGACCTGTGCTACACCACAC TGAAAATC. [115 • 9 CACAGCA GCAGACAGTTTGAGCCATCCCATT TCAATAAAA 116 CACATAC TAGAA. CTGTTGAAACAACATGC. • 1 0 ACAAAATCC 116 'CRfi • DS 6 CACAGTG ACAGAACTGTCGGAGGGAGGTG. T ACAAAAGCC 117 • 1 CACAGTG ttTTGAAGTGATAGTAAAAGCAA. A ACAAAAACC 59 TCR6 31 CACACAG GTTGGAGT. GCATTAAGCCTTTGT CCAAAAACA 58 32 CACAGTG CTACAAAA. CCTACAGAGACCTGT ACAAAAACT 58 • LL3. 1 CACAGTG GGACATAT. ATTGTGAAAACATGT XEL GH ATAAAAACA 118 CACAGTG • LL3. 4 GGAAATAT. ATTATGAAAACATGT ATAAAAACA 118 CACAGTG • LL3. 5 GGAC AAAT . ATTAAGAAAGCCTGT GTAAAAACA 118 • LG2. 1 CACAGTG ACAGAAGAGAATGAGGAAGTCA. G ACAATAACT 118 • LG2. 2 CACAGTG ACAGAAGAGAATGAGGAACTCA. G ACAATATCT 118 • LGZ 4 CACAGTG ACTAAATATACTGAGGAAGTGA. G ACAATAACA 118 CACAGTG ACAGAAAAAAATAAGGAGGTCA. G 118] VLG2. 7 ACAATATCA VLG2. 8 CACAGTG ACAGAACAAAATAAGGAAGTCA. G ACAATATCA 118 VLL1.1 CACAGTG ACAAATAGTCTCAGAGCAGTGC. A ACAAAAACA 118 V LL1.2 CACAGTG ACAAATAGTCTCAGAGCAGTGC. A GCAAAAACA V LL1.3 CACAGTG ACAAATAGTCTCAGAGCAGTGC. A ACAAAAACA V U.1.4 ACAAAGAATCCCAGAGTCATGT. A CACAGTG GAAAATACA 118] ^/LL1.6 CACAGTG ACAAAGAAACACAGAGCAGTGC. A ACAAAAACA 118 VU.1.7 CACACTG ACAAATAGTCTCAGAGCAGTGC. A ACAAAAACA 118 • LL1.8 CACAGTG ACAAATAGTCTCAGAGCAGTGC. A GCAAAAACA 118 • U.1.9 CACAGTG ACAAATAGTCTCAGAGCAGTGC. A 118) ACAAAAACA • 6.2 CACACTG GTTCAAGTTCATGGGGAAGTGA. C GCCAAAACC SHP GX t71 • 12.2 CACAGTG CTCCAGGCCAGGGGGGAAGCGA. C ACAAAAACC 71 CTCCAGGCCAGGGGGGAAGTGA. C • 4.2 CACGGTG GCGAAACCC 71 • 5.2 CACGGTG- CTCCAGGCCAGGGGGGAAGTGA. C ACCAAAGCC 71 • 17 CACGGTG CTCCAGGCCAGGGGGGAAGTGA. C ACCAAAGCC • 10 CACGGTG CTCCAGGCCAGGTGGGAAGTGA. C ACCAAAGCC [71 • 9 CACGGTG CTCCAGGCCAGGTGGGAAGTGA. C ACCAAAGCC f71 • 18 CACAGTG CTCCAGGTCAAGGGGGAAGTGA. C ACAAAAACC [71 • 26.3 CACAGTG CTCCAGGCCAAGGGGGAAGTGA. C ACAAAAACC • 3 CACAGTG CTCCAGGCCAGGGGGGAAGTGA. C ACAAAAACC [71] • 4.1 CACAGTG CTCCAGGCCAGCGGGGAAGTGA. C ACAAAAACC [711 • 16.1 CACAGTG CTCCAGGCCAGGGGGGAAGTGA. C ACAAAAACC f711 Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1994, Vol. 22, No. 10 1793 Table 4.(com. -OCUS segment Heptamer Spacer Nonamer Reference Species ^26.1 CACAGTG CTCCAGGCCAGGGGGGAAGCGA. C ACAAAAACC SHP GX 71] ^ S.I CACAGTG CTCCAGGCCAGGGGGGAAGTGA.C ACAAAAACC 7>l CACTGCC ACCCAAGCAAATCCTGGGCTCC. T ACAGAAACA 6Sj >/ 1113 HEF GH ACAAGAACA V2807 CACAATG AGAGGAACCAGGGCTGGACCC. GT 65 >/ 1403 CACAGCG AGAGGAACCAGGGCTGGACCC. GT ACAAGAACA 65 / 1315 CACAACG AGAGGAACCAGGGCTGGACAT. GT ACAATAACA 65 321113 CACGGTA CTGTACAGAGCGAGTTT. CTTA. TACAAAAACC 65 CACGGTG CTGTACAGAACGAGTTC. CTCA. TACAAAAACC 65 3 1 2807 CTGTACAGAGCGAGTTC.CTCA.T ACAAAAACC 3 1 1403 CACGGTG 65 CTGTACAGAGCGAGATC. TTCA. T 3 1 1315 CACGGTG ACAAAAACC 65 I 1315 CACAGTG TTACATTCCCTGGGCTGGGTCA. C ACAATAACC res 1 1403 CACAGTG TTACATTCCCCGGGCTGGTTCA.G ACAATAACC [6S 12807 CACAGTG TTACATTCCCTGGGCTGGGTCA.G ACAATAACT [65 1 1113 CACAGTG TTACATTCCCTGGGCTGGGTCA. C ACAATAACC 65 */ 122 CACAGTG CAGTGTTTTAAATGGGACGGGTCA CTTAAAACC 66 GL >/141 CACAGTG CAGTGTTTTAAATGGGACGGGTCA CTTAAAACT 66 */H1(a3) CACAGTG AGGGGCCCTCAGGCTGAGCCCA. G ACACAAACC 119] RAB GH W3(a3) CACAGTG RGGGTCCCTCAGGCTGAGCCCA. G ACACAAACC 119) */H4(a3) CACAGTG AGGGGCCCTAGGGCTGAACCCA.G ACACAAACC 119 W6(a3) CACAGTG AGGTG.CCTCAGGCTGAGCCCA.G ACACAAACC 119 Y832 CACAGTG AGGGGCCCTAGGGCGCA.. CCTAG ACACAAACA 120 12 CACAGGG GCACA. TCCCCTGTTGCTGCCCAG ACACAAACC 121 13 CACTGTG ACGACCGTGCCAGGACCCCCGGCA AGAACCGGT 121 14 CACATTG CTGTAGACACCTT. .AGGGGGCGT GCAAAAACC [121 CACATTG TGATGACCGTGCCAGGACCCCA.G GCAAGAACC [1211 IS CACAGTG GTTCCTCCTAAC. CTCCCTCCTGT ACAAAAACT Gx J2 [1221 CACGGTG ACACCGATCCCCAGCACGGTGG.C ACAAAACCC 60 CHK GH CACAATG CCCCAAAATCCGCCTTTTTTCA. C CCAAAAACT 60 ACACAAAGCAATGGGGAAATGA. T CACGGTG ACAAAAACC 61 GX V CACAGT. CTCTGTTCTGCCACTGTTCCT. GT ACTAAAACT 68 RAT GH J Gtc CACAGTG GTAGTTCTCCAT. TGTCTGGCTGT ACAAAAACC 123| J1 CACACTG GTATCCCTTGACTCACCACCGA. T 123 J2 ACAAAAACT J2a CACACTG GTTTCCCTTGACTCACCCCCCA.T ACAAAAACT [123 J3 CACAGTG ATTCATGTCAAAGC. CCCCC. TTTACAAAAACC [123 J4 CACAGTG AAGACTC. TGACATATGCACCTCT ACAAAAACC (123 CACAATG GCATGT. C A. GATGAGGAAGT AGGACAAAAACC 69 GX CACAGTG ACACAGAGC. AATGGGGAAGTGAT ACAAAAACC 72 DUK GX YL5 ^ LI CACAGTG ACACAAAGC. AATGGGGAAGTGAT ACAAAAACC [72 Abbreviations: IG; immunoglobulin. TcR; T cell receptor. H; heavy chain, x; light chain of the kappa isotype. X; light chain of the lambda isotype. lsotype classification for Xel and Hef chains is not clear, however they are grouped with whatever light chain isotype has the same sized RSS spacer for the purposes of these tables, a; T cell receptor alpha chain. 0; T cell receptor beta chain. 7; T cell receptor gamma chain. 6; T cell receptor delta chain. V; variable gene segment. D; diversity gene segment. J; joining gene segment. Species are Mus; Mouse {Mus musculus). Hum; Human (Homo sapiens). Xel; Frog (Xenopus laevis). Shp; Sheep (Ovis aries). Hef; Horned shark (Heterodontus franciscus). Rab; Rabbit (Oryctolagus cuniculus). Chk; Chicken (Gallus gallus). Bov; Cow (Bos taurus). Rat; Rat, (Rattus norvegicus). Duk; Muscovy duck. Periods in sequences designate a gap inserted for best alignment. in [11]). The inclusion of spacer sequences in our analysis of and the 23 bp spacers; and, 3) The conserved sequence in the 12 bp spacer is similar to the conserved sequence in the heptamer RSS has yielded conservation that has not previously been proximal half of the 23 bp spacer. observed. Upon separating the RSS on the basis of whether they were To best assess the relevance of sequence conservation, we made derived from 12 or 23 RSS, we determined that the heptamers our consensus determination using the plurality rule. The plurality and nonamers appear equivalent, irrespective of which type of rule returns a result for all positions analyzed in an aligned set RSS they are derived from. They possess the same consensus of sequences. The result, however, may have ambiguity varying profile, in that equivalent positions are conserved to an equivalent from one (highly conserved) to all four (indistinguishable from degree, regardless of classification by size of spacer. For random) possible nucleotides [9] There is less than a 1 % chance example, the first, fourth, and ninth positions of the nonamer of randomly getting a plurality rule result with ambiguity for less are relatively poorly conserved in both 12 and 23 RSS. This than all four nucleotides at any one position, in the databases observation provides further support for the hypothesis that the observed here [10]. It is with some surprise, therefore, that most heptamer and nonamer function in an identical manner (e.g., positions in 12 and 23 bp spacers demonstrate consensus results serving as recognition sites for the same protein) for both 12 RSS with ambiguity for less than all four nucleotides. and 23 RSS. Some of the sequence conservation observed in this manner may be due to the inclusion of many members of a gene segment Previous examinations of the RSS consensus have concentrated family that has been expanded only recently in evolution. The on the heptamer and nonamer, relying on early studies that suggested that the intervening sequence is truly a spacer, fact that the conserved sequence motif (heptamer proximal) in conserved in length (12 of 23 bp), but not sequence (reviewed 12 bp spacers is similar to the conserved sequence motif in the Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1794 Nucleic Acids Research, 1994, Vol. 22, No. 10 Table 5. Consensus sequences for 12 RSS Table 6. Consensus sequences for 23 RSS 1 2 3 4 5 6 7 1 2 3 4 5 6 7 Position2 Position2 C A A G T G Consensus' C A C A G 1 G Consensus' c %G 85 0 0 1 7 2 91 %G 0 0 0 9 88 0 77 %A 0 100 0 91 8 1 5 %A 0 100 0 81 S 2 13 %7 0 0 0 9 2 86 2 %T 0 0 0 2 3 89 1 %C 00 0 100 1 4 12 8 %C 100 0 99 0 4 9 3 Positions 1 2 3 4 5 6 7 8 9 10 11 12 Position 1 2 3 4 5 6 7 8 9 10 11 A/T/C/G T/C A/r A/G G/A/T/C C/A/Q C/G 0C/A/G r/G/C/A A/T/C/G Consensus A/T/C/G I/ W G/A/C C/G/T V/G VGTOC A/G/C/T C/G/T/A C/T/A VC/G/T/. A/C/T7G Consensus' c/r en %G 16 13 10 13 19 38 26 25 2 16 26 13 %G 11 29 40 31 !S 25 27 26 7 16 15 %A 50 5 58 10 67 25 33 6 8 20 19 43 %A 31 >4 39 9 11 36 42 45 2 11 45 %T 18 56 20 14 7 21 7 10 22 36 35 27 %T 23 44 13 15 3 19 11 21 38 7 13 %C 16 26 13 62 7 15 34 59 68 28 20 16 34 32 %C 20 18 14 36 8 11 21 44 38 %qap 0 0 0 0 0 2 0 0 0 0 0 0 %gap 1 8 2 8 0 1 2 1 5 7 1 Table 6b cont. Position 12 13 14 15 16 17 18 19 20 21 22 23 24 Consensus 3/A/T/C T/G/A/C TC/C/A A/G/T/C U/C C/T » « A/I r/G/C/A 1 2 3 4 5 6 7 8 9 'X a/T A/G/C/T ./ U Position4 %G 29 32 15 24 21 12 34 27 29 57 44 8 33 A C A A A A A C C Consensus1 %A 29 13 7 43 53 7 9 6 38 b 14 9 15 %G 12 2 3 8 1 0 0 7 5 %T 21 38 10 32 25 9 13 8 35 14 37 6 39 %A 68 2 86 76 95 95 87 6 9 %C 16 10 )7 22 11 23 11 42 48 47 8 5 20 %T 12 5 2 8 2 5 11 10 14 %aap 5 7 1 2 0 2 3 1 C 0 5 50 1 %C 8 91 9 8 2 0 2 77 71 %nap 0 0 0 0 0 0 0 0 2 a. Consensus1 and nucleotide frequencies in 12 RSS heptamers b. Consensus and nucleotide frequencies in 12 RSS spacers Position 1 2 3 4 5 6 7 8 9 c. Consensus and nucleotide frequencies in 12 RSS nonamers Consensus A C A A/G/C A A A C C 'Consensus as determined by the plurality rule (see text and reference [9]). We %G 2 8 3 19 3 0 3 3 3 further define consensus results ambiguous for more than one nucleotide by %A / 3 2 90 56 89 98 89 3 15 reporting the nucleotides in order of the frequency that they are observed, from %T 3 5 4 6 5 1 5 3 11 %C 3 91 5 19 3 1 3 91 71 the most frequent to the least frequent. %gap 14 0 0 0 0 0 0 0 3 2bases numbered beginning at the first base of the heptamer 3bases numbered beginning at the first base 3 ' of the last base of the heptamer a. Consensus1 and nucleotide frequencies in 23 RSS heptamers 4bases numbered beginning at the first base 3' of the last base of the spacer b. Consensus1 and nucleotide frequencies in 23 RSS spacers A period in place of a nucleotide code represents a gap c. Consensus1 and nucleotide frequencies in 23 RSS nonamers 'Consensus as determined by the plurality rule (see text and reference [9]). We further define consensus results ambiguous for more than one nucleotide by reporting the nucleotides in order of the frequency that they are observed, from first half of 23 bp spacers argues that the origin of this motif the most frequent to the least frequent. is distinct from a recent expansion of gene segment families, 2bases numbered beginning at the first base of the heptamer however. 3bases numbered beginning at the first base 3' of the last base of the heptamer 4bases numbered beginning at the first base 3' of the last base of the spacer The conserved sequence common to both RSS spacers could A period in place of a nucleotide code represents a gap be derived from two possible sources. Firstly, both 12 and 23 RSS may have a common ancestral origin. For example, early RSS may have all possessed 12 bp spacers. A requirement for the directed joining of one type of segment (e.g. a V segment) however, that the Lieber report does demonstrate a significant to a second type of segment (e.g. a J segment) might have resulted loss of recombination frequency (p<0.05, using a two tailed in an adaptation of this early version of the V(D)J rearrangement Mann-Whitney test) when comparing a substrate where both machinery to include a 12/23 rule, and an accompanying change the 12 and 23 bp spacers were substituted with GC base pairs of the spacer length of one type to 23 bp. to a substrate with unsubstituted RSS spacers [6]. Thus the available data are consistent with the conclusion that differences A second, more likely possibility is that this sequence is in RSS spacer sequence contribute to minor differences in the conserved because it contributes to RSS function. In support of efficiency with which the RSS mediates recombination. this hypothesis, we found, using extra chromosomal recombination substrates, that a single substitution of the most We suggest two possible methods by which the conserved conserved position (replacement of the conserved A at the 5th sequence in RSS spacers could contribute to RSS function. One position of a 12 bp spacer with a C) resulted in a significant, possibility is that this sequence may represent a functional though modest (approx. 15%) drop in the frequency with which extension of the heptamer. Thus while the element of recombinase the substituted RSS mediated recombination (unpublished results). that recognizes RSS likely makes critical contacts with the highly This observation appears to contradict a previous report from conserved heptamer, contact with the RSS may extend into the Lieber and colleagues, where the authors concluded that complete spacer. This possibility is supported by the fact that conservation replacement of a spacer with GC base pairs did not appear to in both the 12 and 23 bp spacers peak at the fourth and fifth influence the frequency with which the substituted RSS mediated positions 3 ' of the heptamer, which is located approximately one recombination [6]. In the study by Lieber and colleagues, the turn of a B DNA helix from the critical first three nucleotides substituted and unsubstituted RSS were tested in separate of the heptamer. Moreover, in 12 bp spacers this position is also substrates, rather than in a competitive substrate as was used in one turn of a B DNA helix from the beginning of the nonamer. our experiment, and thus subtle differences in recombination Thus the sequence recognition component of recombinase could frequency may have been less readily observable. We note, lie along one face of the 12 RSS DNA helix, making sequence Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1994, Vol. 22, No. 10 1795 specific contacts at the heptamer, the fourth and fifth positions 12. Barber, A. M. and V. B. Zhurkin. (1990) J. Biomol. Struct. Dyn., 8, 213-232 . of the spacer, as well as the nonamer. 13. Patel, D. J., L. Shapiro and D. Hare. (1987). In R. D. WeUs and S. C. Alternatively, the observed conserved sequence may induce Harvey (ed.), Unusual DNA structures. Springer publishing, New York, functionally important structural changes in RSS DNA. In 12 USA. bp spacers the most conserved positions are C and A, four and 14. Timsit, Y., E. Vilbois and D. Moras. (1991) Nature, 354, 167-170. five bp 3 ' of the heptamer, respectively. Polymeric CA sequences 15. Bolshoy, A., P. McNamara, R. E. Harrington and E. N. Trifonov. (1991) Proc. Nail. Acad. Sci., 88, 2312-2316. have been linked with sequences active in recombination and 16. Ramsden, D. A. and G. E. Wu. (1991) Proc. Natl. Acad. Sci. USA., 88, transcription [12]. This has been attributed to the fact that CA 10721-10725. tracts cause unusual perturbations in DNA structure, including 17. Sakano, H., Y. Kurosawa, M. Weigert and S. Tonegawa. (1981) Nature, the de-stacking of bases and the formation of non-Watson—Crick 290, 562-565. base pairs [13, 14], as well as a reduced electrophoretic mobility 18. Kurosawa, Y., H. Von Boehmer, W. Haas, H. Sakano, A. Traunecker and S. Tonegawa. (1981) Nature, 290, 565-570. associated with helical kinking [15]. It is unknown if the structural 19. Kurosawa, Y. and S. Tonegawa. (1982) J. Exp. Med., 155, 201-218. alterations described above would necessarily be associated with 20. Corbet, S., M. Milili, M. Fougereau and C. Schiff. (1989) J. Immunol, a single CA dinucleotide, in the context of the 12 bp spacer. It 138, 932-939. is worth noting, however, that 23 bp spacers are generally rich 21. Jouvin-Marche, E. and S. Rudikoff. (1986) Invnunogenetics, 24, 191 -201 . in CA, as well as the complementary dinucleotide, TG (data not 22. Boyd, R. T., M. M. Goldrick and P. D. Gottlieb. (1986) Proc. Natl. Acad. Sci. U.S.A., 83, 9134-9138. shown). 23. Seising, E. and U. Storb. (1981) Cell, 25, 47-58 . We have demonstrated here that, contrary to previous analysis, 24. Max, E. E., J. G. Seidman, H. MiUer and P. Leder. (1980) Cell, 21 , the RSS spacer does possess significant conservation of sequence. 793-799 . The degree of conservation, as well as experiments using 25. Seidman, J. G., E. E. Max and P. Leder. (1979) Nature, 280, 370-375 . 26. Seidman, J. G., A. Leder, M. H. Edgell, F. Polsky, S. M. Tilghman, D. recombination substrates, suggests that, though significant, C. Tiemeier and P. Leder. (1978) Proc. Nail. Acad. Sci. U.S.A., 75, conserved sequences in RSS spacers are not as critical to RSS 3881-3885. function as the heptamer and nonamer motifs. As has been 27. Heinrich, G., A. Traunecker and S. Tonegawa. (1984) J. Exp. Med., 159, demonstrated with kappa and lambda RSS, however, multiple, 417-435 . 'non-critical' substitutions can still result in a dramatic reduction 28. Joho,R.,H.GershenfeldandI.L.Ceissman.(1984)£AfBOy.,3, 185-191. 29. Ng, K. H., A. Lavigueur, L. Ricard, M. Bouvrette, S. MacLean, D. Cloutier in recombination frequency [16] Thus differences in the and D. M. Gibson. (1989) J. Immunol., 143, 638-648. sequence of RSS spacers may also make a significant contribution 30. Milstein, C , J. Even, J. M. Jarvis, A. gonzalez-Femandez and E. Gherardi. to the frequencies with which endogenous gene segments (1992) Eur. J. Immunol., 22, 1627-1634. rearrange. The possibility that portions of the RSS spacer could 31. Miller, J., E. Seising and U. Storb. (1982) Nature, 295, 428-430. 32. Winoto, A., S. Mjolsness and L. Hood. (1985) Nature, 316, 832-836. aid in RSS function, through direct sequence specific contacts 33. WUson, R. K., B. F. Koop, C. Chen, N. Halloran, R. Sciammis and L. or through DNA structural effects, warrants continued Hood. (1992) Genomics, 13, 1198-1208. investigation with extra chromosomal constructs. 34. Arden, B., J. L. Klotz, G. Siu and L. E. Hood. (1985) Nature, 316, 783-787 . 35. Hayday, A. C , D. J. Diamond, G. Tanigawa, J. S. HeUig, V. Folsom, H. Saito and S. Tonegawa. (1985) Nature, 316, 828-832. ACKNOWLEDGEMENTS 36. Gascoigne, N. R. J., Y. Chien, D. M. Becker, K. J. and M. M. Davis. (1984) Nature, 310, 387-390. We would like to thank Helen Garrioch for assistance in 37. Chien, Y., N. R. J. Gascoigne, J. Kavaler, N. E. Lee and M. M. Davis. completing the recombination assay. We would also like to thank (1984) Nature, 309, 322-326. Dr Marc Shulman and Matthew Binney for critical reading of 38. Siu, G., M. Kronenburg, E. Strauss, R. Haars and T. W. Mak. (1984) Nature, 311, 344-350. the manuscript. This work was supported by grants from the 39. Hayday, A. C , H. Saito, S. D. Gillies, D. M. Kranz, G. Tanigawa, H. National Cancer Institute of Canada and the Medical Research N. Eisen and S. Tonegawa. (1985) Cell, 40, 259-269. Council of Canada. G.E.Wu is a Medical Research Council of 40. Elliot, J. F., E. K. Rock, P. A. Patten and M. M. Davis. (1988) Nature, Canada Scholar, and D.A.Ramsden is the recipient of a National 331, 627-631. Cancer Institute of Canada Steve Fonyo Studentship. 41 . Ravetch, J. V., U. Siebenlist, S. Korsmeyer, T. Waldmann and P. Leder. (1981) ail, 27, 583-591. 42. Siebenlist, U., J. V. Ravetch, S. Korsmeyer, T. Waldmann and P. Leder. (1981) Nature, 294, 631-635. REFERENCES 43. Ichihara, Y., H. Matsuoka and Y. Kurosawa. (1988) EMBO J., 7, 1. Sakano, H., K. Huppi, G. Heinrich and S. Tonegawa. (1979) Nature, 280, 4141-4150. 288-294. 44. Chen, P. P., K. Albrandt, N. K. Orida, V. Radoux, E. Y. Chen, R. 2. Max, E. E., J. G. Seidman and P. Leder. (1979) Proc. Nail. Acad. Sci. Schrantz, F.-T. Liu and D. A. Carson. (1986) Proc. Natl. Acad. Sci. U.S.A., USA, 76, 3450-3454. 83, 8318-8322. 3. Akira, S., K. Okazaki and H. Sakano. (1987) Science, 238, 1134-1138. 45. Liu, M.-F., D. L. Robbins, J. J. Crowley, S. Sinha, F. Kozin, T. J. Kipps, 4. Hesse, J. E., M. R. Lieber, M. GeUert and K. Mizuuchi. (1987) Cell, D. A. Carson and P. P. Chen. (1989) J. Immunol., 142, 688-694. 49, 775-783. 46. Pech, M., H.-R. Jaenichen, H.-D. Pohlenz, P. S. Neumaier, H.-G. Klobeck and H. G. Zachau. (1984) J. Mol. Biol., 176, 189-204. 5. Early, P., H. Huang, M. Davis, Calame and L. E. Hood. (1980) Cell, 19, 981-992. 47. Bentley, D. L. and T. H. Rabbitts. (1980) Nature, 288, 730-733. 6. Wei, Z. and M. R. Lieber. (1993) / Biol. Chem., 268, 3180-3183. 48. Bentley, D. L. and T. H. Rabbitts. (1983) Cell, 32, 181-189. 7. Hesse, J. E., M. R. Lieber, K. Mizuuchi and M. GeUert. (1989) Genes 49. Pech, M. and H. G. Zachau. (1984) Nucleic Adds Res., 12, 9229-9236. Dev., 3, 1053-1061. 50. Udey, J. A. and B. Blomberg. (1987) Immunogenetics, 25, 63-70. 8. Devereux, Haeberli and Smithies. (1984) Nucleic Acids Research, 12(1), 51 . Vasicek, T. J. and P. Leder. (1990) J. Exp. Med., 172, 609-620. 387-395 . 52. Yoshikai, Y., S. P. Clark, S. Taylor, U. Sohn, B. I. WUson, M. D. Minden 9. McMorris, F. R. and W. H. E. Day. (1992) Nucleic Acids Res., 20, and T. W. Mak. (1985) Nature, 316, 837-940. 1093-1099. 53. Baer, R., T. Boehm, H. Yssel, H. Spits and T. H. Rabbitts. (1988) EMBO 10. Day, W. H. E. and F. R. McMorris. (1992) Math. Biosci., 111, 231 -247 . J., 7, 1661-1668. 11. GeUert, M. (1992) Anna. Rev. Genet., 22, 425-446. 54. Siu, G., S. P. Clark, Y. Yoxhikai, M. M., Y. Yanagi, E. Strauss, T. W. Downloaded from https://academic.oup.com/nar/article-abstract/22/10/1785/1248239 by DeepDyve user on 05 August 2020 1796 Nucleic Acids Research, 1994, Vol. 22, No. 10 Mak and L. Hood. (1984) Cell, 37, 393-401. 94. Chou, H. S., S. J. Anderson, M. C. Louie, S. A. Godambe and M. R. Pozzi. (1987) Proc. Natl Acad. Sci. U.S.A., 84, 1992-1996. 55. Toyonaga, B., Y. Yoshikai, V. Vadasz, B. Chin and M. T.W. (1985) Proc. Nad. Acad. Sci. USA, 82, 8624-8628. 95. Louie, M. C , C. A. Nelson and D. Y. Loh. (1989) J. Exp. Med., 170, 1987-1998. 56. Tunnacliffe, A. and T. H. Rabbitts. (1985) Nucleic Acids Res., 13, 6651-6671 . 96. Garman, R. D., P. J. Doherty and D. H. Raulet. (1986) Cell, 45, 733-742. 57. LeFranc, M.-P., A. Forster and T. H. Rabins. (1986) Nature, 319, 97. Shen, A., C. Humprhies, P. Tucker and F. Blattner. (1987) Proc. Natl. 420-422 . Acad. Sci. U.S.A., 84, 8563-8567. 58. Hockett, R. D., J. de Villartay, K. PoUock, D. G. Poplack, D. I. Cohen 98. Lee, K. H., F. Matsuda, T. Kinashi, M. Kodaira and T. Honjo. (1987) and S. J. Korsmeyer. (1988) Proc. Natl. Acad. Sci. USA, 85, 9694-9698. / Mol Biol, 195, 761-768. 59. Satyanarayana, K., S. Hata, P. Devlin, M. G. Roncarlo, J. E. De Vries, 99. Berman, J. E., S. J. Mellis, R. PoUock, S. C.L., H. Suh, B. Heinke, C. H. Spits, J. L. Strominger and M. S. Krangel. (1988) Proc. Natl. Acad. Kowal, U. Surti, L. Chess, C. R. Cantor and F. W. Alt. (1988) EMBO Sci. USA, 85, 8166-8170. J., 7, 727-738. 60. Reynaud, C.-A., A. Dahan, V. Anquez and J.-C. Weill. (1989) Cell, 59, 100. Matsuda, F., K. H. lee, S. Makai, T. Sato, M. Kodaira, S. Q. Zong, 171-183 . H. Ohno, S. Fukuhara and T. Honzo. (1988) EMBOJ., 7, 1047-1051. 61. Renaud, C.-A., A. Anquez, A. Dahan and J.-C. Weill. (1985) Cell, 40, 101. Kodaira, M., T. Kinashi, I. Umemura, F. Matsuda, T. Noma, Y. Ono 283-291 . and T. Honjo. (1986) / Mol. Biol, 190, 529-541. 62. Becker, R. S., M. Suter and K. L. Knight. (1990) Eur. J. Immunol., 20, 102. Matthyssens, G. and T. H. Rabbitts. (1980) Proc. Natl. Acad. Sci. USA, 397-402 . 77, 6561 -6565 . 63. Leiberman, R., L. Emorine and E. E. Max. (1984) J. Immunol., 133, 103. Rechavi, G., B. Bienz, D. Ram, Y. Ben-Neriah, J. B. Cohen, R. Zakut 2753-2756. and D. Givol. (1982) Proc. Natl. Acad. Sci. USA, 79, 4405-4409. 64. Heidmann, O. and F. Rougeon. (1984) Nature, 311, 74-76 . 104. Rechavi, G., D. Ram, L. Glazer, R. Zakut and D. Givol. (1983) Proc. 65. Kokubu, F., R. Litman, M. J. Shamblott, K. Hinds and G. W. Litman. Natl, Acad. Sci, USA, 80, 855. (1988) EMBO J., 7, 3413-3422. 105. Heiter, P. A., J. Maizel J.V. and P. Leder. (1982) J. Biol. Chem., 257, 66. Shamblott, M. J. and G. W. Litman. (1989) EMBO J., 8, 3733-3739. 1516-1522. 67. Zezza, D. J., S. E. Stewart and L. A. Steiner. (1992) J. Immunol, 149, 106. Frippiat, J. P., P. Chuchanan, F. Bernard, L. Buluwela, G. Lefranc and 3968-3977. M. P. Lefranc. (1990) Nucleic Acids Res., 18, 7134-7134. 68. Brueggemann, B., J. Free, A. Diamond, J. Howard, S. Cobbold and H. 107. Alexandre, D., P. Chuchana, F. Brockly, G. Lefranc and M.-P. Lefranc. Waldmann. (1986) Proc. Natl. Acad. Sci. U.S.A., 83, 6075-6079. (1989) Nucleic Acids Res., 17, 3975-3975. 69. Steen, M.-L., L. Hellman and U. Pettersson. (1987) Gene, 55, 75-84. 108. Siminovitch, K. A., V. Misener, P. C. Kwong, Q.-L. Song and P. P. Chen. (1989) J. Clin. Invest., 84, 1675-1678. 70. Takeuchi, N., N. Ishiguro and M. Shinagawa. (1992) Immunogenetics, 35, 89-96 . 109. Bernard, F., P. Chuchana, J. P. Frippiat, L. Buluwela and M. P. Lefranc. 71. Renaud, C.-A., C. R. Mackay, R. G. Muller and J.-C. Weill. (1991) Cell, (1990) Nucleic Acids Res., 18, 7139-7139. 64,995-1005 . 110. Brockley, F., D. Alexandra, P. Chuchana, S. Huck, G. Lefranc and M.- P. Lefranc. (1989) Nucleic Acids Res., 17, 3976. 72. McCormack, W. T., L. M. Carlson, L. W. Tjoelker and C. B. Thompson. (1989) Int. Immunol, 1, 332-341. 111. Daley, M. D., H. Peng, V. Misener, X. Liu, P. P. Chen and K. A. Siminovitch. (1992) Mol. Immunol, 29, 1515-1518. 73. Blankenstein, T., F. Bonhomme and U. Krawinkel. (1987)Immunogenetics, 26, 237-248. 112. Smith, W. J., A. Tunnacliffe and T. H. Rabitts. (1987) Nucleic Acids Res., 15, 4991. 74. Schroeder, H. W., J. L. Hillson and R. M. Perlmutter. (1989) Int. Immunol, 113. Siu, G., E. C. Strauss, E. Lai and L. E. Hood. (1986) J. Exp. Med., 2, 41-50. 164, 1600-1614. 75. Cohen, J. B. and D. Givol. (1983) EMBO J., 2, 2013-2018. 114. Dcuta, K., T. Ogura, A. Shimizu and T. Honjo. (1985) Proc. Natl. Acad. 76. Sakano, H., R. Maki, Y. Kurosawa, W. Roederand S. Tonegawa. (1980) Name, 286, 676-683. Sci. U.S.A., 82, 7701-7705. 77. Givoli, D., R. Zakut, K. Effron, G. Rechavi, D. Ram and J. B. Cohen. 115. Lefranc, M.-P., A. Forster, R. Baer, M. A. StinsonandT. H. Rabbitts. (1981) Nature, 292, 426-430. (1986) Cell, 45, 237-246. 78. Olio, R., C. Auffray, J.-L. Sikorav and F. Rougeon. (1981) Nucleic Acids 116. Huck, S., P. Dariavach and M.-P. Lefranc. (1988) EMBOJ., 7, 719-726. Res., 9, 4099-4109. 117. Guglielmi, P., F. Davi, L. d'Auriol, J.-C. Bories, J. Dausset and A. 79. Schiff, C , M. Milili, I. Hue, S. Rudikoff and M. Fougereau. (1986) J. Bensussan. (1988) Proc. Natl. Acad. Sci. U.S.A., 85, 5634-5638. Exp. Med., 163, 573-587. 118. Schwager, J., N. Burckert, M. Courtet and L. D. Du Pasquier. (1989) 80. Siekevitz, M., S. Y. Huang and M. L. Gefter. (1983) Eur. J. Immunol, EMBO J., 8, 2989-3001. 13, 123-132. 119. Knight, K. L. and R. S. Becker. (1990) Cell, 60, 963-970. 81. Kataoka, T., T. Nikaido, T. Miyata, K. Moriwaki and T. Honjo. (1982) 120. McCormack, W. T., S. M. Laster, W. F. Marzluff and K. H. Roux. J. Biol. Chem., 257, 277-285. (1985) Nucleic Adds. Res., 13, 7041-7045. 82. Yancopoulos, G. D. and F. W. Alt. (1985) Cell, 40, 271. 121. Becker, R. S., S. K. Zhai, S. J. Currier and K. L. Knight. (1989) J. 83. Cohen, J. B., K. Effron, G. Rechavi, Y. Ben-Nenah, R. Zakut and D. Immunol, 142, 1351-1355. Givol. (1982) Nucleic Acids Res., 10, 3353-3370. 122. Heidmann, O. and F. Rougeon. (1983) Cell, 34, 767-777. 123. Gutman, G. A., R. M. Besta, M. B. Frank and P. R. Baverstock. (1987) 84. Crews, S., G. J., H. Huang, K. Calame and L. E. Hood. (1981) Cell, Immunogenetics, 26, 14-20. 25, 59-66. 85. Bothwell, A. L., M. Parking, M. Reth, T. Imanishi-kari, K. Rajewsky and D. Baltimore. (1981) Cell, 24, 625. 86. Yancopoulos, G. D., S. V. Desiderio, M. Paskind, J. F. Kearney, D. Baltimore and F. W. Alt. (1984) Nature, 311, 727-733. 87. Olio, R., J.-L. Sikorav and F. Rougeon. (1983) Nucleic Acids Res., 11, 7887-7897. 88. Ucker, D. S., Y. Kurwawaand S. Tonegawa. (1985)/ Immunol.., 135, 89. Bernard, O., N. Hozumi and S. Tonegawa. (1978) Cell, 15, 1133-1144. 90. Tonegawa, S., A. M. Maxam, R. Tizard, O. Bernard and W. Gilbert. (1978) Proc. Natl Acad. Sci. U.S.A., 75, 1485-1489. 91. Sanchez, P., P. N. Marche, D. Rueff-Juy and P.-A. Cazenave. (1990) / . Immunol, 144, 2816-2820. 92. Hirama, T., S. Takeshita, Y. Matsubayashi, M. Iwashiro, T. Masuda, K. Kuribayashi, Y. Yoshida and H. Yamagishi. (1990) Eur. J. Immunol ,21 , 483-488 . 93. Chou, H. S., M. A. Behlke, S. A. Godambe, J. H. Russell, C. G. Brooks and D. Y. Loh. (1986) EMBO J., 5, 2149-2155.

Journal

Nucleic Acids Research – Oxford University Press

Published: May 25, 1994

There are no references for this article.