Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

A novel set of spliceosome‐associated proteins and the essential splicing factor PSF bind stably to pre‐mRNA prior to catalytic step II of the splicing reaction.

A novel set of spliceosome‐associated proteins and the essential splicing factor PSF bind stably... The EMBO Journal vol.13 no.14 pp.3356-3367, 1994 A novel set of spliceosome-associated proteins and the essential splicing factor PSF bind stably to pre- step 11 of the splicing mRNA prior to catalytic reaction complexes on a native gel, and most likely contains non- Or Gozani, James G.Patton" and snRNP RNA binding proteins, whereas the snRNPs remain Robin Reed2 associated with the lariat intron in a larger complex Department of Cell Biology, Harvard Medical School, Boston, MA (Konarska and Sharp, 1987; Lamond et al., 1987). Conver- 02115 and IDepartment of Molecular Biology, Vanderbilt University, sion of the B to the C complex, as well as conversion of Nashville, TN 37235, USA the splicing intermediates into the spliced products, 2Corresponding author ATP and Abelson, requires and incubation at 30°C (Cheng 1988; Reed Communicated by I.Mattaj 1987; Lin et al., 1987; Abmayr et al., et al., 1988). E complex contains U2AF35, U2AF65, We have isolated and determined the protein composi- Affinity-purified snRNP and several tion of the spliceosomal complex C. The pre-mRNA in Ul components, spliceosome- et this complex has undergone catalytic step I, but not associated proteins (SAPs) (Bennett al., 1992; D.Staknis, and unpublished observations). The step II, of the splicing reaction. We show that a novel M.Bennett R.Reed, associated with one set of 14 spliceosome-associated proteins (SAPs) and the 5' and 3' splice sites are functionally in E and this interaction be essential splicing factor PSF are specifically associated another the complex, may by Ul snRNP bound to the 5' splice site and with the C complex, implicating these proteins in mediated 3' site with SR catalytic step II. Significantly, immunodepletion and U2AF bound to the splice proteins bridging factors and Wu and Maniatis, biochemical complementation studies demonstrate these (Michaud Reed, 1993; for II. 1993). Although affinity-purified E complex lacks SR directly that PSF is essential catalytic step crosslink to et al., 1992), these proteins are bound Purified PSF is known to UV pyrimidine proteins (Bennett UV crosslinks to to in the functional gel filtration-purified E tracts, and our data show that PSF pre-mRNA in Thus, PSF may and B and R.Reed, unpublished pre-mRNA purified C complex. complexes (D.Staknis to 3' site factor U2AF65 which Ul U2AF35 and U2AF65 appear replace the splice binding observations). snRNP, the E to B assembly. Finally, be destabilized at some point during complex is destabilized during spliceosome 60 and which are in possibly as early as complex assembly we show that SAPs 90, present transition, Staknis and B and C are associated (Michaud and Reed, 1991, 1993; Reed, both the complexes, specifically are U2 snRNP and and thus have 1994). Ten new proteins, most of which with U4 U6 snRNPs, may important bound to the roles in the functioning of these snRNPs during the components, then become stably pre-mRNA Staknis and reaction. in the A complex (Bennett et al., 1992; Reed, splicing A the U2 snRNP UV words: complexes/splicing reaction 1994). subset of components Key spliceosomal in A and crosslink to pre-mRNA affinity-purified complex interactions between U2 snRNP and the may mediate pre- mRNA and (Staknis Reed, 1994). Introduction B contains U5 and U6 snRNAs The complex U2, U4, and Konarska and Pre-mRNA splicing takes place in a multi-component (Grabowski Sharp, 1986; Sharp, 1986, et 1986; Cheng and Abelson, 1987). complex designated the spliceosome. Spliceosomes 1987; Pikeilny al., in and four In this contains all of the proteins assemble on pre-mRNA a stepwise manner, addition, complex 12 five which assemble in the order E -* A present in the A complex plus additional proteins, discrete complexes, in the pathway of which are 20S U5 snRNP (Bennett et al., -o B -e C, are functional intermediates components and Lamm and 1992). One of the U5 snRNP proteins (200 kDa) UV (see for reviews Rymond Rosbash, 1992; 1 and 1993; Moore et al., 1993). The E and A com- crosslinks to exon adjacent to the 5' splice junction Lamond, interactions plexes are designated prespliceosomes, and the B and C may mediate U5 snRNA-pre-mRNA (Wyatt A to I of the are referred to as spliceosomes. The E, and et al., 1992). Prior catalytic step splicing complexes dissociates from the B complexes contain unspliced pre-mRNA, whereas the reaction, U4 snRNA spliceosome C contains the of I of the et and Abelson, 1987; Lamond complex products catalytic step (Pikeilny al., 1986; Cheng reaction 1 and lariat-exon The C complex et and is not for the catalytic steps splicing (exon 2). al., 1988) required is a short-lived intermediate due to the rapid conversion (Yean and Lin, 1991). In contrast, U6 snRNA, which of the splicing intermediates into the spliced products (the forms an essential base-pairing interaction with the 5' The mRNA in in ligated exons and lariat intron). spliced is splice site, is thought to be involved directly the of the reaction and turn rapidly released from the C complex, such that no catalytic steps (Sawa Abelson, 1992; discrete has been identified that Sawa and Wassarman and Steitz, 1992; spliceosomal complex Shimura, 1992; contains both the exons and the excised lariat Kandels-Lewis and Seraphin, 1993; Lesser and Guthrie, ligated intron. The spliced mRNA alone is detected in a complex Sontheimer and Steitz, 1993). Although proteins 1993; that much faster than any of the spliceosomal associated with U 1, U2 and U5 snRNAs have been migrates 33563 6© Oxford Press University SAPs and PSF bind stably to pre-mRNA Parental U UUCcGUjACUGUCCCUUUUUUUUCCACAG xAG UUCGIUGCUGAIC ICU!UUCCCUUUUUUUUCCUCUCUCUC uGG XAG Pare-ta' parental AAG 40 5 20- 40 s 20 10' 601 601 nu 2 40 60 5' 1 23' 40' - -C :U. "... w;? -B ANN EI ..i -A ! m .. .,. 7- -H 1. Accumulation of C on intron are the boxes and Fig. complex AAG pre-mRNA. (A) Structure of pre-mRNAs. The exons and represented by line, The 5' and 3' sites and are indicated. The nucleotide of 3' of the intron respectively. splice branchpoint sequence (BPS) sequence the is portion shown. The BPS is boxed A in and the additional residues in the are underlined. The (branch-site bQld) pyrimidine present AAG AG pre-mRNA dinucleotide in the was to in in time with or parental pre-mRNA changed GG AAG pre-mRNA (indicated course AAG bold). (B) Splicing parental pre-mRNAs. Parental or AAG were incubated under conditions p1 for the times and total RNA pre-mRNAs (20 ng) splicing (25 reaction) indicated, was fractionated on an 8% The bands denaturing polyacrylamide gel. corresponding to intermediates and spliced products are indicated. (C) Time course of or complex assembly on parental AAG pre-mRNAs. Parental or AAG pre-mRNAs (20 were incubated under conditions pl ng) splicing (25 reaction) for the times indicated and then were fractionated on a 4% The bands to complexes non-denaturing polyacrylamide gel. corresponding H, A, B and C complexes are indicated. The bracket indicates a band that was observed with the and This band only parental pre-mRNA at 40 60 min. most likely contains spliced mRNA. identified in purified spliceosomal ates with complexes (Bennett spliceosomes on density gradients (Smith et al., et al., 1992; Staknis and no and contains Reed, 1994), spliceosomal 1989) U2, U5 and U6 snRNAs and a large proteins have been identified that are associ- number of specifically unidentified proteins (Reed, 1990). ated with U4 or U6 snRNPs. In this we have study carried out a detailed characteriza- Under normal splicing the C is tion of affinity-purified C conditions, complex complex assembled on a pre- detected at low levels as a discrete band that migrates mRNA lacking the AG dinucleotide. We show that this more slowly than the A and B complexes on native gels complex contains all of the in proteins present the B et (Lamond al., 1987). To characterize the C complex, it complex, as well as an additional 14 novel SAPs. The has been to necessary find conditions that result in its essential splicing factor PSF is abundant in and UV accumulation. II Catalytic step of the splicing reaction crosslinks to pre-mRNA in the C complex. Moreover, can be blocked mild by heat treatment (Krainer and biochemical complementation of extracts PSF-depleted and the exon 1 and 2 Maniatis, 1985) lariat-exon that shows that PSF is essential for II of the catalytic step accumulate in this C can be chased reaction. complex into spliced splicing Finally, we have identified SAPs 60 and products (Reed et al., 1988). Heat treatment of nuclear 90 as the first U4/U6 snRNP-specific spliceosomal has not to be a reliable method proteins. extracts, however, proven for accumulating the C due to between complex variability extracts. Catalytic step II can also be blocked assem- by Results bling complexes on a pre-mRNA that lacks the AG dinucleotide at the 3' splice site, but contains a To accumulate the C complex, we employed a derivative long of AdML pyrimidine tract (Reed, 1989, 1990; Smith et al., 1989). pre-mRNA designated AAG pre-mRNA, that has a The complex assembled on such pre-mRNAs co-fraction- long, uninterrupted pyrimidine tract and a GG 3357 O.Gozani, J.G.Patton and R.Reed C complex (40') 50oo E E E 8- 3000. 2000 . 1000, 0o .1 A . 1 ? I 20 30 40 5060 70 60 fraction number fraction number fraction number was incubated under conditions Fig. 2. Analysis of spliceosome assembly on AAG pre-mRNA by gel filtration. AAG pre-mRNA (80 ng) splicing jl fractionated filtration. The B and C are (100 reaction) for the times indicated and then complexes were by gel peaks containing H, A, complexes another the extent indicated the native indicated; note that the A, B and C complexes are contaminated with one to by gel analysis (see H and the to the left of the B corresponding time points in Figure IC). The peak to the right of the complex contains degraded pre-mRNA peak A, of the column. or C complexes is the void volume 10U40 5:10O -0-kam4a W.". C=D--F--2D L*Z-::h iih4W 1lElS; : x ----~~~~-- .xci r El:U ~~~U 40, :J5_ 6 i~Js 4 z16_ 3 A assembled on AAG 3. The snRNA of AAG biotin was Fig. compositions spliceosomal complexes pre-mRNA. (A) pre-mRNA (1.92 ig) containing for the times were fractionated filtration and then under conditions ml incubated splicing (2.4 reaction) indicated, complexes by gel affinity-purified and Total RNA was 3' end-labeled with and then in mM salt to avidin Materials 250 by binding agarose (see methods). prepared, [32P]pCp Total RNA to is shown in lanes 1-3. The bands fractionated on an 8% denaturing polyacrylamide gel (lanes 4-6). prior end-labeling corresponding are indicated. X a band that fractionates below snRNA that is not seen in all nuclear to the and intermediates designates U1 snRNAs, pre-mRNA Total RNA from the E and C were 3' end-labeled with and then fractionated on a extracts and [32P]pCp (Michaud Reed, 1991, 1993). (B) complexes The of the Ul snRNA and the band X is shown. from lanes were 6% denaturing polyacrylamide gel. portion gel containing (C) Samples (A), 4-6, The of the exon 1 and U4 snRNA is shown. A of the fractionated on a 6% denaturing polyacrylamide gel. portion gel containing (D) long exposure lanes 4-6. The band below U6 snRNA to a band detected in lower portion of (A), may correspond previously affinity-purified spliceosomes Lamond et Total RNA was from 80 AAG assembled into the C and (Grabowski and Sharp, 1986; al., 1988). (E) prepared ng pre-mRNA complex fractionated on an 8% Bands were visualized ethidium bromide denaturing polyacrylamide gel. by staining. less substitution of the AG dinucleotide at the 3' terminus of assembly is reproducibly efficient than observed with In the intron (compare AAG and parental pre-mRNAs, Figure the parental pre-mRNA (Figure IC). contrast to the When AAG is in the C IA). pre-mRNA incubated splicing parental pre-mRNA, complex accumulates on the pre-mRNA and is the major complex detected at 40 the AAG extracts, splicing intermediates account for -50% of the total pre-mRNA detected at 40 and 60 min (Figure and 60 min IC, compare parental with AAG). We (Figure iB, AAG, 40', 60'). With the parental pre-mRNA, >50% conclude that the C complex, containing the products of conversion to the spliced products is detected at 60 min, catalytic step I (see Figure 1B, AAG, 40', 60'), accumulates on AAG In and only low levels of the splicing intermediates are pre-mRNA. the case of the parental pre- observed at the complexes are no longer detected earlier time points (Figure iB, parental). mRNA, spliceosomal of the reactions shown in Figure lB by non- at 60 Analysis min (Figure IC, parental), but a complex that shows fractionates faster than the H complex (designated by the denaturing gel electrophoresis that the A and B assemble on the AAG is detected and most complexes pre-mRNA, though bracket) likely contains spliced 3358 SAPs and PSF bind to stably pre-mRNA AAG 5 complex AAG 1 O'complex OH H[I OH 200) .... 49 ,- f.. 1 t 4 5 4 ;:, *s. -130 . 115 __ 1. 0 16 114 t 4 *- _72 x --- 7 2 - ---- 72 9'-~~2._ ~ ~~~~~~~~ ~~~~~,- 62 - 60 *. 62 , l ,: *_ "W. 4. 0 ff of 5 and assembled on Total was from 150 AAG Fig. 4. Protein composition 10 min spliceosomal complexes AAG pre-mRNA. protein prepared ng pre-mRNA in 5 or 10 and fractionated 2-D Proteins were detected present affinity-purified min spliceosomal complexes by gel electrophoresis. by silver The in the 5 and 10 are labeled to the nomenclature in Bennett et The A staining. proteins min complexes according al. (1992). complex proteins are labeled in both the 5 and 10 whereas the B are labeled in the 10 The min complexes complex-specific proteins min only complex. bracket indicates the heat-shock et proteins (Bennett al., 1992). mRNA released from the and The snRNA compositions of the 10 spliceosome (Konarska 5 and min complexes Sharp, Lamond et assembled on AAG pre-mRNA 1987; al., 1987). (Figure 3A, lanes 4 and The 40 min time was used to the 5) are similar to those observed point analyze composi- in the corresponding tion of the C To ensure complexes assembled on complex (Figure IC, AAG, 40'). normal pre-mRNAs (data not that the AG mutation did not result in of shown; Michaud and Reed, 1993). These assembly compositions aberrant complexes, we also the are consistent with the levels ofA and B analyzed compositions complex observed of complexes assembled for 5 and 10 min on this at these two times in Figure IC pre- (AAG). As expected, the mRNA (see Figure IC, AAG, 5', 10'). The A and but C complex (40 min) contains the B, same level of U2 snRNA not the C, complexes are detected at these times. For as observed in the 5 and 10 min complexes (Figure 3A, purification, complexes were assembled on lanes 4-6). The levels of U5 and U6 snRNAs are biotinylated higher filtration and then pre-mRNA, fractionated by gel in the C complex relative to the 5 and 10 min complexes affinity- in mM purified 250 salt (Bennett et We note (Figure 3A, lanes 4-6; see Figure 3D for a longer exposure al., 1992). same the same relative that we used the conditions (i.e. of the portion of the gel containing U6 snRNA). The amounts of nuclear extract and to lower levels of pre-mRNA) U5 and U6 snRNAs in the B (10 min) generate the filtration as were used to complex 3A and complexes analyzed by gel (Figure D) are due, at least in part, to on the native As from contamination with the A analyze complexes gels. complex (see Figure IC, AAG). expected previous work et Michaud and Analysis of the snRNAs in (Reed al., 1988; Reed, the C complex by ethidium the at all three time co-fractionate bromide shows that 1991), complexes points staining U2, U5 and U6 snRNAs are filtration due to the inherent about in this by gel (Figure 2; variability equimolar complex (Figure 3E). between different filtration the relative Ul snRNA is barely detected in the gel columns, only 5, 10 and 40 min elution positions of each complexes (Figure 3A, lanes peak can be compared). Thus, 4-6; the band below Ul the spliceosomal are contaminated snRNA, designated X, is a background band as shown in complexes with one another to the extents indicated the Figure 3B; Michaud and Reed, 1993). This is consistent by non-denaturing gel with work analysis (see For both the A previous showing that Ul snRNP is tightly Figure IC, AAG). example, bound in the E and B complexes are at 10 min ATP-independent complex and then present (Figure IC, AAG, but a becomes destabilized the E to B transition 10'), only single gel filtration peak containing during complex these Michaud and U4 complexes is detected (Figure 2, B (see Figure 3B; Reed, 1991, 1993). complex, 10'). snRNA is not detectable in the C Importantly for this study, the C complex detected at 40 readily complex by ethidium bromide see also min is contaminated at only a low level with the B staining (Figure 3E; Figure 3C, which resolves exon 1 from U4 snRNA in the C complex (Figure IC, AAG). complex). 3359 O.Gozani, J.G.Patton and R.Reed '_S t1 -' _E.. . _ r :4_ .: ........... : _ 111! 1E t1_ P' kF E ! .... :dF. -- -~~~~~~a s _ .. ;c , - i~~~~ , 1;eEz 4iP - - - - ~~~~~~~4 :: - i:i _:t g., 5 .z-:.'' , , .St. + *. ,s. }4_ |Ei 2% .,:!: .", :ij. i.i "1:4. :::.: ...IQk St B...::. 81e::: ...... _..Sg ss :: :.:: ..:..a:"s:_:.. W:. : : ::.^ . ... E!}.. .. ' WX'-t: :'': .............. ..... . : wss: e}a,s i: .} ; 11!^ 1te j ....I j S. Xw - %, *,.; j,j,,,: iL ^ oiZ .4 ,$wi _. - ....................... _ 'ki O '.,? .. * ak 4,:?. ;, t-. ., .. +.l 'Not... i' 5. Protein of the C and identification of U4/U6 snRNP MaS antiserum. C Fig. composition complex components using (A) Affinity-purified complex and assembled on 200 ng AAG pre-mRNA was fractionated by 2-D gel electrophoresis, proteins were detected by silver staining. The 14 novel in circles for while the four enriched in the C versus the B are SAPs the C complex are indicated by [see (B) SAP 165], proteins highly complex The are indicated A of a 2-D of C which shows SAPs 165 and 100 more The heat- boxed. heat-shock proteins (A). (B) portion gel complex clearly. shock are Proteins from filtration-isolated U4/U6 snRNPs MaS antiserum were proteins indicated (A). (C) immunoprecipitated gel using patient fractionated 2-D and were detected silver The this by gel electrophoresis proteins by staining. proteins specifically immunoprecipitated by antibody and that with C are indicated 90 and B and SnRNAs from specifically comigrate complex proteins (SAPs 60, B'). (D) immunoprecipitated gel filtration-isolated U4/U6 snRNPs MaS antiserum. B MaS The of the snRNAs and using patient B, complex. IP, immunoprecipitation. positions pre- mRNA are indicated. MaS antiserum alone of filtration fractions MaS antiserum or (E) (MaS), immunoprecipitation gel using (MaS IP) affinity- C mixed with the MaS IP + MaS were fractionated on 2-D B and B' and the in the of purified complex (C complex IP) gels. Only proteins vicinity in MaS IP SAPs 60 and 90 are labeled. The arrows the indicate that are in the MaS and not in the MaS panel proteins present immunoprecipitation the are as antiserum alone. The acidic and basic ends of gels indicated in (A). 3360 SAPs and PSF bind stably to pre-mRNA These data are consistent with that U4 (Bennett et al., 1992; Staknis and Reed, 1994). To deter- the observation snRNP dissociates at some point to I mine whether any of the SAPs in purified B or C complexes prior catalytic step (Pikeilny et al., 1986; Cheng and Abelson, 1987; Lamond correspond to U4/U6 snRNP proteins, we used the U4/ et al., 1988) and is no longer required for the splicing U6 snRNP-specific MaS antiserum (Okano and Medsger, reaction (Yean and Lin, 1991). Note that the levels of U4 1991) to immunoprecipitate this snRNP from gel filtration- and snRNA may be low in the 10 min complex due to its fractionated nuclear extract (see Materials methods). snRNAs contamination with the A complex (see Figure 3A, lanes As expected, U4 and U6 are immunoprecipitated 4-6 and C). by this antisera (Figure SD; Okano and Medsger, 1991; The protein composition of min The the 5 and 10 complexes Blencowe et al., 1993). immunoprecipitated proteins in of the unlabeled assembled on AAG pre-mRNA (Figure 4) is similar to are shown Figure SC. [Most proteins that observed in the B assembled on in the MaS are due to the previously complex immunoprecipitate antibody of the C with the MaS parental pre-mRNA (Bennett et al., 1992). As predicted (see below).] Comparison complex from the native gel analysis indicated that SAPs 60 and 90 and the (Figure lC, AAG, 5', 10'), immunoprecipitate there are higher levels of the B snRNP core B and B' are in common. To complex-specific proteins proteins at 10 min (B complex proteins are labeled in the 10 only determine whether these proteins precisely comigrate we min complex, Figure 4). No proteins other than those carried out a SE shows a mixing experiment. Figure detected in the B complex assembled on normal pre- of the bands that elute from comparison background the mRNAs are present in the 5 or 10 min complexes the MaS antiserum alone the resin containing (MaS), assembled on the AAG pre-mRNA. In addition, these S proteins present in the MaS of the immunoprecipitation and 10 min complexes do not appear to be lacking any U4/U6 snRNP-containing gel filtration fractions (MaS IP) of the proteins found in the corresponding complexes and a mixture of the MaS IP sample and the C complex assembled on normal pre-mRNAs. These data, together (MaS IP + C complex). These data reveal that SAPs 60 with the analysis of the snRNAs, indicate that the initial and 90 comigrate as no extra bands in the 60 and 90 kDa stages of spliceosome assembly occur normally on the and 90 region are detected. We conclude that SAPs 60 AAG pre-mRNA, despite the presence of the AG mutation. are associated with U4/U6 snRNAs. We were unable to identify conclusively additional Identification of C in and MaS complex-specific SAPs proteins common between the C complex the The protein composition of the C complex assembled on immunoprecipitate due to the complexity of the pattern. AAG pre-mRNA is shown in Figure SA. Comparison of The high background the of the also obscures region the 10 min B complex (Figure 4) with the C complex the 150 kDa MaS its gel containing antigen making revealed the presence of 14 new proteins in the C identification difficult. the MaS to Using antibody probe complex (indicated by circles, Figure 5A and B). These a Western blot of we were unable to detect spliceosomes, are designated SAPs 165, 100, 95, 76, 75, 70, 65, 58, 51, the 150 kDa MaS or other antigen any proteins (M.Bennett 48, 45, 38, 36 and 30. SAPs 165 and 100 are seen more and R.Reed, unpublished observation). The failure to clearly in Figure SB. In addition to the novel proteins that detect SAPs 60 and 90 with the MaS which is antiserum, bind in the C complex, the 40 kDa U5 snRNP protein polyclonal, indicates that these SAPs cannot be breakdown and SAPs 102, 68 and 57 (indicated by boxes) are present products of the 150 kDa MaS antigen. In previous work, at much higher relative levels in the C than in the B the MaS antisera were used to immunoprecipitate [35S]_ complex (e.g. compare the levels of SAPs 40 and 49, methionine-labeled proteins from HeLa whole cell 4 and Figures SA). To be consistent with our previous extracts. This study identified proteins of 150 (the MaS in which nomenclature, spliceosomal proteins are desig- antigen), 120, 80, 36 and 34 kDa (Okano and Medsger, nated to the in which according complex they are most 1991). Comparison of the 2-D gels containing the MaS SAPs and and abundant, 102, 68 57 the 40 kDa U5 snRNP IP (Figure SE, MaS IP) and the MaS antiserum alone protein, as well as the 14 novel SAPs, are designated C (Figure 5E, MaS) reveals several proteins that are spe- of cifically complex-specific proteins. None the these proteins were immunoprecipitated by the MaS antiserum (indic- detected when the was ated our affinity-purification procedure by arrows; estimated molecular weights from top carried out using the AAG pre-mRNA biotin to bottom for these are lacking (data proteins 130, 50, 45 and 34 kDa). not shown). In addition, analysis of the C complex on It is possible that some of these proteins correspond to higher percentage gels (12 and 15%) did not reveal any those detected previously by Okano and Medsger (1991). additional C complex-specific not For example, the 130 and 34 kDa proteins (data shown). proteins could correspond Finally, the C complex-specific proteins were detected to their 120 and 34 kDa proteins. However, our MaS IP reproducibly in >20 independent preparations of the C was from nuclear extract fractions whereas they used in complex and several different preparations of nuclear whole cell extracts. Thus, it is possible that some of extracts. However, as pointed out with SAPs 165 and 100 their proteins are not associated with U4/U6 snRNP in we find that resolution of some of the above, proteins the nucleus. varies on different 2-D gels. SAPs 102 and 68 to an correspond PSF and SAPs 60 and 90 are U41U6 snRNP breakdown of PSF proteins apparent product U2 and but not of a of the U1, U5, U4/U6, snRNP-specific proteins Comparison partially purified preparation (Bach et al., 1989; Okano and Medsger, 1991; Behrens essential splicing factor PSF (Patton et al., 1993) to et see Luhrmann et 1990 for a affinity-purified spliceosomes on a 2-D gel revealed that al., 1993a; al., review) have been detected in purified spliceosomal complexes SAPs 102 and 68 co-fractionate with PSF and its apparent 3361 O.Gozani, J.G.Patton and R.Reed PSF Io:;:mpiex preparatitc PS with F abs k3 .s.d estierl ....: *;. '. '- PSF '102 * w PSF 68 2-D of PSF Fig. 6. SAPs 102 and 68 correspond to the essential splicing factor PSF and its apparent breakdown product PSF*. (A) gel comparison 2-D Proteins were and spliceosomes. A partially purified preparation of PSF or affinity-purified B complex were fractionated by gel electrophoresis. Al and A2 indicated in the and the are indicated detected by silver staining. PSF, PSF*, hnRNPs I/PTB, are PSF preparation spliceosomal proteins in B Western The was fractionated on a 2-D transferred to nitrocellulose and with the complex. (B) analysis. C complex gel, probed polyclonal to of and the streaks above PSF antibodies to PSF. Spots corresponding to PSF (SAP 102) and PSF* (SAP 68) are indicated. The spot the left PSF* are not and are not detected The of the low molecular weight protein detected by the PSF antibody is not known. proteins reproducibly. identity PSF* PSF* is to complex also crosslink in the C complex (Figure 7A). breakdown product (Figure 6A). thought a breakdown of PSF because in Significantly, however, three additional proteins crosslink be product purified of PSF* accumulates over time whereas to pre-mRNA in the C complex. By superimposing the preparations PSF, As crosslinking and silver-stained patterns of the gel, we PSF diminishes (J.G.Patton, unpublished observation). shown hnRNP I/PTB and a 33 kDa identified these as the C complex components SAP 36, previously, protein in the PSF et and SAPs 102 and 68 (PSF and PSF*, respectively) are present preparation (Patton al., 1991, of the 33 kDa (Figure 7B). We note that, as observed previously, the 1993). Peptide sequence analysis protein indicates that it is hnRNP A (J.G.Patton, unpublished crosslinked proteins are shifted slightly above and to the show that the Consistent with our data acidic side of the silver-stained proteins (Figure 7B; observation). this, hnRNPs Al and A2 PSF contains Staknis and Reed, 1994). This shift is most likely due to purified preparation with hnRNP (based on a 2-D gel comparison purified the presence of the crosslinked RNase digestion product Further evidence that SAPs as the shift is complexes; data not shown). and, expected, larger with smaller proteins. to PSF and PSF* is the observation We detect no other likely candidates for these crosslinked 102 and 68 correspond to PSF detect SAPs 102 and proteins on our silver-stained 2-D gels (Figure 7B). that antibodies specifically 2-D Western blots of C the between 68 on affinity-purified complex Moreover, correspondence the crosslinked As noted SAPs 102 and 68 are and silver-stained was also seen on (Figure 6B). above, present proteins lower percent- in at relative levels which resolve the not the C complex significantly higher age gels proteins differently (data than in the B levels of these Consistent with our data that PSF complex (e.g. compare shown). indicating proteins in Figures 5A and 6A, B complex). We conclude crosslinks to this factor contains two RNA pre-mRNA, that PSF is specifically enriched in the C complex. binding domains, and the purified protein crosslinks spe- cifically to pyrimidine tracts in pre-mRNA (Patton UV crosslink to C complex-specific proteins pre- et al., 1993). mRNA As observed we find that the 200 kDa U5 PSF is for previously, required catalytic step 11 of the splicing snRNP et Whittaker and reaction protein (Garcia-Blanco al., 1990; Beggs, 1991; Wyatt et al., 1992; Staknis and Reed, 1994) It was thought previously that PSF was required for A and the U2 snRNP-specific SAPs 155, 145, 114, 62, 61 et This was based complex assembly (Patton al., 1993). and 49 and UV (Staknis Reed, 1994) crosslink to parental on the observation that A complex assembly was inefficient or AAG in B pre-mRNA affinity-purified complex (Figure in splicing extracts immunodepleted of PSF. However, 7A; 'x' is a non-specific protein that also crosslinks to analysis of splicing reactions in PSF-depleted extracts RNAs lacking splice sites; Staknis and Reed, 1994). The typically showed that catalytic step I still occurred (Patton same U2 and U5 snRNP proteins that crosslink in the B et al., 1993). This observation, together with our observa- 3362 PSF bind to pre-mRNA SAPs and stably A H OH- B OH- H+ .,,AG C comDlex B complex 0H- H- -AG complex parentai ..! *s F. AN ;1 / 2 .N IC,2 x x 49 49 C, crosslinked C complex proteins superlmposition silver stained C B complex proteins '>s _ * _ K ;KsXw _ $, t '"s4:... -r XS. ..-$4 ...4 N 1! .... . A. 'arw.,. -1 '-.. . < C. 7. SAPs 68 and 36 UV crosslink to pre-mRNA in the C complex. (A) Affinity-purified B complex assembled on parental pre-mRNA or B Fig. 102, and C complexes assembled on AAG pre-mRNA were UV crosslinked, treated with RNase and fractionated by 2-D gel electrophoresis (see Materials and methods). The crosslinked proteins were detected by phosphorimager analysis and identified as described in (B). Note that low levels of hnRNP C crosslink in the AAG B and C complexes; this protein crosslinks much more efficiently in the H complex and is most likely present in the C due to contamination with the H complex (Staknis and Reed, 1994). (B) A sample of affinity-purified C complex prepared as in (A) complex was fractionated on a 2-D gel, and silver-stained proteins (silver-stained C complex proteins) or crosslinked proteins (crosslinked C complex proteins) were detected. The crosslinked pattern superimposed on the silver-stained pattern is shown in the third panel (superimposition). The crosslinked proteins identified by the superimposition are indicated. SAP 115, which is better resolved in (B) than in (A), has only been found to crosslink on complexes assembled on AdmL pre-mRNA. The acidic and basic ends of the gels in (B) are the same as indicated in (A). tions PSF is enriched in the C complex II that specifically fully restores catalytic step activity to the PSF-depleted and also crosslinks in this us to re- complex, prompted extracts (Figure 8, lane 5). These results are seen best by evaluate the data extracts. Signific- the ratio of lariat-intron versus lariat-exon using PSF-depleted comparing 2, our data show that the levels of intermediates due to the of a breakdown of the antly, splicing presence product pre- 1 and lariat-exon in extracts are mRNA near the spliced mRNA (a darker exposure of the (exon 2) PSF-depleted in similar to the levels of in the normal of the is presented Figure spliced products top portion gel (lanes 2-5) data and the nuclear extract or in the mock-depleted extract (Figure 8, right panel). On the basis of these 8, is a block is enriched in and UV lanes 2-4). Notably, however, there complete observations that PSF specifically II extracts in the C we conclude that PSF is in catalytic step only with PSF-depleted (Figure crosslinks complex, fusion II of the reaction. The lane addition of a protein essential for catalytic step splicing 8, 4). Moreover, pET-PSF 3363 O.Gozani, J.G.Patton and R.Reed 62 and 114), and components of U1, U2 and U5 snRNPs (Bennett et al., 1992; Behrens et al., 1993a,b; Bennett and Reed, 1993; Brosi et al., 1993a,b; Staknis and Reed, 1994). In addition, all of the novel proteins detected in the purified complexes, designated SAPs, require splice sites and/or ATP for binding to pre-mRNA, and are thus ::;:.. .. ..::.:. ::Y,f:: likely to be essential for spliceosome assembly and/or the catalytic steps of the splicing reaction. I K -) 6 F. 1, , !'I 1.1 !.. ..: :.... -,! ... ::.,.. ,!z In mammals, no individual factors have been identified r !! . -, :.::-.:,.: C-1 j,... :. for catalytic step II, but not that are specifically required The existence of for step I, of the splicing reaction. A A is indicated complementation such factors by biochemical identified a heat-sensitive activity and a studies which fraction that were required for catalytic chromatographic and Maniatis, 1985). To identify candidates step II (Krainer factors, we have now carried out a detailed for such of C complex, a spliceosomal analysis affinity-purified I, '.N A; *. .. ., that has already undergone catalytic step I. A complex lacking the AG dinucleotide at the 3' splice pre-mRNA was used to accumulate the C complex; catalytic step site II is blocked with such mutants (Reed and Maniatis, 1985; Reed, 1989; Smith et al., 1989). It is not possible to assembled on normal pre- characterize the C complex II occurs so rapidly after mRNAs because catalytic step Signific- catalytic step I that little C complex accumulates. C assembled on AAG pre- antly, however, the complex to be similar to the C complex assembled mRNA appears This is based on the observation on normal pre-mRNAs. assembled on normal and mutant that the C complexes co-fractionate on native gels, as a complex pre-mRNAs with lower mobility than the B complex. In significantly A B complexes assembled on the addition, the and for II of the reaction. 8. PSF is required catalytic step splicing Fig. AAG have the same snRNA and protein pre-mRNA was incubated under 32P-labeled a-tropomyosin pre-mRNA splicing as the assembled on normal pre- indicated in or PSF- compositions complexes conditions for the times normal, mock-depleted nuclear extracts 1-4). Bacterially immunodepleted (APSF) (lanes mRNAs. our data indicate that spliceosome assembly Thus, was added to the PSF-depleted extracts synthesized PSF (pETPSF) the normally with the AAG pre-mRNA through proceeds RNA was from each sample and fractionated (lane 5). Total prepared of the AAG of C complex. The failure pre-mRNA stage an gel. The panel on the right is a on 8% denaturing polyacrylamide reaction could to undergo catalytic step II of the splicing of the of the gel (lanes 2-5). The bands darker exposure top portion that do not involve a to intermediates and products are indicated. The be due to the loss of interactions corresponding spliced band indicated by the arrow is a breakdown product of the pre-mRNA. such as interactions with major change in the C complex, with a few or transient factors, interactions just proteins work is in the with the previous probably explained a confornational change complex. discrepancy levels of PSF that are to the C complex are obvious the observation that higher Proteins unique by significantly to block for factors involved in catalytic step II of the antibodies were A complex assembly candidates required block II of the it is also possible that some than were required to catalytic step splicing splicing reaction. However, unpublished are involved in catalytic reaction (Patton et al., 1993; J.G.Patton, of the C complex-specific proteins it is that the PSF antibodies I. In this the would have to bind to the observation). Thus, possible step case, proteins A factor that has much lower affinity before and remain stably deplete an complex spliceosome immediately step I, antibodies or inactivate a factor bound after I. Such factors would not be detected in for the non-specifically step for A assembly. the B but could remain in the C complex. Our required complex complex, this of are unable to distinguish between type analyses for catalytic step II. first-step factor and factors required Discussion 14 SAPs in the C complex (SAPs We detected novel As an for identifying, characterizing and cloning 75, 70, 65, 58, 51, 48, 45, 38, 36 and approach 165, 100, 95, 76, factors for spliceosome assembly, we identified In we identified four proteins, previously required 30). addition, with the proteins that are stably associated detected in the B complex, that are highly enriched in the previously E and A and affinity-purified pre-spliceosomal complexes C These are the 40 kDa U5 snRNP protein and complex. B al., 1992; Bennett the spliceosomal complex (Bennett et SAPs 68 and 57. Our data show that SAPs 102 and 102, that are known to be, or and Reed, 1993). Several factors 68 correspond to the essential splicing factor PSF and are to for spliceosome assembly are likely be, essential its apparent breakdown product PSF*, respectively (see in the complexes. These factors include present purified below). We do not yet know whether any of the other C the three subunits of SF3a (SAPs 61, products of SAP U2AF65, U2AF35, complex-specific SAPs are breakdown 3364 and PSF bind to SAPs stably pre-mRNA 102 or other spliceosomal proteins. However, the apparent yeast (Patterson and Guthrie, 1991). Our data, together high complexity of the C complex is consistent with the with the observation that purified PSF binds pyrimidine fact that this complex migrates as a significantly larger tracts, are consistent with the possibility that PSF recog- particle than the B complex on native gels (Lamond nizes the pyrimidine tract for catalytic step II. et al., 1987). As suggested previously (Patton et al., 1993), it is SAP 57 is the most abundant protein detected in any possible that PSF corresponds to intron-binding protein of the spliceosomal complexes and appears to be present (IBP), a factor that associates with U5 snRNP (Gerke and at much greater than a 1:1 stoichiometry in purified C Steitz, 1986; Tazi et al., 1986). Similar to PSF and PSF* complex. Further studies are needed to understand the (SAPs 102 and 68, respectively), IBP is a 100 kDa protein, a is to its breakdown significance of this observation. The 40 kDa U5 snRNP and 70 kDa protein thought be protein is specifically enriched in the C complex, even product (Gerke and Steitz, 1986; Tazi et al., 1986; Pinto U5 snRNP in B and Steitz, 1989). Furthermore, IBP and PSF both bind though binds the complex. However, we have found that there is not, in general, a tight correlation to pyrimidine tracts in pre-mRNA (Gerke and Steitz, 1986; between the of U5 snRNA and Tazi et al., 1986; Patton et al., 1993). In addition, the presence proteins classified as U5 snRNP components (Bach et al., 1989) in the observation that IBP is associated with U5 snRNP is purified spliceosomal complexes. For example, U5 snRNA consistent with the late role in splicing observed for PSF. is detected at lower levels in the B than in the C complex, Although an association of PSF with U5 snRNP has not yet the levels of the 200 and 116 kDa U5 snRNP proteins been detected, this could be for a variety of reasons, are similar between these complexes. Similarly, the 200 including that the PSF epitope may not always be access- kDa protein is detected in the A complex when little U5 ible and that IBP may be associated with U5 snRNP only snRNA is present. Thus, although these proteins can be under certain conditions (Gerke and Steitz, 1986; Tazi detected in association with purified 20S U5 snRNP (Bach et al., 1986; Pinto and Steitz, 1989). In contrast to mammals, several factors involved in et al., 1989), it is possible that they bind to the spliceosome II at different times or with different stabilities than does catalytic step of the splicing reaction have been identified snRNP. in yeast [see Rymond and Rosbash (1992) for a review]. U5 These include SLU7 (Frank and Guthrie, 1992; Frank UV crosslinking studies of affinity-purified C complex showed that all of the same that crosslink in the etal., 1992) and PRPs 16 (Couto etal., 1987; Burgess etal., proteins B crosslink in the C These include six Schwer 17 complex complex. 1990; and Guthrie, 1991, 1992), (Vijayraghavan U2 snRNP 61 and proteins (SAPs 155, 145, 114, 62, 49) et al., 1989; Ruby and Abelson, 1991; Frank and Guthrie, and the 200 kDa snRNP and 1992; Frank et al., 1992), 18 (Vijayraghavan and Abelson, U5 protein (Staknis Reed, 1994). In contrast, PSF and PSF* (SAPs 102 and 68) and Horowitz and 1990; Abelson, 1993b) and 29 (Ruby and SAP 36 were identified as that crosslink in Abelson, 1991). As appears to occur with PSF, PRP18 proteins only the C complex, implicating a role for these proteins in can bind to spliceosomes that have undergone catalytic catalytic step II of the splicing reaction. step I (i.e. the C complex) (Horowitz and Abelson, 1993a). The observation that PSF crosslinks to pre-mRNA in In the case of PRP18, the C complex is formed in the the C complex is consistent with the fact that PSF has absence of functional PRP18 and the addition of PRP18 RNA in two recognition motifs; addition, purified PSF allows catalytic step II to occur (Horowitz and Abelson, crosslinks to the pyrimidine tract of pre-mRNAs (Patton 1993a). PRP1 8 is thought to be associated with U5 snRNP et al., 1993). U2AF65 (Zamore and Green, 1989) binds to (Horowitz and Abelson, 1993b). Thus, data in both yeast the in E in and snRNP pyrimidine tract the complex, but is detected mammals show that U5 proteins (e.g. the lower levels in B and C significantly affinity-purified A, mammalian 40 kDa U5 snRNP protein) can bind to pre- mRNA complexes (Staknis and Reed, 1994; this study). Thus, after U5 snRNP has bound. to E A U2AF65 appears be destabilized during the to Interestingly, antibodies to PRP18 detect a mammalian transition and It is not complex (Staknis Reed, 1994). protein, designated p54nrb, which bears a strong amino clear from these studies in acid to a of whether U2AF65 remains the similarity portion PSF (Dong et al., 1993). A complex in a more loosely bound state or dissociates Although there is no obvious similarity between PRP18 the observations that PSF crosslinks and at the amino acid level et completely. However, p54nrb (or PSF) (Dong al., in the C complex (this study) and crosslinks to pyrimidine 1993), the observations regarding PRP18, PSF, p54nrb, tracts (Patton et al., 1993) suggest that PSF could ulti- IBP and U5 snRNP raise the possibility that there may U2AF65 on the tract. This be some relationship between these splicing components. mately replace pyrimidine possibility is supported by the observation that PSF is Significantly, in both yeast and mammals, a pyrimidine for II of the reaction. tract required catalytic step splicing preceding the AG dinucleotide increases the effici- II Significantly, the pyrimidine tract appears to have at ency of catalytic step (Reed, 1989; Patterson and least two roles in the Smith The observation that PRP18 a splicing pathway (Reed, 1989; Guthrie, 1991). is U5 et This element is first for snRNP as for al., 1989). sequence required component suggests that, proposed PSF, most for U2AF in PRP18 could interact at the 3' splice site. spliceosome assembly, likely binding the E et Zamore and complex (Smith al., 1989; Green, Michaud and The tract is SAPs 60 and 90 are U4/U6 snRNP proteins 1989; Reed, 1993). pyrimidine of the AG A are associated then required again for efficient recognition large number of proteins that specifically II of the reaction with mammalian U5 snRNP or U4/U5/U6 snRNP dinucleotide during catalytic step splicing purified A for the tract in AG have been identified et Behrens and (Reed, 1989). role pyrimidine (Bach al., 1989; II has also been observed in In no recognition for catalytic step Luhrmann, 1991). contrast, snRNP-specific proteins 3365 O.Gozani, J.G.Patton and R.Reed incubation (data not shown). Native gel electrophoresis of splicing have been detected in purified U4/U6 snRNP (see Luhr- complexes was carried out as described (Konarska and Sharp, 1987), mann et al., 1990). However, a rare patient antiserum, except that 1 of 6.5 mg/ml heparin was added to 25 ,ul reactions, and git MaS, immunoprecipitates U4/U6 snRNAs from designated 10 pA of each reaction was fractionated on the gel. For purification of cell extracts (Okano and Medsger, 1991; Blencowe et al., complexes, splicing reactions (2.4 ml) containing 1.92 pre-mRNA gg 1993; this study). The MaS antigen is a 150 kDa protein, were incubated at 30°C for the times indicated. Gel filtration and affinity purification of splicing complexes were carried out as described (Bennett and four proteins (120, 80, 36 and 34 kDa) in addition to et al., 1992). For identification of spliceosomal snRNA composition, the core snRNP proteins are co-immunoprecipitated from total RNA was prepared from equivalent amounts of each affinity- extracts along with the 150 kDa MaS antigen (Okano cell purified complex and end-labeled with [32P]pCp and RNA ligase, as and Medsger, 1991). Substoichiometric amounts of the described (Reed, 1990). In UV crosslinking experiments, complexes bound to avidin agarose were immediately irradiated on ice with 254 MaS antigen can be detected in purified U2, U5 and U4/ nm UV light (Sylvania G15T8 lamp) for 5 min at a distance of 5.5 cm U5/U6 snRNPs, but this protein does not correspond to from the light source (Staknis and Reed, 1994). To digest the 32P- any of the snRNP-specific proteins identified previously labeled RNA after crosslinking, 1 10 mg/ml protease-free RNase A gl (Blencowe et al., 1993). (Pharmacia) was added per 10 ,ul of avidin agarose-bound splicing We used the MaS antiserum to immunoprecipitate U4/ complexes and incubated at 37°C for 30 min. Proteins were then eluted from the avidin beads and acetone-precipitated (Bennett et al., 1992). U6 snRNPs from nuclear extracts and were able to identify 2-D gel electrophoresis was carried out as described (O'Farrell et al., proteins in the immunoprecipitate that precisely co-frac- 1977; Bennett et al., 1992). The first dimension was non-equilibrium tionated with SAPs 60 and 90 and the snRNP core proteins pH gradient gel electrophoresis [NEPHGE, ampholytes pH 3-10 (Bio- B and B'. SAPs 60 and 90 were not detected by Western Rad)] and the second dimension was 9% SDS-PAGE. The total protein obtained from splicing complexes assembled on 200 ng of pre-mRNA analysis using the MaS antiserum. Thus, these data indicate was loaded on 2-D gels. Proteins were visualized by silver staining specifically associated with U4/ that SAPs 60 and 90 are (Morrissey, 1981), and crosslinked proteins were detected by Phos- detect the 150 kDa MaS U6 snRNPs. We were unable to phorimager analysis (Molecular Dynamics) and autoradiography. due to the complexity antigen in our purified complexes proteins. In addition, further Immunoprecipitation of U4/U6 snRNP of the high molecular weight Total nuclear extract (lacking pre-mRNA) was fractionated by gel whether there is a relationship work is needed to determine filtration, and fractions containing U4/U6 snRNP were pooled. MaS and the four proteins shown between SAPs 60 and 90 patient antiserum (7.5 ,ul) was coupled to an AminoLink gel column as by the MaS anti- previously to be co-immunoprecipitated described (Pierce ImmunoPure Ag/Ab Immobilization Kit). 100 of 1l 34 kDa). In yeast, several proteins serum (120, 80, 36 and column resin were removed and mixed overnight at 4°C with 30 ml of gel filtration fractions containing U4/U6 snRNP. After washing the snRNP, including PRPs 3 (Ruby associated with U4/U6 immunoprecipitate with 125 mM NaCl, 20 mM Tris, pH 7.6, total RNA 1991), 4 (Banroques and Abelson, 1989; and Abelson, was prepared, end-labeled with [32P]pCp and fractionated on an 8% al., 1989; Petersen-Bjorn et al., 1989; Dalrymple et denaturing polyacrylamide gel. Proteins were prepared and analyzed by 1990; Xu et al., 1990), 6 (Abovich et al., Bordonne et al., 2-D gel electrophoresis. As a marker for the antibody proteins, a sample of the antibodies bound to the AminoLink gel column was analyzed by Legrain and Choulika, 1990) and 24 (Shannon and 1990; 2-D gel electrophoresis. 1991; Strauss and Guthrie, 1991), have been Guthrie, identified as essential splicing factors. Our analysis has Western analysis, comparison of B complex and PSF, and identified SAPs 60 and 90 as the first mammalian U4/U6 immunodepletion snRNP proteins in the spliceosome. U4 and U6 snRNAs For Western blots, affinity-purified B complex assembled on 250 ng pre- mRNA was fractionated by 2-D gel electrophoresis, transferred to critical roles in the catalytic steps of splicing, and play nitrocellulose and probed with PSF polyclonal antibodies (Patton et al., SAPs 60 and 90 may be important factors involved in the 1993). Anti-rabbit secondary antibodies were horseradish peroxidase- functioning of these snRNAs. linked and the ECL detection system (Amersham) was used. For comparison of PSF and B complex, PSF was partially purified as described (Patton et al., 1993) and fractionated on a 2-D gel in parallel and methods Materials with affinity-purified B complex. Immunodepletion or mock depletion of nuclear extracts using PSF antibodies was carried out as described; Plasmids depletion of PSF was estimated to be -90% complete based on Western Plasmids pAdMLAAG and pAdMLPar were constructed by inserting an analysis (Patton et al., 1993). The pET-PSF fusion protein was purified oligonucleotide into the HindIll and PstI sites in pAdMLA3'ss (Michaud by affinity-chromatography on a nickel column. The amount needed for and Reed, 1993). The sequences of the 3' portions of the pre-mRNAs complement of the immunodepleted extracts was determined by titration encoded by these plasmids are shown in Figure 1. The pre-mRNAs (Patton et 1993). al., contain exon 1 (129 nucleotides), intron 1 (104 nucleotides in pAdMLAAG and 97 nucleotides in pAdMLPar) and exon 2 (45 nucleo- Acknowledgements unit. DNA tides) derived from the adenovirus 2 major late transcription for transcription and transcribed with T7 was linearized with BamHI We are indebted to Rebecca Feld for excellent technical assistance and RNA polymerase. are especially grateful to Maria Bennett for carrying out the 2-D gel comparison of PSF and the B complex. We thank members of our complex purification, end-labeling and UV Splicing 132PlpCp laboratory for useful discussions and comments on the manuscript. HeLa crosslinking cells for nuclear extracts were provided by the National Institutes of Capped biotinylated pre-mRNAs (Grabowski and Sharp, 1986) were Health cell culture facility at Endotronics (MN). R.R. is a Lucille reactions (Melton et al., 1984). For synthesized in standard transcription P.Markey Scholar. This work was supported by a grant from the Lucille UV transcription reactions (100 contained 50 ,Ci each crosslinking, P.Markey Charitable Trust and a grant from NIH. gl) (3000 Ci/mmol), 100 lM cold of [32P]ATP, [32P]GTP, and [32P]CTP ATP, GTP, CTP and UTP, and 15-20 ltM biotinylated UTP (Enzo Biochemicals). For all other transcriptions, reactions contained 10 gCi References (800 Ci/mmol), 200 tM cold GTP, CTP and UTP, and [32P]UTP ATP, Abmayr,S.M., Reed,R. and Maniatis,T. (1988) Proc. Acad. Sci. 15-20 ,uM biotinylated UTP. Assembly of splicing complexes and Natl USA, 85, 7216-7220. splicing reactions were carried out under standard in vitro splicing To accumulate maximal levels of C Abovich,N., Legrain,P. and Roshbash,M. (1990) Mol. Cell. Biol., 10, conditions (Krainer et al., 1984). we the levels of pre-mRNA and the time of complex, optimized AAG 6417-6425. 3366 SAPs and PSF bind to stably pre-mRNA and Luhrmann,R. (1989) Proc. Natl Acad. Sci. Reed,R. and Maniatis,T. (1985) Cell, 41, 95-105. Bach,M., Winkelman,G. 6038-6042. Reed,R., Griffith,J. and Maniatis,T. (1988) Cell, 53, 949-961. USA, 86, and Abelson,J.N. (1989) Mol. Cell. Biol., 9, 3710-3719. Ruby,S.W. and Abelson,J. (1991) Trends Genet., 7, 79-85. Banroques,J. In Pringle,J. and Behrens,S.E. and Luhrmann,R. (1991) Genes Dev., 5, 1439-1452. Rymond,B.C. and Rosbash,M. (1992) Broach,J.R., the Yeast Behrens,S.E., Tyc,K., Kastner,B., Reichelt,J. and Luhrmann,R. (1993a) Jones,E.W. (eds), The Molecular and Cellular Biology of Cold Mol. Cell. Biol., 13, 307-319. Saccharomvces. Vol. 2, Cold Spring Harbor Laboratory Press, 143-192. Behrens,S.E., Galisson,F., Legrain,P. and Luhrmann,R. (1993b) Proc. Spring Harbor, NY, pp. Natl Acad. Sci. 11269- NatI Acad. Sci. USA, 90, 8229-8233. Sawa,H. and Abelson,J. (1992) Proc. USA, 89, Bennett,M. and Reed,R. (1993) Science, 262, 105-108. 11273. (1992) Genes Dev., 6, Genes 244-254. Bennett,M., Michaud,S., Kingston,J. and Reed,R. Sawa,H. and (1992) Dev., 6, Shimura,Y. and (1991) Nature, 349, 494-499. 1986-2000. Schwer,B. Guthrie,C. Behrens,S., Luhrmann,R. and Schwer,B. and Guthrie,C. (1992) EMBO J., 11, 5033-5039. Blencowe,B.J., Carmo-Fonseca,M., 105, 685-697. Shannon,K.W. and Guthrie,C. (1991) Genes Dev., 5, 773-785. Lamond,A. (1993) J. Cell Sci., Banroques,J., Abelson,J. and Guthrie,C. (1990) Genes Patton,J.G. and Nadal-Ginard,B. (1989) Bordonne,R., Smith,C.W.J., Porro,E.B., Dev., 4, 1185-1196. Nature, 342, 243-247. Hauri,H.P. and Kramer,A. (1993a) J. Biol. Chem., 268, Sontheimer,E.J. and Steitz,J.A. (1993) Science, 262, 1989-1996. Brosi,R., 17640-17646. Staknis,D. and Reed,R. (1994) Mol. Cell. Biol., 14, 2994-3005. Behrens,S.E., Luhrmann,R. and Kramer,A. (1993b) Strauss,E.J. and Guthrie,C. (1991) Genes Dev., 5, 629-641. Brosi,R., Groning,K., 262, 102-105. Tazi,J., Alibert,C., Temsamani,J., Reveillaud,I., Cathal,G., Brunel,C. and Science, Burgess,S., Couto,J.R. and Guthrie,C. (1990) Cell, 60, 705-717. Jeanteur,P. (1986) Cell, 47, 755-766. and Abelson,J. Genes Dev., 1, 1014-1027. Vijayraghavan,U. and Abelson,J. (1990) Mol. Cell. Biol., 10, 324-332. Cheng,S.C. (1987) Tamm,J., Parker,R. and Guthrie,C. (1987) Genes Dev., 1, Vijayraghavan,U., Company,M. and Abelson,J. (1989) Genes Dev., 3, Couto,J.R., 445-455. 1206-1216. Dalrymple,M.A., Petersen-Bjorn,S., Friesen,J.D. and Beggs,J.D. (1989) and Steitz,J.A. (1992) Science, 257, 1918-1925. Wassarman,D.A. (1991) Nucleic Acids Res., 19, 5483-5489. Cell, 58, 811-812. Whittaker,E. and Beggs,J.D. Cell, 75, 1061-1070. Dong,B., Horowitz,D.S., Kobayashi,R. and Krainer,A.R. (1993) Nucleic Wu,J.Y. and Maniatis,T. (1993) Sontheimer,E.J. and Steitz,J.A. (1992) Genes Dev., 6, Acids Res., 21, 4085-4092. Wyatt,J.R., Frank,D. and Guthrie,C. (1992) Genes Dev., 6, 2112-2124. 2542-2553. 12, Petersen-Bjorn,S. and Friesen,J.D. (1990) Mol. Cell. Biol., 10, Frank,D., Patterson,B. and Guthrie,C. (1992) Mol. Cell. Biol., Xu,Y, 5197-5205. 1217-1225. Mol. Cell. Biol., 11, 5571-5577. Garcfa-Blanco,M.A., Anderson,G.J., Beggs,J. and Sharp,P.A. (1990) Yean,S. and Lin,R. (1991) and (1989) Proc. Natl Acad. Sci. USA, 86, Proc. Natl Acad. Sci. USA, 87, 3082-3086. Zamore,P.D. Green,M.R. Gerke,V. and Steitz,J.A. (1986) Cell, 47, 973-984. 9243-9247. Grabowski,P.J. and Sharp,P.A. (1986) Science, 233, 1294-1299. and Abelson,J. (1993a) Genes Dev., 7, 320-329. 1994; revised on April 26, 1994 Horowitz,D.S. Received on March 17, and Abelson,J. (1993b) Mol. Cell. Biol., 13, 2959-2970. Horowitz,D.S. and (1993) Science, 262, 2035-2039. Kandels-Lewis,S. Seraphin,B. Konarska,M.M. and Sharp,P.A. (1986) Cell, 46, 845-855. Konarska,M.M. and Sharp,P.A. (1987) Cell, 49, 763-774. Krainer,A.R. and (1985) Cell, 42, 725-736. Maniatis,T. Krainer,A.R., Ruskin,B. and Green,M.R. (1984) Cell, 36, Maniatis,T., 993-1005. Lamm,G.M. and Lamond,A.I. (1993) Biochimn. Biophvs. Acta, 1173, 246-265. Lamond,A.I., Konarska,M.M. and Sharp,P. (1987) Genes Dev., 1, 532- Lamond,A.I., Konarska,M.M., Grabowski,P.J. and Sharp,P. (1988) Proc. Natl Acad. Sci. USA, 85, 411-415. Legrain,P. and Choulika,A. (1990) EMBO J., 9, 2775-2781. Lesser,C.F. and Guthrie,C. (1993) Science, 262, 1982-1988. and Abelson,J. Dev., 1, 7-18. Lin,R., Lustig,A.J. (1987) Genes Kastner,B. and Bach,M. (1990) Biochim. Biophvs. Acta, Luhrmann,R., 1087, 265-292. Krieg,P.A., Rebagliati,M.R., Maniatis,T., Zinn,K. and Melton,D.A., Nucleic Acids 7035-7056. Green,M.R. (1984) Res., 12, Michaud,S. and Reed,R. (1991) Genes Dev., 5, 2534-2546. Michaud,S. and Reed,R. (1993) Genes Dev., 7, 1008-1020. Moore,M.J., Query,C.C. and Sharp,P.A. (1993) In Gestland,R.F. and Atkins,J.F. (eds), RNA World. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 303-357. Morrissey,J.H. (1981) Anal. Biochem., 117, 307-310. O'Farrell,P.Z., Goodman,H.M. and O'Farrell,P.H. (1977) Cell, 12, 1133-1142. 535-542. and Medsger,T.A. (1991) J. Immunol., 146, Okano,Y. and 181-187. Patterson,B. Guthrie,C. (1991) Cell, 64, and Genes Patton,J.G., Mayer,S.A., Tempst,P. Nadal-Ginard,B. (1991) 1237-1251. Dev., 5, and Nadal-Ginard,B. Patton,J.G., Porro,E.B., Galceran,J., Tempst,P. Genes Dev., 7, 393-406. (1993) Mol. Beggs,J.D. and Friesen,J.D. (1989) Petersen-Bjorn,S., Soltyk,A., Cell. Biol., 9, 3698-3709. and 341- Pikeilny,C.W, Rymond,B.C. Rosbash,M. (1986) Nature, 324, and Steitz,J. Proc. Natl Acad. Sci. 8742-8746. Pinto,A.L. (1989) USA, 86, Genes 2113-2123. Reed,R. (1989) Dev., 3, Proc. Natl Acad. Sci. 8031-8035. Reed,R. (1990) USA, 87, http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

A novel set of spliceosome‐associated proteins and the essential splicing factor PSF bind stably to pre‐mRNA prior to catalytic step II of the splicing reaction.

Gozani, O.; Patton, J.G.; Reed, R.
The EMBO Journal , Volume 13 (14) – Jul 1, 1994
Download PDF
12 pages

Loading next page...
 
/lp/springer-journals/a-novel-set-of-spliceosome-associated-proteins-and-the-essential-1vnIsq2RRI

References (2)

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 1994
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1002/j.1460-2075.1994.tb06638.x
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal vol.13 no.14 pp.3356-3367, 1994 A novel set of spliceosome-associated proteins and the essential splicing factor PSF bind stably to pre- step 11 of the splicing mRNA prior to catalytic reaction complexes on a native gel, and most likely contains non- Or Gozani, James G.Patton" and snRNP RNA binding proteins, whereas the snRNPs remain Robin Reed2 associated with the lariat intron in a larger complex Department of Cell Biology, Harvard Medical School, Boston, MA (Konarska and Sharp, 1987; Lamond et al., 1987). Conver- 02115 and IDepartment of Molecular Biology, Vanderbilt University, sion of the B to the C complex, as well as conversion of Nashville, TN 37235, USA the splicing intermediates into the spliced products, 2Corresponding author ATP and Abelson, requires and incubation at 30°C (Cheng 1988; Reed Communicated by I.Mattaj 1987; Lin et al., 1987; Abmayr et al., et al., 1988). E complex contains U2AF35, U2AF65, We have isolated and determined the protein composi- Affinity-purified snRNP and several tion of the spliceosomal complex C. The pre-mRNA in Ul components, spliceosome- et this complex has undergone catalytic step I, but not associated proteins (SAPs) (Bennett al., 1992; D.Staknis, and unpublished observations). The step II, of the splicing reaction. We show that a novel M.Bennett R.Reed, associated with one set of 14 spliceosome-associated proteins (SAPs) and the 5' and 3' splice sites are functionally in E and this interaction be essential splicing factor PSF are specifically associated another the complex, may by Ul snRNP bound to the 5' splice site and with the C complex, implicating these proteins in mediated 3' site with SR catalytic step II. Significantly, immunodepletion and U2AF bound to the splice proteins bridging factors and Wu and Maniatis, biochemical complementation studies demonstrate these (Michaud Reed, 1993; for II. 1993). Although affinity-purified E complex lacks SR directly that PSF is essential catalytic step crosslink to et al., 1992), these proteins are bound Purified PSF is known to UV pyrimidine proteins (Bennett UV crosslinks to to in the functional gel filtration-purified E tracts, and our data show that PSF pre-mRNA in Thus, PSF may and B and R.Reed, unpublished pre-mRNA purified C complex. complexes (D.Staknis to 3' site factor U2AF65 which Ul U2AF35 and U2AF65 appear replace the splice binding observations). snRNP, the E to B assembly. Finally, be destabilized at some point during complex is destabilized during spliceosome 60 and which are in possibly as early as complex assembly we show that SAPs 90, present transition, Staknis and B and C are associated (Michaud and Reed, 1991, 1993; Reed, both the complexes, specifically are U2 snRNP and and thus have 1994). Ten new proteins, most of which with U4 U6 snRNPs, may important bound to the roles in the functioning of these snRNPs during the components, then become stably pre-mRNA Staknis and reaction. in the A complex (Bennett et al., 1992; Reed, splicing A the U2 snRNP UV words: complexes/splicing reaction 1994). subset of components Key spliceosomal in A and crosslink to pre-mRNA affinity-purified complex interactions between U2 snRNP and the may mediate pre- mRNA and (Staknis Reed, 1994). Introduction B contains U5 and U6 snRNAs The complex U2, U4, and Konarska and Pre-mRNA splicing takes place in a multi-component (Grabowski Sharp, 1986; Sharp, 1986, et 1986; Cheng and Abelson, 1987). complex designated the spliceosome. Spliceosomes 1987; Pikeilny al., in and four In this contains all of the proteins assemble on pre-mRNA a stepwise manner, addition, complex 12 five which assemble in the order E -* A present in the A complex plus additional proteins, discrete complexes, in the pathway of which are 20S U5 snRNP (Bennett et al., -o B -e C, are functional intermediates components and Lamm and 1992). One of the U5 snRNP proteins (200 kDa) UV (see for reviews Rymond Rosbash, 1992; 1 and 1993; Moore et al., 1993). The E and A com- crosslinks to exon adjacent to the 5' splice junction Lamond, interactions plexes are designated prespliceosomes, and the B and C may mediate U5 snRNA-pre-mRNA (Wyatt A to I of the are referred to as spliceosomes. The E, and et al., 1992). Prior catalytic step splicing complexes dissociates from the B complexes contain unspliced pre-mRNA, whereas the reaction, U4 snRNA spliceosome C contains the of I of the et and Abelson, 1987; Lamond complex products catalytic step (Pikeilny al., 1986; Cheng reaction 1 and lariat-exon The C complex et and is not for the catalytic steps splicing (exon 2). al., 1988) required is a short-lived intermediate due to the rapid conversion (Yean and Lin, 1991). In contrast, U6 snRNA, which of the splicing intermediates into the spliced products (the forms an essential base-pairing interaction with the 5' The mRNA in in ligated exons and lariat intron). spliced is splice site, is thought to be involved directly the of the reaction and turn rapidly released from the C complex, such that no catalytic steps (Sawa Abelson, 1992; discrete has been identified that Sawa and Wassarman and Steitz, 1992; spliceosomal complex Shimura, 1992; contains both the exons and the excised lariat Kandels-Lewis and Seraphin, 1993; Lesser and Guthrie, ligated intron. The spliced mRNA alone is detected in a complex Sontheimer and Steitz, 1993). Although proteins 1993; that much faster than any of the spliceosomal associated with U 1, U2 and U5 snRNAs have been migrates 33563 6© Oxford Press University SAPs and PSF bind stably to pre-mRNA Parental U UUCcGUjACUGUCCCUUUUUUUUCCACAG xAG UUCGIUGCUGAIC ICU!UUCCCUUUUUUUUCCUCUCUCUC uGG XAG Pare-ta' parental AAG 40 5 20- 40 s 20 10' 601 601 nu 2 40 60 5' 1 23' 40' - -C :U. "... w;? -B ANN EI ..i -A ! m .. .,. 7- -H 1. Accumulation of C on intron are the boxes and Fig. complex AAG pre-mRNA. (A) Structure of pre-mRNAs. The exons and represented by line, The 5' and 3' sites and are indicated. The nucleotide of 3' of the intron respectively. splice branchpoint sequence (BPS) sequence the is portion shown. The BPS is boxed A in and the additional residues in the are underlined. The (branch-site bQld) pyrimidine present AAG AG pre-mRNA dinucleotide in the was to in in time with or parental pre-mRNA changed GG AAG pre-mRNA (indicated course AAG bold). (B) Splicing parental pre-mRNAs. Parental or AAG were incubated under conditions p1 for the times and total RNA pre-mRNAs (20 ng) splicing (25 reaction) indicated, was fractionated on an 8% The bands denaturing polyacrylamide gel. corresponding to intermediates and spliced products are indicated. (C) Time course of or complex assembly on parental AAG pre-mRNAs. Parental or AAG pre-mRNAs (20 were incubated under conditions pl ng) splicing (25 reaction) for the times indicated and then were fractionated on a 4% The bands to complexes non-denaturing polyacrylamide gel. corresponding H, A, B and C complexes are indicated. The bracket indicates a band that was observed with the and This band only parental pre-mRNA at 40 60 min. most likely contains spliced mRNA. identified in purified spliceosomal ates with complexes (Bennett spliceosomes on density gradients (Smith et al., et al., 1992; Staknis and no and contains Reed, 1994), spliceosomal 1989) U2, U5 and U6 snRNAs and a large proteins have been identified that are associ- number of specifically unidentified proteins (Reed, 1990). ated with U4 or U6 snRNPs. In this we have study carried out a detailed characteriza- Under normal splicing the C is tion of affinity-purified C conditions, complex complex assembled on a pre- detected at low levels as a discrete band that migrates mRNA lacking the AG dinucleotide. We show that this more slowly than the A and B complexes on native gels complex contains all of the in proteins present the B et (Lamond al., 1987). To characterize the C complex, it complex, as well as an additional 14 novel SAPs. The has been to necessary find conditions that result in its essential splicing factor PSF is abundant in and UV accumulation. II Catalytic step of the splicing reaction crosslinks to pre-mRNA in the C complex. Moreover, can be blocked mild by heat treatment (Krainer and biochemical complementation of extracts PSF-depleted and the exon 1 and 2 Maniatis, 1985) lariat-exon that shows that PSF is essential for II of the catalytic step accumulate in this C can be chased reaction. complex into spliced splicing Finally, we have identified SAPs 60 and products (Reed et al., 1988). Heat treatment of nuclear 90 as the first U4/U6 snRNP-specific spliceosomal has not to be a reliable method proteins. extracts, however, proven for accumulating the C due to between complex variability extracts. Catalytic step II can also be blocked assem- by Results bling complexes on a pre-mRNA that lacks the AG dinucleotide at the 3' splice site, but contains a To accumulate the C complex, we employed a derivative long of AdML pyrimidine tract (Reed, 1989, 1990; Smith et al., 1989). pre-mRNA designated AAG pre-mRNA, that has a The complex assembled on such pre-mRNAs co-fraction- long, uninterrupted pyrimidine tract and a GG 3357 O.Gozani, J.G.Patton and R.Reed C complex (40') 50oo E E E 8- 3000. 2000 . 1000, 0o .1 A . 1 ? I 20 30 40 5060 70 60 fraction number fraction number fraction number was incubated under conditions Fig. 2. Analysis of spliceosome assembly on AAG pre-mRNA by gel filtration. AAG pre-mRNA (80 ng) splicing jl fractionated filtration. The B and C are (100 reaction) for the times indicated and then complexes were by gel peaks containing H, A, complexes another the extent indicated the native indicated; note that the A, B and C complexes are contaminated with one to by gel analysis (see H and the to the left of the B corresponding time points in Figure IC). The peak to the right of the complex contains degraded pre-mRNA peak A, of the column. or C complexes is the void volume 10U40 5:10O -0-kam4a W.". C=D--F--2D L*Z-::h iih4W 1lElS; : x ----~~~~-- .xci r El:U ~~~U 40, :J5_ 6 i~Js 4 z16_ 3 A assembled on AAG 3. The snRNA of AAG biotin was Fig. compositions spliceosomal complexes pre-mRNA. (A) pre-mRNA (1.92 ig) containing for the times were fractionated filtration and then under conditions ml incubated splicing (2.4 reaction) indicated, complexes by gel affinity-purified and Total RNA was 3' end-labeled with and then in mM salt to avidin Materials 250 by binding agarose (see methods). prepared, [32P]pCp Total RNA to is shown in lanes 1-3. The bands fractionated on an 8% denaturing polyacrylamide gel (lanes 4-6). prior end-labeling corresponding are indicated. X a band that fractionates below snRNA that is not seen in all nuclear to the and intermediates designates U1 snRNAs, pre-mRNA Total RNA from the E and C were 3' end-labeled with and then fractionated on a extracts and [32P]pCp (Michaud Reed, 1991, 1993). (B) complexes The of the Ul snRNA and the band X is shown. from lanes were 6% denaturing polyacrylamide gel. portion gel containing (C) Samples (A), 4-6, The of the exon 1 and U4 snRNA is shown. A of the fractionated on a 6% denaturing polyacrylamide gel. portion gel containing (D) long exposure lanes 4-6. The band below U6 snRNA to a band detected in lower portion of (A), may correspond previously affinity-purified spliceosomes Lamond et Total RNA was from 80 AAG assembled into the C and (Grabowski and Sharp, 1986; al., 1988). (E) prepared ng pre-mRNA complex fractionated on an 8% Bands were visualized ethidium bromide denaturing polyacrylamide gel. by staining. less substitution of the AG dinucleotide at the 3' terminus of assembly is reproducibly efficient than observed with In the intron (compare AAG and parental pre-mRNAs, Figure the parental pre-mRNA (Figure IC). contrast to the When AAG is in the C IA). pre-mRNA incubated splicing parental pre-mRNA, complex accumulates on the pre-mRNA and is the major complex detected at 40 the AAG extracts, splicing intermediates account for -50% of the total pre-mRNA detected at 40 and 60 min (Figure and 60 min IC, compare parental with AAG). We (Figure iB, AAG, 40', 60'). With the parental pre-mRNA, >50% conclude that the C complex, containing the products of conversion to the spliced products is detected at 60 min, catalytic step I (see Figure 1B, AAG, 40', 60'), accumulates on AAG In and only low levels of the splicing intermediates are pre-mRNA. the case of the parental pre- observed at the complexes are no longer detected earlier time points (Figure iB, parental). mRNA, spliceosomal of the reactions shown in Figure lB by non- at 60 Analysis min (Figure IC, parental), but a complex that shows fractionates faster than the H complex (designated by the denaturing gel electrophoresis that the A and B assemble on the AAG is detected and most complexes pre-mRNA, though bracket) likely contains spliced 3358 SAPs and PSF bind to stably pre-mRNA AAG 5 complex AAG 1 O'complex OH H[I OH 200) .... 49 ,- f.. 1 t 4 5 4 ;:, *s. -130 . 115 __ 1. 0 16 114 t 4 *- _72 x --- 7 2 - ---- 72 9'-~~2._ ~ ~~~~~~~~ ~~~~~,- 62 - 60 *. 62 , l ,: *_ "W. 4. 0 ff of 5 and assembled on Total was from 150 AAG Fig. 4. Protein composition 10 min spliceosomal complexes AAG pre-mRNA. protein prepared ng pre-mRNA in 5 or 10 and fractionated 2-D Proteins were detected present affinity-purified min spliceosomal complexes by gel electrophoresis. by silver The in the 5 and 10 are labeled to the nomenclature in Bennett et The A staining. proteins min complexes according al. (1992). complex proteins are labeled in both the 5 and 10 whereas the B are labeled in the 10 The min complexes complex-specific proteins min only complex. bracket indicates the heat-shock et proteins (Bennett al., 1992). mRNA released from the and The snRNA compositions of the 10 spliceosome (Konarska 5 and min complexes Sharp, Lamond et assembled on AAG pre-mRNA 1987; al., 1987). (Figure 3A, lanes 4 and The 40 min time was used to the 5) are similar to those observed point analyze composi- in the corresponding tion of the C To ensure complexes assembled on complex (Figure IC, AAG, 40'). normal pre-mRNAs (data not that the AG mutation did not result in of shown; Michaud and Reed, 1993). These assembly compositions aberrant complexes, we also the are consistent with the levels ofA and B analyzed compositions complex observed of complexes assembled for 5 and 10 min on this at these two times in Figure IC pre- (AAG). As expected, the mRNA (see Figure IC, AAG, 5', 10'). The A and but C complex (40 min) contains the B, same level of U2 snRNA not the C, complexes are detected at these times. For as observed in the 5 and 10 min complexes (Figure 3A, purification, complexes were assembled on lanes 4-6). The levels of U5 and U6 snRNAs are biotinylated higher filtration and then pre-mRNA, fractionated by gel in the C complex relative to the 5 and 10 min complexes affinity- in mM purified 250 salt (Bennett et We note (Figure 3A, lanes 4-6; see Figure 3D for a longer exposure al., 1992). same the same relative that we used the conditions (i.e. of the portion of the gel containing U6 snRNA). The amounts of nuclear extract and to lower levels of pre-mRNA) U5 and U6 snRNAs in the B (10 min) generate the filtration as were used to complex 3A and complexes analyzed by gel (Figure D) are due, at least in part, to on the native As from contamination with the A analyze complexes gels. complex (see Figure IC, AAG). expected previous work et Michaud and Analysis of the snRNAs in (Reed al., 1988; Reed, the C complex by ethidium the at all three time co-fractionate bromide shows that 1991), complexes points staining U2, U5 and U6 snRNAs are filtration due to the inherent about in this by gel (Figure 2; variability equimolar complex (Figure 3E). between different filtration the relative Ul snRNA is barely detected in the gel columns, only 5, 10 and 40 min elution positions of each complexes (Figure 3A, lanes peak can be compared). Thus, 4-6; the band below Ul the spliceosomal are contaminated snRNA, designated X, is a background band as shown in complexes with one another to the extents indicated the Figure 3B; Michaud and Reed, 1993). This is consistent by non-denaturing gel with work analysis (see For both the A previous showing that Ul snRNP is tightly Figure IC, AAG). example, bound in the E and B complexes are at 10 min ATP-independent complex and then present (Figure IC, AAG, but a becomes destabilized the E to B transition 10'), only single gel filtration peak containing during complex these Michaud and U4 complexes is detected (Figure 2, B (see Figure 3B; Reed, 1991, 1993). complex, 10'). snRNA is not detectable in the C Importantly for this study, the C complex detected at 40 readily complex by ethidium bromide see also min is contaminated at only a low level with the B staining (Figure 3E; Figure 3C, which resolves exon 1 from U4 snRNA in the C complex (Figure IC, AAG). complex). 3359 O.Gozani, J.G.Patton and R.Reed '_S t1 -' _E.. . _ r :4_ .: ........... : _ 111! 1E t1_ P' kF E ! .... :dF. -- -~~~~~~a s _ .. ;c , - i~~~~ , 1;eEz 4iP - - - - ~~~~~~~4 :: - i:i _:t g., 5 .z-:.'' , , .St. + *. ,s. }4_ |Ei 2% .,:!: .", :ij. i.i "1:4. :::.: ...IQk St B...::. 81e::: ...... _..Sg ss :: :.:: ..:..a:"s:_:.. W:. : : ::.^ . ... E!}.. .. ' WX'-t: :'': .............. ..... . : wss: e}a,s i: .} ; 11!^ 1te j ....I j S. Xw - %, *,.; j,j,,,: iL ^ oiZ .4 ,$wi _. - ....................... _ 'ki O '.,? .. * ak 4,:?. ;, t-. ., .. +.l 'Not... i' 5. Protein of the C and identification of U4/U6 snRNP MaS antiserum. C Fig. composition complex components using (A) Affinity-purified complex and assembled on 200 ng AAG pre-mRNA was fractionated by 2-D gel electrophoresis, proteins were detected by silver staining. The 14 novel in circles for while the four enriched in the C versus the B are SAPs the C complex are indicated by [see (B) SAP 165], proteins highly complex The are indicated A of a 2-D of C which shows SAPs 165 and 100 more The heat- boxed. heat-shock proteins (A). (B) portion gel complex clearly. shock are Proteins from filtration-isolated U4/U6 snRNPs MaS antiserum were proteins indicated (A). (C) immunoprecipitated gel using patient fractionated 2-D and were detected silver The this by gel electrophoresis proteins by staining. proteins specifically immunoprecipitated by antibody and that with C are indicated 90 and B and SnRNAs from specifically comigrate complex proteins (SAPs 60, B'). (D) immunoprecipitated gel filtration-isolated U4/U6 snRNPs MaS antiserum. B MaS The of the snRNAs and using patient B, complex. IP, immunoprecipitation. positions pre- mRNA are indicated. MaS antiserum alone of filtration fractions MaS antiserum or (E) (MaS), immunoprecipitation gel using (MaS IP) affinity- C mixed with the MaS IP + MaS were fractionated on 2-D B and B' and the in the of purified complex (C complex IP) gels. Only proteins vicinity in MaS IP SAPs 60 and 90 are labeled. The arrows the indicate that are in the MaS and not in the MaS panel proteins present immunoprecipitation the are as antiserum alone. The acidic and basic ends of gels indicated in (A). 3360 SAPs and PSF bind stably to pre-mRNA These data are consistent with that U4 (Bennett et al., 1992; Staknis and Reed, 1994). To deter- the observation snRNP dissociates at some point to I mine whether any of the SAPs in purified B or C complexes prior catalytic step (Pikeilny et al., 1986; Cheng and Abelson, 1987; Lamond correspond to U4/U6 snRNP proteins, we used the U4/ et al., 1988) and is no longer required for the splicing U6 snRNP-specific MaS antiserum (Okano and Medsger, reaction (Yean and Lin, 1991). Note that the levels of U4 1991) to immunoprecipitate this snRNP from gel filtration- and snRNA may be low in the 10 min complex due to its fractionated nuclear extract (see Materials methods). snRNAs contamination with the A complex (see Figure 3A, lanes As expected, U4 and U6 are immunoprecipitated 4-6 and C). by this antisera (Figure SD; Okano and Medsger, 1991; The protein composition of min The the 5 and 10 complexes Blencowe et al., 1993). immunoprecipitated proteins in of the unlabeled assembled on AAG pre-mRNA (Figure 4) is similar to are shown Figure SC. [Most proteins that observed in the B assembled on in the MaS are due to the previously complex immunoprecipitate antibody of the C with the MaS parental pre-mRNA (Bennett et al., 1992). As predicted (see below).] Comparison complex from the native gel analysis indicated that SAPs 60 and 90 and the (Figure lC, AAG, 5', 10'), immunoprecipitate there are higher levels of the B snRNP core B and B' are in common. To complex-specific proteins proteins at 10 min (B complex proteins are labeled in the 10 only determine whether these proteins precisely comigrate we min complex, Figure 4). No proteins other than those carried out a SE shows a mixing experiment. Figure detected in the B complex assembled on normal pre- of the bands that elute from comparison background the mRNAs are present in the 5 or 10 min complexes the MaS antiserum alone the resin containing (MaS), assembled on the AAG pre-mRNA. In addition, these S proteins present in the MaS of the immunoprecipitation and 10 min complexes do not appear to be lacking any U4/U6 snRNP-containing gel filtration fractions (MaS IP) of the proteins found in the corresponding complexes and a mixture of the MaS IP sample and the C complex assembled on normal pre-mRNAs. These data, together (MaS IP + C complex). These data reveal that SAPs 60 with the analysis of the snRNAs, indicate that the initial and 90 comigrate as no extra bands in the 60 and 90 kDa stages of spliceosome assembly occur normally on the and 90 region are detected. We conclude that SAPs 60 AAG pre-mRNA, despite the presence of the AG mutation. are associated with U4/U6 snRNAs. We were unable to identify conclusively additional Identification of C in and MaS complex-specific SAPs proteins common between the C complex the The protein composition of the C complex assembled on immunoprecipitate due to the complexity of the pattern. AAG pre-mRNA is shown in Figure SA. Comparison of The high background the of the also obscures region the 10 min B complex (Figure 4) with the C complex the 150 kDa MaS its gel containing antigen making revealed the presence of 14 new proteins in the C identification difficult. the MaS to Using antibody probe complex (indicated by circles, Figure 5A and B). These a Western blot of we were unable to detect spliceosomes, are designated SAPs 165, 100, 95, 76, 75, 70, 65, 58, 51, the 150 kDa MaS or other antigen any proteins (M.Bennett 48, 45, 38, 36 and 30. SAPs 165 and 100 are seen more and R.Reed, unpublished observation). The failure to clearly in Figure SB. In addition to the novel proteins that detect SAPs 60 and 90 with the MaS which is antiserum, bind in the C complex, the 40 kDa U5 snRNP protein polyclonal, indicates that these SAPs cannot be breakdown and SAPs 102, 68 and 57 (indicated by boxes) are present products of the 150 kDa MaS antigen. In previous work, at much higher relative levels in the C than in the B the MaS antisera were used to immunoprecipitate [35S]_ complex (e.g. compare the levels of SAPs 40 and 49, methionine-labeled proteins from HeLa whole cell 4 and Figures SA). To be consistent with our previous extracts. This study identified proteins of 150 (the MaS in which nomenclature, spliceosomal proteins are desig- antigen), 120, 80, 36 and 34 kDa (Okano and Medsger, nated to the in which according complex they are most 1991). Comparison of the 2-D gels containing the MaS SAPs and and abundant, 102, 68 57 the 40 kDa U5 snRNP IP (Figure SE, MaS IP) and the MaS antiserum alone protein, as well as the 14 novel SAPs, are designated C (Figure 5E, MaS) reveals several proteins that are spe- of cifically complex-specific proteins. None the these proteins were immunoprecipitated by the MaS antiserum (indic- detected when the was ated our affinity-purification procedure by arrows; estimated molecular weights from top carried out using the AAG pre-mRNA biotin to bottom for these are lacking (data proteins 130, 50, 45 and 34 kDa). not shown). In addition, analysis of the C complex on It is possible that some of these proteins correspond to higher percentage gels (12 and 15%) did not reveal any those detected previously by Okano and Medsger (1991). additional C complex-specific not For example, the 130 and 34 kDa proteins (data shown). proteins could correspond Finally, the C complex-specific proteins were detected to their 120 and 34 kDa proteins. However, our MaS IP reproducibly in >20 independent preparations of the C was from nuclear extract fractions whereas they used in complex and several different preparations of nuclear whole cell extracts. Thus, it is possible that some of extracts. However, as pointed out with SAPs 165 and 100 their proteins are not associated with U4/U6 snRNP in we find that resolution of some of the above, proteins the nucleus. varies on different 2-D gels. SAPs 102 and 68 to an correspond PSF and SAPs 60 and 90 are U41U6 snRNP breakdown of PSF proteins apparent product U2 and but not of a of the U1, U5, U4/U6, snRNP-specific proteins Comparison partially purified preparation (Bach et al., 1989; Okano and Medsger, 1991; Behrens essential splicing factor PSF (Patton et al., 1993) to et see Luhrmann et 1990 for a affinity-purified spliceosomes on a 2-D gel revealed that al., 1993a; al., review) have been detected in purified spliceosomal complexes SAPs 102 and 68 co-fractionate with PSF and its apparent 3361 O.Gozani, J.G.Patton and R.Reed PSF Io:;:mpiex preparatitc PS with F abs k3 .s.d estierl ....: *;. '. '- PSF '102 * w PSF 68 2-D of PSF Fig. 6. SAPs 102 and 68 correspond to the essential splicing factor PSF and its apparent breakdown product PSF*. (A) gel comparison 2-D Proteins were and spliceosomes. A partially purified preparation of PSF or affinity-purified B complex were fractionated by gel electrophoresis. Al and A2 indicated in the and the are indicated detected by silver staining. PSF, PSF*, hnRNPs I/PTB, are PSF preparation spliceosomal proteins in B Western The was fractionated on a 2-D transferred to nitrocellulose and with the complex. (B) analysis. C complex gel, probed polyclonal to of and the streaks above PSF antibodies to PSF. Spots corresponding to PSF (SAP 102) and PSF* (SAP 68) are indicated. The spot the left PSF* are not and are not detected The of the low molecular weight protein detected by the PSF antibody is not known. proteins reproducibly. identity PSF* PSF* is to complex also crosslink in the C complex (Figure 7A). breakdown product (Figure 6A). thought a breakdown of PSF because in Significantly, however, three additional proteins crosslink be product purified of PSF* accumulates over time whereas to pre-mRNA in the C complex. By superimposing the preparations PSF, As crosslinking and silver-stained patterns of the gel, we PSF diminishes (J.G.Patton, unpublished observation). shown hnRNP I/PTB and a 33 kDa identified these as the C complex components SAP 36, previously, protein in the PSF et and SAPs 102 and 68 (PSF and PSF*, respectively) are present preparation (Patton al., 1991, of the 33 kDa (Figure 7B). We note that, as observed previously, the 1993). Peptide sequence analysis protein indicates that it is hnRNP A (J.G.Patton, unpublished crosslinked proteins are shifted slightly above and to the show that the Consistent with our data acidic side of the silver-stained proteins (Figure 7B; observation). this, hnRNPs Al and A2 PSF contains Staknis and Reed, 1994). This shift is most likely due to purified preparation with hnRNP (based on a 2-D gel comparison purified the presence of the crosslinked RNase digestion product Further evidence that SAPs as the shift is complexes; data not shown). and, expected, larger with smaller proteins. to PSF and PSF* is the observation We detect no other likely candidates for these crosslinked 102 and 68 correspond to PSF detect SAPs 102 and proteins on our silver-stained 2-D gels (Figure 7B). that antibodies specifically 2-D Western blots of C the between 68 on affinity-purified complex Moreover, correspondence the crosslinked As noted SAPs 102 and 68 are and silver-stained was also seen on (Figure 6B). above, present proteins lower percent- in at relative levels which resolve the not the C complex significantly higher age gels proteins differently (data than in the B levels of these Consistent with our data that PSF complex (e.g. compare shown). indicating proteins in Figures 5A and 6A, B complex). We conclude crosslinks to this factor contains two RNA pre-mRNA, that PSF is specifically enriched in the C complex. binding domains, and the purified protein crosslinks spe- cifically to pyrimidine tracts in pre-mRNA (Patton UV crosslink to C complex-specific proteins pre- et al., 1993). mRNA As observed we find that the 200 kDa U5 PSF is for previously, required catalytic step 11 of the splicing snRNP et Whittaker and reaction protein (Garcia-Blanco al., 1990; Beggs, 1991; Wyatt et al., 1992; Staknis and Reed, 1994) It was thought previously that PSF was required for A and the U2 snRNP-specific SAPs 155, 145, 114, 62, 61 et This was based complex assembly (Patton al., 1993). and 49 and UV (Staknis Reed, 1994) crosslink to parental on the observation that A complex assembly was inefficient or AAG in B pre-mRNA affinity-purified complex (Figure in splicing extracts immunodepleted of PSF. However, 7A; 'x' is a non-specific protein that also crosslinks to analysis of splicing reactions in PSF-depleted extracts RNAs lacking splice sites; Staknis and Reed, 1994). The typically showed that catalytic step I still occurred (Patton same U2 and U5 snRNP proteins that crosslink in the B et al., 1993). This observation, together with our observa- 3362 PSF bind to pre-mRNA SAPs and stably A H OH- B OH- H+ .,,AG C comDlex B complex 0H- H- -AG complex parentai ..! *s F. AN ;1 / 2 .N IC,2 x x 49 49 C, crosslinked C complex proteins superlmposition silver stained C B complex proteins '>s _ * _ K ;KsXw _ $, t '"s4:... -r XS. ..-$4 ...4 N 1! .... . A. 'arw.,. -1 '-.. . < C. 7. SAPs 68 and 36 UV crosslink to pre-mRNA in the C complex. (A) Affinity-purified B complex assembled on parental pre-mRNA or B Fig. 102, and C complexes assembled on AAG pre-mRNA were UV crosslinked, treated with RNase and fractionated by 2-D gel electrophoresis (see Materials and methods). The crosslinked proteins were detected by phosphorimager analysis and identified as described in (B). Note that low levels of hnRNP C crosslink in the AAG B and C complexes; this protein crosslinks much more efficiently in the H complex and is most likely present in the C due to contamination with the H complex (Staknis and Reed, 1994). (B) A sample of affinity-purified C complex prepared as in (A) complex was fractionated on a 2-D gel, and silver-stained proteins (silver-stained C complex proteins) or crosslinked proteins (crosslinked C complex proteins) were detected. The crosslinked pattern superimposed on the silver-stained pattern is shown in the third panel (superimposition). The crosslinked proteins identified by the superimposition are indicated. SAP 115, which is better resolved in (B) than in (A), has only been found to crosslink on complexes assembled on AdmL pre-mRNA. The acidic and basic ends of the gels in (B) are the same as indicated in (A). tions PSF is enriched in the C complex II that specifically fully restores catalytic step activity to the PSF-depleted and also crosslinks in this us to re- complex, prompted extracts (Figure 8, lane 5). These results are seen best by evaluate the data extracts. Signific- the ratio of lariat-intron versus lariat-exon using PSF-depleted comparing 2, our data show that the levels of intermediates due to the of a breakdown of the antly, splicing presence product pre- 1 and lariat-exon in extracts are mRNA near the spliced mRNA (a darker exposure of the (exon 2) PSF-depleted in similar to the levels of in the normal of the is presented Figure spliced products top portion gel (lanes 2-5) data and the nuclear extract or in the mock-depleted extract (Figure 8, right panel). On the basis of these 8, is a block is enriched in and UV lanes 2-4). Notably, however, there complete observations that PSF specifically II extracts in the C we conclude that PSF is in catalytic step only with PSF-depleted (Figure crosslinks complex, fusion II of the reaction. The lane addition of a protein essential for catalytic step splicing 8, 4). Moreover, pET-PSF 3363 O.Gozani, J.G.Patton and R.Reed 62 and 114), and components of U1, U2 and U5 snRNPs (Bennett et al., 1992; Behrens et al., 1993a,b; Bennett and Reed, 1993; Brosi et al., 1993a,b; Staknis and Reed, 1994). In addition, all of the novel proteins detected in the purified complexes, designated SAPs, require splice sites and/or ATP for binding to pre-mRNA, and are thus ::;:.. .. ..::.:. ::Y,f:: likely to be essential for spliceosome assembly and/or the catalytic steps of the splicing reaction. I K -) 6 F. 1, , !'I 1.1 !.. ..: :.... -,! ... ::.,.. ,!z In mammals, no individual factors have been identified r !! . -, :.::-.:,.: C-1 j,... :. for catalytic step II, but not that are specifically required The existence of for step I, of the splicing reaction. A A is indicated complementation such factors by biochemical identified a heat-sensitive activity and a studies which fraction that were required for catalytic chromatographic and Maniatis, 1985). To identify candidates step II (Krainer factors, we have now carried out a detailed for such of C complex, a spliceosomal analysis affinity-purified I, '.N A; *. .. ., that has already undergone catalytic step I. A complex lacking the AG dinucleotide at the 3' splice pre-mRNA was used to accumulate the C complex; catalytic step site II is blocked with such mutants (Reed and Maniatis, 1985; Reed, 1989; Smith et al., 1989). It is not possible to assembled on normal pre- characterize the C complex II occurs so rapidly after mRNAs because catalytic step Signific- catalytic step I that little C complex accumulates. C assembled on AAG pre- antly, however, the complex to be similar to the C complex assembled mRNA appears This is based on the observation on normal pre-mRNAs. assembled on normal and mutant that the C complexes co-fractionate on native gels, as a complex pre-mRNAs with lower mobility than the B complex. In significantly A B complexes assembled on the addition, the and for II of the reaction. 8. PSF is required catalytic step splicing Fig. AAG have the same snRNA and protein pre-mRNA was incubated under 32P-labeled a-tropomyosin pre-mRNA splicing as the assembled on normal pre- indicated in or PSF- compositions complexes conditions for the times normal, mock-depleted nuclear extracts 1-4). Bacterially immunodepleted (APSF) (lanes mRNAs. our data indicate that spliceosome assembly Thus, was added to the PSF-depleted extracts synthesized PSF (pETPSF) the normally with the AAG pre-mRNA through proceeds RNA was from each sample and fractionated (lane 5). Total prepared of the AAG of C complex. The failure pre-mRNA stage an gel. The panel on the right is a on 8% denaturing polyacrylamide reaction could to undergo catalytic step II of the splicing of the of the gel (lanes 2-5). The bands darker exposure top portion that do not involve a to intermediates and products are indicated. The be due to the loss of interactions corresponding spliced band indicated by the arrow is a breakdown product of the pre-mRNA. such as interactions with major change in the C complex, with a few or transient factors, interactions just proteins work is in the with the previous probably explained a confornational change complex. discrepancy levels of PSF that are to the C complex are obvious the observation that higher Proteins unique by significantly to block for factors involved in catalytic step II of the antibodies were A complex assembly candidates required block II of the it is also possible that some than were required to catalytic step splicing splicing reaction. However, unpublished are involved in catalytic reaction (Patton et al., 1993; J.G.Patton, of the C complex-specific proteins it is that the PSF antibodies I. In this the would have to bind to the observation). Thus, possible step case, proteins A factor that has much lower affinity before and remain stably deplete an complex spliceosome immediately step I, antibodies or inactivate a factor bound after I. Such factors would not be detected in for the non-specifically step for A assembly. the B but could remain in the C complex. Our required complex complex, this of are unable to distinguish between type analyses for catalytic step II. first-step factor and factors required Discussion 14 SAPs in the C complex (SAPs We detected novel As an for identifying, characterizing and cloning 75, 70, 65, 58, 51, 48, 45, 38, 36 and approach 165, 100, 95, 76, factors for spliceosome assembly, we identified In we identified four proteins, previously required 30). addition, with the proteins that are stably associated detected in the B complex, that are highly enriched in the previously E and A and affinity-purified pre-spliceosomal complexes C These are the 40 kDa U5 snRNP protein and complex. B al., 1992; Bennett the spliceosomal complex (Bennett et SAPs 68 and 57. Our data show that SAPs 102 and 102, that are known to be, or and Reed, 1993). Several factors 68 correspond to the essential splicing factor PSF and are to for spliceosome assembly are likely be, essential its apparent breakdown product PSF*, respectively (see in the complexes. These factors include present purified below). We do not yet know whether any of the other C the three subunits of SF3a (SAPs 61, products of SAP U2AF65, U2AF35, complex-specific SAPs are breakdown 3364 and PSF bind to SAPs stably pre-mRNA 102 or other spliceosomal proteins. However, the apparent yeast (Patterson and Guthrie, 1991). Our data, together high complexity of the C complex is consistent with the with the observation that purified PSF binds pyrimidine fact that this complex migrates as a significantly larger tracts, are consistent with the possibility that PSF recog- particle than the B complex on native gels (Lamond nizes the pyrimidine tract for catalytic step II. et al., 1987). As suggested previously (Patton et al., 1993), it is SAP 57 is the most abundant protein detected in any possible that PSF corresponds to intron-binding protein of the spliceosomal complexes and appears to be present (IBP), a factor that associates with U5 snRNP (Gerke and at much greater than a 1:1 stoichiometry in purified C Steitz, 1986; Tazi et al., 1986). Similar to PSF and PSF* complex. Further studies are needed to understand the (SAPs 102 and 68, respectively), IBP is a 100 kDa protein, a is to its breakdown significance of this observation. The 40 kDa U5 snRNP and 70 kDa protein thought be protein is specifically enriched in the C complex, even product (Gerke and Steitz, 1986; Tazi et al., 1986; Pinto U5 snRNP in B and Steitz, 1989). Furthermore, IBP and PSF both bind though binds the complex. However, we have found that there is not, in general, a tight correlation to pyrimidine tracts in pre-mRNA (Gerke and Steitz, 1986; between the of U5 snRNA and Tazi et al., 1986; Patton et al., 1993). In addition, the presence proteins classified as U5 snRNP components (Bach et al., 1989) in the observation that IBP is associated with U5 snRNP is purified spliceosomal complexes. For example, U5 snRNA consistent with the late role in splicing observed for PSF. is detected at lower levels in the B than in the C complex, Although an association of PSF with U5 snRNP has not yet the levels of the 200 and 116 kDa U5 snRNP proteins been detected, this could be for a variety of reasons, are similar between these complexes. Similarly, the 200 including that the PSF epitope may not always be access- kDa protein is detected in the A complex when little U5 ible and that IBP may be associated with U5 snRNP only snRNA is present. Thus, although these proteins can be under certain conditions (Gerke and Steitz, 1986; Tazi detected in association with purified 20S U5 snRNP (Bach et al., 1986; Pinto and Steitz, 1989). In contrast to mammals, several factors involved in et al., 1989), it is possible that they bind to the spliceosome II at different times or with different stabilities than does catalytic step of the splicing reaction have been identified snRNP. in yeast [see Rymond and Rosbash (1992) for a review]. U5 These include SLU7 (Frank and Guthrie, 1992; Frank UV crosslinking studies of affinity-purified C complex showed that all of the same that crosslink in the etal., 1992) and PRPs 16 (Couto etal., 1987; Burgess etal., proteins B crosslink in the C These include six Schwer 17 complex complex. 1990; and Guthrie, 1991, 1992), (Vijayraghavan U2 snRNP 61 and proteins (SAPs 155, 145, 114, 62, 49) et al., 1989; Ruby and Abelson, 1991; Frank and Guthrie, and the 200 kDa snRNP and 1992; Frank et al., 1992), 18 (Vijayraghavan and Abelson, U5 protein (Staknis Reed, 1994). In contrast, PSF and PSF* (SAPs 102 and 68) and Horowitz and 1990; Abelson, 1993b) and 29 (Ruby and SAP 36 were identified as that crosslink in Abelson, 1991). As appears to occur with PSF, PRP18 proteins only the C complex, implicating a role for these proteins in can bind to spliceosomes that have undergone catalytic catalytic step II of the splicing reaction. step I (i.e. the C complex) (Horowitz and Abelson, 1993a). The observation that PSF crosslinks to pre-mRNA in In the case of PRP18, the C complex is formed in the the C complex is consistent with the fact that PSF has absence of functional PRP18 and the addition of PRP18 RNA in two recognition motifs; addition, purified PSF allows catalytic step II to occur (Horowitz and Abelson, crosslinks to the pyrimidine tract of pre-mRNAs (Patton 1993a). PRP1 8 is thought to be associated with U5 snRNP et al., 1993). U2AF65 (Zamore and Green, 1989) binds to (Horowitz and Abelson, 1993b). Thus, data in both yeast the in E in and snRNP pyrimidine tract the complex, but is detected mammals show that U5 proteins (e.g. the lower levels in B and C significantly affinity-purified A, mammalian 40 kDa U5 snRNP protein) can bind to pre- mRNA complexes (Staknis and Reed, 1994; this study). Thus, after U5 snRNP has bound. to E A U2AF65 appears be destabilized during the to Interestingly, antibodies to PRP18 detect a mammalian transition and It is not complex (Staknis Reed, 1994). protein, designated p54nrb, which bears a strong amino clear from these studies in acid to a of whether U2AF65 remains the similarity portion PSF (Dong et al., 1993). A complex in a more loosely bound state or dissociates Although there is no obvious similarity between PRP18 the observations that PSF crosslinks and at the amino acid level et completely. However, p54nrb (or PSF) (Dong al., in the C complex (this study) and crosslinks to pyrimidine 1993), the observations regarding PRP18, PSF, p54nrb, tracts (Patton et al., 1993) suggest that PSF could ulti- IBP and U5 snRNP raise the possibility that there may U2AF65 on the tract. This be some relationship between these splicing components. mately replace pyrimidine possibility is supported by the observation that PSF is Significantly, in both yeast and mammals, a pyrimidine for II of the reaction. tract required catalytic step splicing preceding the AG dinucleotide increases the effici- II Significantly, the pyrimidine tract appears to have at ency of catalytic step (Reed, 1989; Patterson and least two roles in the Smith The observation that PRP18 a splicing pathway (Reed, 1989; Guthrie, 1991). is U5 et This element is first for snRNP as for al., 1989). sequence required component suggests that, proposed PSF, most for U2AF in PRP18 could interact at the 3' splice site. spliceosome assembly, likely binding the E et Zamore and complex (Smith al., 1989; Green, Michaud and The tract is SAPs 60 and 90 are U4/U6 snRNP proteins 1989; Reed, 1993). pyrimidine of the AG A are associated then required again for efficient recognition large number of proteins that specifically II of the reaction with mammalian U5 snRNP or U4/U5/U6 snRNP dinucleotide during catalytic step splicing purified A for the tract in AG have been identified et Behrens and (Reed, 1989). role pyrimidine (Bach al., 1989; II has also been observed in In no recognition for catalytic step Luhrmann, 1991). contrast, snRNP-specific proteins 3365 O.Gozani, J.G.Patton and R.Reed incubation (data not shown). Native gel electrophoresis of splicing have been detected in purified U4/U6 snRNP (see Luhr- complexes was carried out as described (Konarska and Sharp, 1987), mann et al., 1990). However, a rare patient antiserum, except that 1 of 6.5 mg/ml heparin was added to 25 ,ul reactions, and git MaS, immunoprecipitates U4/U6 snRNAs from designated 10 pA of each reaction was fractionated on the gel. For purification of cell extracts (Okano and Medsger, 1991; Blencowe et al., complexes, splicing reactions (2.4 ml) containing 1.92 pre-mRNA gg 1993; this study). The MaS antigen is a 150 kDa protein, were incubated at 30°C for the times indicated. Gel filtration and affinity purification of splicing complexes were carried out as described (Bennett and four proteins (120, 80, 36 and 34 kDa) in addition to et al., 1992). For identification of spliceosomal snRNA composition, the core snRNP proteins are co-immunoprecipitated from total RNA was prepared from equivalent amounts of each affinity- extracts along with the 150 kDa MaS antigen (Okano cell purified complex and end-labeled with [32P]pCp and RNA ligase, as and Medsger, 1991). Substoichiometric amounts of the described (Reed, 1990). In UV crosslinking experiments, complexes bound to avidin agarose were immediately irradiated on ice with 254 MaS antigen can be detected in purified U2, U5 and U4/ nm UV light (Sylvania G15T8 lamp) for 5 min at a distance of 5.5 cm U5/U6 snRNPs, but this protein does not correspond to from the light source (Staknis and Reed, 1994). To digest the 32P- any of the snRNP-specific proteins identified previously labeled RNA after crosslinking, 1 10 mg/ml protease-free RNase A gl (Blencowe et al., 1993). (Pharmacia) was added per 10 ,ul of avidin agarose-bound splicing We used the MaS antiserum to immunoprecipitate U4/ complexes and incubated at 37°C for 30 min. Proteins were then eluted from the avidin beads and acetone-precipitated (Bennett et al., 1992). U6 snRNPs from nuclear extracts and were able to identify 2-D gel electrophoresis was carried out as described (O'Farrell et al., proteins in the immunoprecipitate that precisely co-frac- 1977; Bennett et al., 1992). The first dimension was non-equilibrium tionated with SAPs 60 and 90 and the snRNP core proteins pH gradient gel electrophoresis [NEPHGE, ampholytes pH 3-10 (Bio- B and B'. SAPs 60 and 90 were not detected by Western Rad)] and the second dimension was 9% SDS-PAGE. The total protein obtained from splicing complexes assembled on 200 ng of pre-mRNA analysis using the MaS antiserum. Thus, these data indicate was loaded on 2-D gels. Proteins were visualized by silver staining specifically associated with U4/ that SAPs 60 and 90 are (Morrissey, 1981), and crosslinked proteins were detected by Phos- detect the 150 kDa MaS U6 snRNPs. We were unable to phorimager analysis (Molecular Dynamics) and autoradiography. due to the complexity antigen in our purified complexes proteins. In addition, further Immunoprecipitation of U4/U6 snRNP of the high molecular weight Total nuclear extract (lacking pre-mRNA) was fractionated by gel whether there is a relationship work is needed to determine filtration, and fractions containing U4/U6 snRNP were pooled. MaS and the four proteins shown between SAPs 60 and 90 patient antiserum (7.5 ,ul) was coupled to an AminoLink gel column as by the MaS anti- previously to be co-immunoprecipitated described (Pierce ImmunoPure Ag/Ab Immobilization Kit). 100 of 1l 34 kDa). In yeast, several proteins serum (120, 80, 36 and column resin were removed and mixed overnight at 4°C with 30 ml of gel filtration fractions containing U4/U6 snRNP. After washing the snRNP, including PRPs 3 (Ruby associated with U4/U6 immunoprecipitate with 125 mM NaCl, 20 mM Tris, pH 7.6, total RNA 1991), 4 (Banroques and Abelson, 1989; and Abelson, was prepared, end-labeled with [32P]pCp and fractionated on an 8% al., 1989; Petersen-Bjorn et al., 1989; Dalrymple et denaturing polyacrylamide gel. Proteins were prepared and analyzed by 1990; Xu et al., 1990), 6 (Abovich et al., Bordonne et al., 2-D gel electrophoresis. As a marker for the antibody proteins, a sample of the antibodies bound to the AminoLink gel column was analyzed by Legrain and Choulika, 1990) and 24 (Shannon and 1990; 2-D gel electrophoresis. 1991; Strauss and Guthrie, 1991), have been Guthrie, identified as essential splicing factors. Our analysis has Western analysis, comparison of B complex and PSF, and identified SAPs 60 and 90 as the first mammalian U4/U6 immunodepletion snRNP proteins in the spliceosome. U4 and U6 snRNAs For Western blots, affinity-purified B complex assembled on 250 ng pre- mRNA was fractionated by 2-D gel electrophoresis, transferred to critical roles in the catalytic steps of splicing, and play nitrocellulose and probed with PSF polyclonal antibodies (Patton et al., SAPs 60 and 90 may be important factors involved in the 1993). Anti-rabbit secondary antibodies were horseradish peroxidase- functioning of these snRNAs. linked and the ECL detection system (Amersham) was used. For comparison of PSF and B complex, PSF was partially purified as described (Patton et al., 1993) and fractionated on a 2-D gel in parallel and methods Materials with affinity-purified B complex. Immunodepletion or mock depletion of nuclear extracts using PSF antibodies was carried out as described; Plasmids depletion of PSF was estimated to be -90% complete based on Western Plasmids pAdMLAAG and pAdMLPar were constructed by inserting an analysis (Patton et al., 1993). The pET-PSF fusion protein was purified oligonucleotide into the HindIll and PstI sites in pAdMLA3'ss (Michaud by affinity-chromatography on a nickel column. The amount needed for and Reed, 1993). The sequences of the 3' portions of the pre-mRNAs complement of the immunodepleted extracts was determined by titration encoded by these plasmids are shown in Figure 1. The pre-mRNAs (Patton et 1993). al., contain exon 1 (129 nucleotides), intron 1 (104 nucleotides in pAdMLAAG and 97 nucleotides in pAdMLPar) and exon 2 (45 nucleo- Acknowledgements unit. DNA tides) derived from the adenovirus 2 major late transcription for transcription and transcribed with T7 was linearized with BamHI We are indebted to Rebecca Feld for excellent technical assistance and RNA polymerase. are especially grateful to Maria Bennett for carrying out the 2-D gel comparison of PSF and the B complex. We thank members of our complex purification, end-labeling and UV Splicing 132PlpCp laboratory for useful discussions and comments on the manuscript. HeLa crosslinking cells for nuclear extracts were provided by the National Institutes of Capped biotinylated pre-mRNAs (Grabowski and Sharp, 1986) were Health cell culture facility at Endotronics (MN). R.R. is a Lucille reactions (Melton et al., 1984). For synthesized in standard transcription P.Markey Scholar. This work was supported by a grant from the Lucille UV transcription reactions (100 contained 50 ,Ci each crosslinking, P.Markey Charitable Trust and a grant from NIH. gl) (3000 Ci/mmol), 100 lM cold of [32P]ATP, [32P]GTP, and [32P]CTP ATP, GTP, CTP and UTP, and 15-20 ltM biotinylated UTP (Enzo Biochemicals). For all other transcriptions, reactions contained 10 gCi References (800 Ci/mmol), 200 tM cold GTP, CTP and UTP, and [32P]UTP ATP, Abmayr,S.M., Reed,R. and Maniatis,T. (1988) Proc. Acad. Sci. 15-20 ,uM biotinylated UTP. Assembly of splicing complexes and Natl USA, 85, 7216-7220. splicing reactions were carried out under standard in vitro splicing To accumulate maximal levels of C Abovich,N., Legrain,P. and Roshbash,M. (1990) Mol. Cell. Biol., 10, conditions (Krainer et al., 1984). we the levels of pre-mRNA and the time of complex, optimized AAG 6417-6425. 3366 SAPs and PSF bind to stably pre-mRNA and Luhrmann,R. (1989) Proc. Natl Acad. Sci. Reed,R. and Maniatis,T. (1985) Cell, 41, 95-105. Bach,M., Winkelman,G. 6038-6042. Reed,R., Griffith,J. and Maniatis,T. (1988) Cell, 53, 949-961. USA, 86, and Abelson,J.N. (1989) Mol. Cell. Biol., 9, 3710-3719. Ruby,S.W. and Abelson,J. (1991) Trends Genet., 7, 79-85. Banroques,J. In Pringle,J. and Behrens,S.E. and Luhrmann,R. (1991) Genes Dev., 5, 1439-1452. Rymond,B.C. and Rosbash,M. (1992) Broach,J.R., the Yeast Behrens,S.E., Tyc,K., Kastner,B., Reichelt,J. and Luhrmann,R. (1993a) Jones,E.W. (eds), The Molecular and Cellular Biology of Cold Mol. Cell. Biol., 13, 307-319. Saccharomvces. Vol. 2, Cold Spring Harbor Laboratory Press, 143-192. Behrens,S.E., Galisson,F., Legrain,P. and Luhrmann,R. (1993b) Proc. Spring Harbor, NY, pp. Natl Acad. Sci. 11269- NatI Acad. Sci. USA, 90, 8229-8233. Sawa,H. and Abelson,J. (1992) Proc. USA, 89, Bennett,M. and Reed,R. (1993) Science, 262, 105-108. 11273. (1992) Genes Dev., 6, Genes 244-254. Bennett,M., Michaud,S., Kingston,J. and Reed,R. Sawa,H. and (1992) Dev., 6, Shimura,Y. and (1991) Nature, 349, 494-499. 1986-2000. Schwer,B. Guthrie,C. Behrens,S., Luhrmann,R. and Schwer,B. and Guthrie,C. (1992) EMBO J., 11, 5033-5039. Blencowe,B.J., Carmo-Fonseca,M., 105, 685-697. Shannon,K.W. and Guthrie,C. (1991) Genes Dev., 5, 773-785. Lamond,A. (1993) J. Cell Sci., Banroques,J., Abelson,J. and Guthrie,C. (1990) Genes Patton,J.G. and Nadal-Ginard,B. (1989) Bordonne,R., Smith,C.W.J., Porro,E.B., Dev., 4, 1185-1196. Nature, 342, 243-247. Hauri,H.P. and Kramer,A. (1993a) J. Biol. Chem., 268, Sontheimer,E.J. and Steitz,J.A. (1993) Science, 262, 1989-1996. Brosi,R., 17640-17646. Staknis,D. and Reed,R. (1994) Mol. Cell. Biol., 14, 2994-3005. Behrens,S.E., Luhrmann,R. and Kramer,A. (1993b) Strauss,E.J. and Guthrie,C. (1991) Genes Dev., 5, 629-641. Brosi,R., Groning,K., 262, 102-105. Tazi,J., Alibert,C., Temsamani,J., Reveillaud,I., Cathal,G., Brunel,C. and Science, Burgess,S., Couto,J.R. and Guthrie,C. (1990) Cell, 60, 705-717. Jeanteur,P. (1986) Cell, 47, 755-766. and Abelson,J. Genes Dev., 1, 1014-1027. Vijayraghavan,U. and Abelson,J. (1990) Mol. Cell. Biol., 10, 324-332. Cheng,S.C. (1987) Tamm,J., Parker,R. and Guthrie,C. (1987) Genes Dev., 1, Vijayraghavan,U., Company,M. and Abelson,J. (1989) Genes Dev., 3, Couto,J.R., 445-455. 1206-1216. Dalrymple,M.A., Petersen-Bjorn,S., Friesen,J.D. and Beggs,J.D. (1989) and Steitz,J.A. (1992) Science, 257, 1918-1925. Wassarman,D.A. (1991) Nucleic Acids Res., 19, 5483-5489. Cell, 58, 811-812. Whittaker,E. and Beggs,J.D. Cell, 75, 1061-1070. Dong,B., Horowitz,D.S., Kobayashi,R. and Krainer,A.R. (1993) Nucleic Wu,J.Y. and Maniatis,T. (1993) Sontheimer,E.J. and Steitz,J.A. (1992) Genes Dev., 6, Acids Res., 21, 4085-4092. Wyatt,J.R., Frank,D. and Guthrie,C. (1992) Genes Dev., 6, 2112-2124. 2542-2553. 12, Petersen-Bjorn,S. and Friesen,J.D. (1990) Mol. Cell. Biol., 10, Frank,D., Patterson,B. and Guthrie,C. (1992) Mol. Cell. Biol., Xu,Y, 5197-5205. 1217-1225. Mol. Cell. Biol., 11, 5571-5577. Garcfa-Blanco,M.A., Anderson,G.J., Beggs,J. and Sharp,P.A. (1990) Yean,S. and Lin,R. (1991) and (1989) Proc. Natl Acad. Sci. USA, 86, Proc. Natl Acad. Sci. USA, 87, 3082-3086. Zamore,P.D. Green,M.R. Gerke,V. and Steitz,J.A. (1986) Cell, 47, 973-984. 9243-9247. Grabowski,P.J. and Sharp,P.A. (1986) Science, 233, 1294-1299. and Abelson,J. (1993a) Genes Dev., 7, 320-329. 1994; revised on April 26, 1994 Horowitz,D.S. Received on March 17, and Abelson,J. (1993b) Mol. Cell. Biol., 13, 2959-2970. Horowitz,D.S. and (1993) Science, 262, 2035-2039. Kandels-Lewis,S. Seraphin,B. Konarska,M.M. and Sharp,P.A. (1986) Cell, 46, 845-855. Konarska,M.M. and Sharp,P.A. (1987) Cell, 49, 763-774. Krainer,A.R. and (1985) Cell, 42, 725-736. Maniatis,T. Krainer,A.R., Ruskin,B. and Green,M.R. (1984) Cell, 36, Maniatis,T., 993-1005. Lamm,G.M. and Lamond,A.I. (1993) Biochimn. Biophvs. Acta, 1173, 246-265. Lamond,A.I., Konarska,M.M. and Sharp,P. (1987) Genes Dev., 1, 532- Lamond,A.I., Konarska,M.M., Grabowski,P.J. and Sharp,P. (1988) Proc. Natl Acad. Sci. USA, 85, 411-415. Legrain,P. and Choulika,A. (1990) EMBO J., 9, 2775-2781. Lesser,C.F. and Guthrie,C. (1993) Science, 262, 1982-1988. and Abelson,J. Dev., 1, 7-18. Lin,R., Lustig,A.J. (1987) Genes Kastner,B. and Bach,M. (1990) Biochim. Biophvs. Acta, Luhrmann,R., 1087, 265-292. Krieg,P.A., Rebagliati,M.R., Maniatis,T., Zinn,K. and Melton,D.A., Nucleic Acids 7035-7056. Green,M.R. (1984) Res., 12, Michaud,S. and Reed,R. (1991) Genes Dev., 5, 2534-2546. Michaud,S. and Reed,R. (1993) Genes Dev., 7, 1008-1020. Moore,M.J., Query,C.C. and Sharp,P.A. (1993) In Gestland,R.F. and Atkins,J.F. (eds), RNA World. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 303-357. Morrissey,J.H. (1981) Anal. Biochem., 117, 307-310. O'Farrell,P.Z., Goodman,H.M. and O'Farrell,P.H. (1977) Cell, 12, 1133-1142. 535-542. and Medsger,T.A. (1991) J. Immunol., 146, Okano,Y. and 181-187. Patterson,B. Guthrie,C. (1991) Cell, 64, and Genes Patton,J.G., Mayer,S.A., Tempst,P. Nadal-Ginard,B. (1991) 1237-1251. Dev., 5, and Nadal-Ginard,B. Patton,J.G., Porro,E.B., Galceran,J., Tempst,P. Genes Dev., 7, 393-406. (1993) Mol. Beggs,J.D. and Friesen,J.D. (1989) Petersen-Bjorn,S., Soltyk,A., Cell. Biol., 9, 3698-3709. and 341- Pikeilny,C.W, Rymond,B.C. Rosbash,M. (1986) Nature, 324, and Steitz,J. Proc. Natl Acad. Sci. 8742-8746. Pinto,A.L. (1989) USA, 86, Genes 2113-2123. Reed,R. (1989) Dev., 3, Proc. Natl Acad. Sci. 8031-8035. Reed,R. (1990) USA, 87,

Journal

The EMBO Journal – Springer Journals

Published: Jul 1, 1994

There are no references for this article.