Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Mutations in the cytoplasmic domain of P0 reveal a role for PKC-mediated phosphorylation in adhesion and myelination

Mutations in the cytoplasmic domain of P0 reveal a role for PKC-mediated phosphorylation in... JCB Article Mutations in the cytoplasmic domain of P0 reveal a role for PKC-mediated phosphorylation in adhesion and myelination 1 1 1 2 3 3 3 Wenbo Xu, Michael Shy, John Kamholz, Lisa Elferink, Gang Xu, Jack Lilien, and Janne Balsamo Department of Neurology and the Center for Molecular Medicine and Genetics, Wayne State University Detroit, MI 48202 Biomedical Marine Institute and Department of Biophysics and Physiology, Galveston, TX 77555 Department of Biological Sciences, The University of Iowa, Iowa City, IA 52242 utations in P0 (MPZ), the major myelin protein of inhibition of PKC activity abolishes P0-mediated adhesion. the peripheral nervous system, cause the inherited Point mutations in the RSTK target site that abolish adhesion Mdemyelinating neuropathy Charcot-Marie-Tooth do not alter the association of PKC with P0; however, deletion disease type 1B. P0 is a member of the immunoglobulin of a 14 amino acid region, which includes the RSTK motif, superfamily and functions as a homophilic adhesion does abolish the association. Thus, the interaction of PKC molecule. We now show that point mutations in the cyto- with the cytoplasmic domain of P0 is independent of specific plasmic domain that modify a PKC target motif (RSTK) or target residues but is dependent on a nearby sequence. We an adjacent serine residue abolish P0 adhesion function conclude that PKC-mediated phosphorylation of specific and can cause peripheral neuropathy in humans. Consistent residues within the cytoplasmic domain of P0 is necessary with these data, PKC along with the PKC binding protein for P0-mediated adhesion, and alteration of this process RACK1 are immunoprecipitated with wild-type P0, and can cause demyelinating neuropathy in humans. Introduction Myelin is a multilamellar structure that surrounds axons phy, and sensory loss (for review see Nelis et al., 1999; in both the central nervous system and the peripheral Shy et al., 2001). nervous system (PNS),* facilitating nerve conduction. P0, P0 functions as a homophilic adhesion molecule in vitro a transmembrane protein of the Ig superfamily, is the (Filbin et al., 1990; Filbin and Tennekoon, 1993), and this major myelin structural protein in the PNS, expressed activity may mediate compaction of adjacent leaflets in pe- exclusively by myelinating Schwann cells and necessary for ripheral nerve myelin. Analysis of the crystal structure of normal myelin structure and function. In mice, the absence the P0 extracellular domain indicates that P0 molecules of P0 (Giese et al., 1992; Martini et al., 1995) or overex- have the potential to interact in cis to form homotetra- pression of P0 (Wrabetz et al., 2000) results in hypomyelin- mers, and these interact in trans to mediate homophilic ad- ation and peripheral neuropathy. In addition, mutations hesion (Shapiro et al., 1996). Consistent with this model, in the human P0 gene cause the demyelinating peripheral mutation of several of the amino acid residues critical for neuropathy Charcot-Marie-Tooth disease 1B, the more these putative cis and trans interactions can cause the severe Dejerine-Sottas syndrome, and congenital hypo- inherited demyelinating peripheral neuropathy, CMT1B myelination, all associated with muscle weakness, atro- (Warner et al., 1996; Nelis et al., 1999). The cytoplasmic domain of P0 is also important for its function, and mutations in this region result in loss of P0- Address correspondence to Jack Lilien, Dept. of Biological Sciences, The mediated homophilic adhesion in vitro (Wong and Filbin, University of Iowa, 138 Biology Bldg., Iowa City, IA 52242-1324. Tel.: 1994). Coexpression of both wild-type and cytoplasmically (319) 353-2969. Fax: (319) 335-0081. E-mail: [email protected] truncated P0 causes loss of wild-type function, presumably W. Xu’s present address is Dept. of Neurology, University of Michigan, due to a dominant negative effect of the truncated molecule Ann Arbor, MI 48105. (Wong and Filbin, 1996). Mutations within the P0 cyto- *Abbreviations used in this paper: HPRT, hypoxanthine phosphoribosyl plasmic domain are also found in patients with inherited de- transferase; PNS, peripheral nervous system; PVDF, polyvinylene difluo- ride; RACK, receptor for activated C kinase; RT, reverse transcription. myelinating neuropathies, some of which have very severe Key words: P0; adhesion; myelination; PKC; RACK1 clinical phenotypes (Nelis et al., 1999; Shy et al., 2001).  The Rockefeller University Press, 0021-9525/2001/10/439/7 $5.00 The Journal of Cell Biology, Volume 155, Number 3, October 29, 2001 439–445 http://www.jcb.org/cgi/doi/10.1083/jcb.200107114 439 440 The Journal of Cell Biology | Volume 155, Number 3, 2001 ropathy in humans. This is the first glimpse of the molecular machinery that regulates the function of P0 in myelination. Results A subterminal 13 amino acid sequence in the cytoplasmic domain of P0 is essential for adhesion To define the regions of the cytoplasmic domain of P0 that are essential for homophilic adhesion, we stably transfected mouse L cells and HeLa cells with cDNAs encoding wild- type P0 or P0 deletion mutants lacking the COOH-termi- nal 13 (13), 28 (28), 43 (43), or 59 amino acids (59). Expression of the transfected P0 constructs was determined by reverse transcription (RT)-PCR using specific primers for each construct and by Western blotting. RT-PCR reveals that all constructs were expressed in relatively equal amounts in both cell types (Fig. 1 B shows L cells). To ensure that protein was expressed and inserted in the plasma membrane, we labeled live cells with a membrane impermeable biotin- ylation reagent followed by immunoprecipitation with anti- Figure 1. Expression of full-length P0 and P0 deletion mutants in P0 antibody. The immunoprecipitated material was fraction- transfected L cells. (A) Diagram of P0 cDNA showing the relative ated by SDS-PAGE, transferred to polyvinylene difluoride positions of the primers used to clone full-length and mutant P0. (PVDF) membranes, and probed with HRP-streptavidin. The same 5 primer (P0WT5) was used in all cases. The 3 primers Each of the P0 constructs is expressed at the cell surface (Fig. were designed to allow the cDNAs to be inserted in frame with the 1 C shows L cells). flag sequence in the pCMV-Tag4 vector. SP, signal sequence; EC, extracellular domain; TM, transmembrane domain; IC, intracellular Cells expressing each of the deletion mutants were assayed domain. (B) P0 mRNA is expressed in L cells transfected with the P0 for their ability to form homophilic adhesions as measured constructs as determined by RT-PCR using the specific primers by binding of single cells expressing P0 constructs to a con- shown in A. Primers specific to the enzyme HPRT were used to fluent layer of cells expressing wild-type P0. Both L cells and compare expression levels between cell lines. Numbers to the right HeLa cells expressing 13 were comparable to the same cell of the figure represent the migration of molecular markers. (C) Full- types expressing wild-type P0 (Fig. 2, A and B). However, length and mutant P0s are expressed at the cell surface in trans- fected L cells. Cell membrane proteins were labeled with biotin, P0-mediated adhesion was reduced dramatically in all cell and P0 was precipitated with an anti-P0 antibody. The immunopre- lines with deletions of 28 amino acids or greater (Fig. 2, A cipitates were fractionated by SDS-PAGE, transferred to PVDF mem- and B). This suggests that the sequence between amino acids branes, and probed with HRP-streptavidin. WT, full-length P0; 13, 193 and 206 is essential for P0-mediated cell–cell adhesion. 28, 43, and 59, P0 constructs lacking the terminal 13, 28, 43, This region contains three serine residues that are phosphor- or 59 amino acids, respectively; Vect, L cells transfected with empty ylated in mouse sciatic nerve: S197, S199, and S204 (Hilmi vector. Numbers to the left of the figure represent the migration of molecular markers. et al., 1995). These residues are conserved in the human P0 sequence. Furthermore, serine 199 is part of a PKC recogni- tion motif (198-RSTK-201) (Kishimoto et al., 1985; These data demonstrate a critical role for the cytoplasmic do- Woodgett et al., 1986), suggesting that phosphorylation me- main of P0 in mediating homophilic adhesion and in the mo- diated by PKC is critical to P0 adhesive function. lecular pathogenesis of inherited demyelinating neuropathies. Since it has been reported that expression of P0 in HeLa We now demonstrate that deletion of a 14 amino acid se- cells results in upregulation of cadherin expression (Doyle et quence in the cytoplasmic domain of P0 abolishes adhesive al., 1995), we were careful to perform all P0 adhesion assays in function. Point mutations in this region that alter a PKC the absence of Ca , which is necessary for cadherin-mediated substrate motif (RSTK) and mutation of an adjacent serine adhesion. Additionally, we examined both HeLa and L cells residue (S204) are critical to P0 adhesive function. More- bearing each of the P0 deletion constructs for cadherin expres- over, PKC and the receptor for activated C kinase sion using a pan cadherin antibody to blot equivalent amounts (RACK1) are coimmunoprecipitated from cells expressing of cell lysate. In agreement with the previous observations, wild-type P0 but not P0 bearing a deletion of 14 amino acid cadherin and the cadherin-associated protein -catenin are up- sequence. In addition, inhibition of PKC activity results in regulated in HeLa cells stably transfected with pCMV Tag4 loss of P0-mediated adhesion. We have also identified a mu- containing the full-length wild-type P0 but not in L cells simi- tation of the initial arginine of the PKC substrate motif to a larly transfected (unpublished data). Furthermore, among serine residue (R198S) in a patient with CMT1B, and we HeLa cells upregulation requires the same region of the mole- find that cells expressing P0 bearing this mutation fail to cule that is essential for adhesion function, amino acids 193– form homophilic adhesions. These data indicate that PKC- 206 (unpublished data). The two cell lines do differ in their mediated phosphorylation is an important component of basal level of cadherin expression: HeLa cells express a small the regulation of P0-mediated adhesion and demonstrate amount of cadherin, whereas L cells do not express detectable that alteration of this process can cause demyelinating neu- levels of cadherin. Thus, upregulation of cadherin expression PKC and P0 adhesion | Xu et al. 441 and in serine 204 (S204A) for their ability to form ho- mophilic P0 adhesions. In addition, we assayed cells bearing a mutation at serine 197 (S197A), a site of low level in vivo phosphorylation (Hilmi et al., 1995), aspartic acid 195 (D195A), and tyrosine 191 (Y191A) as controls. Stable cell lines were created and tested for P0 expression by RT-PCR and immunoprecipitation of cell surface labeled P0 as above. All constructs were expressed at the cell surface (unpublished data). Cells expressing P0 mutated at serine sites 199 or 204 or threonine 200 failed to form P0-mediated adhesions (Fig. 3 A), indicating that both the PKC motif and serine residue 204 are functionally important. In contrast to these muta- tions, substitution of serine 197 or aspartic acid 195 have lit- tle or no effect (Fig. 3 A). Furthermore, replacement of tyro- sine 191, a site shown recently to be phosphorylated in vivo (Xu et al., 2000a) with alanine, also has little or no effect on P0-mediated adhesion (Fig. 3 A). To further examine the importance of the PKC function in P0-mediated adhesion, we tested the effect of the PKC in- hibitor, calphostin C (Tamaoki and Nakano, 1990; Svetlov and Nigam, 1993). Calphostin C inhibits P0-mediated ad- hesion in a dose-dependent manner with maximum inhibi- tion at 60 nM (Fig. 3 B). At this concentration (60 nM), calphostin has no detectable effect on cell viability as mea- sured by Sytox green (Molecular Probes). Mutation within the RSTK domain (R198S) causes the demyelinating peripheral neuropathy CMT1B and loss of P0 homophilic adhesion We have identified an individual with CMT1B who is het- erozygous for a P0 mutation producing a substitution of argi- nine for serine at amino acid 198 (R198S) within the PKC binding motif. The patient had normal growth, development, and motor function until 5 yr ago, in his late 30s, when he noted the onset of lower extremity clumsiness; however, these symptoms have not progressed notably since that time. On neurological examination, he had minimal symmetrical foot dorsiflexor weakness, a mild decrease in both large and small fi- Figure 2. Identification of a region in the cytoplasmic domain of ber sensory modalities (vibration and pin prick) in his feet, and P0 that is essential for P0-mediated adhesion. (A) L cells stably expressing full-length or truncated P0 were labeled with a vital diminished Achilles and patellar deep tendon reflexes. His gait fluorescent dye and assayed for adhesion to monolayers of L cells appeared normal, but he was unable to walk on his heels, con- expressing full-length P0. Adherent cells were determined by mea- firming the mild weakness of the foot dorsiflexors. In addition, suring the amount of fluorescence associated with the cell layers. he had bilateral pes cavus, a common finding in patients with Adhesion of L cells bearing full-length P0 was considered 100% and inherited neuropathy, probably caused by weakness of the in- used to calculate adhesion of the other lines. Each cell type was trinsic muscles of the feet. On electrophysiological testing, the assayed in triplicate. (B) HeLa cells stably expressing full-length or truncated P0 were assayed for adhesion as described in A. WT, full- nerve conduction velocities of peroneal and tibial motor nerves length P0; 13, 28, 43, 59, P0 bearing deletions of the terminal were slowed bilaterally to 25 m/s, whereas his right sural sen- 13, 28, 43, and 59 amino acids, respectively; Vect, L cells trans- sory NCV was slowed to 28 m/s. The left sural potential was fected with empty vector. Bars represent the standard deviation unobtainable. These neurological signs and symptoms and elec- from the mean (p  0.0001). trophysiological findings are consistent with the presence of a mild demyelinating sensory and motor peripheral neuropathy. in the presence of P0 is not universal and may depend on a To determine if this mutation affected P0 homophilic ad- basal level of cadherin expression and P0 adhesive function or hesion, we transfected L cells with P0 bearing this mutation. signaling mediated by the cytoplasmic domain. Expression was assayed as above and was found approxi- mately equivalent to other P0 constructs in L cells (unpub- A PKC target motif and PKC activity are essential for lished data). These cells showed a much reduced ability to P0-mediated adhesion form P0 homophilic adhesions (Fig. 3 C). Thus, elimination To investigate the importance of the RSTK motif and the of PKC target residues or alteration of the PKC target motif adjacent serine, we assayed L cells transfected with P0 con- not only abolishes P0 adhesive function in vitro but also taining mutations in the RSTK motif (S199A and T200A) causes demyelinating disease in humans. 442 The Journal of Cell Biology | Volume 155, Number 3, 2001 Table I. PKC expression in mouse sciatic nerve Isoform Expression Isoform Expression Conventional Novel Atypical PKC and the PKC binding protein RACK1 are associated with P0 in situ The functional requirement for the PKC target motif in P0 and its importance to human disease led us to determine which of the many isoforms of PKC is present in sciatic nerve. We find that two conventional PKCs,  and , are detected, as well as the novel isoforms , , and (Table I). All of these isoforms are also detected in P0-transfected L cells (Fig. 4, none). However, P0 immunoprecipitates from L cells lysed in neutral detergent reveal that only PKC is present in association with P0 (Fig. 4). Furthermore, PKC is present and associated with P0 in cultured Schwann cells (Fig. 4, SC). We further probed P0 immunoprecipitates derived from each of our deletion mutants for the association of PKC and the PKC binding protein RACK1. RACKs bind acti- vated PKC at a site distinct from the substrate-binding site (Mochly-Rosen et al., 1991) and are thought to target the enzyme to specific cellular sites independent of PKC sub- strate recognition (Sim and Scott, 1999; for reviewed see Jaken and Parker, 2000). As can be seen in Fig. 5, deletion of the same 14 amino acid sequence containing the RSTK motif that is essential for P0-mediated adhesion eliminates the association of PKC and RACK1 with P0 (Fig. 5, com- pare 13 with 28 and 59). However, point mutations al- tering the RSTK substrate recognition motif or the adjacent serine 204, mutations that do eliminate P0-mediated adhe- sion, do not alter PKC or RACK1 binding. Thus, substrate recognition by PKC and binding, presumably mediated by RACK1, are two independent events occurring through dis- tinct sites within a 14 amino acid domain of P0. Discussion In this study, we present data correlating specific amino acid residues in the cytoplasmic domain of P0 with adhesion func- tion and ultimately with human disease. By creating a series of deletions in the cytoplasmic domain, we find that the region between amino acids 193 and 206 is essential for P0-mediated adhesion. This region contains a PKC substrate motif (RSTK) that is one of two major sites of in situ phosphorylation on Figure 3. A PKC target motif and the adjacent serine 204 is essen- tial for P0-mediated cell adhesion and myelination. (A) Full-length P0 constructs bearing point mutations at the indicated amino acids adhesion. L cells expressing full-length P0 were assayed for adhe- were prepared by PCR and transfected into L cells. Stable clones of sion in the presence of increasing concentrations of calphostin. cells expressing each P0 mutant were selected and assayed for P0- Adhesion in the absence of the inhibitor was considered 100%. mediated adhesion as described in the legend to Fig. 2. Adhesion is Each cell type was assayed in triplicate. (C) A point mutation in the expressed as percent of control, with the control being adhesion of PKC target motif results in human disease and loss of P0-mediated L cells expressing full-length P0. Each cell type was assayed in tripli- adhesion in transfected L cells. Stable clones of L cells expressing cate. WT, cell expressing full-length P0. Mutant cell lines are the R198S P0 mutant were assayed for P0-mediated adhesion as indicated by the specific point mutation. Vect, cell transfected with above. Adhesion is represented as percent of control. Bars represent empty vector. (B) Inhibition of PKC activity prevents P0-mediated the standard deviation from the mean (p  0.0001). PKC and P0 adhesion | Xu et al. 443 Figure 4. PKC coimmunoprecipitates specifically with P0 from Schwann cells and L cells expressing full-length P0. Confluent cultures of Schwann cells (SC), L cells expressing full-length P0 Figure 6. Diagram showing human mutations found in the (P0wt), and L cells transfected with empty vector (Vect) were lysed cytoplasmic domain of P0 and the corresponding syndrome. The in nonionic detergent. 1 ml of each cleared cell lysate was immu- site and type of mutation are indicated. (1) Y152 to Stop; (2) noprecipitated with anti-P0 antibody (P0), and equal aliquots of nucleotide deletion; (3) 17 nucleotide insertion; (4) Q186 to Stop; resuspended precipitates were fractionated by SDS-PAGE, trans- (5) nucleotide insertion; (6) nucleotide insertion; (7) R198 to S; ferred to PVDF, and probed with antibody to the PKC isoform (8) four nucleotide deletions including S204. The amino acid indicated. 20 l of each cell lysate, before immunoprecipitation, sequences deleted to create the several P0 truncated mutants used was also fractionated by SDS-PAGE, transferred to PVDF, and blot- in Fig. 1 are represented as alternating blocks of red and blue. The ted with the indicated antibody (lanes labeled none). Numbers to amino acids that prove to be essential for P0-mediated adhesion are the left indicate the migration of prestained standards. Bands due to shown in black, and the point mutations that have no effect are PKC and Ig heavy chain are indicated at the right. shown in green. serine residues (serine 199) (Hilmi et al., 1995). Using site- solutely correlated. Furthermore, the association of both pro- directed mutagenesis, we demonstrate that this motif is im- teins with P0 is dependent on a 14 amino acid sequence in the portant for adhesive function. A second serine residue at posi- cytoplasmic domain, amino acids 193–206. This is the same tion 204, closely juxtaposed to the RSTK site, is also critical region containing the PKC substrate motif; however, the sub- for adhesion function, and this residue is also phosphorylated strate site and the binding site are distinct, since point muta- in the sciatic nerve (Hilmi et al., 1995). Another serine (197) tions in the substrate site that eliminate adhesion function do that is phosphorylated in situ (Hilmi et al., 1995) does not ap- not eliminate binding of PKC or RACK1. RACK1 is one pear to be necessary for adhesion function, nor is a tyrosine member of a group of proteins that bind PKC at a site distinct residue in the cytoplasmic domain, Y191, which is also phos- from the substrate-binding site (Mochly-Rosen et al., 1991; phorylated in sciatic nerve (Iyer et al., 1996). Sim and Scott, 1999; for review see Jaken and Parker, 2000). Of the PKC isoforms present in sciatic nerve and our L cell We suggest that RACK1 binds activated PKC and interacts model, PKC is specifically immunoprecipitated with P0, in- with P0 either directly or through an additional adaptor to dicating an in situ association between the two molecules. bring activated PKC into substrate proximity. This interaction may be mediated by RACK1, the receptor PKC has been implicated previously in phosphorylation of for activated C kinase, since we find that under our experi- P0 in vitro (Suzuki et al., 1990; Rowe-Rendleman and Eich- mental conditions the association of these two proteins is ab- berg, 1994) and tumor promoters that activate PKC accentu- ate phosphorylation in situ (Agrawal and Agrawal, 1989). Most pertinent to our identification of PKC as the critical isoform, abolition of phorbol 12,13 dibutyrate–induced up- regulation of PKC in sciatic nerve is accompanied by a re- duction in PKC (Rowe-Rendleman and Eichberg, 1994). However, these prior studies were not able to correlate the PKC-dependent phosphorylation of P0 with a specific func- tion. Our data indicate for the first time that PKC-mediated phosphorylation on serine residues is important for P0 adhesion function: P0-mediated adhesion is abolished by mutations of a PKC target motif, PKC and the adaptor RACK1 are immu- Figure 5. A 14 amino acid sequence in the cytoplasmic domain of P0 is essential for its association with PKC and the PKC binding noprecipitated with wild-type P0, and P0-mediated adhesion is protein RACK1. L cells expressing wild-type P0 (WT) or P0 with decreased dramatically by calphostin C, a kinase inhibitor that point mutations or progressive truncations of its cytoplasmic preferentially blocks PKC activity (IC for PKC  50 nM). domain were lysed in neutral detergent and immunoprecipitated There are two possible mechanisms by which phosphory- with anti-P0 antibody (P0) or preimmune serum (Co). The precipi- lation of the cytoplasmic domain of P0 may regulate adhe- tates were fractionated by SDS-PAGE and transferred to PVDF. The sion and/or myelination. One is a direct mechanism in membranes were cut at the 55 kD marker and the top half probed with anti-PKC antibody, whereas the bottom half was probed with which phosphorylation of P0 alters its conformation, allow- anti-RACK1 monoclonal antibody. Cell line indicates L cells trans- ing the cis or trans interactions required for adhesion (Sha- fected with empty vector (Vec), wild-type P0 (WT), P0 lacking the piro et al., 1996). The second is an indirect mechanism in 13 COOH-terminal amino acids (13), P0 lacking the 28 COOH- which phosphorylation of P0 allows or facilitates the bind- terminal amino acids (28), P0 lacking the 59 COOH-terminal ing of effector or adaptor molecules essential for adhesion. amino acids (59), P0 bearing a S197A mutation (S197), P0 bearing a S199A mutation (S199), or P0 bearing a S204A mutation (S204). In either case, dynamic changes in the phosphorylation state 444 The Journal of Cell Biology | Volume 155, Number 3, 2001 fied on immobilized peptide and recognizes an 27 KD P0 molecule in of P0 would have significant effects on P0-mediated adhe- the rat sciatic nerve (unpublished data). Antipan cadherin antibody is from sion and/or myelination. Further experiments will clearly be Sigma-Aldrich. Antibodies to PKC isoforms and RACK1 were from Trans- required to distinguish between these two possibilities. duction Laboratories. HRP-conjugated anti–mouse or –rabbit IgG were Our deletion and mutational analysis are consistent with from Cappel Laboratories (ICN Biomedicals). The secondary antibodies conjugated to magnetic beads used in immunoprecipitations were ob- some of the mutations known to give rise to human neuropa- tained from PerSeptive Biosystems. thies. There are no known human mutations in the COOH- terminal 13 amino acids that give rise to pathology (Fig. 6); Cloning the wild-type P0 and creating a series of mutated the single amino acid change identified in this region P0 constructs The coding sequences of full-length wild-type P0 (P0WT) and P0 COOH- (R215L) appears to have no physiological ramifications (Ne- terminal deletion mutants were cloned into the pCMV-Tag4 expression lis et al., 1999). Accordingly, we find that deletion of this en- vector (Stratagene) using a PCR-based technique. These various mutants tire region has no effect on adhesion. Five human mutations contain deletions at the COOH terminus of the P0 cytoplasmic domain causing neuropathy produce a shift in the reading frame, and lacking the last 13 (13), 28 (28), 43 (43), or 59 (59) amino acids. All constructs were created using the same forward primer (P0WT5, ATAG- two result in introduction of a stop codon, all altering or de- GATCCCACCATGGCTCCTGGGGCTC), containing a BamHI restriction leting the PKC target site and/or serine 204. One of the site and a Kozak consensus sequence. The reverse 3 primers were de- frame shifts leaves the RSTK motif intact but deletes serine signed to contain overlapping DNA sequence according to the position of the deletion followed by a stop codon and a XhoI restriction site (Fig. 1 A): 204. This mutation gives rise to a severe form of CMT1, em- P0WT3, ATACTCGAGTTTCTTATCCTTGCGAGAC; 13flag, ATACTC- phasizing the importance of this residue. In addition, we have GAGGTCGTCCTCGCCAC; 28flag, ATACTCGAGATACAGCACTGGC- identified a patient with CMT1B in which an arginine resi- GTCT; 43flag, ATACTCGAGAGACTTGTGAAATTTCCCCT; and 59flag, due has been changed to a serine within this PKC target mo- ATACTCGAGGGCAGCCTGCCTGCGCAG. All constructs were cloned into pCMV-Tag4 and tested by restriction tif (RSTK→SSTK), potentially eliminating the ability of enzyme cleavage and sequenced to ensure that the insertions were in PKC to phosphorylate residues critical to adhesive function frame and that no mutations were introduced during PCR. (Fig. 6). Indeed, mimicking this mutation in our in vitro as- say abolishes P0 homophilic adhesion. Thus, these data im- Site-directed mutagenesis Recombinant PCR was used to introduce point mutations in the P0 cyto- plicate PKC-mediated phosphorylation of the cytoplasmic plasmic domain substituting the natural amino acids with alanine residues. domain of P0 in both the regulation of homophilic adhesion The oligonucleotide primers for point mutations were as follows. The un- and myelination. Consistent with this possibility, mutations derlined bases indicate the changes from the naturally occurring nucle- in a dual specificity phosphatase, myotubularin-related pro- -AGACCCCAGTGCTGGCTGCCAT-3; reverse otides: forward Y191A, 5 -TGGTCCAGCATGGCAGCCAGCACT-3; forward D195A, 5- Y191A, 5 tein-2, cause an autosomal recessive form of demyelinating CACAGCCGAA-3; reverse D195A, 5-TGCTTCGGCT- TGCTGGCC CMT, called CMT4B (Bolino et al., 2000). Although it is CAGCA-3; forward S197A, 5-CTGGACCACGCTCGAAGCAC- GTGGGC not yet known whether myotubularin-related protein-2 ; reverse S197A, 5-AGCTTTGGTGCTTCGAGCGTGGT-3; for- CAAA-3 -CTGGACCACAGCCGAGCTACCAAA-3; reverse S199A, cleaves phosphate groups on P0, these results clearly demon- ward S199A, 5 -AGCTTTGGTAGCTCGGCTGTGGT-3; forward T200A, 5-CACAGC- strate that a phosphorylation/dephosphorylation cascade AAAGCT-3; reverse T200A, 5-TGGCAGCTTTGGCGCT- CGAAGCGCC plays a role in the regulation of normal PNS myelination. GAGAA-3; TCGGCT-3; forward S204A, 5-AAGCACCAAAGCTGCCGCT Given the central role that P0 plays in myelination, it is TT-3. and reverse S204A, 5-ATTTCTTCTCAGCGGCAGC All mutant constructs were confirmed by sequencing. The constructs likely that other components interact with the cytoplasmic were named Y191A, D195A, S197A, S199A, T200A, S204A, and R198, domain to further regulate the process of myelination. Thus, respectively. P0 mutations that may have profound effects on the process of myelination independent of its adhesive function will ren- Transfection of L and HeLa cells All of the constructs and pCMV-Tag4 without inserts (Vect) were trans- der incomplete any correlation between adhesion itself and fected into mouse L cells. WTP0, 13, 28, 43, 59, and Vect were also severity of disease. Recent work from our group emphasizes transfected into HeLa cells. Stable cell lines were selected for 2 wk in the this point, since the expression of P0 has dramatic effects on presence of 1 mg/ml and maintained in the presence of 200 g/ml of G418 the levels of expression of other myelin proteins important (GIBCO BRL). Single clones were isolated and expanded. Clones of cells expressing high levels of transfected proteins as determined by immuno- for myelination (Xu et al., 2000b). Additionally, the possi- blotting with anti-P0 serum were chosen for adhesion assays. bility that tyrosine 191 plays a role independent of adhesive function is suggested by the fact that mutation has no effect RT-PCR on adhesion, yet the array of polypeptides precipitated with Expression of transfected constructs was assayed by RT-PCR. In brief, total anti-P0 antibody is altered by its phosphorylation (Xu et al., RNA was isolated from cultured cells using a QIAGEN kit and reverse tran- scribed with Superscript II and oligo dT primers (GIBCO BRL). The result- 2000a). We expect that a full accounting of the molecular ing cDNA was used to amplify the transfected construct using the same machinery associated with the cytoplasmic domain of P0 primers that were used for cloning. For RT-PCR, the hypoxanthine phos- will reveal many more effectors and adaptors as is the case phoribosyl transferase (HPRT) cDNA was used as an internal control. The two primers for HPRT amplification were: forward primer, 5-CACAG- for the cytoplasmic domains of other Ig superfamily adhe- GACTAGAACACCTGC-3, and reverse primer, 5-GCTGGTGAAAAG- sion molecules (for review see Crossin and Krushel, 2000) GACCTCT-3. and for cadherin (Vleminckx and Kemler, 1999) and inte- grin (Aplin et al., 1998) adhesion molecules. Expression of transfected cDNAs To analyze protein expression of the transfected cDNAs and determine plasma membrane localization, cell surface molecules were labeled by bio- tinylation of intact cells followed by immunoprecipitation. Confluent cell lay- Materials and methods ers in 100-mm dishes were rinsed free of serum and labeled with 0.1 mg/ml Antibodies freshly prepared NHS-LC-biotin (Pierce Chemical Co.) in cold PBS for 30 Polyclonal anti-P0 was prepared using a synthetic peptide specific to a 12 min. After washing and quenching, cell lysates were prepared using 1 ml of amino acid fragment (TWRYQPEGGRDA) from the extracellular domain of lysis buffer (1.5% NP-40, 0.15 M NaCl, 10 mM Tris, pH 7.2, 5 mM EDTA, 1 rat P0 as immunogen (Bio-Synthesis Inc.). The antiserum was affinity puri- mM PMSF, 100 g/ml protease inhibitor cocktail [Sigma-Aldrich], and 100 PKC and P0 adhesion | Xu et al. 445 g/ml DNase) per 100-mm plate, cleared by centrifugation at 14,000 g for 5 Role of P0 protein as a homophilic adhesion molecule. Nature. 344:871– min, and the supernatant immunoprecipitated with anti-P0 antibody. The im- 872. munoprecipitated proteins were separated by SDS-PAGE, transferred to PVDF Giese, K.P., R. Martini, G. Lemke, P. Soriano, and M. Schachner. 1992. Mouse membrane, and biotinylated proteins were detected with HRP-streptavidin. P0 gene disruption leads to hypomyelination, abnormal expression of recog- nition molecules, and degeneration of myelin and axons. Cell. 17:565–576. Immunoprecipitation and Western blotting Hilmi, S., M. Fournier, H. Valeins, J.C. Gandar, and J. Bonnet. 1995. Myelin P0 To analyze the expression of PKC isoforms in sciatic nerve, equal weights glycoprotein: identification of the site phosphorylated in vitro and in vivo by of mouse sciatic nerve were solubilized in 4% SDS, fractionated by SDS- endogenous protein kinases. J. Neurochem. 64:902–907. PAGE, and transferred to PVDF membranes. The membranes were probed Iyer, S., C.L. Rowe-Rendleman, R. Bianchi, and J. Eichberg. 1996. Tyrosine phos- with the indicated anti-PKC isoform antibody followed by HRP-conjugated phorylation of myelin protein P0. J. Neurosci. Res. 46:531–539. anti–mouse IgG and visualized using the extended duration HRP substrate Jaken, S., and P.J. Parker. 2000. Protein kinase C binding partners. Bioessays. 22: (Pierce Chemical Co.). For L cells transfected with wild-type P0, cultures 245–254. were grown to confluence on 100-mm plates, washed, and incubated free Kishimoto, A., K. Nishiyama, H. Nakanishi, Y. Uratsuji, H. Nomura, Y. of serum for 2 h before lysis as indicated above. An aliquot of the lysate Takeyama, and Y. Nishizuka. 1985. Studies on the phosphorylation of my- was fractionated by SDS-PAGE and immunoblotted with antibodies to the elin basic protein by protein kinase C and adenosine 3:5-monophosphate- PKC isoforms detected in sciatic nerve. The remaining lysate was preincu- dependent protein kinase. J. Biol. Chem. 260:12492–12499. bated with preimmune rabbit serum followed by goat anti–rabbit magnetic Martini, R., J. Zielasek, K.V. Toyka, K.P. Giese, and M. Schachner. 1995. Protein beads. The beads were discarded, and the cleared supernatant was incu- zero (P0)-deficient mice show myelin degeneration in peripheral nerves bated with anti-P0 antibody. The immunoprecipitated P0 and associated characteristic of inherited human neuropathies. Nat. Genet. 11:281–286. molecules were then fractionated by SDS-PAGE, transferred to PVDF, and Mochly-Rosen, D., H. Khaner, and J. Lopez. 1991. Identification of intracellular probed with anti-PKC and anti-RACK1 antibodies. The immunoblots were processed as described above. receptor proteins for activated protein kinase C. Proc. Natl. Acad. Sci. USA. 88:3997–4000. Adhesion assays Nelis, E., H. Neva, and C. Van Broeckhoven. 1999. Mutations in the peripheral Cell layers were washed free of serum, harvested using 0.1% trypsin myelin genes and associated genes in inherited peripheral neuropathies. Hu- (GIBCO BRL) in PBS buffer, and resuspended in serum-free medium (DME) man Mutation. 13:11–28. cells/ml. 2 l/ml of fluorogenic dye containing 10 mM EDTA at 5  10 Rowe-Rendleman, C.L., and J. Eichberg. 1994. P0 phosphorylation in nerves from calcein acetoxymethyl ester (calcein AM) (Molecular Probes) were added normal and diabetic rats: role of protein kinase C and turnover of phosphate to the cell suspensions and incubated at 37C for 30 min. After two groups. Neurochem. Res. 19:1023–1031. single calcein-labeled cells were added to prepared mi- washes, 5  10 Shapiro, L., J.P. Doyle, P. Hensley, D.R. Coleman, and W.A. Hendrickson. 1996. croplate wells containing confluent monolayers of cells expressing wild- Crystal structure of the extracellular domain from P0, the major structural type P0 or BSA-coated wells as controls. After 1 h incubation at 37C, the protein of peripheral nerve myelin. Neuron. 17:435–449 nonadherent calcein-labeled cells were removed by carefully washing sev- Sim, A.T.R., and J.D. Scott. 1999. Targeting of PKA, PKC and protein phos- eral times with DME containing 10 mM EDTA until the BSA-coated wells phatases to cellular microdomains. Cell Cal. 26:209–217. had no cells left. The number of cells adhering to the monolayer was mea- Shy, M.E., J. Balsamo, J. Lilien, and J. Kamholz. 2001. A molecular basis for he- sured with a molecular device microplate reader equipped with a fluores- reditary motor and sensory neuropathy disorders. Curr. Neurol. Neurosci. cein filter set at 494 nm. Rep. 1:77–88. To determine the importance of the PKC motif in the P0 sequence, Suzuki, M., Y. Sakamoto, K. Kitamura, K. Fukunaga, H. Yamamoto, E. Miya- calphostin C (Calbiochem) was used to specifically inhibit PKC. Wild-type moto, and K. Uyemura. 1990. Phosphorylation of Po glycoprotein in pe- P0-transfected cells were preincubated with increasing concentrations of ripheral nerve myelin. J. Neurochem. 55:1966–1971. calphostin C for 1 h and then assayed for adhesion as described above. Svetlov, S., and S. Nigam. 1993. Calphostin C, a specific protein kinase C inhibi- tor, activates human neutrophils: effect on phospholipase A2 and aggrega- We wish to express our appreciation to Athena Diagnostics (Worcester, tion. Biochim. Biophys. Acta. 1177:75–78. MA) for referring the new CMT1B patient to us, and to Beth Hjertos for Tamaoki, T., and H. Nakano. 1990. Potent and specific inhibitors of protein ki- help with transfection and culture of cells expressing mutant forms of P0. nase C of microbial origin. Biotech. 8:732–735. This research was supported by a grant from the National Multiple Scle- Vleminckx, K., and R. Kemler. 1999. Cadherins and tissue formation integrating rosis Society to J. Kamholz and M. Shy. adhesion and signaling. Bioessays. 21:211–220. Submitted: 26 July 2001 Warner, L.E., M.J. Hilz, S.H. Appel, J.M. Killian, E.H. Kolodry, G. Karpati, S. Revised: 14 September 2001 Carpenter, G.V. Watters, C. Wheeler, D. Witt, et al. 1996. Clinical pheno- Accepted: 21 September 2001 types of different MPZ (P0) mutations may include Charcot-Marie-Tooth type 1B, Dejerine-Sottas, and congenital hypomyelination. Neuron. 17:451– References Wong, M.-H., and M.T. Filbin. 1994. The cytoplasmic domain of the myelin Po Agrawal, H.C., and D. Agrawal. 1989. Tumor promoters accentuate phosphoryla- protein influences the adhesive interactions of its extracellular domain. J. tion of P0: evidence for the presence of protein kinase C in purified PNS Cell Biol. 126:1089–1097. myelin. Neurochem. Res. 14:409–413. Wong, M.-H., and M.T. Filbin. 1996. Dominant negative effect on adhesion by Aplin, A.E., A. Howe, S.K. Alahari, and R.L. Juliano. 1998. Signal transduction myelin Po protein truncated in its cytoplasmic domain. J. Cell Biol. 134: and signal modulation by cell adhesion receptors: the role of integrins, cad- 1531–1541. herins, immunoglobulin-cell adhesion molecules, and selectins. Pharm. Rev. Woodgett, J.R., K.L. Gould, and T. Hunter. 1986. Substrate specificity of protein 5:197–263. kinase C. Use of synthetic peptides corresponding to physiological sites as Bolino, A., M. Muglia, F.L. Conforti, E. LeGuern, M.A. Salih, D.M. Georgiou, K. probes for substrate recognition requirements. Eur. J. Biochem. 161:177– Christodoulou, I. Hausmanowa-Petrusewicz, P. Mandich, A. Schenone, et 184. al. 2000. Charcot-Marie-Tooth type 4B is caused by mutations in the gene Wrabetz, L., M.L. Feltri, A. Quattrini, D. Imperiale, D. Previtali, M. D’Antonio, encoding myotubularin-related protein-2. Nat. Genet. 25:17–20. X. Yin, B.D. Trapp, L. Zhou, S.Y. Chiu, et al. 2000. P(0) glycoprotein over- Crossin, K.L., and L.A. Krushel. 2000. Cellular signaling by neural cell adhesion expression causes congenital hypomyelination of peripheral nerves. J. Cell molecules of the immunoglobulin superfamily. Develop. Dyn. 218:260–279. Biol. 148:1021–1034. Doyle, J.P., J.G. Stempak, P. Cowin, D.R. Colman, and D. D’Urso. 1995. Protein Xu, M., R. Zhao, X. Sui, F. Xu, and Z.J. Zhao. 2000a. Tyrosine phosphorylation zero, a nervous system adhesion molecule, triggers epithelial reversion in of myelin P0 and its implication in signal transduction. Biochem. Biophys. host carcinoma cells. J. Cell Biol. 131:465–482. Res Commun. 267:820–825. Filbin, M.T., and G.I. Tennekoon. 1993. Homophilic adhesion of the myelin P0 Xu, W., D. Manichella, H. Jiang, J.M. Vallat, J. Lilien, P. Baron, G. Scarlato, J. protein requires glycosylation of both molecules in the homophilic pair. J. Kamholz, and M.E. Shy. 2000b. Absence of P0 leads to dysregulation of Cell Biol. 122:451–459. myelin gene expression and myelin morphogenesis. J. Neurosci. Res. 60:714– Filbin, M.T., F.S. Walsh, B.D. Trapp, J.A. Pizzey, and G.I. Tennekoon. 1990. 724. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The Journal of Cell Biology Pubmed Central

Mutations in the cytoplasmic domain of P0 reveal a role for PKC-mediated phosphorylation in adhesion and myelination

Xu, Wenbo; Shy, Michael; Kamholz, John; Elferink, Lisa; Xu, Gang; Lilien, Jack; Balsamo, Janne
The Journal of Cell Biology , Volume 155 (3) – Oct 29, 2001
Download PDF
7 pages

Loading next page...
 
/lp/pubmed-central/mutations-in-the-cytoplasmic-domain-of-p0-reveal-a-role-for-pkc-2cYmxzDWVO

References (30)

Publisher
Pubmed Central
Copyright
Copyright © 2001, The Rockefeller University Press
ISSN
0021-9525
eISSN
1540-8140
DOI
10.1083/jcb.200107114
Publisher site
See Article on Publisher Site

Abstract

JCB Article Mutations in the cytoplasmic domain of P0 reveal a role for PKC-mediated phosphorylation in adhesion and myelination 1 1 1 2 3 3 3 Wenbo Xu, Michael Shy, John Kamholz, Lisa Elferink, Gang Xu, Jack Lilien, and Janne Balsamo Department of Neurology and the Center for Molecular Medicine and Genetics, Wayne State University Detroit, MI 48202 Biomedical Marine Institute and Department of Biophysics and Physiology, Galveston, TX 77555 Department of Biological Sciences, The University of Iowa, Iowa City, IA 52242 utations in P0 (MPZ), the major myelin protein of inhibition of PKC activity abolishes P0-mediated adhesion. the peripheral nervous system, cause the inherited Point mutations in the RSTK target site that abolish adhesion Mdemyelinating neuropathy Charcot-Marie-Tooth do not alter the association of PKC with P0; however, deletion disease type 1B. P0 is a member of the immunoglobulin of a 14 amino acid region, which includes the RSTK motif, superfamily and functions as a homophilic adhesion does abolish the association. Thus, the interaction of PKC molecule. We now show that point mutations in the cyto- with the cytoplasmic domain of P0 is independent of specific plasmic domain that modify a PKC target motif (RSTK) or target residues but is dependent on a nearby sequence. We an adjacent serine residue abolish P0 adhesion function conclude that PKC-mediated phosphorylation of specific and can cause peripheral neuropathy in humans. Consistent residues within the cytoplasmic domain of P0 is necessary with these data, PKC along with the PKC binding protein for P0-mediated adhesion, and alteration of this process RACK1 are immunoprecipitated with wild-type P0, and can cause demyelinating neuropathy in humans. Introduction Myelin is a multilamellar structure that surrounds axons phy, and sensory loss (for review see Nelis et al., 1999; in both the central nervous system and the peripheral Shy et al., 2001). nervous system (PNS),* facilitating nerve conduction. P0, P0 functions as a homophilic adhesion molecule in vitro a transmembrane protein of the Ig superfamily, is the (Filbin et al., 1990; Filbin and Tennekoon, 1993), and this major myelin structural protein in the PNS, expressed activity may mediate compaction of adjacent leaflets in pe- exclusively by myelinating Schwann cells and necessary for ripheral nerve myelin. Analysis of the crystal structure of normal myelin structure and function. In mice, the absence the P0 extracellular domain indicates that P0 molecules of P0 (Giese et al., 1992; Martini et al., 1995) or overex- have the potential to interact in cis to form homotetra- pression of P0 (Wrabetz et al., 2000) results in hypomyelin- mers, and these interact in trans to mediate homophilic ad- ation and peripheral neuropathy. In addition, mutations hesion (Shapiro et al., 1996). Consistent with this model, in the human P0 gene cause the demyelinating peripheral mutation of several of the amino acid residues critical for neuropathy Charcot-Marie-Tooth disease 1B, the more these putative cis and trans interactions can cause the severe Dejerine-Sottas syndrome, and congenital hypo- inherited demyelinating peripheral neuropathy, CMT1B myelination, all associated with muscle weakness, atro- (Warner et al., 1996; Nelis et al., 1999). The cytoplasmic domain of P0 is also important for its function, and mutations in this region result in loss of P0- Address correspondence to Jack Lilien, Dept. of Biological Sciences, The mediated homophilic adhesion in vitro (Wong and Filbin, University of Iowa, 138 Biology Bldg., Iowa City, IA 52242-1324. Tel.: 1994). Coexpression of both wild-type and cytoplasmically (319) 353-2969. Fax: (319) 335-0081. E-mail: [email protected] truncated P0 causes loss of wild-type function, presumably W. Xu’s present address is Dept. of Neurology, University of Michigan, due to a dominant negative effect of the truncated molecule Ann Arbor, MI 48105. (Wong and Filbin, 1996). Mutations within the P0 cyto- *Abbreviations used in this paper: HPRT, hypoxanthine phosphoribosyl plasmic domain are also found in patients with inherited de- transferase; PNS, peripheral nervous system; PVDF, polyvinylene difluo- ride; RACK, receptor for activated C kinase; RT, reverse transcription. myelinating neuropathies, some of which have very severe Key words: P0; adhesion; myelination; PKC; RACK1 clinical phenotypes (Nelis et al., 1999; Shy et al., 2001).  The Rockefeller University Press, 0021-9525/2001/10/439/7 $5.00 The Journal of Cell Biology, Volume 155, Number 3, October 29, 2001 439–445 http://www.jcb.org/cgi/doi/10.1083/jcb.200107114 439 440 The Journal of Cell Biology | Volume 155, Number 3, 2001 ropathy in humans. This is the first glimpse of the molecular machinery that regulates the function of P0 in myelination. Results A subterminal 13 amino acid sequence in the cytoplasmic domain of P0 is essential for adhesion To define the regions of the cytoplasmic domain of P0 that are essential for homophilic adhesion, we stably transfected mouse L cells and HeLa cells with cDNAs encoding wild- type P0 or P0 deletion mutants lacking the COOH-termi- nal 13 (13), 28 (28), 43 (43), or 59 amino acids (59). Expression of the transfected P0 constructs was determined by reverse transcription (RT)-PCR using specific primers for each construct and by Western blotting. RT-PCR reveals that all constructs were expressed in relatively equal amounts in both cell types (Fig. 1 B shows L cells). To ensure that protein was expressed and inserted in the plasma membrane, we labeled live cells with a membrane impermeable biotin- ylation reagent followed by immunoprecipitation with anti- Figure 1. Expression of full-length P0 and P0 deletion mutants in P0 antibody. The immunoprecipitated material was fraction- transfected L cells. (A) Diagram of P0 cDNA showing the relative ated by SDS-PAGE, transferred to polyvinylene difluoride positions of the primers used to clone full-length and mutant P0. (PVDF) membranes, and probed with HRP-streptavidin. The same 5 primer (P0WT5) was used in all cases. The 3 primers Each of the P0 constructs is expressed at the cell surface (Fig. were designed to allow the cDNAs to be inserted in frame with the 1 C shows L cells). flag sequence in the pCMV-Tag4 vector. SP, signal sequence; EC, extracellular domain; TM, transmembrane domain; IC, intracellular Cells expressing each of the deletion mutants were assayed domain. (B) P0 mRNA is expressed in L cells transfected with the P0 for their ability to form homophilic adhesions as measured constructs as determined by RT-PCR using the specific primers by binding of single cells expressing P0 constructs to a con- shown in A. Primers specific to the enzyme HPRT were used to fluent layer of cells expressing wild-type P0. Both L cells and compare expression levels between cell lines. Numbers to the right HeLa cells expressing 13 were comparable to the same cell of the figure represent the migration of molecular markers. (C) Full- types expressing wild-type P0 (Fig. 2, A and B). However, length and mutant P0s are expressed at the cell surface in trans- fected L cells. Cell membrane proteins were labeled with biotin, P0-mediated adhesion was reduced dramatically in all cell and P0 was precipitated with an anti-P0 antibody. The immunopre- lines with deletions of 28 amino acids or greater (Fig. 2, A cipitates were fractionated by SDS-PAGE, transferred to PVDF mem- and B). This suggests that the sequence between amino acids branes, and probed with HRP-streptavidin. WT, full-length P0; 13, 193 and 206 is essential for P0-mediated cell–cell adhesion. 28, 43, and 59, P0 constructs lacking the terminal 13, 28, 43, This region contains three serine residues that are phosphor- or 59 amino acids, respectively; Vect, L cells transfected with empty ylated in mouse sciatic nerve: S197, S199, and S204 (Hilmi vector. Numbers to the left of the figure represent the migration of molecular markers. et al., 1995). These residues are conserved in the human P0 sequence. Furthermore, serine 199 is part of a PKC recogni- tion motif (198-RSTK-201) (Kishimoto et al., 1985; These data demonstrate a critical role for the cytoplasmic do- Woodgett et al., 1986), suggesting that phosphorylation me- main of P0 in mediating homophilic adhesion and in the mo- diated by PKC is critical to P0 adhesive function. lecular pathogenesis of inherited demyelinating neuropathies. Since it has been reported that expression of P0 in HeLa We now demonstrate that deletion of a 14 amino acid se- cells results in upregulation of cadherin expression (Doyle et quence in the cytoplasmic domain of P0 abolishes adhesive al., 1995), we were careful to perform all P0 adhesion assays in function. Point mutations in this region that alter a PKC the absence of Ca , which is necessary for cadherin-mediated substrate motif (RSTK) and mutation of an adjacent serine adhesion. Additionally, we examined both HeLa and L cells residue (S204) are critical to P0 adhesive function. More- bearing each of the P0 deletion constructs for cadherin expres- over, PKC and the receptor for activated C kinase sion using a pan cadherin antibody to blot equivalent amounts (RACK1) are coimmunoprecipitated from cells expressing of cell lysate. In agreement with the previous observations, wild-type P0 but not P0 bearing a deletion of 14 amino acid cadherin and the cadherin-associated protein -catenin are up- sequence. In addition, inhibition of PKC activity results in regulated in HeLa cells stably transfected with pCMV Tag4 loss of P0-mediated adhesion. We have also identified a mu- containing the full-length wild-type P0 but not in L cells simi- tation of the initial arginine of the PKC substrate motif to a larly transfected (unpublished data). Furthermore, among serine residue (R198S) in a patient with CMT1B, and we HeLa cells upregulation requires the same region of the mole- find that cells expressing P0 bearing this mutation fail to cule that is essential for adhesion function, amino acids 193– form homophilic adhesions. These data indicate that PKC- 206 (unpublished data). The two cell lines do differ in their mediated phosphorylation is an important component of basal level of cadherin expression: HeLa cells express a small the regulation of P0-mediated adhesion and demonstrate amount of cadherin, whereas L cells do not express detectable that alteration of this process can cause demyelinating neu- levels of cadherin. Thus, upregulation of cadherin expression PKC and P0 adhesion | Xu et al. 441 and in serine 204 (S204A) for their ability to form ho- mophilic P0 adhesions. In addition, we assayed cells bearing a mutation at serine 197 (S197A), a site of low level in vivo phosphorylation (Hilmi et al., 1995), aspartic acid 195 (D195A), and tyrosine 191 (Y191A) as controls. Stable cell lines were created and tested for P0 expression by RT-PCR and immunoprecipitation of cell surface labeled P0 as above. All constructs were expressed at the cell surface (unpublished data). Cells expressing P0 mutated at serine sites 199 or 204 or threonine 200 failed to form P0-mediated adhesions (Fig. 3 A), indicating that both the PKC motif and serine residue 204 are functionally important. In contrast to these muta- tions, substitution of serine 197 or aspartic acid 195 have lit- tle or no effect (Fig. 3 A). Furthermore, replacement of tyro- sine 191, a site shown recently to be phosphorylated in vivo (Xu et al., 2000a) with alanine, also has little or no effect on P0-mediated adhesion (Fig. 3 A). To further examine the importance of the PKC function in P0-mediated adhesion, we tested the effect of the PKC in- hibitor, calphostin C (Tamaoki and Nakano, 1990; Svetlov and Nigam, 1993). Calphostin C inhibits P0-mediated ad- hesion in a dose-dependent manner with maximum inhibi- tion at 60 nM (Fig. 3 B). At this concentration (60 nM), calphostin has no detectable effect on cell viability as mea- sured by Sytox green (Molecular Probes). Mutation within the RSTK domain (R198S) causes the demyelinating peripheral neuropathy CMT1B and loss of P0 homophilic adhesion We have identified an individual with CMT1B who is het- erozygous for a P0 mutation producing a substitution of argi- nine for serine at amino acid 198 (R198S) within the PKC binding motif. The patient had normal growth, development, and motor function until 5 yr ago, in his late 30s, when he noted the onset of lower extremity clumsiness; however, these symptoms have not progressed notably since that time. On neurological examination, he had minimal symmetrical foot dorsiflexor weakness, a mild decrease in both large and small fi- Figure 2. Identification of a region in the cytoplasmic domain of ber sensory modalities (vibration and pin prick) in his feet, and P0 that is essential for P0-mediated adhesion. (A) L cells stably expressing full-length or truncated P0 were labeled with a vital diminished Achilles and patellar deep tendon reflexes. His gait fluorescent dye and assayed for adhesion to monolayers of L cells appeared normal, but he was unable to walk on his heels, con- expressing full-length P0. Adherent cells were determined by mea- firming the mild weakness of the foot dorsiflexors. In addition, suring the amount of fluorescence associated with the cell layers. he had bilateral pes cavus, a common finding in patients with Adhesion of L cells bearing full-length P0 was considered 100% and inherited neuropathy, probably caused by weakness of the in- used to calculate adhesion of the other lines. Each cell type was trinsic muscles of the feet. On electrophysiological testing, the assayed in triplicate. (B) HeLa cells stably expressing full-length or truncated P0 were assayed for adhesion as described in A. WT, full- nerve conduction velocities of peroneal and tibial motor nerves length P0; 13, 28, 43, 59, P0 bearing deletions of the terminal were slowed bilaterally to 25 m/s, whereas his right sural sen- 13, 28, 43, and 59 amino acids, respectively; Vect, L cells trans- sory NCV was slowed to 28 m/s. The left sural potential was fected with empty vector. Bars represent the standard deviation unobtainable. These neurological signs and symptoms and elec- from the mean (p  0.0001). trophysiological findings are consistent with the presence of a mild demyelinating sensory and motor peripheral neuropathy. in the presence of P0 is not universal and may depend on a To determine if this mutation affected P0 homophilic ad- basal level of cadherin expression and P0 adhesive function or hesion, we transfected L cells with P0 bearing this mutation. signaling mediated by the cytoplasmic domain. Expression was assayed as above and was found approxi- mately equivalent to other P0 constructs in L cells (unpub- A PKC target motif and PKC activity are essential for lished data). These cells showed a much reduced ability to P0-mediated adhesion form P0 homophilic adhesions (Fig. 3 C). Thus, elimination To investigate the importance of the RSTK motif and the of PKC target residues or alteration of the PKC target motif adjacent serine, we assayed L cells transfected with P0 con- not only abolishes P0 adhesive function in vitro but also taining mutations in the RSTK motif (S199A and T200A) causes demyelinating disease in humans. 442 The Journal of Cell Biology | Volume 155, Number 3, 2001 Table I. PKC expression in mouse sciatic nerve Isoform Expression Isoform Expression Conventional Novel Atypical PKC and the PKC binding protein RACK1 are associated with P0 in situ The functional requirement for the PKC target motif in P0 and its importance to human disease led us to determine which of the many isoforms of PKC is present in sciatic nerve. We find that two conventional PKCs,  and , are detected, as well as the novel isoforms , , and (Table I). All of these isoforms are also detected in P0-transfected L cells (Fig. 4, none). However, P0 immunoprecipitates from L cells lysed in neutral detergent reveal that only PKC is present in association with P0 (Fig. 4). Furthermore, PKC is present and associated with P0 in cultured Schwann cells (Fig. 4, SC). We further probed P0 immunoprecipitates derived from each of our deletion mutants for the association of PKC and the PKC binding protein RACK1. RACKs bind acti- vated PKC at a site distinct from the substrate-binding site (Mochly-Rosen et al., 1991) and are thought to target the enzyme to specific cellular sites independent of PKC sub- strate recognition (Sim and Scott, 1999; for reviewed see Jaken and Parker, 2000). As can be seen in Fig. 5, deletion of the same 14 amino acid sequence containing the RSTK motif that is essential for P0-mediated adhesion eliminates the association of PKC and RACK1 with P0 (Fig. 5, com- pare 13 with 28 and 59). However, point mutations al- tering the RSTK substrate recognition motif or the adjacent serine 204, mutations that do eliminate P0-mediated adhe- sion, do not alter PKC or RACK1 binding. Thus, substrate recognition by PKC and binding, presumably mediated by RACK1, are two independent events occurring through dis- tinct sites within a 14 amino acid domain of P0. Discussion In this study, we present data correlating specific amino acid residues in the cytoplasmic domain of P0 with adhesion func- tion and ultimately with human disease. By creating a series of deletions in the cytoplasmic domain, we find that the region between amino acids 193 and 206 is essential for P0-mediated adhesion. This region contains a PKC substrate motif (RSTK) that is one of two major sites of in situ phosphorylation on Figure 3. A PKC target motif and the adjacent serine 204 is essen- tial for P0-mediated cell adhesion and myelination. (A) Full-length P0 constructs bearing point mutations at the indicated amino acids adhesion. L cells expressing full-length P0 were assayed for adhe- were prepared by PCR and transfected into L cells. Stable clones of sion in the presence of increasing concentrations of calphostin. cells expressing each P0 mutant were selected and assayed for P0- Adhesion in the absence of the inhibitor was considered 100%. mediated adhesion as described in the legend to Fig. 2. Adhesion is Each cell type was assayed in triplicate. (C) A point mutation in the expressed as percent of control, with the control being adhesion of PKC target motif results in human disease and loss of P0-mediated L cells expressing full-length P0. Each cell type was assayed in tripli- adhesion in transfected L cells. Stable clones of L cells expressing cate. WT, cell expressing full-length P0. Mutant cell lines are the R198S P0 mutant were assayed for P0-mediated adhesion as indicated by the specific point mutation. Vect, cell transfected with above. Adhesion is represented as percent of control. Bars represent empty vector. (B) Inhibition of PKC activity prevents P0-mediated the standard deviation from the mean (p  0.0001). PKC and P0 adhesion | Xu et al. 443 Figure 4. PKC coimmunoprecipitates specifically with P0 from Schwann cells and L cells expressing full-length P0. Confluent cultures of Schwann cells (SC), L cells expressing full-length P0 Figure 6. Diagram showing human mutations found in the (P0wt), and L cells transfected with empty vector (Vect) were lysed cytoplasmic domain of P0 and the corresponding syndrome. The in nonionic detergent. 1 ml of each cleared cell lysate was immu- site and type of mutation are indicated. (1) Y152 to Stop; (2) noprecipitated with anti-P0 antibody (P0), and equal aliquots of nucleotide deletion; (3) 17 nucleotide insertion; (4) Q186 to Stop; resuspended precipitates were fractionated by SDS-PAGE, trans- (5) nucleotide insertion; (6) nucleotide insertion; (7) R198 to S; ferred to PVDF, and probed with antibody to the PKC isoform (8) four nucleotide deletions including S204. The amino acid indicated. 20 l of each cell lysate, before immunoprecipitation, sequences deleted to create the several P0 truncated mutants used was also fractionated by SDS-PAGE, transferred to PVDF, and blot- in Fig. 1 are represented as alternating blocks of red and blue. The ted with the indicated antibody (lanes labeled none). Numbers to amino acids that prove to be essential for P0-mediated adhesion are the left indicate the migration of prestained standards. Bands due to shown in black, and the point mutations that have no effect are PKC and Ig heavy chain are indicated at the right. shown in green. serine residues (serine 199) (Hilmi et al., 1995). Using site- solutely correlated. Furthermore, the association of both pro- directed mutagenesis, we demonstrate that this motif is im- teins with P0 is dependent on a 14 amino acid sequence in the portant for adhesive function. A second serine residue at posi- cytoplasmic domain, amino acids 193–206. This is the same tion 204, closely juxtaposed to the RSTK site, is also critical region containing the PKC substrate motif; however, the sub- for adhesion function, and this residue is also phosphorylated strate site and the binding site are distinct, since point muta- in the sciatic nerve (Hilmi et al., 1995). Another serine (197) tions in the substrate site that eliminate adhesion function do that is phosphorylated in situ (Hilmi et al., 1995) does not ap- not eliminate binding of PKC or RACK1. RACK1 is one pear to be necessary for adhesion function, nor is a tyrosine member of a group of proteins that bind PKC at a site distinct residue in the cytoplasmic domain, Y191, which is also phos- from the substrate-binding site (Mochly-Rosen et al., 1991; phorylated in sciatic nerve (Iyer et al., 1996). Sim and Scott, 1999; for review see Jaken and Parker, 2000). Of the PKC isoforms present in sciatic nerve and our L cell We suggest that RACK1 binds activated PKC and interacts model, PKC is specifically immunoprecipitated with P0, in- with P0 either directly or through an additional adaptor to dicating an in situ association between the two molecules. bring activated PKC into substrate proximity. This interaction may be mediated by RACK1, the receptor PKC has been implicated previously in phosphorylation of for activated C kinase, since we find that under our experi- P0 in vitro (Suzuki et al., 1990; Rowe-Rendleman and Eich- mental conditions the association of these two proteins is ab- berg, 1994) and tumor promoters that activate PKC accentu- ate phosphorylation in situ (Agrawal and Agrawal, 1989). Most pertinent to our identification of PKC as the critical isoform, abolition of phorbol 12,13 dibutyrate–induced up- regulation of PKC in sciatic nerve is accompanied by a re- duction in PKC (Rowe-Rendleman and Eichberg, 1994). However, these prior studies were not able to correlate the PKC-dependent phosphorylation of P0 with a specific func- tion. Our data indicate for the first time that PKC-mediated phosphorylation on serine residues is important for P0 adhesion function: P0-mediated adhesion is abolished by mutations of a PKC target motif, PKC and the adaptor RACK1 are immu- Figure 5. A 14 amino acid sequence in the cytoplasmic domain of P0 is essential for its association with PKC and the PKC binding noprecipitated with wild-type P0, and P0-mediated adhesion is protein RACK1. L cells expressing wild-type P0 (WT) or P0 with decreased dramatically by calphostin C, a kinase inhibitor that point mutations or progressive truncations of its cytoplasmic preferentially blocks PKC activity (IC for PKC  50 nM). domain were lysed in neutral detergent and immunoprecipitated There are two possible mechanisms by which phosphory- with anti-P0 antibody (P0) or preimmune serum (Co). The precipi- lation of the cytoplasmic domain of P0 may regulate adhe- tates were fractionated by SDS-PAGE and transferred to PVDF. The sion and/or myelination. One is a direct mechanism in membranes were cut at the 55 kD marker and the top half probed with anti-PKC antibody, whereas the bottom half was probed with which phosphorylation of P0 alters its conformation, allow- anti-RACK1 monoclonal antibody. Cell line indicates L cells trans- ing the cis or trans interactions required for adhesion (Sha- fected with empty vector (Vec), wild-type P0 (WT), P0 lacking the piro et al., 1996). The second is an indirect mechanism in 13 COOH-terminal amino acids (13), P0 lacking the 28 COOH- which phosphorylation of P0 allows or facilitates the bind- terminal amino acids (28), P0 lacking the 59 COOH-terminal ing of effector or adaptor molecules essential for adhesion. amino acids (59), P0 bearing a S197A mutation (S197), P0 bearing a S199A mutation (S199), or P0 bearing a S204A mutation (S204). In either case, dynamic changes in the phosphorylation state 444 The Journal of Cell Biology | Volume 155, Number 3, 2001 fied on immobilized peptide and recognizes an 27 KD P0 molecule in of P0 would have significant effects on P0-mediated adhe- the rat sciatic nerve (unpublished data). Antipan cadherin antibody is from sion and/or myelination. Further experiments will clearly be Sigma-Aldrich. Antibodies to PKC isoforms and RACK1 were from Trans- required to distinguish between these two possibilities. duction Laboratories. HRP-conjugated anti–mouse or –rabbit IgG were Our deletion and mutational analysis are consistent with from Cappel Laboratories (ICN Biomedicals). The secondary antibodies conjugated to magnetic beads used in immunoprecipitations were ob- some of the mutations known to give rise to human neuropa- tained from PerSeptive Biosystems. thies. There are no known human mutations in the COOH- terminal 13 amino acids that give rise to pathology (Fig. 6); Cloning the wild-type P0 and creating a series of mutated the single amino acid change identified in this region P0 constructs The coding sequences of full-length wild-type P0 (P0WT) and P0 COOH- (R215L) appears to have no physiological ramifications (Ne- terminal deletion mutants were cloned into the pCMV-Tag4 expression lis et al., 1999). Accordingly, we find that deletion of this en- vector (Stratagene) using a PCR-based technique. These various mutants tire region has no effect on adhesion. Five human mutations contain deletions at the COOH terminus of the P0 cytoplasmic domain causing neuropathy produce a shift in the reading frame, and lacking the last 13 (13), 28 (28), 43 (43), or 59 (59) amino acids. All constructs were created using the same forward primer (P0WT5, ATAG- two result in introduction of a stop codon, all altering or de- GATCCCACCATGGCTCCTGGGGCTC), containing a BamHI restriction leting the PKC target site and/or serine 204. One of the site and a Kozak consensus sequence. The reverse 3 primers were de- frame shifts leaves the RSTK motif intact but deletes serine signed to contain overlapping DNA sequence according to the position of the deletion followed by a stop codon and a XhoI restriction site (Fig. 1 A): 204. This mutation gives rise to a severe form of CMT1, em- P0WT3, ATACTCGAGTTTCTTATCCTTGCGAGAC; 13flag, ATACTC- phasizing the importance of this residue. In addition, we have GAGGTCGTCCTCGCCAC; 28flag, ATACTCGAGATACAGCACTGGC- identified a patient with CMT1B in which an arginine resi- GTCT; 43flag, ATACTCGAGAGACTTGTGAAATTTCCCCT; and 59flag, due has been changed to a serine within this PKC target mo- ATACTCGAGGGCAGCCTGCCTGCGCAG. All constructs were cloned into pCMV-Tag4 and tested by restriction tif (RSTK→SSTK), potentially eliminating the ability of enzyme cleavage and sequenced to ensure that the insertions were in PKC to phosphorylate residues critical to adhesive function frame and that no mutations were introduced during PCR. (Fig. 6). Indeed, mimicking this mutation in our in vitro as- say abolishes P0 homophilic adhesion. Thus, these data im- Site-directed mutagenesis Recombinant PCR was used to introduce point mutations in the P0 cyto- plicate PKC-mediated phosphorylation of the cytoplasmic plasmic domain substituting the natural amino acids with alanine residues. domain of P0 in both the regulation of homophilic adhesion The oligonucleotide primers for point mutations were as follows. The un- and myelination. Consistent with this possibility, mutations derlined bases indicate the changes from the naturally occurring nucle- in a dual specificity phosphatase, myotubularin-related pro- -AGACCCCAGTGCTGGCTGCCAT-3; reverse otides: forward Y191A, 5 -TGGTCCAGCATGGCAGCCAGCACT-3; forward D195A, 5- Y191A, 5 tein-2, cause an autosomal recessive form of demyelinating CACAGCCGAA-3; reverse D195A, 5-TGCTTCGGCT- TGCTGGCC CMT, called CMT4B (Bolino et al., 2000). Although it is CAGCA-3; forward S197A, 5-CTGGACCACGCTCGAAGCAC- GTGGGC not yet known whether myotubularin-related protein-2 ; reverse S197A, 5-AGCTTTGGTGCTTCGAGCGTGGT-3; for- CAAA-3 -CTGGACCACAGCCGAGCTACCAAA-3; reverse S199A, cleaves phosphate groups on P0, these results clearly demon- ward S199A, 5 -AGCTTTGGTAGCTCGGCTGTGGT-3; forward T200A, 5-CACAGC- strate that a phosphorylation/dephosphorylation cascade AAAGCT-3; reverse T200A, 5-TGGCAGCTTTGGCGCT- CGAAGCGCC plays a role in the regulation of normal PNS myelination. GAGAA-3; TCGGCT-3; forward S204A, 5-AAGCACCAAAGCTGCCGCT Given the central role that P0 plays in myelination, it is TT-3. and reverse S204A, 5-ATTTCTTCTCAGCGGCAGC All mutant constructs were confirmed by sequencing. The constructs likely that other components interact with the cytoplasmic were named Y191A, D195A, S197A, S199A, T200A, S204A, and R198, domain to further regulate the process of myelination. Thus, respectively. P0 mutations that may have profound effects on the process of myelination independent of its adhesive function will ren- Transfection of L and HeLa cells All of the constructs and pCMV-Tag4 without inserts (Vect) were trans- der incomplete any correlation between adhesion itself and fected into mouse L cells. WTP0, 13, 28, 43, 59, and Vect were also severity of disease. Recent work from our group emphasizes transfected into HeLa cells. Stable cell lines were selected for 2 wk in the this point, since the expression of P0 has dramatic effects on presence of 1 mg/ml and maintained in the presence of 200 g/ml of G418 the levels of expression of other myelin proteins important (GIBCO BRL). Single clones were isolated and expanded. Clones of cells expressing high levels of transfected proteins as determined by immuno- for myelination (Xu et al., 2000b). Additionally, the possi- blotting with anti-P0 serum were chosen for adhesion assays. bility that tyrosine 191 plays a role independent of adhesive function is suggested by the fact that mutation has no effect RT-PCR on adhesion, yet the array of polypeptides precipitated with Expression of transfected constructs was assayed by RT-PCR. In brief, total anti-P0 antibody is altered by its phosphorylation (Xu et al., RNA was isolated from cultured cells using a QIAGEN kit and reverse tran- scribed with Superscript II and oligo dT primers (GIBCO BRL). The result- 2000a). We expect that a full accounting of the molecular ing cDNA was used to amplify the transfected construct using the same machinery associated with the cytoplasmic domain of P0 primers that were used for cloning. For RT-PCR, the hypoxanthine phos- will reveal many more effectors and adaptors as is the case phoribosyl transferase (HPRT) cDNA was used as an internal control. The two primers for HPRT amplification were: forward primer, 5-CACAG- for the cytoplasmic domains of other Ig superfamily adhe- GACTAGAACACCTGC-3, and reverse primer, 5-GCTGGTGAAAAG- sion molecules (for review see Crossin and Krushel, 2000) GACCTCT-3. and for cadherin (Vleminckx and Kemler, 1999) and inte- grin (Aplin et al., 1998) adhesion molecules. Expression of transfected cDNAs To analyze protein expression of the transfected cDNAs and determine plasma membrane localization, cell surface molecules were labeled by bio- tinylation of intact cells followed by immunoprecipitation. Confluent cell lay- Materials and methods ers in 100-mm dishes were rinsed free of serum and labeled with 0.1 mg/ml Antibodies freshly prepared NHS-LC-biotin (Pierce Chemical Co.) in cold PBS for 30 Polyclonal anti-P0 was prepared using a synthetic peptide specific to a 12 min. After washing and quenching, cell lysates were prepared using 1 ml of amino acid fragment (TWRYQPEGGRDA) from the extracellular domain of lysis buffer (1.5% NP-40, 0.15 M NaCl, 10 mM Tris, pH 7.2, 5 mM EDTA, 1 rat P0 as immunogen (Bio-Synthesis Inc.). The antiserum was affinity puri- mM PMSF, 100 g/ml protease inhibitor cocktail [Sigma-Aldrich], and 100 PKC and P0 adhesion | Xu et al. 445 g/ml DNase) per 100-mm plate, cleared by centrifugation at 14,000 g for 5 Role of P0 protein as a homophilic adhesion molecule. Nature. 344:871– min, and the supernatant immunoprecipitated with anti-P0 antibody. The im- 872. munoprecipitated proteins were separated by SDS-PAGE, transferred to PVDF Giese, K.P., R. Martini, G. Lemke, P. Soriano, and M. Schachner. 1992. Mouse membrane, and biotinylated proteins were detected with HRP-streptavidin. P0 gene disruption leads to hypomyelination, abnormal expression of recog- nition molecules, and degeneration of myelin and axons. Cell. 17:565–576. Immunoprecipitation and Western blotting Hilmi, S., M. Fournier, H. Valeins, J.C. Gandar, and J. Bonnet. 1995. Myelin P0 To analyze the expression of PKC isoforms in sciatic nerve, equal weights glycoprotein: identification of the site phosphorylated in vitro and in vivo by of mouse sciatic nerve were solubilized in 4% SDS, fractionated by SDS- endogenous protein kinases. J. Neurochem. 64:902–907. PAGE, and transferred to PVDF membranes. The membranes were probed Iyer, S., C.L. Rowe-Rendleman, R. Bianchi, and J. Eichberg. 1996. Tyrosine phos- with the indicated anti-PKC isoform antibody followed by HRP-conjugated phorylation of myelin protein P0. J. Neurosci. Res. 46:531–539. anti–mouse IgG and visualized using the extended duration HRP substrate Jaken, S., and P.J. Parker. 2000. Protein kinase C binding partners. Bioessays. 22: (Pierce Chemical Co.). For L cells transfected with wild-type P0, cultures 245–254. were grown to confluence on 100-mm plates, washed, and incubated free Kishimoto, A., K. Nishiyama, H. Nakanishi, Y. Uratsuji, H. Nomura, Y. of serum for 2 h before lysis as indicated above. An aliquot of the lysate Takeyama, and Y. Nishizuka. 1985. Studies on the phosphorylation of my- was fractionated by SDS-PAGE and immunoblotted with antibodies to the elin basic protein by protein kinase C and adenosine 3:5-monophosphate- PKC isoforms detected in sciatic nerve. The remaining lysate was preincu- dependent protein kinase. J. Biol. Chem. 260:12492–12499. bated with preimmune rabbit serum followed by goat anti–rabbit magnetic Martini, R., J. Zielasek, K.V. Toyka, K.P. Giese, and M. Schachner. 1995. Protein beads. The beads were discarded, and the cleared supernatant was incu- zero (P0)-deficient mice show myelin degeneration in peripheral nerves bated with anti-P0 antibody. The immunoprecipitated P0 and associated characteristic of inherited human neuropathies. Nat. Genet. 11:281–286. molecules were then fractionated by SDS-PAGE, transferred to PVDF, and Mochly-Rosen, D., H. Khaner, and J. Lopez. 1991. Identification of intracellular probed with anti-PKC and anti-RACK1 antibodies. The immunoblots were processed as described above. receptor proteins for activated protein kinase C. Proc. Natl. Acad. Sci. USA. 88:3997–4000. Adhesion assays Nelis, E., H. Neva, and C. Van Broeckhoven. 1999. Mutations in the peripheral Cell layers were washed free of serum, harvested using 0.1% trypsin myelin genes and associated genes in inherited peripheral neuropathies. Hu- (GIBCO BRL) in PBS buffer, and resuspended in serum-free medium (DME) man Mutation. 13:11–28. cells/ml. 2 l/ml of fluorogenic dye containing 10 mM EDTA at 5  10 Rowe-Rendleman, C.L., and J. Eichberg. 1994. P0 phosphorylation in nerves from calcein acetoxymethyl ester (calcein AM) (Molecular Probes) were added normal and diabetic rats: role of protein kinase C and turnover of phosphate to the cell suspensions and incubated at 37C for 30 min. After two groups. Neurochem. Res. 19:1023–1031. single calcein-labeled cells were added to prepared mi- washes, 5  10 Shapiro, L., J.P. Doyle, P. Hensley, D.R. Coleman, and W.A. Hendrickson. 1996. croplate wells containing confluent monolayers of cells expressing wild- Crystal structure of the extracellular domain from P0, the major structural type P0 or BSA-coated wells as controls. After 1 h incubation at 37C, the protein of peripheral nerve myelin. Neuron. 17:435–449 nonadherent calcein-labeled cells were removed by carefully washing sev- Sim, A.T.R., and J.D. Scott. 1999. Targeting of PKA, PKC and protein phos- eral times with DME containing 10 mM EDTA until the BSA-coated wells phatases to cellular microdomains. Cell Cal. 26:209–217. had no cells left. The number of cells adhering to the monolayer was mea- Shy, M.E., J. Balsamo, J. Lilien, and J. Kamholz. 2001. A molecular basis for he- sured with a molecular device microplate reader equipped with a fluores- reditary motor and sensory neuropathy disorders. Curr. Neurol. Neurosci. cein filter set at 494 nm. Rep. 1:77–88. To determine the importance of the PKC motif in the P0 sequence, Suzuki, M., Y. Sakamoto, K. Kitamura, K. Fukunaga, H. Yamamoto, E. Miya- calphostin C (Calbiochem) was used to specifically inhibit PKC. Wild-type moto, and K. Uyemura. 1990. Phosphorylation of Po glycoprotein in pe- P0-transfected cells were preincubated with increasing concentrations of ripheral nerve myelin. J. Neurochem. 55:1966–1971. calphostin C for 1 h and then assayed for adhesion as described above. Svetlov, S., and S. Nigam. 1993. Calphostin C, a specific protein kinase C inhibi- tor, activates human neutrophils: effect on phospholipase A2 and aggrega- We wish to express our appreciation to Athena Diagnostics (Worcester, tion. Biochim. Biophys. Acta. 1177:75–78. MA) for referring the new CMT1B patient to us, and to Beth Hjertos for Tamaoki, T., and H. Nakano. 1990. Potent and specific inhibitors of protein ki- help with transfection and culture of cells expressing mutant forms of P0. nase C of microbial origin. Biotech. 8:732–735. This research was supported by a grant from the National Multiple Scle- Vleminckx, K., and R. Kemler. 1999. Cadherins and tissue formation integrating rosis Society to J. Kamholz and M. Shy. adhesion and signaling. Bioessays. 21:211–220. Submitted: 26 July 2001 Warner, L.E., M.J. Hilz, S.H. Appel, J.M. Killian, E.H. Kolodry, G. Karpati, S. Revised: 14 September 2001 Carpenter, G.V. Watters, C. Wheeler, D. Witt, et al. 1996. Clinical pheno- Accepted: 21 September 2001 types of different MPZ (P0) mutations may include Charcot-Marie-Tooth type 1B, Dejerine-Sottas, and congenital hypomyelination. Neuron. 17:451– References Wong, M.-H., and M.T. Filbin. 1994. The cytoplasmic domain of the myelin Po Agrawal, H.C., and D. Agrawal. 1989. Tumor promoters accentuate phosphoryla- protein influences the adhesive interactions of its extracellular domain. J. tion of P0: evidence for the presence of protein kinase C in purified PNS Cell Biol. 126:1089–1097. myelin. Neurochem. Res. 14:409–413. Wong, M.-H., and M.T. Filbin. 1996. Dominant negative effect on adhesion by Aplin, A.E., A. Howe, S.K. Alahari, and R.L. Juliano. 1998. Signal transduction myelin Po protein truncated in its cytoplasmic domain. J. Cell Biol. 134: and signal modulation by cell adhesion receptors: the role of integrins, cad- 1531–1541. herins, immunoglobulin-cell adhesion molecules, and selectins. Pharm. Rev. Woodgett, J.R., K.L. Gould, and T. Hunter. 1986. Substrate specificity of protein 5:197–263. kinase C. Use of synthetic peptides corresponding to physiological sites as Bolino, A., M. Muglia, F.L. Conforti, E. LeGuern, M.A. Salih, D.M. Georgiou, K. probes for substrate recognition requirements. Eur. J. Biochem. 161:177– Christodoulou, I. Hausmanowa-Petrusewicz, P. Mandich, A. Schenone, et 184. al. 2000. Charcot-Marie-Tooth type 4B is caused by mutations in the gene Wrabetz, L., M.L. Feltri, A. Quattrini, D. Imperiale, D. Previtali, M. D’Antonio, encoding myotubularin-related protein-2. Nat. Genet. 25:17–20. X. Yin, B.D. Trapp, L. Zhou, S.Y. Chiu, et al. 2000. P(0) glycoprotein over- Crossin, K.L., and L.A. Krushel. 2000. Cellular signaling by neural cell adhesion expression causes congenital hypomyelination of peripheral nerves. J. Cell molecules of the immunoglobulin superfamily. Develop. Dyn. 218:260–279. Biol. 148:1021–1034. Doyle, J.P., J.G. Stempak, P. Cowin, D.R. Colman, and D. D’Urso. 1995. Protein Xu, M., R. Zhao, X. Sui, F. Xu, and Z.J. Zhao. 2000a. Tyrosine phosphorylation zero, a nervous system adhesion molecule, triggers epithelial reversion in of myelin P0 and its implication in signal transduction. Biochem. Biophys. host carcinoma cells. J. Cell Biol. 131:465–482. Res Commun. 267:820–825. Filbin, M.T., and G.I. Tennekoon. 1993. Homophilic adhesion of the myelin P0 Xu, W., D. Manichella, H. Jiang, J.M. Vallat, J. Lilien, P. Baron, G. Scarlato, J. protein requires glycosylation of both molecules in the homophilic pair. J. Kamholz, and M.E. Shy. 2000b. Absence of P0 leads to dysregulation of Cell Biol. 122:451–459. myelin gene expression and myelin morphogenesis. J. Neurosci. Res. 60:714– Filbin, M.T., F.S. Walsh, B.D. Trapp, J.A. Pizzey, and G.I. Tennekoon. 1990. 724.

Journal

The Journal of Cell Biology – Pubmed Central

Published: Oct 29, 2001

There are no references for this article.