Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Antibodies to SARS Coronavirus in Civets

Antibodies to SARS Coronavirus in Civets DISPATCHES habitat are infected with SARS-CoV. Lack of access to Antibodies to wild civets and regulatory issues involved make conduct- ing detailed field studies of wild civets difficult, if not SARS Coronavirus impossible, for the foreseeable future. Since most civets in markets are sourced from civet farms, we have conducted in Civets a preliminary serologic study on the prevalence of antibod- ies to SARS-CoV in civets from the market and farms. 1 1 Changchun Tu,* Gary Crameri,† Xiangang Kong,‡ Jinding Chen,§ Yanwei Sun,¶ The Study Meng Yu,† Hua Xiang,* Xianzhu Xia,* After detecting SARS-CoV in civets from animal mar- Shengwang Liu,‡ Tao Ren,§ Yedong Yu,¶ kets in Shenzen in late November 2003, the Guangdong Bryan T. Eaton,† Hua Xuan,* and Lin-Fa Wang† government launched a campaign to cull all civets in the province to reduce the risk of SARS-CoV transmission to Using three different assays, we examined 103 serum samples collected from different civet farms and a market humans (10). To study the distribution of SARS-CoV and in China in June 2003 and January 2004. While civets on antibodies in these culled animals, intestine tissues and farms were largely free from SARS-CoV infection, ≈80% of serum samples were taken from 56 animals: 38 civets from the animals from one animal market in Guangzhou con- four farms in different regions of Guangdong Province (10 tained significant levels of antibody to SARS-CoV, which from Zhuhai, 10 from Shanwei, 9 from Shaoguan, and 9 suggests no widespread infection among civets resident on from Qingyuan; Figure) and 18 civets from the Xinyuan farms, and the infection of civets in the market might be Live Animal Market in Guangzhou. associated with trading activities under the conditions of Because of time constrains and regulatory issues, selec- overcrowding and mixing of various animal species. tion was conducted on the basis of convenience and per- sonal contact with groups involved in the slaughter evere acute respiratory syndrome (SARS) first campaign. However, we tried to select civets from farms Sappeared in November 2002 in Guangdong Province, >100 km apart in the Guangdong Province. A total of 41 China (1). The outbreak was caused by a newly emerged civet farms were in Guangdong Province at the time of the virus now known as the SARS-associated coronavirus slaughter campaign, and most had <100 animals. No biose- (SARS-CoV), which is believed to originate from animals. curity measures were used in farms or markets, and no vet- Most of the early index cases in Guangdong Province were erinary examination or accreditation was required for civet concentrated in food handlers, and workers in live-animal farming or trading. All of the farms tested had obtained markets had higher rates of antibodies to SARS-CoV than their original seed stock from markets. persons in other occupations (2,3). Studies have indicated Also included in the study were 47 civet serum samples that Chinese ferret-badgers (Melogale moschata), masked that had been previously collected in early June 2003 from palm civets (Paguma larvata), and raccoon-dogs two civet farms in Luoning City of Henan Province and (Nyctereutes procyonoides) could be naturally infected by Changsha City of Hunan Province. The farm conditions SARS-CoV or a closely related virus (4). Furthermore, were similar to those in Guangdong, basically small-scale experimental infection studies indicated that a variety of farms without biosecurity or animal health safeguards. animals, including monkey, cat, ferret, mouse, and pig, are All serum samples were inactivated at 56°C for 30 min, susceptible to SARS-CoV infection (5–9). These findings transferred to the Australian Animal Health Laboratory, highlight the difficulties facing investigation into the ori- and inactivated by gamma irradiation before analysis. gin of SARS-CoV. Anti–SARS-CoV antibody in serum was detected by using Civets have been considered one of the most likely ani- immunofluoresence antibody assay (IFA) and quantified in mals responsible for animal-to-human SARS-CoV trans- a microtiter virus neutralization test (VNT). The SARS- mission, and on this basis, more than a thousand civets in CoV (strain HKU-39849) used in both VNT and IFA was Guangdong were culled in January 2004. However, no plaque purified three times in Vero cells, and stock virus conclusive evidence suggests that civets are the natural (titer 5 x 10 50% tissue culture infective dose [TCID ]) reservoir host of SARS-CoV or that civets in their natural prepared by two low-multiplicity passes in Vero cells. In IFA, monolayers of Vero cells infected with SARS-CoV at a multiplicity of infection of 0.02 TCID /cell were *Changchun University of Agriculture and Animal Sciences, Changchun, China; †CSIRO Livestock Industries, Geelong, methanol-fixed 24 h postinfection, exposed to a range of Australia; ‡Harbin Veterinary Research Institute, Harbin, China; serum dilutions, and bound antibody detected by using §South China Agriculture University, Guangzhou; China; and ¶Guangdong Provincial Veterinary Station of Epidemic Prevention and Supervision, Guangzhou, China These authors contributed equally to this study. 2244 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 10, No. 12, December 2004 Antibodies to SARS-Coronavirus in Civets Figure. Geographic distribution of the farms and market examined in this study. The dia- gram on the left identifies the six provinces relevant to this study. The diagram on the right is an enlarged map of Guangdong Province showing the locations of the four farms and the capital city Guangzhou, where the live animal market was located. Also shown is Shenzhen, where civets from live animal markets were tested by Guan et al. in May 2003 (5). fluorescein isothiocyanate–conjugated protein A was 4 (≈10%) of 38. SARS-CoV antibody levels in the (Kirkegaard & Perry Laboratories, Gaithersburg, MD). four animals at the farm in Shanwei, which is located ≈240 Groups of samples that reacted positively in either VNT or km east of Guangzhou (Figure), were lower than those IFA were also subjected to Western blot analysis with a from the market, and two samples positive by VNT failed recombinant SARS-CoV nucleocapsid (N) protein to react on IFA or Western blot (Table). expressed in Escherichia coli. Bound antibodies were Intestinal tissues collected from the 56 civets were test- detected by using alkaline phosphatase–conjugated protein ed by RT-PCR using N-gene primers; none of the samples A/G (Pierce, Rockford, IL). were positive. Negative results were confirmed by RT- Intestine tissues collected from the 56 animals in PCR with M- and S-gene primers. Therefore, virus isola- January 2004 were also tested for SARS-CoV viral nucle- tion from these tissues was abandoned. The other 47 serum ic acid by using reverse transcription–polymerase chain samples taken in June 2003 from Henan and Hunan reaction (RT-PCR). Total RNA was extracted from these provinces were negative by VNT or IFA (Table). Western samples by using the Trizol method (Invitrogen, Carlsbad, blot was not performed on this group of serum samples. CA), followed by first-strand cDNA synthesis using the Superscript II RNase H reverse transcriptase (New Discussion England Biolab, Beverly, MA) and random hexamer While civet selection was derived from a convenience primers. PCR amplification was conducted by using Ex sample and limited because of time constraints imposed by Taq polymerase (TaKaRa). Three pairs of SARS- the slaughter campaign, this study showed a marked differ- CoV–specific primers were used to amplify regions in the ence in SARS-CoV antibody prevalence between animals N gene (forward, 5′-ATGTCTGATAATGGACCCCAAT; from the market and those selected from the farms. reverse, 5′-TTATGCCTGAGTTGAATCAG), the M gene Animals selected from one market in Guangzhou in (forward, 5′-ATGGCAGACAACGGTACTATT; reverse, January 2004 had a much higher prevalence of SARS-CoV 5′-CTTACTGTACTAGCAAAGCAAT) and the S gene antibodies than those selected from farms in the same peri- (forward, 5′-ATGTTTATTTTCTTATTATTTC; reverse, 5′- od or from farms in two other provinces in June 2003. GTCGACATGCTCAGCTCCTAT), respectively. These results raise the possibility that civets, rather than Of 103 civet serum samples tested, 18 were positive on being the natural animal reservoir of SARS-CoV, are at least one of the three assays used, for ≈17% overall sero- infected mainly in markets or during other trade-related prevalence. However, when seroprevalence among civets activities. Our results suggest that mass slaughter of civets from farms and the market was compared, differences on farms might not be necessary to control SARS-CoV were observed. For samples taken in January 2004, 14 of spread. A more effective approach might be to implement 18 obtained from the Xinyuan Live Animal Market in testing in live animal markets and farms for susceptible Guangzhou tested positive by all three assays (Table), for animals and to apply quarantine regulation and targeted a seroprevalence of 78%. In contrast, the prevalence on slaughter for markets or farms with infected animals. each farm was <40% (4 of 10 animals from the farm in While Guan et al. (4) were able to detect SARS-CoV Shanwei tested positive, and no positive animals were infection by RT-PCR in six out of six palm civets collect- found on the other farms); the overall prevalence on farms ed in one particular live animal retail market in Shenzhen Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 10, No. 12, December 2004 2245 DISPATCHES in May 2003, a similar study conducted by us in the same CoV, perhaps especially when they are stressed, and that period yielded different results. In our study, we collected most infections occurred in the market. civets from Xinyuan Live Animal Market in Guangzhou We observed a number of practices during our study. (n = 7), the Guangdong Centre for Rescue and Care of First, most animal traders deal with multiple species. Wildlife Animals, also located in Guangzhou (n = 9), and Second, housing different animals in close proximity is a civet farm in neighboring Jiangxi Province (n = 15). common. Third, although civets are in high demand in While 2 civets from the market and 2 from the center were Guangdong Province, they are expensive, so a batch of positive for SARS-CoV by RT-PCR, all 15 farmed animals animals may remain in a storehouse for weeks. All of these from Jiangxi had negative results (C. Tu et al., unpub. factors facilitate interspecies transmission, which would be data). followed by rapid transmission among the civet popula- Results of these studies and those from our current tion. Finally, civet farming and trading has been in practice study are similar. We observed a high percentage of infect- in China for >10 years, but SARS has not been observed in ed civets in one particular market at a specific time. workers until recently, which points to a recent introduc- However, no indication of civet infection was seen on most tion of SARS-CoV in the civet population in markets. farms during the same period. These results support the In a study conducted by the Guangdong Province hypothesis that civets are highly susceptible to SARS- Centre for Disease Control and Prevention and the World 2246 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 10, No. 12, December 2004 Antibodies to SARS-Coronavirus in Civets Health Organization (3), epidemiologic data were ana- antibodies are not likely to positively react in all three of lyzed from 1,454 clinically confirmed SARS cases (and 55 the assays used in this study. deaths) from November 2002 to April 30, 2003. One The most basic limitation of our study was the nonran- important observation from this study was that patients dom sampling, which limits the generalization of our who became ill early in the epidemic were more likely than results. However, this study is a first step in investigating those who became ill later to report living near a produce the role of civets in transmitting SARS-CoV. Much market but not near a farm, which supports the notion that remains to be done, including studies on the prevalence of no widespread SARS-CoV infection occurred among infection with SARS-CoV and related coronaviruses that farmed animals. use more robust methods to sample susceptible animals in In the market study conducted by Guan et al. (4), all of markets, farms, and the wild. Improved serologic tests the civets collected were positive for SARS-CoV. These should be developed that can detect SARS-CoV–specific animals were collected in the same market at the same antibodies from different animal species, without relying time, but they originated in different regions of southern on live SARS-CoV. Other issues that remain to be resolved China; consequently, most, if not all, of these animals were include the rate of new infections in susceptible animal likely infected in the market. In addition, SARS-CoV species, the characteristics of the animals that become infection was also observed in at least one raccoon dog infected, and the nature of the exposures that lead to inter- (Nyctereutes procyonoides) and one Chinese ferret-badger species transmission. (Melogale moschata) from the same market at the same time, which demonstrates possible interspecies SARS- Acknowledgments CoV transmission during trading. Sequence analysis of the We thank Zhaoan Xin, Liancheng Lei, Yuwei Gao, Yanhua S genes showed that one civet isolate (SZ16) was more Ao, Sandra Sapats, Chris Morrissy, Laurie Gleeson, Patrick closely related to the raccoon dog isolate (SZ13) than the Kluver, and Gary Anderson for providing either leadership sup- other two civet isolates (SZ1 and SZ3), which further sup- port, project supervision, technical assistance, animal coron- ports interspecies transmission in the market (4). Since that avirus antisera, critical reading of the manuscript, or help in study, several experimental infection studies have shown statistical analysis. most mammalian species tested to be susceptible to SARS- This study was part of a project supported by Guangdong CoV infection (5–9), and animal-to-animal transmission Provincial Program on SARS Prevention and Treatment to H.X. can occur under experimental conditions as well (6). (project no. 2003FD02-06), the State High Technology Caution should be taken in determining the origin of Development Program (the 863 Program) on SARS origination SARS-CoV; data collected from markets where a wide research to X.K. (project no.2003AA208407). The investigation variety of species are housed in close proximity may be was organized and supported by the Chinese Ministry of unreliable. Agriculture. The serologic study carried out at the Australian Out of the four farms in Guangdong Province, four ani- Animal Health Laboratory was supported in part by a grant from mals from one farm in Shanwei had low levels of neutral- the Australian Biosecurity Co-operative Research Centre for izing antibodies to SARS-CoV, and two of the four Emerging Infectious Diseases (Project No. 1.007R) to L.F.W. samples did not react in IFA or Western blot. This farm in Shanwei is unique in that they farmed civets not for meat, Dr. Tu is a professor of animal virology at the Changchun but for the pet market in Southeast Asia. Most of their ani- University of Agriculture and Animal Sciences, Changchun, mals were obtained from various markets at various times China. His main research interests include molecular epidemiol- from 2002 to 2003. These animals had possibly been ogy and DNA immunization of animal viruses, as well as the exposed to SARS-CoV before arriving on the farm, and development of viral detection methods. they still had low levels of convalescent antibodies in January 2004. References To assess the specificity of the serologic tests used in our study, we tested for cross-reactivity of SARS-CoV to 1. World Health Organization. Summary of probable SARS cases with onset of illness from 1 November 2002 to 31 July 2003. Geneva: The four known coronaviruses from group 1 (porcine epidem- Organization; 2003 Sep 26 [cited 2004 Oct 14]. Available from ic diarrhea virus and transmissible gastroenteritis virus), http://www.who.int/csr/sars/country/table2003_09_23/en/ group 2 (porcine hemagglutinating encephalomyelitis 2. Centers for Disease Control and Prevention. Prevalence of IgG anti- virus), and group 3 (infectious bronchitis virus) and found body to SARS-associated coronavirus in animal traders—Guangdong Province, China, 2003. MMWR Morb Mortal Wkly Rep. no cross-reactivity (data not shown). We cannot rule out 2003;52:986–7. the possibility that an unknown coronavirus can infect 3. Xu R-H, He J-F, Evans MR, Peng G-W, Field HE, Yu D-W, et al. civets, which may give low levels of cross-reactivity in the Epidemiologic clues to SARS origin in China. Emerg Infect Dis. assays used in this study. However, such cross-reactive 2004;10:1030–7. Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 10, No. 12, December 2004 2247 DISPATCHES 4. Guan Y, Zheng BJ, He YQ, Li XL, Zhuang ZX, Cheung CL, et al. 8. Wentworth DE, Gillim-Ross L, Espina N, Bernard KA. Mice suscep- Isolation and characterization of viruses related to the SARS coron- tible to SARS coronavirus. Emerg Infect Dis. 2004;10:1293–6. avirus from animals in southern China. Science. 2003;302:276–8. 9. Weingartl HM, Copps J, Drebot MA, Marszal P, Smith G, Gren J, et 5. Fouchier RA, Kuiken T, Schutten M, van Amerongen G, van al. Susceptibility of pigs and chickens to SARS coronavirus. Emerg Doomum GJ, van den Hoogen BG, et al. Aeitiology: Koch’s postu- Infect Dis. 2004;10:179–84. lates fulfilled for SARS virus. Nature. 2003;423:240. 10. Watts J. China culls wild animals to prevent new SARS threat. 6. Martina BEE, Haagmans BL, Kuiken T, Fouchier RAM, Lancet. 2004;363:134. Rimmelzwaan GF, van Amerogan G, et al. SARS virus infection of cats and ferrets. Nature. 2003;425:915. Address for correspondence: H. Xuan, Changchun University of 7. Subbarao K, McAuliffe J, Vogel L, Fahle G, Fischer S, Tatti K, et al. Agriculture and Animal Sciences, Changchun 130062, China; fax: 86- Prior infection and passive transfer of neutralizing antibody prevent 431-6986667; email: [email protected] replication of severe acute respiratory syndrome coronavirus in the respiratory tract of mice. J Virol. 2004;78:3572–7. Search 2248 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 10, No. 12, December 2004 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Emerging Infectious Diseases Pubmed Central

Antibodies to SARS Coronavirus in Civets

Download PDF
5 pages

Loading next page...
 
/lp/pubmed-central/antibodies-to-sars-coronavirus-in-civets-4fPq0xiM02

References (24)

Publisher
Pubmed Central
ISSN
1080-6040
eISSN
1080-6059
DOI
10.3201/eid1012.040520
Publisher site
See Article on Publisher Site

Abstract

DISPATCHES habitat are infected with SARS-CoV. Lack of access to Antibodies to wild civets and regulatory issues involved make conduct- ing detailed field studies of wild civets difficult, if not SARS Coronavirus impossible, for the foreseeable future. Since most civets in markets are sourced from civet farms, we have conducted in Civets a preliminary serologic study on the prevalence of antibod- ies to SARS-CoV in civets from the market and farms. 1 1 Changchun Tu,* Gary Crameri,† Xiangang Kong,‡ Jinding Chen,§ Yanwei Sun,¶ The Study Meng Yu,† Hua Xiang,* Xianzhu Xia,* After detecting SARS-CoV in civets from animal mar- Shengwang Liu,‡ Tao Ren,§ Yedong Yu,¶ kets in Shenzen in late November 2003, the Guangdong Bryan T. Eaton,† Hua Xuan,* and Lin-Fa Wang† government launched a campaign to cull all civets in the province to reduce the risk of SARS-CoV transmission to Using three different assays, we examined 103 serum samples collected from different civet farms and a market humans (10). To study the distribution of SARS-CoV and in China in June 2003 and January 2004. While civets on antibodies in these culled animals, intestine tissues and farms were largely free from SARS-CoV infection, ≈80% of serum samples were taken from 56 animals: 38 civets from the animals from one animal market in Guangzhou con- four farms in different regions of Guangdong Province (10 tained significant levels of antibody to SARS-CoV, which from Zhuhai, 10 from Shanwei, 9 from Shaoguan, and 9 suggests no widespread infection among civets resident on from Qingyuan; Figure) and 18 civets from the Xinyuan farms, and the infection of civets in the market might be Live Animal Market in Guangzhou. associated with trading activities under the conditions of Because of time constrains and regulatory issues, selec- overcrowding and mixing of various animal species. tion was conducted on the basis of convenience and per- sonal contact with groups involved in the slaughter evere acute respiratory syndrome (SARS) first campaign. However, we tried to select civets from farms Sappeared in November 2002 in Guangdong Province, >100 km apart in the Guangdong Province. A total of 41 China (1). The outbreak was caused by a newly emerged civet farms were in Guangdong Province at the time of the virus now known as the SARS-associated coronavirus slaughter campaign, and most had <100 animals. No biose- (SARS-CoV), which is believed to originate from animals. curity measures were used in farms or markets, and no vet- Most of the early index cases in Guangdong Province were erinary examination or accreditation was required for civet concentrated in food handlers, and workers in live-animal farming or trading. All of the farms tested had obtained markets had higher rates of antibodies to SARS-CoV than their original seed stock from markets. persons in other occupations (2,3). Studies have indicated Also included in the study were 47 civet serum samples that Chinese ferret-badgers (Melogale moschata), masked that had been previously collected in early June 2003 from palm civets (Paguma larvata), and raccoon-dogs two civet farms in Luoning City of Henan Province and (Nyctereutes procyonoides) could be naturally infected by Changsha City of Hunan Province. The farm conditions SARS-CoV or a closely related virus (4). Furthermore, were similar to those in Guangdong, basically small-scale experimental infection studies indicated that a variety of farms without biosecurity or animal health safeguards. animals, including monkey, cat, ferret, mouse, and pig, are All serum samples were inactivated at 56°C for 30 min, susceptible to SARS-CoV infection (5–9). These findings transferred to the Australian Animal Health Laboratory, highlight the difficulties facing investigation into the ori- and inactivated by gamma irradiation before analysis. gin of SARS-CoV. Anti–SARS-CoV antibody in serum was detected by using Civets have been considered one of the most likely ani- immunofluoresence antibody assay (IFA) and quantified in mals responsible for animal-to-human SARS-CoV trans- a microtiter virus neutralization test (VNT). The SARS- mission, and on this basis, more than a thousand civets in CoV (strain HKU-39849) used in both VNT and IFA was Guangdong were culled in January 2004. However, no plaque purified three times in Vero cells, and stock virus conclusive evidence suggests that civets are the natural (titer 5 x 10 50% tissue culture infective dose [TCID ]) reservoir host of SARS-CoV or that civets in their natural prepared by two low-multiplicity passes in Vero cells. In IFA, monolayers of Vero cells infected with SARS-CoV at a multiplicity of infection of 0.02 TCID /cell were *Changchun University of Agriculture and Animal Sciences, Changchun, China; †CSIRO Livestock Industries, Geelong, methanol-fixed 24 h postinfection, exposed to a range of Australia; ‡Harbin Veterinary Research Institute, Harbin, China; serum dilutions, and bound antibody detected by using §South China Agriculture University, Guangzhou; China; and ¶Guangdong Provincial Veterinary Station of Epidemic Prevention and Supervision, Guangzhou, China These authors contributed equally to this study. 2244 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 10, No. 12, December 2004 Antibodies to SARS-Coronavirus in Civets Figure. Geographic distribution of the farms and market examined in this study. The dia- gram on the left identifies the six provinces relevant to this study. The diagram on the right is an enlarged map of Guangdong Province showing the locations of the four farms and the capital city Guangzhou, where the live animal market was located. Also shown is Shenzhen, where civets from live animal markets were tested by Guan et al. in May 2003 (5). fluorescein isothiocyanate–conjugated protein A was 4 (≈10%) of 38. SARS-CoV antibody levels in the (Kirkegaard & Perry Laboratories, Gaithersburg, MD). four animals at the farm in Shanwei, which is located ≈240 Groups of samples that reacted positively in either VNT or km east of Guangzhou (Figure), were lower than those IFA were also subjected to Western blot analysis with a from the market, and two samples positive by VNT failed recombinant SARS-CoV nucleocapsid (N) protein to react on IFA or Western blot (Table). expressed in Escherichia coli. Bound antibodies were Intestinal tissues collected from the 56 civets were test- detected by using alkaline phosphatase–conjugated protein ed by RT-PCR using N-gene primers; none of the samples A/G (Pierce, Rockford, IL). were positive. Negative results were confirmed by RT- Intestine tissues collected from the 56 animals in PCR with M- and S-gene primers. Therefore, virus isola- January 2004 were also tested for SARS-CoV viral nucle- tion from these tissues was abandoned. The other 47 serum ic acid by using reverse transcription–polymerase chain samples taken in June 2003 from Henan and Hunan reaction (RT-PCR). Total RNA was extracted from these provinces were negative by VNT or IFA (Table). Western samples by using the Trizol method (Invitrogen, Carlsbad, blot was not performed on this group of serum samples. CA), followed by first-strand cDNA synthesis using the Superscript II RNase H reverse transcriptase (New Discussion England Biolab, Beverly, MA) and random hexamer While civet selection was derived from a convenience primers. PCR amplification was conducted by using Ex sample and limited because of time constraints imposed by Taq polymerase (TaKaRa). Three pairs of SARS- the slaughter campaign, this study showed a marked differ- CoV–specific primers were used to amplify regions in the ence in SARS-CoV antibody prevalence between animals N gene (forward, 5′-ATGTCTGATAATGGACCCCAAT; from the market and those selected from the farms. reverse, 5′-TTATGCCTGAGTTGAATCAG), the M gene Animals selected from one market in Guangzhou in (forward, 5′-ATGGCAGACAACGGTACTATT; reverse, January 2004 had a much higher prevalence of SARS-CoV 5′-CTTACTGTACTAGCAAAGCAAT) and the S gene antibodies than those selected from farms in the same peri- (forward, 5′-ATGTTTATTTTCTTATTATTTC; reverse, 5′- od or from farms in two other provinces in June 2003. GTCGACATGCTCAGCTCCTAT), respectively. These results raise the possibility that civets, rather than Of 103 civet serum samples tested, 18 were positive on being the natural animal reservoir of SARS-CoV, are at least one of the three assays used, for ≈17% overall sero- infected mainly in markets or during other trade-related prevalence. However, when seroprevalence among civets activities. Our results suggest that mass slaughter of civets from farms and the market was compared, differences on farms might not be necessary to control SARS-CoV were observed. For samples taken in January 2004, 14 of spread. A more effective approach might be to implement 18 obtained from the Xinyuan Live Animal Market in testing in live animal markets and farms for susceptible Guangzhou tested positive by all three assays (Table), for animals and to apply quarantine regulation and targeted a seroprevalence of 78%. In contrast, the prevalence on slaughter for markets or farms with infected animals. each farm was <40% (4 of 10 animals from the farm in While Guan et al. (4) were able to detect SARS-CoV Shanwei tested positive, and no positive animals were infection by RT-PCR in six out of six palm civets collect- found on the other farms); the overall prevalence on farms ed in one particular live animal retail market in Shenzhen Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 10, No. 12, December 2004 2245 DISPATCHES in May 2003, a similar study conducted by us in the same CoV, perhaps especially when they are stressed, and that period yielded different results. In our study, we collected most infections occurred in the market. civets from Xinyuan Live Animal Market in Guangzhou We observed a number of practices during our study. (n = 7), the Guangdong Centre for Rescue and Care of First, most animal traders deal with multiple species. Wildlife Animals, also located in Guangzhou (n = 9), and Second, housing different animals in close proximity is a civet farm in neighboring Jiangxi Province (n = 15). common. Third, although civets are in high demand in While 2 civets from the market and 2 from the center were Guangdong Province, they are expensive, so a batch of positive for SARS-CoV by RT-PCR, all 15 farmed animals animals may remain in a storehouse for weeks. All of these from Jiangxi had negative results (C. Tu et al., unpub. factors facilitate interspecies transmission, which would be data). followed by rapid transmission among the civet popula- Results of these studies and those from our current tion. Finally, civet farming and trading has been in practice study are similar. We observed a high percentage of infect- in China for >10 years, but SARS has not been observed in ed civets in one particular market at a specific time. workers until recently, which points to a recent introduc- However, no indication of civet infection was seen on most tion of SARS-CoV in the civet population in markets. farms during the same period. These results support the In a study conducted by the Guangdong Province hypothesis that civets are highly susceptible to SARS- Centre for Disease Control and Prevention and the World 2246 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 10, No. 12, December 2004 Antibodies to SARS-Coronavirus in Civets Health Organization (3), epidemiologic data were ana- antibodies are not likely to positively react in all three of lyzed from 1,454 clinically confirmed SARS cases (and 55 the assays used in this study. deaths) from November 2002 to April 30, 2003. One The most basic limitation of our study was the nonran- important observation from this study was that patients dom sampling, which limits the generalization of our who became ill early in the epidemic were more likely than results. However, this study is a first step in investigating those who became ill later to report living near a produce the role of civets in transmitting SARS-CoV. Much market but not near a farm, which supports the notion that remains to be done, including studies on the prevalence of no widespread SARS-CoV infection occurred among infection with SARS-CoV and related coronaviruses that farmed animals. use more robust methods to sample susceptible animals in In the market study conducted by Guan et al. (4), all of markets, farms, and the wild. Improved serologic tests the civets collected were positive for SARS-CoV. These should be developed that can detect SARS-CoV–specific animals were collected in the same market at the same antibodies from different animal species, without relying time, but they originated in different regions of southern on live SARS-CoV. Other issues that remain to be resolved China; consequently, most, if not all, of these animals were include the rate of new infections in susceptible animal likely infected in the market. In addition, SARS-CoV species, the characteristics of the animals that become infection was also observed in at least one raccoon dog infected, and the nature of the exposures that lead to inter- (Nyctereutes procyonoides) and one Chinese ferret-badger species transmission. (Melogale moschata) from the same market at the same time, which demonstrates possible interspecies SARS- Acknowledgments CoV transmission during trading. Sequence analysis of the We thank Zhaoan Xin, Liancheng Lei, Yuwei Gao, Yanhua S genes showed that one civet isolate (SZ16) was more Ao, Sandra Sapats, Chris Morrissy, Laurie Gleeson, Patrick closely related to the raccoon dog isolate (SZ13) than the Kluver, and Gary Anderson for providing either leadership sup- other two civet isolates (SZ1 and SZ3), which further sup- port, project supervision, technical assistance, animal coron- ports interspecies transmission in the market (4). Since that avirus antisera, critical reading of the manuscript, or help in study, several experimental infection studies have shown statistical analysis. most mammalian species tested to be susceptible to SARS- This study was part of a project supported by Guangdong CoV infection (5–9), and animal-to-animal transmission Provincial Program on SARS Prevention and Treatment to H.X. can occur under experimental conditions as well (6). (project no. 2003FD02-06), the State High Technology Caution should be taken in determining the origin of Development Program (the 863 Program) on SARS origination SARS-CoV; data collected from markets where a wide research to X.K. (project no.2003AA208407). The investigation variety of species are housed in close proximity may be was organized and supported by the Chinese Ministry of unreliable. Agriculture. The serologic study carried out at the Australian Out of the four farms in Guangdong Province, four ani- Animal Health Laboratory was supported in part by a grant from mals from one farm in Shanwei had low levels of neutral- the Australian Biosecurity Co-operative Research Centre for izing antibodies to SARS-CoV, and two of the four Emerging Infectious Diseases (Project No. 1.007R) to L.F.W. samples did not react in IFA or Western blot. This farm in Shanwei is unique in that they farmed civets not for meat, Dr. Tu is a professor of animal virology at the Changchun but for the pet market in Southeast Asia. Most of their ani- University of Agriculture and Animal Sciences, Changchun, mals were obtained from various markets at various times China. His main research interests include molecular epidemiol- from 2002 to 2003. These animals had possibly been ogy and DNA immunization of animal viruses, as well as the exposed to SARS-CoV before arriving on the farm, and development of viral detection methods. they still had low levels of convalescent antibodies in January 2004. References To assess the specificity of the serologic tests used in our study, we tested for cross-reactivity of SARS-CoV to 1. World Health Organization. Summary of probable SARS cases with onset of illness from 1 November 2002 to 31 July 2003. Geneva: The four known coronaviruses from group 1 (porcine epidem- Organization; 2003 Sep 26 [cited 2004 Oct 14]. Available from ic diarrhea virus and transmissible gastroenteritis virus), http://www.who.int/csr/sars/country/table2003_09_23/en/ group 2 (porcine hemagglutinating encephalomyelitis 2. Centers for Disease Control and Prevention. Prevalence of IgG anti- virus), and group 3 (infectious bronchitis virus) and found body to SARS-associated coronavirus in animal traders—Guangdong Province, China, 2003. MMWR Morb Mortal Wkly Rep. no cross-reactivity (data not shown). We cannot rule out 2003;52:986–7. the possibility that an unknown coronavirus can infect 3. Xu R-H, He J-F, Evans MR, Peng G-W, Field HE, Yu D-W, et al. civets, which may give low levels of cross-reactivity in the Epidemiologic clues to SARS origin in China. Emerg Infect Dis. assays used in this study. However, such cross-reactive 2004;10:1030–7. Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 10, No. 12, December 2004 2247 DISPATCHES 4. Guan Y, Zheng BJ, He YQ, Li XL, Zhuang ZX, Cheung CL, et al. 8. Wentworth DE, Gillim-Ross L, Espina N, Bernard KA. Mice suscep- Isolation and characterization of viruses related to the SARS coron- tible to SARS coronavirus. Emerg Infect Dis. 2004;10:1293–6. avirus from animals in southern China. Science. 2003;302:276–8. 9. Weingartl HM, Copps J, Drebot MA, Marszal P, Smith G, Gren J, et 5. Fouchier RA, Kuiken T, Schutten M, van Amerongen G, van al. Susceptibility of pigs and chickens to SARS coronavirus. Emerg Doomum GJ, van den Hoogen BG, et al. Aeitiology: Koch’s postu- Infect Dis. 2004;10:179–84. lates fulfilled for SARS virus. Nature. 2003;423:240. 10. Watts J. China culls wild animals to prevent new SARS threat. 6. Martina BEE, Haagmans BL, Kuiken T, Fouchier RAM, Lancet. 2004;363:134. Rimmelzwaan GF, van Amerogan G, et al. SARS virus infection of cats and ferrets. Nature. 2003;425:915. Address for correspondence: H. Xuan, Changchun University of 7. Subbarao K, McAuliffe J, Vogel L, Fahle G, Fischer S, Tatti K, et al. Agriculture and Animal Sciences, Changchun 130062, China; fax: 86- Prior infection and passive transfer of neutralizing antibody prevent 431-6986667; email: [email protected] replication of severe acute respiratory syndrome coronavirus in the respiratory tract of mice. J Virol. 2004;78:3572–7. Search 2248 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 10, No. 12, December 2004

Journal

Emerging Infectious Diseases – Pubmed Central

Published: Dec 1, 2004

There are no references for this article.