Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Serine 129 Phosphorylation of α-Synuclein Induces Unfolded Protein Response-mediated Cell Death

Serine 129 Phosphorylation of α-Synuclein Induces Unfolded Protein Response-mediated Cell Death THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 34, pp. 23179 –23188, August 22, 2008 © 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Serine 129 Phosphorylation of -Synuclein Induces Unfolded Protein Response-mediated Cell Death Received for publication, March 20, 2008, and in revised form, June 18, 2008 Published, JBC Papers in Press, June 18, 2008, DOI 10.1074/jbc.M802223200 ‡ ‡1 ‡ ‡ ‡ § Naoto Sugeno , Atsushi Takeda , Takafumi Hasegawa , Michiko Kobayashi , Akio Kikuchi , Fumiaki Mori , § ‡ Koichi Wakabayashi , and Yasuto Itoyama From the Department of Neurology, Tohoku University School of Medicine, 1-1 Seiryomachi, Aobaku, Sendai, Miyagi 980-8574, Japan and the Department of Neuropathology, Institute of Brain Science, Hirosaki University School of Medicine, 5 Zaifu-cho, Hirosaki 036-8562, Japan -Synuclein is a major protein component deposited in Lewy ing neurons, although the mechanism that underlies LB bio- bodies and Lewy neurites that is extensively phosphorylated at genesis is poorly understood (2, 3). -Synuclein is a 140-amino Ser , although its role in neuronal degeneration is still elusive. In acid protein physiologically localized in presynaptic terminals this study, several apoptotic pathways were examined in (4, 5) and pathologically aggregated in hallmark inclusions, -synuclein-overexpressing SH-SY5Y cells. Following the treat- such as LB and Lewy neurites (6). Furthermore, point muta- mentwithrotenone,amitochondrialcomplexIinhibitor,wildtype tions (A53T, A30P, and E46K) or gene multiplications of -synuclein-overexpressing cells demonstrated intracellular -synuclein were proved to be responsible for familial PD aggregations, which shared a number of features with Lewy bodies, (7–10). Thus, it is suggested that -synuclein plays a key role in although cells overexpressing the S129A mutant, in which phos- the neurodegenerative process of synucleinopathies (11). It has phorylation at Ser was blocked, showed few aggregations. In been demonstrated that -synuclein undergoes several post- wildtype-synucleincellstreatedwithrotenone,theproportionof translational modifications (5). Among them, serine 129 phos- phosphorylated -synuclein was about 1.6 times higher than that phorylation is thought to be one of the most important events of untreated cells. Moreover, induction of unfolded protein (12–15), because it has been reported that almost 90% of response (UPR) markers was evident several hours before the -synuclein in LB is phosphorylated at serine 129 (12) and that induction of mitochondrial disruption and caspase-3 activation. the serine 129 phosphorylation is closely associated with aggre- Eukaryotic initiation factor 2, a member of the PERK pathway gate formation in cellular models (16). However, it has not been family, was remarkably activated at early phases. On the other clarified whether the serine 129 phosphorylation plays a critical hand, the S129A mutant failed to activate UPR. Casein kinase 2 role in the pathomechanisms of neuronal death. inhibitor, which decreased -synuclein phosphorylation, also Mitochondrial dysfunction has been implicated in the patho- reduced UPR activation. The -synuclein aggregations were co- genesis of PD and other neurodegenerative diseases (17, 18). localized with a marker for the endoplasmic reticulum-Golgi The administration of rotenone, an inhibitor of mitochondrial intermediate compartment. Taken together, it seems plausi- complex I, induced the major pathological and behavioral fea- ble that -synuclein toxicity is dependent on the phosphoryl- tures of PD in animal and cellular models (19–22). We estab- ation at Ser that induces the UPRs, possibly triggered by lished -synuclein-overexpressing cell lines, which reproduced the disturbed endoplasmic reticulum-Golgi trafficking. LB-like inclusions when exposed to ROS-inducing reagents including rotenone (21). It is still elusive whether aggregate formation is an adaptive response or is directly related to neu- Parkinson’s disease (PD) is the second most common neu- ronal cell death (23). However, mounting evidence suggests rodegenerative disorder (1). Pathologically, it is characterized that such protein aggregates may not directly trigger the cell by the loss of dopamine neurons in the substantia nigra pars death process in neurodegeneration (24, 25). The aggregate for- compacta and the presence of cytoplasmic inclusions (Lewy mation is promoted by incorrect protein structures (26). As bodies (LB)) and dystrophic neurites (Lewy neurites) in surviv- adaptive responses against the accumulation of misfolded or difficult to fold proteins, the unfolded protein response (UPR) regulates both protein translation and gene transcription to * The costs of publication of this article were defrayed in part by the payment help the function. Thus, the UPR induction is cytoprotective, of page charges. This article must therefore be hereby marked “advertise- ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. but if it fails to remedy the situation, the ER function is dis- To whom correspondence should be addressed: 1-1 Seiryomachi, Aobaku, rupted, and apoptosis is initiated (27). It was revealed that Sendai 980-8574, Japan. Tel.: 81-22-717-7189; Fax: 81-22-717-7192; E-mail: -synuclein blocks ER-Golgi trafficking and induces UPR in a [email protected]. The abbreviations used are: PD, Parkinson disease; CHOP, CCAAT enhancer- yeast model (28). Furthermore, mutations in the familial PD- binding protein homologous transcription factor; CK, casein kinase; related gene, parkin, are also associated with ER-mediated UPR -COP,-coat protein; DCF, 2,7-dichlorodihydrofluorescein; DMAT, 2-Dim- (29). These results suggest that the UPR pathway may consti- ethylamino-4,5,6,7-tetrabromo-1H-benzimidazole; eIF2, eukaryotic initi- ation factor 2; ER, endoplasmic reticulum; ERGIC, ER-Golgi intermediate tute common pathomechanisms in nigral degeneration. compartment; JNK, c-Jun N-terminal kinase; LB, Lewy bodies; MTT, 3-(4,5- In this study using a cellular model overexpressing wild type dimethelthiazo-2-yl)-2,5-diphenyltetrazolium bromide; PBS, phosphate- (WT) -synuclein, we showed that the appearance of UPR buffered saline; ROS, reactive oxygen species; UPR, unfolded protein response; WT, wild type; CAT, chloramphenicol acetyltransferase. markers, especially activation of the PERK (PKR-like ER kinase) This is an Open Access article under the CC BY license. AUGUST 22, 2008• VOLUME 283 • NUMBER 34 JOURNAL OF BIOLOGICAL CHEMISTRY 23179 Serine 129 Phosphorylation Induces ER Stress pathway, was evident several hours before disruption of the avidin-biotin-peroxidase complex method with a Vectastain ABC mitochondria. In contrast, the S129A -synuclein-expressing kit (Vector, Burlingame, CA). Monoclonal antibody against cells showed much less UPR induction. Our data suggested that -COP (-coat protein, 1:100; Sigma) was used as primary anti- phosphorylation of -synuclein at serine 129 plays a key role in body. The sections were pretreated by heating for 15 min at 121 °C. -synuclein-related cell death, which is triggered by UPR Diaminobenzidine was used as the chromogen. The sections were activation. counterstained with hematoxylin. Immunoblot Analyses—After treatment with rotenone for EXPERIMENTAL PROCEDURES the preparation of whole cell lysates, the cells were washed Expression Construct and Cell Culture—The WT -synuclein three times with PBS and sonicated in 100 mM Tris-HCl, 8% cDNA was subcloned into the pUC18 vector at SalI and SphI sites SDS, 1% Tween 20 containing the protease inhibitors, 1 mM and the S129A mutant was generated by site-directed mutagenesis phenylmethylsulfonyl fluoride, 5 g/ml of pepstain A, 5 g/ml TM (Takara LA PCR in vitro mutagenesis kit; Takara Biomedicals, of leupeptin, and 5 g/ml of aprotinin. Twenty microgram of Tokyo, Japan). The cDNAs were introduced into the eukaryotic total protein determined by the BCA assay (Pierce) were sepa- episomal vector pCEP4 (Invitrogen). In a mock construct, the rated by SDS-PAGE and then transferred onto polyvinylidene chloramphenicol acetyltransferase (CAT) gene was substituted for difluoride membrane (Millipore Corp., Bedford, MA). The -synuclein. The SH-SY5Y cells were cultured in Dulbecco’s mod- membranes were incubated with primary antibodies (described ified Eagle’s medium supplemented with 10% fetal bovine serum below) for 60 min. After vigorous washing, a rabbit anti-mouse (Invitrogen) at 37 °C in 5% of CO and were transfected by these IgG-horseradish peroxidase-conjugated antibody (1:2000; constructs using DOTAP (N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N- DAKO, Denmark) or goat anti-rabbit IgG-horseradish peroxi- trimethylammonium methyl-sulfate) lipofection system (Roche dase-conjugated antibody (1:2000; Santa Cruz Biotechnology, Applied Science). To evaluate cell viability, transfected cells were Santa Cruz, CA) were used as secondary antibodies and devel- plated at a density of 5  10 cells/well in 96-well plates and oped by using an ECL detection kit (GE Healthcare) combined allowed to grow in regular medium for 24 h, and then the cultures with an image analyzer (LAS-3000; Fuji Photo Film, Tokyo, were exposed to 10 nM of rotenone (Sigma) for 24 to 120 h. Cell Japan). survival rates were evaluated using the 3-(4,5-dimethelthiazo-2- Immunoprecipitation and Casein Kinase Reaction—For yl)-2,5-diphenyltetrazolium bromide (MTT) assay. immunoprecipitation, the cells were washed with TS buffer (50 Immunocytochemistry—Cells grown on poly-L-lysine coated mM Tris-HCl, 150 mM NaCl, pH 7.6) and harvested in radioim- coverslips were fixed with 4% paraformaldehyde for 20 min and mune precipitation assay buffer (50 mM Tris-HCl, 150 mM permeabilized with 0.5% Triton X-100 in PBS for 10 min. After NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 a brief wash with PBS, the cells were incubated in a blocking mM phenylmethylsulfonyl fluoride, 5 g/ml of pepstain A, 5 solution (1.5% normal goat serum in PBS) with 10 g/ml of g/ml of leupeptin, and 5 g/ml of aprotinin, pH 7.5). The RNase for 30 min and treated with the primary antibodies lysates were sonicated and centrifuged 12,000  g for 5 min, (described below) for2hat room temperature. After washing and supernatants were isolated. Equal amounts of protein were with PBS, the cells were incubated with fluorescent dye (Alexa incubated with 10 g of a monoclonal antibody against 488 and/or Alexa 568)-conjugated goat anti-mouse or anti-rab- -synuclein (Millipore; syn211) at 4 °C overnight and then bit antibodies (1:1000; Molecular Probes, Eugene, OR) for1hat incubated with protein G plus agarose (GE Healthcare) at 4 °C room temperature. The nuclei were counterstained with TO- 1 h. For serine phosphorylation, immunoprecipitates were PRO3 (Molecular Probes). Fluorescent images were analyzed washed three times with kinase buffer (20 mM Tris-HCl, 50 mM with a confocal laser scanning microscope (Fluoview FV300, KCl, 10 mM MgCl , pH 7.5) and incubated with 1,000 units of Olympus, Tokyo, Japan). To evaluate the effect of -synuclein casein kinase 2 (CK2; New England Biolabs) in the presence of toxicity on the mitochondrial membrane potential ( ), we 0.2 mM ofATPfor1hat30 °C.The reaction was terminated by adopted a fluorescent indicator, JC-1 (10 mg/ml for 10min, Molec- addition of SDS-PAGE sample buffer. The samples were boiled for ular Probes) (30). All of the images were scanned by laser scanning 3 min and separated on a SDS-PAGE. Proteins were detected with microscope in identical conditions of 512  512, 12 bit/pixel res- either an anti--synuclein antibody or an anti-phosphorylated olution, the photo multiplier tube voltages of argon and krypton -synuclein antibody. For the experiment of casein kinase inhibi- were 630, and the gain and the background offset were 0. At each tion, the cells were incubated with rotenone in the presence of CK2 time point, 10–20 cells in six randomly chosen fields were ana- inhibitor (DMAT (2-Dimethylamino-4,5,6,7-tetrabromo-1H- lyzed to evaluate the 527:590 nm signal ratio by using the macro benzimidazole); calbiochem, Darmstadt, Germany, 1 M). To program in the Image-Pro Plus software (MediaCybernetics; examine the effect of CK2 inhibitor on eIF2 phosphorylation, Bethesda, MD). Intracellular ROS were detected by the 2,7-dichlo- SH-SY5Y cell lines were incubated with 10 g/l of tunicamycin rodihydrofluorescein (DCF) diacetate (Molecular Probes) as a flu- (Calbiochem) and 0.2–5 M of DMAT. Protein samples from orescent probe. Briefly, after washing with PBS, the cells were these cells were analyzed by Western blots. incubated with Dulbecco’s modified Eagle’s medium for 20 min. Real Time PCR—Total RNA samples were isolated by using Following extensive washing in PBS, the intracellular levels of ROS the acid phenol method (RNA-bee; Tel-Test, Friendswood, were evaluated by laser scanning microscope. Four-micrometer- TX) according to the manufacturer’s instructions. Comple- thick, paraffin-embedded sections including the substantia nigra, mentary DNA was synthesized from RNA samples using Super- locus ceruleus, and dorsal vagal nucleus from five patients with PD ScriptIII (Invitrogen) containing oligo(dT) . Quantitative real were subjected to immunohistochemical investigations using the time PCR was run in LightCycler1.0 (Roche Applied Science). 23180 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 34 •AUGUST 22, 2008 Serine 129 Phosphorylation Induces ER Stress synuclein phosphorylated at serine 129 monoclonal antibody (Pser#64; phosphory lated- -Syn WAKO, Osaka, Japan), rabbit α-Syn phosphory lated- -Syn α anti--synuclein phosphorylated at serine 129 polyclonal antibodies -tubulin α-Syn (gift from Dr. Iwatsubo), mouse CAT W T S129A 1 2 3 monoclonal anti--COP antibody (Sigma), mouse monoclonal anti- * D ERGIC-53 antibody (LifeSpan Biosciences, Seattle, WA), mouse 4 100 * monoclonal anti--tubulin anti- 80 body (Sigma), lysosome (Lyso- tracker; Invitrogen), rabbit poly- clonal ER antibodies (PDI; Stressgen, Victoria, Canada), rabbit polyclonal Golgi antibodies (NUCB; 0 AVIVA systems biology, San Diego, 1 2 3 CAT WT S129A CA), rabbit polyclonal anti-acti- vated caspase-9 antibodies (Cell FIGURE 1. The S129A mutation blocked -synuclein phosphorylation at serine 129. A, cells were stably transfected with WT or S129A -synuclein. Cell lysates were analyzed by immunoblotting using anti-- Signaling Technology, Danvers, synuclein antibody (-Syn, LB509) or anti-phosphorylated -synuclein antibody (phosphorylated -Syn, MA), rabbit polyclonal anti-acti- Pser#64). -Tubulin was used as a loading control. B, the signal intensities per cell were quantified from images of immunostaining using anti-phosphorylated -synuclein antibody. For each sample, eight random fields vated caspase-3 antibodies (Cell Sig- were selected for counting. The results were analyzed by one-way analysis of variance test and were shown as naling Technology), rabbit polyclonal the means  S.E. *, p  0.001 versus both CAT and S129A. C, cell lysates were immunoprecipitated by the anti-phospho-IRE1 antibodies anti--synuclein antibody and analyzed by Western blots. Lane 1, samples of untreated cells; lane 2, samples of rotenone-treated cells; lane 3, samples of untreated cells were phosphorylated by CK2. D, relative ratio of (Novus Biologicals, Littleton, CO), phosphorylated -synuclein (phosphorylated -Syn) against total -synuclein (-Syn) was evaluated by West- rabbit polyclonal anti-phospho- ern blots. The value of samples treated with CK2 was defined as 100%. The data from four individual experi- PERK antibodies (Santa Cruz Bio- ments were analyzed by one-way analysis of variance. Lanes 1–3 were the same as those in C. The results were analyzed by one-way analysis of variance test and were shown as the means S.E. (n 4). *, p 0.01 versus0h. technology), rabbit polyclonal anti- phospho-eIF2 antibodies (Cell The relative amounts of mRNAs were calculated from the sec- Signaling Technology), rabbit polyclonal anti-c-Jun N-terminal ond derivative maximum method using -actin as a control. kinase (JNK) antibodies (Cell Signaling Technology), and rabbit Primer sequences were designed by the Universal Probe Library polyclonal anti-phospho-JNK antibodies (Cell Signaling Assay Design Center (Roche Applied Science). The following Technology). primers were used: BiP forward, AGCTGTAGCGTATGGTG- Statistical Analyses—The data were analyzed by one-way CTG; BiP reverse, AAGGGGACATACATCAAGCAG; Erdj4 analyses of variance and posts hoc multiple comparison using forward CCACCCTGACAAAAATAAGAGC; Erdj4 reverse, Newman-Keul’s multiple comparison test or two-way analyses CGTCTATTAGCATCTGAGAGTGTTTC; CHOP forward, of variance and posts hoc multiple comparison using Bonferro- AGCTGGAACCTGAGGAGAGA; CHOP reverse, TGGATCA- ni’s test on GraphPad Prism version 4.03 for Windows (Graph- GTCTGGAAAAGCA; -actin forward, CCAACCGCGAGAA- Pad Software, San Diego, CA). GATGA; and-actin reverse, CCAGAGGCGTACAGGGATAG. RESULTS Assay for Proteasome Activity—The proteasome activity was quantified using a 20 S proteasome assay kit (Affinity Research Low Dose and Long Time Exposure of Rotenone Preferentially Product, Exeter, UK). Briefly, the cells were washed three times Induced Intracellular Aggregates in -Synuclein-overexpressing with PBS, resuspended into a buffer containing 50 mM Tris/ Cells—Following the transfection of WT or S129A mutant HCl, pH 7.5, 25 mM KCl, 10 mM NaCl, and 1 mM MgCl and -synuclein constructs, the immunocytochemical examination then lysed by a brief sonication. The lysates were incubated demonstrated diffuse staining of -synuclein in the entire cyto- with the fluorogenic substrate, Suc-Leu-Leu-Val-Tyr-AMC, at plasm. There were no obvious changes in the growth and mor- 37 °C for 30 min. The proteasome activity was detected by phology of these transfected cells as previously described (21). changes in fluorescence intensity at 355 nm of excitation and The Western blot revealed that there were no differences in the 460 nm of emission using an automatic multi-well fluorometer expression levels and molecular sizes between WT and S129A- (Fluoroscan Ascent; Labsystems, Helsinki, Finland). The rela- expressing cells, although the latter failed to show positive tive activity was standardized by the protein concentrations bands for anti-phosphorylated -synuclein antibody (Fig. 1A). determined by the BCA method. To confirm the loss of phosphorylation at serine 129 in the Antibodies—The following primary antibodies were used in S129A mutant, the cells were stained by anti-phosphorylated immunocytochemistry and Western blots: mouse monoclonal -synuclein monoclonal antibody (Pser#64) (12), and the signal anti--synuclein antibody (LB509; Zymed Laboratories Inc., intensities per cell were quantified. The signal intensities in WT South San Francisco, CA), rabbit polyclonal anti--synuclein -synuclein-expressing cells were significantly higher than antibodies (AB5038; Chemicon, Temecula, CA), mouse anti-- those in the other two cell lines (Fig. 1B). To evaluate amounts AUGUST 22, 2008• VOLUME 283 • NUMBER 34 JOURNAL OF BIOLOGICAL CHEMISTRY 23181 Signal intensity per cell phosphorylated-α -Syn /α -Syn (%) Serine 129 Phosphorylation Induces ER Stress CAT ** WT ** S129A A 8 (c) (a) (b) ERGIC Syn-p (β-COP) Merge (d) (e) (f) 0 24 72 120 ERGIC Time (hour) Syn-p (ERGIC-53) Merge (h) (i) (g) Me Syn-m rge ER (j) (k) (l) Syn-m Golgi Merge (m) (n) (o) Lysosome Merge Syn-p FIGURE 2. Characterization of intracellular aggregations and their incidence in each cell line. A, the SH-SY5Y cells overexpressing WT -synuclein showed intracellular aggregations after 120 h of exposure to rotenone at 10 nM. The cells were co-stained with polyclonal phosphorylated -synuclein (Syn-p; panels a, d, and m), monoclonal phosphorylated-synuclein (Syn-m; panels g and j), ERGIC (-COP; panel b, ERGIC-53; panel e), ER (PDI; panel h), Golgi (NUCB; panel k), and lysosome (Lysotracker; panel n). In panels c, f, i, l, and o, the images were merged from each of left two ones, and the nuclei were stained with TO-PRO3 (blue). The scale bars indicate 10 m. B, cells were treated with the same concentration of rotenone for 24 –120 h, and then the incidence of intracellular aggregations was quantified. For each sample, eight random fields were selected for counting. The results were analyzed by two-way analysis of variance test and were shown as the means  S.E. *, p  0.05 versus both CAT and S129A; **, p  0.001 versus both CAT and S129A. C, sections from the locus ceruleus (panel a) and the dorsal vagal nucleus (panel b) from patients with PD. LB in the locus ceruleus (panel a) and ring-like (panel b, center left) and homogenous LBs (panel b, center right) in the dorsal vagal nucleus were immunopositive for -COP. The scale bars indicate 10 m. of phosphorylated -synuclein after a short time of (6 h) expo- -synuclein following CK2 treatment (Fig. 1C, lane 3) was sure of rotenone, immunoprecipitation experiments were con- defined as 100%, 50% of -synuclein was phosphorylated in ducted using an antibody recognizing -synuclein, and then a untreated -synuclein-overexpressing cells, and 80% was phos- part of immunoprecipitates was incubated with CK2. The sam- phorylated following rotenone treatment (Fig. 1D). The data ples were analyzed on Western blots using antibody against were quantified by densitometry from four independent exper- -synuclein or that of phosphorylated form. Increased amounts iments of Western blots (Fig. 1D). After 120 h of treatment with of phosphorylated -synuclein were evident after rotenone rotenone (10 nM), intracellular aggregates were observed in WT exposure (Fig. 1C). When the amount of phosphorylated -synuclein-expressing cells (Fig. 2A). The aggregates were 23182 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 34 •AUGUST 22, 2008 Cells with aggregation (%) Serine 129 Phosphorylation Induces ER Stress immunopositive for anti--synuclein, anti-phosphorylated -synuclein, anti-ubiquitin, and anti-neurofilament antibodies 1.2 (data not shown). The aggregates were also co-localized with -COP and ERGIC-53, the marker for the ER-Golgi intermedi- 1.0 ate compartment (ERGIC) (31) but not with a marker for ER, lysosome, and Golgi (Fig. 2A). Furthermore, some LBs in autop- sied brain were also immunopositive for -COP (Fig. 2C). After 0.8 24 h exposure, the cells expressing the S129A mutant showed much fewer aggregations compared with cells expressing WT 0.6 (Fig. 2B), which was in good agreement with the previous reports (16, 32). At 120 h of exposure, 10% of WT cells were aggregate-positive but only 1% positive of S129A cells (Fig. 2B). 0.4 The incidence of aggregates was roughly dependent on the CAT period of rotenone exposure (Fig. 2B). 0.2 WT S129A Mutation Ameliorates Cell Toxicity Induced by S129A -Synuclein Overexpression—Because of initial medium changes for rotenone treatments, values of MTT assay were 0.0 transiently decreased during first 24 h in all cell lines. However, 0 24 72 96 120 after that, the viability of WT -synuclein-expressing cells was Time (hour) dramatically reduced compared with those of CAT- and S129A-expressing cells (Fig. 3A). To assess whether apoptotic processes played a role in this cellular model, cells overexpress- CAT ing CAT, WT, and S129A were double-stained by anti-- WT synuclein and anti-activated caspase-3 antibodies after the S129A treatment with 10 nM of rotenone for 0–120 h. In WT -synuclein-overexpressing cells, activated caspase-3-positive cells were increased after the exposure to rotenone (Fig. 3B). The incidence of activated caspase-3-positive cells was signifi- cantly higher in the WT than in the CAT and S129A mutants after 72 h of exposure of rotenone (Fig. 3B). Thus, it is suggested that the cell death in this model was based on apoptotic processes. Mitochondrial Dysfunction Following Rotenone Treatment— To evaluate the cell death process in this model, we investigated the mitochondrial membrane potential by the JC-1 staining method, in which red represents a normal mitochondrial mem- brane potential ( ), and green represents decreased mito- 0 24 72 120 chondrial membrane potential. In each image, the green/red Time (hour) signal intensity ratio was calculated. In WT -synuclein-ex- FIGURE 3. Evaluation of cell viability and apoptosis. A, the SH-SY5Y cells pressing cells, the green/red score was much more increased overexpressing WT or S129A-synuclein were treated with 10 nM of rotenone after 24 h of exposure to rotenone (Fig. 4A). Consistent with for 24 to 120 h. Cell viability was assessed using MTT assay, and the results the cytochemical data, immunoblots also indicated that acti- were expressed as cell survival rates compared with those of no treatment controls (0 h). The values were represented as the means S.E. (n 6). *, p vated caspase-3 expression was more increased in WT 0.001 versus both CAT and S129A. B, activated caspase-3 positive cells were -synuclein cells compared with CAT and S129A cells (Fig. counted following the rotenone treatment at 10 nM for 24 –120 h. For each sample, eight random fields were selected for counting. The results were 4B). Activated caspase-9 induction did not precede caspase-3 analyzed by two-way analysis of variance test and were shown as the activation (Fig. 4C). On the other hand, DCF signal intensities means  S.E. *, p  0.05 versus both CAT and S129A. were significantly elevated after 72 h of treatment of rotenone, but there were little difference in the ROS levels among the (33); BiP, a target shared by all UPR pathways (34, 35); and three cell lines (Fig. 4D). Only in WT -synuclein-expressing CHOP, a downstream target of the PERK/activating transcrip- cells, JNK inactivation was observed until 120 h after the rote- tional factor 4 pathway (34). In WT -synuclein cells, the Erdj4 none exposure. However, in CAT and S129A mutant cells, the and CHOP mRNA levels were elevated (Fig. 5, A and B), but in JNK activation was less prominent (Fig. 4E). The results were CAT cells the Erdj4 mRNA levels were not elevated signifi- quantified by densitometry from three independent experi- cantly (p  0.06) after 24 h of rotenone exposure (Fig. 5C). The ments (Fig. 4, B, C, and E). induction of CHOP in WT -synuclein cells was also observed in Unfolded Protein Responses Precede Mitochondrial Western blot experiments (data not shown). Although the Dysfunction—The levels of transcripts for three target genes of p-IRE1 and p-PERK expression showed few changes during the the UPR were measured by real time PCR. The three target observed period (0–120 h) (Fig. 5, D and E), higher expression of genes were MDG1/Erdj4, a specific target of the Xbp-1 pathway p-eIF2 was exhibited in the WT cells between 6 and 12 h of rote- AUGUST 22, 2008• VOLUME 283 • NUMBER 34 JOURNAL OF BIOLOGICAL CHEMISTRY 23183 Rate of viable cells Activated caspase-3 positive cell (%) Serine 129 Phosphorylation Induces ER Stress CAT WT S129A CAT WT S129A 0 12 24 72 Time (hour) CAT ** WT S129A 0 12 24 72 ** * Time (hour) 1.75 CAT ## 1.50 # WT 1.25 S129A 1.00 0 6 12 24 72 120 0.75 Time (hour) 0.50 0.25 2.5 CAT 0.00 ** 0 6 12 24 72 120 WT 2.0 Time (hour) S129A 1.5 ** 1.0 0.5 0.0 0 6 12 24 72 120 Time (hour) FIGURE 4. Changes in mitochondrial function and oxidative stress. A, mitochondrial membrane potential stain was demonstrated by JC-1. The intensity of green color (decreased mitochondrial membrane potential ( )) was divided by the intensity of red color (reporter molecule). As shown, only WT cells showed transient damages after 24 h. For each sample, eight random fields were selected for counting. The results were analyzed by two-way analysis of variance test and were shown as the means  S.E. *, p  0.001 versus CAT, p  0.01 versus S129A. B and C, activation of apoptosis-related molecules was evaluated by Western blots. The figure represents the immunoreactivity of activated caspase-3 (B) and activated caspase-9 (C) against -tubulin (loading control). The results were analyzed by two-way analysis of variance test and were shown as the means S.E. (n 3). *, p 0.001 versus CAT. **, p 0.001 versus CAT and S129A. D, intracellular ROSs were measured by signal intensities of DCF staining after 10 nM rotenone treatment. The images from laser scanning microscope were quantified per cell. Eight random fields were selected for counting. The results were analyzed by two-way analysis of variance test and were shown as the means  S.E. *, p  0.05 versus 0h. E, the figure represents immunoreactivity of phosphorylated-JNK (p-JNK) against JNK (loading control). The results were analyzed by two-way analysis of variance test and were shown as the means S.E. (n 3). *, p 0.01 versus CAT. #, p 0.01 versus S129A. ##, p 0.001 versus S129A. none exposure (Fig. 5F). The results were quantified by densitom- cells, the proteasome activities showed few changes during the etry from three independent experiments (Fig. 5, D–F). observed period (Fig. 6). Proteasome Activity Is Elevated in WT -Synuclein-express- Casein Kinase 2 Inhibitor Blocked UPR Activation Caused by ing Cells—Three cell samples were prepared at each time point Rotenone Exposure—Cells overexpressing -synuclein were to measure the proteasome activities. In WT -synuclein cells, cultured with rotenone and casein kinase inhibitors for 6 h. elevation of proteasome activities were moderate at 12 h and Casein kinase 2 inhibitor DMAT (1 M) decreased not only were significant at 24 h following 10 nM rotenone treatment phosphorylation of -synuclein but also expression of p-eIF2 (Fig. 6). On the other hand, in CAT and S129A -synuclein induced by rotenone. Casein kinase 1 inhibitor (0.2–4 M) also 23184 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 34 •AUGUST 22, 2008 Green / Red (%; signal intensity) caspase-9 / -tubulin caspase-3 / β-tubulin DCF signal intensity per cells p-JNK / JNK Serine 129 Phosphorylation Induces ER Stress none exposure at low doses (10 nM) A Erdj4 and for a relatively longer time (up 0.07 CAT to 120 h). Under this condition, ** WT 0.06 approximately half of the complex I S129A activities were inhibited (36). High 0.05 CAT 2.0 doses (100 nM) and short duration WT 0.04 (within 24 h) exposure to rotenone S129A 1.5 0.03 induced only 2–3% aggregate-posi- 1.0 tive cells (data not shown), but low 0.02 doses and long time exposure pro- 0.5 0.01 duced about 10% of aggregate-posi- tive cells (Fig. 2B). Immunocyto- 0.0 0.00 0 6 12 24 72 120 0 12 24 chemical experiments revealed that Time (hour) Time (hour) intracellular aggregates were immu- nopositive for -synuclein, phos- B BiP 1.5 CAT phorylated -synuclein, ubiquitin, 0.04 CAT WT and neurofilament (data not WT S129A 1.0 shown). These results indicated that S129A 0.03 the aggregates shared a number of pathological features with LB (12, 0.5 37–39). 0.02 -Synuclein is modulated by sev- 0.0 eral post-translational modifica- 0 6 12 24 72 120 0.01 Time (hour) tions (5). The serine 129 phospho- rylation is thought to be one of the most important post-translational 0.00 ** 0 12 24 # ## modifications (12–14). Several Time (hour) CAT 1.0 reports have described close rela- WT CHOP tionships between serine 129 phos- S129A phorylation of -synuclein and the 0.04 CAT 0.5 PD pathogenesis (12–14). Several WT S129A protein kinases, such as CK1, CK2, 0.03 N.S and a family of G-protein-coupled receptor kinases, have been pro- 0.0 0 6 12 24 72 120 posed as candidates that phospho- 0.02 Time (hour) rylate -synuclein (40, 41). More- over, it has been suggested that the 0.01 haplotype of the G-protein-coupled receptor kinase 5 gene was related 0.00 to sporadic PD (42). However, it is 0 12 24 not clear whether serine 129 phos- Time (hour) phorylation is an essential factor for FIGURE 5. ER stress in each cell after treatment with rotenone. A–C, the levels of mRNA for Erdj4 (A), BiP (B), forming LBs. Although it was and CHOP (C) were quantified by real time PCR and expressed as relative ratios compared with the levels of -actin mRNA as controls. Three independent experiments were performed. The results were analyzed by reported that blocking of serine 129 two-way analysis of variance test and were shown as the means  S.E. *, p  0.01 versus S129A; **, p  0.001 phosphorylation increased inclu- versus S129A. D–F, Western blot analyses of marker proteins of ER stress were carried out using antibodies to sion formation in -synuclein trans- p-IRE1 (D), p-PERK (E), and p-eIF2 (F). Protein amounts were quantified by using anti--tubulin antibody as a loading control. The results were analyzed by two-way analysis of variance test and were shown as the means S.E. genic flies (32), there have been (n 3). *, p 0.01 versus CAT. **, p 0.001 versus CAT. #, p 0.05 versus S129A. ##, p 0.01 versus S129A. some claims against assessing synuclein aggregations in a Dro- reduced -synuclein phosphorylation caused by rotenone (data sophila model. First, flies do not have a counterpart of -synuclein because, phylogenically, the synuclein family is not shown). Then SH-SY5Y cell lines were incubated with the only seen in vertebrates. Second, the reported fly model was ER stress inducer tunicamycin. Phosphorylation of eIF2 induced by tunicamycin (10 g/l) was not suppressed by co-transfected with Gprk2 (40) for -synuclein phosphoryla- DMAT (0.2–5 M). tion, but Gprk2 has not been proven to localize in LB (42, 43). Thus, although Gprk2 can phosphorylate -synuclein in vitro, DISCUSSION it may not contribute to synuclein pathology in vivo.Inour In this study, we attempted to develop a cellular model of PD study using a mammalian cellular model, we clearly showed using -synuclein-overexpressing cells combined with rote- that the S129A mutant-expressing cells, in which the serine 129 AUGUST 22, 2008• VOLUME 283 • NUMBER 34 JOURNAL OF BIOLOGICAL CHEMISTRY 23185 mRNA relative to -actin mRNA relative to β-actin mRNA relative to β-actin p-eIF2α / β-tubulin p-PERK / β-tubulin IRE1α / β-tubulin Serine 129 Phosphorylation Induces ER Stress * Furthermore, an animal model with chronic intravascular infu- sion of rotenone showed a parkinsonian phenotype and nigral degeneration pathology with cytoplasmic inclusions immuno- reactive for -synuclein and ubiquitin (19, 22). Although the 1200 CAT WT cells were treated with rotenone as an environmental insult in S129A the present study, the dose of rotenone was not sufficient to cause cell death in mock cells. To study the intracellular ROS, DCF fluorescence and JNK activation were evaluated. Although the DCF signal intensities were not changed before 72 h of rotenone exposure (Fig. 4D), JNK activation was observed only in WT -synuclein-expressing cells, which might reflect ROS generation induced by synuclein toxicity (Fig. 4E) (48). Then we 0 3 6 12 24 evaluated the mitochondrial function using immunocytochem- Time (hour) istry of JC-1 staining and Western blots using anti-activated FIGURE 6. Proteasome activities in each cell after the rotenone treatment. caspase-9 antibodies. Although in WT -synuclein-overex- Proteasome activities were measured using the cells treated with 10 nM rote- none for the indicated time periods. Assays for chymotrypsin-like activity pressing cells decreased mitochondrial membrane potential by were conducted using proteasome substrates, Suc-LLVY-AMC. The values are JC-1 staining was observed after 24 h of exposure to rotenone expressed as fluorescence (arbitrary units)/mg total protein S.E. Three inde- pendent experiments were performed. *, p  0.05 versus 0 h of WT; #, p  (Fig. 4A), activated caspase-9 expression did not precede 0.001 versus CAT and p  0.01 versus S129A. caspase-3 activation. Thus, it is not plausible that mitochon- drial dysfunction was a primary event triggering apoptosis in phosphorylation was blocked (Fig. 1, A and B), presented much this cellular model. fewer aggregations compared with WT cells (Fig. 2B). This To study other pathways of cell death, we then focused on ER result was in a good agreement with a previous study using stress. It was suggested that UPR is an important pathway in mammalian cells (16). Moreover, we showed that the percent- causing cellular death in nigral neurons of PD brain (29, 49). age of phosphorylated -synuclein was increased from 50 to The investigations of ER stress markers using real time PCR 80% following the rotenone treatment. It was reported in a (Fig. 5, A–C) and Western blots (Fig. 5, D–F) revealed that UPR mammalian cellular model that the expression of S129D was activated within several hours following the rotenone mutant as a phosphorylated -synuclein increased aggregates exposure in WT -synuclein-expressing cells. Especially, compared with WT cells (44). Taken together, phosphorylation p-eIF2, a member of the PERK pathway family, showed of -synuclein at serine 129 appears to facilitate aggregate for- remarkable induction in WT -synuclein-expressing cells (Fig. mation in mammalian cells. 5F). This p-eIF2 expression was detected after6hof rotenone There has been little evidence showing a relationship exposure (Fig. 5F) and preceded the mitochondrial disruption between serine 129 phosphorylation and neuronal cell death. In shown by JC-1 staining (Fig. 4A). Moreover, CHOP was also this study, we demonstrated that blocking of serine 129 phos- activated after the p-eIF2 activation (Fig. 5C), suggesting that phorylation lead to decreased neuronal cell death induced by ER stress was a trigger of apoptosis in which the PERK pathway mitochondrial toxin exposure (Fig. 3, A and B). The treatment played a key role. Recently, it was reported that p-eIF2-posi- of rotenone at 10 nM was too low to cause apparent cellular tive neurons were observed in substantia nigra in PD brain (50) death in SH-SY5Y cells, as indicated by the low activation of and that CHOP was up-regulated in dopaminergic cells of caspase-3 in controlled cells (Figs. 3B and 4B). Moreover, intra- rodent brain treated by 6-OHDA (51). Activation of eIF2 cellular ROS elevation at the early phase was not evident in DCF might be promoted by -synuclein phosphorylation, because staining (Fig. 4D). However, the addition of WT -synuclein the proportion of phosphorylated -synuclein was about 1.6 expression preferentially caused apoptosis even under these higher than that of untreated cells (Fig. 1D). Furthermore, we low dose conditions. Thus, these data suggested that the serine showed that CK2 inhibitor, which was known to block 129 phosphorylation was required not only for aggregate for- -synuclein phosphorylation, decreased p-eIF2 expression mation but also for the induction of -synuclein toxicity. induced by rotenone (Fig. 7). CK2 was thought to be major Because the toxic effect of -synuclein was suggested to be enzyme for the phosphorylation of human -synuclein at associated with intermediate oligomer formation, so-called serine 129 (52). Moreover, its  subunits were co-localized protofibrils (23, 45), the phosphorylation of -synuclein at ser- with LB (53). The CK2 inhibition failed to suppress the ine 129 may be important for the formation of protofibrils. A induction of phosphorylated eIF2 by tunicamycin (Fig. 7B). recent study using NMR also suggested that serine 129 phos- Therefore, it was suggested that CK2 did not directly affect phorylation may destabilize the intramolecular interactions, the eIF2 phosphorylation. Thus, it is possible that p-eIF2 converting -synuclein into more unfolded forms that self-as- may play an important role in the cellular pathogenesis of sociated readily (46). Parkinson disease. Mitochondrial dysfunction has been implicated in the PD The molecular mechanisms by which -synuclein-induced pathogenesis, because MPTP (1-methyl-4-phenyl-1,2,3,6-tet- UPR are still elusive. In the pathomechanisms of poly(Q) dis- rahydropyridine) whose metabolite MPP (1-methyl-4-phe- eases, including Huntington’s disease (54), it is generally nylpyridinium) inhibits complex I of the mitochondrial elec- believed that misfolding proteins trigger the UPR (55) by the tron-transport chain, causes selective nigral cell death (47). robust attenuation of ER-associated degradation followed by 23186 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 34 •AUGUST 22, 2008 Proteasome activity relative ratio Serine 129 Phosphorylation Induces ER Stress exposure to rotenone (Fig. 6). Thus, it appeared that the increased proteasome activity reflected cytoprotective responses because the proteasome activities were increased fol- phosphorylated-α-Syn lowing the UPR induction (Figs. 5 and 6). A previous report using a cellular model with 6-OHDA treatment showed identi- α -Syn cal results and was in good agreement with our data (62). The in vivo proteasome activities have been evaluated in PD brain by several groups, but their results remain controversial (63, 64). p-eIF2α Because the nigral cell death of PD has already started several years before the disease onset (65), it may be difficult to assess rotenone - + + transient events in the neurodegenerative process such as DMAT - - + changes of proteasome activity by using post-mortem tissues from patients with PD, although some reports demonstrated no changes or decreased proteasome activity (63, 64). p-eIF2α In summary, using -synuclein-overexpressing cells exposed to a low dose of rotenone as an environmental toxin, we showed -tubulin β that phosphorylation of -synuclein at serine 129 promoted intracellular aggregate-formation and induced ER stress that was followed by mitochondrial damage and apoptosis. These Tm - + + + + findings contribute to clarifying the pathomechanisms of PD and other related synucleinopathies, in which disturbed ER- DMAT - - 0.2 1 5 Golgi trafficking might play a central role. FIGURE 7. The effect of casein kinase 2 inhibitor in -synuclein phospho- rylation and ER stress. A, the effect of CK2 inhibitor (DMAT) in -synuclein phosphorylation and UPR activation was evaluated by Western blot analyses. Acknowledgments—We thank Dr. T. Iwatsubo for the gift of anti- Cells overexpressing -synuclein were treated with 10 nM of rotenone and 1 phosphorylated -synuclein antibodies, Dr. H. Sawada for techni- M of DMAT. Phosphorylated -synuclein antibody, -synuclein antibody, cal advice about the measurement of proteasome activity, Dr. R. and p-eIF2 antibodies were used. B, the effect of DMAT in eIF2 phospho- Takahashi for critical comments, and Mr. Brent Bell for reading rylation was evaluated by Western blots. SH-SY5Y cell lines were treated with 10 g/l of tunicamycin (Tm) and 0.2–5 M of DMAT. Antibodies for p-eIF2 the manuscript. and -tubulin were used. REFERENCES decreased proteasome activities (27). In contrast, the protea- 1. Dawson, T. M., and Dawson, V. L. (2003) Science 302, 819–822 some activity was not decreased in the present study. Another 2. Olanow, C. W., Perl, D. P., DeMartino, G. N., and McNaught, K. S. (2004) possible explanation for the UPR demonstrated here is that the Lancet Neurol. 3, 496–503 vesicular trafficking may be disturbed in this cellular model. It 3. Shults, C. W. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 1661–1668 was reported that -synuclein blocked ER-Golgi trafficking and 4. Eriksen, J. L., Dawson, T. M., Dickson, D. W., and Petrucelli, L. (2003) Neuron 40, 453–456 might induce the accumulation of proteins in the ER to produce 5. Dev, K. K., Hofele, K., Barbieri, S., Buchman, V. L., and van der Putten, H. ER stress (28). The fact that intracellular aggregates were co- (2003) Neuropharmacology 45, 14–44 localized with both -COP and ERGIC-53 (Fig. 2A, panels a–c 6. Goedert, M. (2001) Nat. Rev. Neurosci. 2, 492–501 and d–f, respectively) strongly supported this hypothesis, 7. Munoz, E., Oliva, R., Obach, V., Marti, M. J., Pastor, P., Ballesta, F., and because these marker proteins were essential molecules for the Tolosa, E. (1997) Neurosci. Lett. 235, 57–60 transport of proteins from ER to Golgi (56, 57). Furthermore, 8. Kruger, R., Kuhn, W., Muller, T., Woitalla, D., Graeber, M., Kosel, S., Przuntek, H., Epplen, J. T., Schols, L., and Riess, O. (1998) Nat. Genet. 18, we showed that some LBs in autopsied brain from patients with 106–108 PD were immunopositive for -COP (Fig. 2C). Although it has 9. Zarranz, J. J., Alegre, J., Gomez-Esteban, J. C., Lezcano, E., Ros, R., Ampu- not been clarified yet how -synuclein blocks ER-Golgi traffick- ero, I., Vidal, L., Hoenicka, J., Rodriguez, O., Atares, B., Llorens, V., Gomez ing, serine 129 phosphorylation seemed to play a key role in Tortosa, E., del Ser, T., Munoz, D. G., and de Yebenes, J. G. (2004) Ann. promoting these processes. Neurol. 55, 164–173 It was reported that WT -synuclein overexpression did not 10. Singleton, A. B., Farrer, M., Johnson, J., Singleton, A., Hague, S., Kacher- gus, J., Hulihan, M., Peuralinna, T., Dutra, A., Nussbaum, R., Lincoln, S., influence the proteasome activity in cellular and animal models Crawley, A., Hanson, M., Maraganore, D., Adler, C., Cookson, M. R., (58–60). However, we demonstrated here that the proteasome Muenter, M., Baptista, M., Miller, D., Blancato, J., Hardy, J., and Gwinn- activities were increased in WT -synuclein-overexpressing Hardy, K. (2003) Science 302, 841 cells after exposure to a low dose of rotenone. It was possible 11. Xu, J., Kao, S. Y., Lee, F. J., Song, W., Jin, L. W., and Yankner, B. A. (2002) that rotenone per se might increase the proteasome activity, Nat. Med. 8, 600–606 12. Fujiwara, H., Hasegawa, M., Dohmae, N., Kawashima, A., Masliah, E., because MPP (1-methyl-4-phenylpyridinium), another com- Goldberg, M. S., Shen, J., Takio, K., and Iwatsubo, T. (2002) Nat. Cell Biol. plex I inhibitor, was shown to induce proteasome activity in 4, 160–164 cultured cells (61). However, the dose of rotenone in the pres- 13. Kahle, P. J., Neumann, M., Ozmen, L., Muller, V., Jacobsen, H., Spooren, ent study was not sufficient to change proteasome activity, W., Fuss, B., Mallon, B., Macklin, W. B., Fujiwara, H., Hasegawa, M., Iwat- because no changes in the proteasome activities were observed subo, T., Kretzschmar, H. A., and Haass, C. (2002) EMBO Rep. 3, 583–588 in CAT and S129A -synuclein-overexpressing cells under 14. Takahashi, M., Kanuka, H., Fujiwara, H., Koyama, A., Hasegawa, M., AUGUST 22, 2008• VOLUME 283 • NUMBER 34 JOURNAL OF BIOLOGICAL CHEMISTRY 23187 Serine 129 Phosphorylation Induces ER Stress Miura, M., and Iwatsubo, T. (2003) Neurosci. Lett. 336, 155–158 Meijer, L., Kahle, P. J., and Haass, C. (2000) J. Biol. Chem. 275, 390–397 15. Anderson, J. P., Walker, D. E., Goldstein, J. M., de Laat, R., Banducci, K., 42. Arawaka, S., Wada, M., Goto, S., Karube, H., Sakamoto, M., Ren, C. H., Caccavello, R. J., Barbour, R., Huang, J., Kling, K., Lee, M., Diep, L., Keim, Koyama, S., Nagasawa, H., Kimura, H., Kawanami, T., Kurita, K., Tajima, P. S., Shen, X., Chataway, T., Schlossmacher, M. G., Seubert, P., Schenk, K., Daimon, M., Baba, M., Kido, T., Saino, S., Goto, K., Asao, H., Kitanaka, D., Sinha, S., Gai, W. P., and Chilcote, T. J. (2006) J. Biol. Chem. 281, C., Takashita, E., Hongo, S., Nakamura, T., Kayama, T., Suzuki, Y., Koba- 29739–29752 yashi, K., Katagiri, T., Kurokawa, K., Kurimura, M., Toyoshima, I., Niizato, 16. Smith, W. W., Margolis, R. L., Li, X., Troncoso, J. C., Lee, M. K., Dawson, K., Tsuchiya, K., Iwatsubo, T., Muramatsu, M., Matsumine, H., and Kato, V. L., Dawson, T. M., Iwatsubo, T., and Ross, C. A. (2005) J. Neurosci. 25, T. (2006) J. Neurosci. 26, 9227–9238 5544–5552 43. Takahashi, M., Uchikado, H., Caprotti, D., Weidenheim, K. M., Dickson, 17. Olanow, C. W., and Tatton, W. G. (1999) Annu. Rev. Neurosci. 22, D. W., Ksiezak-Reding, H., and Pasinetti, G. M. (2006) J. Neuropathol. Exp. 123–144 Neurol. 65, 1157–1169 18. Lin, M. T., and Beal, M. F. (2006) Nature 443, 787–795 44. Liu, C., Fei, E., Jia, N., Wang, H., Tao, R., Iwata, A., Nukina, N., Zhou, J., and 19. Betarbet, R., Sherer, T. B., MacKenzie, G., Garcia-Osuna, M., Panov, A. V., Wang, G. (2007) J. Biol. Chem. 282, 14558–14566 and Greenamyre, J. T. (2000) Nat. Neurosci. 3, 1301–1306 45. Takeda, A., Hasegawa, T., Matsuzaki-Kobayashi, M., Sugeno, N., Kikuchi, 20. Sherer, T. B., Richardson, J. R., Testa, C. M., Seo, B. B., Panov, A. V., Yagi, A., Itoyama, Y., and Furukawa, K. (2006) J. Biomed. Biotechnol. 2006, T., Matsuno-Yagi, A., Miller, G. W., and Greenamyre, J. T. (2007) J. Neu- 19365–19368 rochem. 100, 1469–1479 46. Sasakawa, H., Sakata, E., Yamaguchi, Y., Masuda, M., Mori, T., Kurimoto, 21. Matsuzaki, M., Hasegawa, T., Takeda, A., Kikuchi, A., Furukawa, K., Kato, E., Iguchi, T., Hisanaga, S., Iwatsubo, T., Hasegawa, M., and Kato, K. (2007) Y., and Itoyama, Y. (2004) Brain Res. 1004, 83–90 Biochem. Biophys. Res. Commun. 363, 795–799 22. Sherer, T. B., Kim, J. H., Betarbet, R., and Greenamyre, J. T. (2003) Exp. 47. Langston, J. W., Ballard, P., Tetrud, J. W., and Irwin, I. (1983) Science 219, Neurol. 179, 9–16 979–980 23. Periquet, M., Fulga, T., Myllykangas, L., Schlossmacher, M. G., and Feany, 48. Borsello, T., and Forloni, G. (2007) Curr. Pharm. Des. 13, 1875–1886 M. B. (2007) J. Neurosci. 27, 3338–3346 49. Wang, H. Q., and Takahashi, R. (2007) Antioxid. Redox. Signal 9, 553–561 24. Lansbury, P. T., and Lashuel, H. A. (2006) Nature 443, 774–779 50. Hoozemans, J. J., van Haastert, E. S., Eikelenboom, P., de Vos, R. A., Roz- 25. Masliah, E., Rockenstein, E., Veinbergs, I., Mallory, M., Hashimoto, M., emuller, J. M., and Scheper, W. (2007) Biochem. Biophys. Res. Commun. Takeda, A., Sagara, Y., Sisk, A., and Mucke, L. (2000) Science 287, 354, 707–711 1265–1269 51. Silva, R. M., Ries, V., Oo, T. F., Yarygina, O., Jackson-Lewis, V., Ryu, E. J., 26. Volles, M. J., and Lansbury, P. T., Jr. (2003) Biochemistry 42, 7871–7878 Lu, P. D., Marciniak, S. J., Ron, D., Przedborski, S., Kholodilov, N., Greene, 27. Schroder, M., and Kaufman, R. J. (2005) Annu. Rev. Biochem. 74, 739–789 L. A., and Burke, R. E. (2005) J. Neurochem. 95, 974–986 28. Cooper, A. A., Gitler, A. D., Cashikar, A., Haynes, C. M., Hill, K. J., Bhullar, 52. Ishii, A., Nonaka, T., Taniguchi, S., Saito, T., Arai, T., Mann, D., Iwatsubo, B., Liu, K., Xu, K., Strathearn, K. E., Liu, F., Cao, S., Caldwell, K. A., Cald- T., Hisanaga, S., Goedert, M., and Hasegawa, M. (2007) FEBS Lett. 581, well, G. A., Marsischky, G., Kolodner, R. D., Labaer, J., Rochet, J. C., Bonini, 4711–4717 N. M., and Lindquist, S. (2006) Science 313, 324–328 53. Ryu, M. Y., Kim, D. W., Arima, K., Mouradian, M. M., Kim, S. U., and Lee, 29. Imai, Y., Soda, M., Inoue, H., Hattori, N., Mizuno, Y., and Takahashi, R. G. (2008) J. Neurol. Sci. 266, 9–12 (2001) Cell 105, 891–902 54. Wacker, J. L., Zareie, M. H., Fong, H., Sarikaya, M., and Muchowski, P. J. 30. Smiley, S. T., Reers, M., Mottola-Hartshorn, C., Lin, M., Chen, A., Smith, (2004) Nat. Struct. Mol. Biol. 11, 1215–1222 T. W., Steele, G. D., Jr., and Chen, L. B. (1991) Proc. Natl. Acad. Sci. U. S. A. 55. Dobson, C. M. (2003) Nature 426, 884–890 88, 3671–3675 56. Pepperkok, R., Scheel, J., Horstmann, H., Hauri, H. P., Griffiths, G., and 31. Duden, R., Griffiths, G., Frank, R., Argos, P., and Kreis, T. E. (1991) Cell 64, Kreis, T. E. (1993) Cell 74, 71–82 649–665 57. Appenzeller-Herzog, C., and Hauri, H. P. (2006) J. Cell Sci. 119, 32. Chen, L., and Feany, M. B. (2005) Nat. Neurosci. 8, 657–663 2173–2183 33. Kanemoto, S., Kondo, S., Ogata, M., Murakami, T., Urano, F., and 58. Martin-Clemente, B., Alvarez-Castelao, B., Mayo, I., Sierra, A. B., Diaz, V., Imaizumi, K. (2005) Biochem. Biophys. Res. Commun. 331, 1146–1153 Milan, M., Farinas, I., Gomez-Isla, T., Ferrer, I., and Castano, J. G. (2004) 34. Ma, Y., and Hendershot, L. M. (2004) J. Biol. Chem. 279, 13792–13799 J. Biol. Chem. 279, 52984–52990 35. Baumeister, P., Luo, S., Skarnes, W. C., Sui, G., Seto, E., Shi, Y., and Lee, 59. Tanaka, Y., Engelender, S., Igarashi, S., Rao, R. K., Wanner, T., Tanzi, R. E., A. S. (2005) Mol. Cell Biol. 25, 4529–4540 Sawa, A. V. L. D., Dawson, T. M., and Ross, C. A. (2001) Hum. Mol. Genet. 36. Sherer, T. B., Trimmer, P. A., Borland, K., Parks, J. K., Bennett, J. P., Jr., and 10, 919–926 Tuttle, J. B. (2001) Brain Res. 891, 94–105 60. Stefanis, L., Larsen, K. E., Rideout, H. J., Sulzer, D., and Greene, L. A. (2001) 37. Goldman, J. E., Yen, S. H., Chiu, F. C., and Peress, N. S. (1983) Science 221, J. Neurosci. 21, 9549–9560 1082–1084 61. Holtz, W. A., and O’Malley, K. L. (2003) J. Biol. Chem. 278, 19367–19377 38. Kuzuhara, S., Mori, H., Izumiyama, N., Yoshimura, M., and Ihara, Y. 62. Holtz, W. A., Turetzky, J. M., Jong, Y. J., and O’Malley, K. L. (2006) J. Neu- (1988) Acta Neuropathol. (Berl.) 75, 345–353 rochem. 99, 54–69 39. Spillantini, M. G., Schmidt, M. L., Lee, V. M., Trojanowski, J. Q., Jakes, R., 63. McNaught, K. S., and Jenner, P. (2001) Neurosci. Lett. 297, 191–194 and Goedert, M. (1997) Nature 388, 839–840 64. Furukawa, Y., Vigouroux, S., Wong, H., Guttman, M., Rajput, A. H., Ang, 40. Pronin, A. N., Morris, A. J., Surguchov, A., and Benovic, J. L. (2000) J. Biol. Chem. 275, 26515–26522 L., Briand, M., Kish, S. J., and Briand, Y. (2002) Ann. Neurol. 51, 779–782 41. Okochi, M., Walter, J., Koyama, A., Nakajo, S., Baba, M., Iwatsubo, T., 65. Marsden, C. D. (1990) Lancet 335, 948–952 23188 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 34 •AUGUST 22, 2008 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Serine 129 Phosphorylation of α-Synuclein Induces Unfolded Protein Response-mediated Cell Death

Download PDF
10 pages

Loading next page...
 
/lp/unpaywall/serine-129-phosphorylation-of-synuclein-induces-unfolded-protein-5Lecf2RD3n

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.m802223200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 34, pp. 23179 –23188, August 22, 2008 © 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Serine 129 Phosphorylation of -Synuclein Induces Unfolded Protein Response-mediated Cell Death Received for publication, March 20, 2008, and in revised form, June 18, 2008 Published, JBC Papers in Press, June 18, 2008, DOI 10.1074/jbc.M802223200 ‡ ‡1 ‡ ‡ ‡ § Naoto Sugeno , Atsushi Takeda , Takafumi Hasegawa , Michiko Kobayashi , Akio Kikuchi , Fumiaki Mori , § ‡ Koichi Wakabayashi , and Yasuto Itoyama From the Department of Neurology, Tohoku University School of Medicine, 1-1 Seiryomachi, Aobaku, Sendai, Miyagi 980-8574, Japan and the Department of Neuropathology, Institute of Brain Science, Hirosaki University School of Medicine, 5 Zaifu-cho, Hirosaki 036-8562, Japan -Synuclein is a major protein component deposited in Lewy ing neurons, although the mechanism that underlies LB bio- bodies and Lewy neurites that is extensively phosphorylated at genesis is poorly understood (2, 3). -Synuclein is a 140-amino Ser , although its role in neuronal degeneration is still elusive. In acid protein physiologically localized in presynaptic terminals this study, several apoptotic pathways were examined in (4, 5) and pathologically aggregated in hallmark inclusions, -synuclein-overexpressing SH-SY5Y cells. Following the treat- such as LB and Lewy neurites (6). Furthermore, point muta- mentwithrotenone,amitochondrialcomplexIinhibitor,wildtype tions (A53T, A30P, and E46K) or gene multiplications of -synuclein-overexpressing cells demonstrated intracellular -synuclein were proved to be responsible for familial PD aggregations, which shared a number of features with Lewy bodies, (7–10). Thus, it is suggested that -synuclein plays a key role in although cells overexpressing the S129A mutant, in which phos- the neurodegenerative process of synucleinopathies (11). It has phorylation at Ser was blocked, showed few aggregations. In been demonstrated that -synuclein undergoes several post- wildtype-synucleincellstreatedwithrotenone,theproportionof translational modifications (5). Among them, serine 129 phos- phosphorylated -synuclein was about 1.6 times higher than that phorylation is thought to be one of the most important events of untreated cells. Moreover, induction of unfolded protein (12–15), because it has been reported that almost 90% of response (UPR) markers was evident several hours before the -synuclein in LB is phosphorylated at serine 129 (12) and that induction of mitochondrial disruption and caspase-3 activation. the serine 129 phosphorylation is closely associated with aggre- Eukaryotic initiation factor 2, a member of the PERK pathway gate formation in cellular models (16). However, it has not been family, was remarkably activated at early phases. On the other clarified whether the serine 129 phosphorylation plays a critical hand, the S129A mutant failed to activate UPR. Casein kinase 2 role in the pathomechanisms of neuronal death. inhibitor, which decreased -synuclein phosphorylation, also Mitochondrial dysfunction has been implicated in the patho- reduced UPR activation. The -synuclein aggregations were co- genesis of PD and other neurodegenerative diseases (17, 18). localized with a marker for the endoplasmic reticulum-Golgi The administration of rotenone, an inhibitor of mitochondrial intermediate compartment. Taken together, it seems plausi- complex I, induced the major pathological and behavioral fea- ble that -synuclein toxicity is dependent on the phosphoryl- tures of PD in animal and cellular models (19–22). We estab- ation at Ser that induces the UPRs, possibly triggered by lished -synuclein-overexpressing cell lines, which reproduced the disturbed endoplasmic reticulum-Golgi trafficking. LB-like inclusions when exposed to ROS-inducing reagents including rotenone (21). It is still elusive whether aggregate formation is an adaptive response or is directly related to neu- Parkinson’s disease (PD) is the second most common neu- ronal cell death (23). However, mounting evidence suggests rodegenerative disorder (1). Pathologically, it is characterized that such protein aggregates may not directly trigger the cell by the loss of dopamine neurons in the substantia nigra pars death process in neurodegeneration (24, 25). The aggregate for- compacta and the presence of cytoplasmic inclusions (Lewy mation is promoted by incorrect protein structures (26). As bodies (LB)) and dystrophic neurites (Lewy neurites) in surviv- adaptive responses against the accumulation of misfolded or difficult to fold proteins, the unfolded protein response (UPR) regulates both protein translation and gene transcription to * The costs of publication of this article were defrayed in part by the payment help the function. Thus, the UPR induction is cytoprotective, of page charges. This article must therefore be hereby marked “advertise- ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. but if it fails to remedy the situation, the ER function is dis- To whom correspondence should be addressed: 1-1 Seiryomachi, Aobaku, rupted, and apoptosis is initiated (27). It was revealed that Sendai 980-8574, Japan. Tel.: 81-22-717-7189; Fax: 81-22-717-7192; E-mail: -synuclein blocks ER-Golgi trafficking and induces UPR in a [email protected]. The abbreviations used are: PD, Parkinson disease; CHOP, CCAAT enhancer- yeast model (28). Furthermore, mutations in the familial PD- binding protein homologous transcription factor; CK, casein kinase; related gene, parkin, are also associated with ER-mediated UPR -COP,-coat protein; DCF, 2,7-dichlorodihydrofluorescein; DMAT, 2-Dim- (29). These results suggest that the UPR pathway may consti- ethylamino-4,5,6,7-tetrabromo-1H-benzimidazole; eIF2, eukaryotic initi- ation factor 2; ER, endoplasmic reticulum; ERGIC, ER-Golgi intermediate tute common pathomechanisms in nigral degeneration. compartment; JNK, c-Jun N-terminal kinase; LB, Lewy bodies; MTT, 3-(4,5- In this study using a cellular model overexpressing wild type dimethelthiazo-2-yl)-2,5-diphenyltetrazolium bromide; PBS, phosphate- (WT) -synuclein, we showed that the appearance of UPR buffered saline; ROS, reactive oxygen species; UPR, unfolded protein response; WT, wild type; CAT, chloramphenicol acetyltransferase. markers, especially activation of the PERK (PKR-like ER kinase) This is an Open Access article under the CC BY license. AUGUST 22, 2008• VOLUME 283 • NUMBER 34 JOURNAL OF BIOLOGICAL CHEMISTRY 23179 Serine 129 Phosphorylation Induces ER Stress pathway, was evident several hours before disruption of the avidin-biotin-peroxidase complex method with a Vectastain ABC mitochondria. In contrast, the S129A -synuclein-expressing kit (Vector, Burlingame, CA). Monoclonal antibody against cells showed much less UPR induction. Our data suggested that -COP (-coat protein, 1:100; Sigma) was used as primary anti- phosphorylation of -synuclein at serine 129 plays a key role in body. The sections were pretreated by heating for 15 min at 121 °C. -synuclein-related cell death, which is triggered by UPR Diaminobenzidine was used as the chromogen. The sections were activation. counterstained with hematoxylin. Immunoblot Analyses—After treatment with rotenone for EXPERIMENTAL PROCEDURES the preparation of whole cell lysates, the cells were washed Expression Construct and Cell Culture—The WT -synuclein three times with PBS and sonicated in 100 mM Tris-HCl, 8% cDNA was subcloned into the pUC18 vector at SalI and SphI sites SDS, 1% Tween 20 containing the protease inhibitors, 1 mM and the S129A mutant was generated by site-directed mutagenesis phenylmethylsulfonyl fluoride, 5 g/ml of pepstain A, 5 g/ml TM (Takara LA PCR in vitro mutagenesis kit; Takara Biomedicals, of leupeptin, and 5 g/ml of aprotinin. Twenty microgram of Tokyo, Japan). The cDNAs were introduced into the eukaryotic total protein determined by the BCA assay (Pierce) were sepa- episomal vector pCEP4 (Invitrogen). In a mock construct, the rated by SDS-PAGE and then transferred onto polyvinylidene chloramphenicol acetyltransferase (CAT) gene was substituted for difluoride membrane (Millipore Corp., Bedford, MA). The -synuclein. The SH-SY5Y cells were cultured in Dulbecco’s mod- membranes were incubated with primary antibodies (described ified Eagle’s medium supplemented with 10% fetal bovine serum below) for 60 min. After vigorous washing, a rabbit anti-mouse (Invitrogen) at 37 °C in 5% of CO and were transfected by these IgG-horseradish peroxidase-conjugated antibody (1:2000; constructs using DOTAP (N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N- DAKO, Denmark) or goat anti-rabbit IgG-horseradish peroxi- trimethylammonium methyl-sulfate) lipofection system (Roche dase-conjugated antibody (1:2000; Santa Cruz Biotechnology, Applied Science). To evaluate cell viability, transfected cells were Santa Cruz, CA) were used as secondary antibodies and devel- plated at a density of 5  10 cells/well in 96-well plates and oped by using an ECL detection kit (GE Healthcare) combined allowed to grow in regular medium for 24 h, and then the cultures with an image analyzer (LAS-3000; Fuji Photo Film, Tokyo, were exposed to 10 nM of rotenone (Sigma) for 24 to 120 h. Cell Japan). survival rates were evaluated using the 3-(4,5-dimethelthiazo-2- Immunoprecipitation and Casein Kinase Reaction—For yl)-2,5-diphenyltetrazolium bromide (MTT) assay. immunoprecipitation, the cells were washed with TS buffer (50 Immunocytochemistry—Cells grown on poly-L-lysine coated mM Tris-HCl, 150 mM NaCl, pH 7.6) and harvested in radioim- coverslips were fixed with 4% paraformaldehyde for 20 min and mune precipitation assay buffer (50 mM Tris-HCl, 150 mM permeabilized with 0.5% Triton X-100 in PBS for 10 min. After NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 a brief wash with PBS, the cells were incubated in a blocking mM phenylmethylsulfonyl fluoride, 5 g/ml of pepstain A, 5 solution (1.5% normal goat serum in PBS) with 10 g/ml of g/ml of leupeptin, and 5 g/ml of aprotinin, pH 7.5). The RNase for 30 min and treated with the primary antibodies lysates were sonicated and centrifuged 12,000  g for 5 min, (described below) for2hat room temperature. After washing and supernatants were isolated. Equal amounts of protein were with PBS, the cells were incubated with fluorescent dye (Alexa incubated with 10 g of a monoclonal antibody against 488 and/or Alexa 568)-conjugated goat anti-mouse or anti-rab- -synuclein (Millipore; syn211) at 4 °C overnight and then bit antibodies (1:1000; Molecular Probes, Eugene, OR) for1hat incubated with protein G plus agarose (GE Healthcare) at 4 °C room temperature. The nuclei were counterstained with TO- 1 h. For serine phosphorylation, immunoprecipitates were PRO3 (Molecular Probes). Fluorescent images were analyzed washed three times with kinase buffer (20 mM Tris-HCl, 50 mM with a confocal laser scanning microscope (Fluoview FV300, KCl, 10 mM MgCl , pH 7.5) and incubated with 1,000 units of Olympus, Tokyo, Japan). To evaluate the effect of -synuclein casein kinase 2 (CK2; New England Biolabs) in the presence of toxicity on the mitochondrial membrane potential ( ), we 0.2 mM ofATPfor1hat30 °C.The reaction was terminated by adopted a fluorescent indicator, JC-1 (10 mg/ml for 10min, Molec- addition of SDS-PAGE sample buffer. The samples were boiled for ular Probes) (30). All of the images were scanned by laser scanning 3 min and separated on a SDS-PAGE. Proteins were detected with microscope in identical conditions of 512  512, 12 bit/pixel res- either an anti--synuclein antibody or an anti-phosphorylated olution, the photo multiplier tube voltages of argon and krypton -synuclein antibody. For the experiment of casein kinase inhibi- were 630, and the gain and the background offset were 0. At each tion, the cells were incubated with rotenone in the presence of CK2 time point, 10–20 cells in six randomly chosen fields were ana- inhibitor (DMAT (2-Dimethylamino-4,5,6,7-tetrabromo-1H- lyzed to evaluate the 527:590 nm signal ratio by using the macro benzimidazole); calbiochem, Darmstadt, Germany, 1 M). To program in the Image-Pro Plus software (MediaCybernetics; examine the effect of CK2 inhibitor on eIF2 phosphorylation, Bethesda, MD). Intracellular ROS were detected by the 2,7-dichlo- SH-SY5Y cell lines were incubated with 10 g/l of tunicamycin rodihydrofluorescein (DCF) diacetate (Molecular Probes) as a flu- (Calbiochem) and 0.2–5 M of DMAT. Protein samples from orescent probe. Briefly, after washing with PBS, the cells were these cells were analyzed by Western blots. incubated with Dulbecco’s modified Eagle’s medium for 20 min. Real Time PCR—Total RNA samples were isolated by using Following extensive washing in PBS, the intracellular levels of ROS the acid phenol method (RNA-bee; Tel-Test, Friendswood, were evaluated by laser scanning microscope. Four-micrometer- TX) according to the manufacturer’s instructions. Comple- thick, paraffin-embedded sections including the substantia nigra, mentary DNA was synthesized from RNA samples using Super- locus ceruleus, and dorsal vagal nucleus from five patients with PD ScriptIII (Invitrogen) containing oligo(dT) . Quantitative real were subjected to immunohistochemical investigations using the time PCR was run in LightCycler1.0 (Roche Applied Science). 23180 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 34 •AUGUST 22, 2008 Serine 129 Phosphorylation Induces ER Stress synuclein phosphorylated at serine 129 monoclonal antibody (Pser#64; phosphory lated- -Syn WAKO, Osaka, Japan), rabbit α-Syn phosphory lated- -Syn α anti--synuclein phosphorylated at serine 129 polyclonal antibodies -tubulin α-Syn (gift from Dr. Iwatsubo), mouse CAT W T S129A 1 2 3 monoclonal anti--COP antibody (Sigma), mouse monoclonal anti- * D ERGIC-53 antibody (LifeSpan Biosciences, Seattle, WA), mouse 4 100 * monoclonal anti--tubulin anti- 80 body (Sigma), lysosome (Lyso- tracker; Invitrogen), rabbit poly- clonal ER antibodies (PDI; Stressgen, Victoria, Canada), rabbit polyclonal Golgi antibodies (NUCB; 0 AVIVA systems biology, San Diego, 1 2 3 CAT WT S129A CA), rabbit polyclonal anti-acti- vated caspase-9 antibodies (Cell FIGURE 1. The S129A mutation blocked -synuclein phosphorylation at serine 129. A, cells were stably transfected with WT or S129A -synuclein. Cell lysates were analyzed by immunoblotting using anti-- Signaling Technology, Danvers, synuclein antibody (-Syn, LB509) or anti-phosphorylated -synuclein antibody (phosphorylated -Syn, MA), rabbit polyclonal anti-acti- Pser#64). -Tubulin was used as a loading control. B, the signal intensities per cell were quantified from images of immunostaining using anti-phosphorylated -synuclein antibody. For each sample, eight random fields vated caspase-3 antibodies (Cell Sig- were selected for counting. The results were analyzed by one-way analysis of variance test and were shown as naling Technology), rabbit polyclonal the means  S.E. *, p  0.001 versus both CAT and S129A. C, cell lysates were immunoprecipitated by the anti-phospho-IRE1 antibodies anti--synuclein antibody and analyzed by Western blots. Lane 1, samples of untreated cells; lane 2, samples of rotenone-treated cells; lane 3, samples of untreated cells were phosphorylated by CK2. D, relative ratio of (Novus Biologicals, Littleton, CO), phosphorylated -synuclein (phosphorylated -Syn) against total -synuclein (-Syn) was evaluated by West- rabbit polyclonal anti-phospho- ern blots. The value of samples treated with CK2 was defined as 100%. The data from four individual experi- PERK antibodies (Santa Cruz Bio- ments were analyzed by one-way analysis of variance. Lanes 1–3 were the same as those in C. The results were analyzed by one-way analysis of variance test and were shown as the means S.E. (n 4). *, p 0.01 versus0h. technology), rabbit polyclonal anti- phospho-eIF2 antibodies (Cell The relative amounts of mRNAs were calculated from the sec- Signaling Technology), rabbit polyclonal anti-c-Jun N-terminal ond derivative maximum method using -actin as a control. kinase (JNK) antibodies (Cell Signaling Technology), and rabbit Primer sequences were designed by the Universal Probe Library polyclonal anti-phospho-JNK antibodies (Cell Signaling Assay Design Center (Roche Applied Science). The following Technology). primers were used: BiP forward, AGCTGTAGCGTATGGTG- Statistical Analyses—The data were analyzed by one-way CTG; BiP reverse, AAGGGGACATACATCAAGCAG; Erdj4 analyses of variance and posts hoc multiple comparison using forward CCACCCTGACAAAAATAAGAGC; Erdj4 reverse, Newman-Keul’s multiple comparison test or two-way analyses CGTCTATTAGCATCTGAGAGTGTTTC; CHOP forward, of variance and posts hoc multiple comparison using Bonferro- AGCTGGAACCTGAGGAGAGA; CHOP reverse, TGGATCA- ni’s test on GraphPad Prism version 4.03 for Windows (Graph- GTCTGGAAAAGCA; -actin forward, CCAACCGCGAGAA- Pad Software, San Diego, CA). GATGA; and-actin reverse, CCAGAGGCGTACAGGGATAG. RESULTS Assay for Proteasome Activity—The proteasome activity was quantified using a 20 S proteasome assay kit (Affinity Research Low Dose and Long Time Exposure of Rotenone Preferentially Product, Exeter, UK). Briefly, the cells were washed three times Induced Intracellular Aggregates in -Synuclein-overexpressing with PBS, resuspended into a buffer containing 50 mM Tris/ Cells—Following the transfection of WT or S129A mutant HCl, pH 7.5, 25 mM KCl, 10 mM NaCl, and 1 mM MgCl and -synuclein constructs, the immunocytochemical examination then lysed by a brief sonication. The lysates were incubated demonstrated diffuse staining of -synuclein in the entire cyto- with the fluorogenic substrate, Suc-Leu-Leu-Val-Tyr-AMC, at plasm. There were no obvious changes in the growth and mor- 37 °C for 30 min. The proteasome activity was detected by phology of these transfected cells as previously described (21). changes in fluorescence intensity at 355 nm of excitation and The Western blot revealed that there were no differences in the 460 nm of emission using an automatic multi-well fluorometer expression levels and molecular sizes between WT and S129A- (Fluoroscan Ascent; Labsystems, Helsinki, Finland). The rela- expressing cells, although the latter failed to show positive tive activity was standardized by the protein concentrations bands for anti-phosphorylated -synuclein antibody (Fig. 1A). determined by the BCA method. To confirm the loss of phosphorylation at serine 129 in the Antibodies—The following primary antibodies were used in S129A mutant, the cells were stained by anti-phosphorylated immunocytochemistry and Western blots: mouse monoclonal -synuclein monoclonal antibody (Pser#64) (12), and the signal anti--synuclein antibody (LB509; Zymed Laboratories Inc., intensities per cell were quantified. The signal intensities in WT South San Francisco, CA), rabbit polyclonal anti--synuclein -synuclein-expressing cells were significantly higher than antibodies (AB5038; Chemicon, Temecula, CA), mouse anti-- those in the other two cell lines (Fig. 1B). To evaluate amounts AUGUST 22, 2008• VOLUME 283 • NUMBER 34 JOURNAL OF BIOLOGICAL CHEMISTRY 23181 Signal intensity per cell phosphorylated-α -Syn /α -Syn (%) Serine 129 Phosphorylation Induces ER Stress CAT ** WT ** S129A A 8 (c) (a) (b) ERGIC Syn-p (β-COP) Merge (d) (e) (f) 0 24 72 120 ERGIC Time (hour) Syn-p (ERGIC-53) Merge (h) (i) (g) Me Syn-m rge ER (j) (k) (l) Syn-m Golgi Merge (m) (n) (o) Lysosome Merge Syn-p FIGURE 2. Characterization of intracellular aggregations and their incidence in each cell line. A, the SH-SY5Y cells overexpressing WT -synuclein showed intracellular aggregations after 120 h of exposure to rotenone at 10 nM. The cells were co-stained with polyclonal phosphorylated -synuclein (Syn-p; panels a, d, and m), monoclonal phosphorylated-synuclein (Syn-m; panels g and j), ERGIC (-COP; panel b, ERGIC-53; panel e), ER (PDI; panel h), Golgi (NUCB; panel k), and lysosome (Lysotracker; panel n). In panels c, f, i, l, and o, the images were merged from each of left two ones, and the nuclei were stained with TO-PRO3 (blue). The scale bars indicate 10 m. B, cells were treated with the same concentration of rotenone for 24 –120 h, and then the incidence of intracellular aggregations was quantified. For each sample, eight random fields were selected for counting. The results were analyzed by two-way analysis of variance test and were shown as the means  S.E. *, p  0.05 versus both CAT and S129A; **, p  0.001 versus both CAT and S129A. C, sections from the locus ceruleus (panel a) and the dorsal vagal nucleus (panel b) from patients with PD. LB in the locus ceruleus (panel a) and ring-like (panel b, center left) and homogenous LBs (panel b, center right) in the dorsal vagal nucleus were immunopositive for -COP. The scale bars indicate 10 m. of phosphorylated -synuclein after a short time of (6 h) expo- -synuclein following CK2 treatment (Fig. 1C, lane 3) was sure of rotenone, immunoprecipitation experiments were con- defined as 100%, 50% of -synuclein was phosphorylated in ducted using an antibody recognizing -synuclein, and then a untreated -synuclein-overexpressing cells, and 80% was phos- part of immunoprecipitates was incubated with CK2. The sam- phorylated following rotenone treatment (Fig. 1D). The data ples were analyzed on Western blots using antibody against were quantified by densitometry from four independent exper- -synuclein or that of phosphorylated form. Increased amounts iments of Western blots (Fig. 1D). After 120 h of treatment with of phosphorylated -synuclein were evident after rotenone rotenone (10 nM), intracellular aggregates were observed in WT exposure (Fig. 1C). When the amount of phosphorylated -synuclein-expressing cells (Fig. 2A). The aggregates were 23182 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 34 •AUGUST 22, 2008 Cells with aggregation (%) Serine 129 Phosphorylation Induces ER Stress immunopositive for anti--synuclein, anti-phosphorylated -synuclein, anti-ubiquitin, and anti-neurofilament antibodies 1.2 (data not shown). The aggregates were also co-localized with -COP and ERGIC-53, the marker for the ER-Golgi intermedi- 1.0 ate compartment (ERGIC) (31) but not with a marker for ER, lysosome, and Golgi (Fig. 2A). Furthermore, some LBs in autop- sied brain were also immunopositive for -COP (Fig. 2C). After 0.8 24 h exposure, the cells expressing the S129A mutant showed much fewer aggregations compared with cells expressing WT 0.6 (Fig. 2B), which was in good agreement with the previous reports (16, 32). At 120 h of exposure, 10% of WT cells were aggregate-positive but only 1% positive of S129A cells (Fig. 2B). 0.4 The incidence of aggregates was roughly dependent on the CAT period of rotenone exposure (Fig. 2B). 0.2 WT S129A Mutation Ameliorates Cell Toxicity Induced by S129A -Synuclein Overexpression—Because of initial medium changes for rotenone treatments, values of MTT assay were 0.0 transiently decreased during first 24 h in all cell lines. However, 0 24 72 96 120 after that, the viability of WT -synuclein-expressing cells was Time (hour) dramatically reduced compared with those of CAT- and S129A-expressing cells (Fig. 3A). To assess whether apoptotic processes played a role in this cellular model, cells overexpress- CAT ing CAT, WT, and S129A were double-stained by anti-- WT synuclein and anti-activated caspase-3 antibodies after the S129A treatment with 10 nM of rotenone for 0–120 h. In WT -synuclein-overexpressing cells, activated caspase-3-positive cells were increased after the exposure to rotenone (Fig. 3B). The incidence of activated caspase-3-positive cells was signifi- cantly higher in the WT than in the CAT and S129A mutants after 72 h of exposure of rotenone (Fig. 3B). Thus, it is suggested that the cell death in this model was based on apoptotic processes. Mitochondrial Dysfunction Following Rotenone Treatment— To evaluate the cell death process in this model, we investigated the mitochondrial membrane potential by the JC-1 staining method, in which red represents a normal mitochondrial mem- brane potential ( ), and green represents decreased mito- 0 24 72 120 chondrial membrane potential. In each image, the green/red Time (hour) signal intensity ratio was calculated. In WT -synuclein-ex- FIGURE 3. Evaluation of cell viability and apoptosis. A, the SH-SY5Y cells pressing cells, the green/red score was much more increased overexpressing WT or S129A-synuclein were treated with 10 nM of rotenone after 24 h of exposure to rotenone (Fig. 4A). Consistent with for 24 to 120 h. Cell viability was assessed using MTT assay, and the results the cytochemical data, immunoblots also indicated that acti- were expressed as cell survival rates compared with those of no treatment controls (0 h). The values were represented as the means S.E. (n 6). *, p vated caspase-3 expression was more increased in WT 0.001 versus both CAT and S129A. B, activated caspase-3 positive cells were -synuclein cells compared with CAT and S129A cells (Fig. counted following the rotenone treatment at 10 nM for 24 –120 h. For each sample, eight random fields were selected for counting. The results were 4B). Activated caspase-9 induction did not precede caspase-3 analyzed by two-way analysis of variance test and were shown as the activation (Fig. 4C). On the other hand, DCF signal intensities means  S.E. *, p  0.05 versus both CAT and S129A. were significantly elevated after 72 h of treatment of rotenone, but there were little difference in the ROS levels among the (33); BiP, a target shared by all UPR pathways (34, 35); and three cell lines (Fig. 4D). Only in WT -synuclein-expressing CHOP, a downstream target of the PERK/activating transcrip- cells, JNK inactivation was observed until 120 h after the rote- tional factor 4 pathway (34). In WT -synuclein cells, the Erdj4 none exposure. However, in CAT and S129A mutant cells, the and CHOP mRNA levels were elevated (Fig. 5, A and B), but in JNK activation was less prominent (Fig. 4E). The results were CAT cells the Erdj4 mRNA levels were not elevated signifi- quantified by densitometry from three independent experi- cantly (p  0.06) after 24 h of rotenone exposure (Fig. 5C). The ments (Fig. 4, B, C, and E). induction of CHOP in WT -synuclein cells was also observed in Unfolded Protein Responses Precede Mitochondrial Western blot experiments (data not shown). Although the Dysfunction—The levels of transcripts for three target genes of p-IRE1 and p-PERK expression showed few changes during the the UPR were measured by real time PCR. The three target observed period (0–120 h) (Fig. 5, D and E), higher expression of genes were MDG1/Erdj4, a specific target of the Xbp-1 pathway p-eIF2 was exhibited in the WT cells between 6 and 12 h of rote- AUGUST 22, 2008• VOLUME 283 • NUMBER 34 JOURNAL OF BIOLOGICAL CHEMISTRY 23183 Rate of viable cells Activated caspase-3 positive cell (%) Serine 129 Phosphorylation Induces ER Stress CAT WT S129A CAT WT S129A 0 12 24 72 Time (hour) CAT ** WT S129A 0 12 24 72 ** * Time (hour) 1.75 CAT ## 1.50 # WT 1.25 S129A 1.00 0 6 12 24 72 120 0.75 Time (hour) 0.50 0.25 2.5 CAT 0.00 ** 0 6 12 24 72 120 WT 2.0 Time (hour) S129A 1.5 ** 1.0 0.5 0.0 0 6 12 24 72 120 Time (hour) FIGURE 4. Changes in mitochondrial function and oxidative stress. A, mitochondrial membrane potential stain was demonstrated by JC-1. The intensity of green color (decreased mitochondrial membrane potential ( )) was divided by the intensity of red color (reporter molecule). As shown, only WT cells showed transient damages after 24 h. For each sample, eight random fields were selected for counting. The results were analyzed by two-way analysis of variance test and were shown as the means  S.E. *, p  0.001 versus CAT, p  0.01 versus S129A. B and C, activation of apoptosis-related molecules was evaluated by Western blots. The figure represents the immunoreactivity of activated caspase-3 (B) and activated caspase-9 (C) against -tubulin (loading control). The results were analyzed by two-way analysis of variance test and were shown as the means S.E. (n 3). *, p 0.001 versus CAT. **, p 0.001 versus CAT and S129A. D, intracellular ROSs were measured by signal intensities of DCF staining after 10 nM rotenone treatment. The images from laser scanning microscope were quantified per cell. Eight random fields were selected for counting. The results were analyzed by two-way analysis of variance test and were shown as the means  S.E. *, p  0.05 versus 0h. E, the figure represents immunoreactivity of phosphorylated-JNK (p-JNK) against JNK (loading control). The results were analyzed by two-way analysis of variance test and were shown as the means S.E. (n 3). *, p 0.01 versus CAT. #, p 0.01 versus S129A. ##, p 0.001 versus S129A. none exposure (Fig. 5F). The results were quantified by densitom- cells, the proteasome activities showed few changes during the etry from three independent experiments (Fig. 5, D–F). observed period (Fig. 6). Proteasome Activity Is Elevated in WT -Synuclein-express- Casein Kinase 2 Inhibitor Blocked UPR Activation Caused by ing Cells—Three cell samples were prepared at each time point Rotenone Exposure—Cells overexpressing -synuclein were to measure the proteasome activities. In WT -synuclein cells, cultured with rotenone and casein kinase inhibitors for 6 h. elevation of proteasome activities were moderate at 12 h and Casein kinase 2 inhibitor DMAT (1 M) decreased not only were significant at 24 h following 10 nM rotenone treatment phosphorylation of -synuclein but also expression of p-eIF2 (Fig. 6). On the other hand, in CAT and S129A -synuclein induced by rotenone. Casein kinase 1 inhibitor (0.2–4 M) also 23184 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 34 •AUGUST 22, 2008 Green / Red (%; signal intensity) caspase-9 / -tubulin caspase-3 / β-tubulin DCF signal intensity per cells p-JNK / JNK Serine 129 Phosphorylation Induces ER Stress none exposure at low doses (10 nM) A Erdj4 and for a relatively longer time (up 0.07 CAT to 120 h). Under this condition, ** WT 0.06 approximately half of the complex I S129A activities were inhibited (36). High 0.05 CAT 2.0 doses (100 nM) and short duration WT 0.04 (within 24 h) exposure to rotenone S129A 1.5 0.03 induced only 2–3% aggregate-posi- 1.0 tive cells (data not shown), but low 0.02 doses and long time exposure pro- 0.5 0.01 duced about 10% of aggregate-posi- tive cells (Fig. 2B). Immunocyto- 0.0 0.00 0 6 12 24 72 120 0 12 24 chemical experiments revealed that Time (hour) Time (hour) intracellular aggregates were immu- nopositive for -synuclein, phos- B BiP 1.5 CAT phorylated -synuclein, ubiquitin, 0.04 CAT WT and neurofilament (data not WT S129A 1.0 shown). These results indicated that S129A 0.03 the aggregates shared a number of pathological features with LB (12, 0.5 37–39). 0.02 -Synuclein is modulated by sev- 0.0 eral post-translational modifica- 0 6 12 24 72 120 0.01 Time (hour) tions (5). The serine 129 phospho- rylation is thought to be one of the most important post-translational 0.00 ** 0 12 24 # ## modifications (12–14). Several Time (hour) CAT 1.0 reports have described close rela- WT CHOP tionships between serine 129 phos- S129A phorylation of -synuclein and the 0.04 CAT 0.5 PD pathogenesis (12–14). Several WT S129A protein kinases, such as CK1, CK2, 0.03 N.S and a family of G-protein-coupled receptor kinases, have been pro- 0.0 0 6 12 24 72 120 posed as candidates that phospho- 0.02 Time (hour) rylate -synuclein (40, 41). More- over, it has been suggested that the 0.01 haplotype of the G-protein-coupled receptor kinase 5 gene was related 0.00 to sporadic PD (42). However, it is 0 12 24 not clear whether serine 129 phos- Time (hour) phorylation is an essential factor for FIGURE 5. ER stress in each cell after treatment with rotenone. A–C, the levels of mRNA for Erdj4 (A), BiP (B), forming LBs. Although it was and CHOP (C) were quantified by real time PCR and expressed as relative ratios compared with the levels of -actin mRNA as controls. Three independent experiments were performed. The results were analyzed by reported that blocking of serine 129 two-way analysis of variance test and were shown as the means  S.E. *, p  0.01 versus S129A; **, p  0.001 phosphorylation increased inclu- versus S129A. D–F, Western blot analyses of marker proteins of ER stress were carried out using antibodies to sion formation in -synuclein trans- p-IRE1 (D), p-PERK (E), and p-eIF2 (F). Protein amounts were quantified by using anti--tubulin antibody as a loading control. The results were analyzed by two-way analysis of variance test and were shown as the means S.E. genic flies (32), there have been (n 3). *, p 0.01 versus CAT. **, p 0.001 versus CAT. #, p 0.05 versus S129A. ##, p 0.01 versus S129A. some claims against assessing synuclein aggregations in a Dro- reduced -synuclein phosphorylation caused by rotenone (data sophila model. First, flies do not have a counterpart of -synuclein because, phylogenically, the synuclein family is not shown). Then SH-SY5Y cell lines were incubated with the only seen in vertebrates. Second, the reported fly model was ER stress inducer tunicamycin. Phosphorylation of eIF2 induced by tunicamycin (10 g/l) was not suppressed by co-transfected with Gprk2 (40) for -synuclein phosphoryla- DMAT (0.2–5 M). tion, but Gprk2 has not been proven to localize in LB (42, 43). Thus, although Gprk2 can phosphorylate -synuclein in vitro, DISCUSSION it may not contribute to synuclein pathology in vivo.Inour In this study, we attempted to develop a cellular model of PD study using a mammalian cellular model, we clearly showed using -synuclein-overexpressing cells combined with rote- that the S129A mutant-expressing cells, in which the serine 129 AUGUST 22, 2008• VOLUME 283 • NUMBER 34 JOURNAL OF BIOLOGICAL CHEMISTRY 23185 mRNA relative to -actin mRNA relative to β-actin mRNA relative to β-actin p-eIF2α / β-tubulin p-PERK / β-tubulin IRE1α / β-tubulin Serine 129 Phosphorylation Induces ER Stress * Furthermore, an animal model with chronic intravascular infu- sion of rotenone showed a parkinsonian phenotype and nigral degeneration pathology with cytoplasmic inclusions immuno- reactive for -synuclein and ubiquitin (19, 22). Although the 1200 CAT WT cells were treated with rotenone as an environmental insult in S129A the present study, the dose of rotenone was not sufficient to cause cell death in mock cells. To study the intracellular ROS, DCF fluorescence and JNK activation were evaluated. Although the DCF signal intensities were not changed before 72 h of rotenone exposure (Fig. 4D), JNK activation was observed only in WT -synuclein-expressing cells, which might reflect ROS generation induced by synuclein toxicity (Fig. 4E) (48). Then we 0 3 6 12 24 evaluated the mitochondrial function using immunocytochem- Time (hour) istry of JC-1 staining and Western blots using anti-activated FIGURE 6. Proteasome activities in each cell after the rotenone treatment. caspase-9 antibodies. Although in WT -synuclein-overex- Proteasome activities were measured using the cells treated with 10 nM rote- none for the indicated time periods. Assays for chymotrypsin-like activity pressing cells decreased mitochondrial membrane potential by were conducted using proteasome substrates, Suc-LLVY-AMC. The values are JC-1 staining was observed after 24 h of exposure to rotenone expressed as fluorescence (arbitrary units)/mg total protein S.E. Three inde- pendent experiments were performed. *, p  0.05 versus 0 h of WT; #, p  (Fig. 4A), activated caspase-9 expression did not precede 0.001 versus CAT and p  0.01 versus S129A. caspase-3 activation. Thus, it is not plausible that mitochon- drial dysfunction was a primary event triggering apoptosis in phosphorylation was blocked (Fig. 1, A and B), presented much this cellular model. fewer aggregations compared with WT cells (Fig. 2B). This To study other pathways of cell death, we then focused on ER result was in a good agreement with a previous study using stress. It was suggested that UPR is an important pathway in mammalian cells (16). Moreover, we showed that the percent- causing cellular death in nigral neurons of PD brain (29, 49). age of phosphorylated -synuclein was increased from 50 to The investigations of ER stress markers using real time PCR 80% following the rotenone treatment. It was reported in a (Fig. 5, A–C) and Western blots (Fig. 5, D–F) revealed that UPR mammalian cellular model that the expression of S129D was activated within several hours following the rotenone mutant as a phosphorylated -synuclein increased aggregates exposure in WT -synuclein-expressing cells. Especially, compared with WT cells (44). Taken together, phosphorylation p-eIF2, a member of the PERK pathway family, showed of -synuclein at serine 129 appears to facilitate aggregate for- remarkable induction in WT -synuclein-expressing cells (Fig. mation in mammalian cells. 5F). This p-eIF2 expression was detected after6hof rotenone There has been little evidence showing a relationship exposure (Fig. 5F) and preceded the mitochondrial disruption between serine 129 phosphorylation and neuronal cell death. In shown by JC-1 staining (Fig. 4A). Moreover, CHOP was also this study, we demonstrated that blocking of serine 129 phos- activated after the p-eIF2 activation (Fig. 5C), suggesting that phorylation lead to decreased neuronal cell death induced by ER stress was a trigger of apoptosis in which the PERK pathway mitochondrial toxin exposure (Fig. 3, A and B). The treatment played a key role. Recently, it was reported that p-eIF2-posi- of rotenone at 10 nM was too low to cause apparent cellular tive neurons were observed in substantia nigra in PD brain (50) death in SH-SY5Y cells, as indicated by the low activation of and that CHOP was up-regulated in dopaminergic cells of caspase-3 in controlled cells (Figs. 3B and 4B). Moreover, intra- rodent brain treated by 6-OHDA (51). Activation of eIF2 cellular ROS elevation at the early phase was not evident in DCF might be promoted by -synuclein phosphorylation, because staining (Fig. 4D). However, the addition of WT -synuclein the proportion of phosphorylated -synuclein was about 1.6 expression preferentially caused apoptosis even under these higher than that of untreated cells (Fig. 1D). Furthermore, we low dose conditions. Thus, these data suggested that the serine showed that CK2 inhibitor, which was known to block 129 phosphorylation was required not only for aggregate for- -synuclein phosphorylation, decreased p-eIF2 expression mation but also for the induction of -synuclein toxicity. induced by rotenone (Fig. 7). CK2 was thought to be major Because the toxic effect of -synuclein was suggested to be enzyme for the phosphorylation of human -synuclein at associated with intermediate oligomer formation, so-called serine 129 (52). Moreover, its  subunits were co-localized protofibrils (23, 45), the phosphorylation of -synuclein at ser- with LB (53). The CK2 inhibition failed to suppress the ine 129 may be important for the formation of protofibrils. A induction of phosphorylated eIF2 by tunicamycin (Fig. 7B). recent study using NMR also suggested that serine 129 phos- Therefore, it was suggested that CK2 did not directly affect phorylation may destabilize the intramolecular interactions, the eIF2 phosphorylation. Thus, it is possible that p-eIF2 converting -synuclein into more unfolded forms that self-as- may play an important role in the cellular pathogenesis of sociated readily (46). Parkinson disease. Mitochondrial dysfunction has been implicated in the PD The molecular mechanisms by which -synuclein-induced pathogenesis, because MPTP (1-methyl-4-phenyl-1,2,3,6-tet- UPR are still elusive. In the pathomechanisms of poly(Q) dis- rahydropyridine) whose metabolite MPP (1-methyl-4-phe- eases, including Huntington’s disease (54), it is generally nylpyridinium) inhibits complex I of the mitochondrial elec- believed that misfolding proteins trigger the UPR (55) by the tron-transport chain, causes selective nigral cell death (47). robust attenuation of ER-associated degradation followed by 23186 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 34 •AUGUST 22, 2008 Proteasome activity relative ratio Serine 129 Phosphorylation Induces ER Stress exposure to rotenone (Fig. 6). Thus, it appeared that the increased proteasome activity reflected cytoprotective responses because the proteasome activities were increased fol- phosphorylated-α-Syn lowing the UPR induction (Figs. 5 and 6). A previous report using a cellular model with 6-OHDA treatment showed identi- α -Syn cal results and was in good agreement with our data (62). The in vivo proteasome activities have been evaluated in PD brain by several groups, but their results remain controversial (63, 64). p-eIF2α Because the nigral cell death of PD has already started several years before the disease onset (65), it may be difficult to assess rotenone - + + transient events in the neurodegenerative process such as DMAT - - + changes of proteasome activity by using post-mortem tissues from patients with PD, although some reports demonstrated no changes or decreased proteasome activity (63, 64). p-eIF2α In summary, using -synuclein-overexpressing cells exposed to a low dose of rotenone as an environmental toxin, we showed -tubulin β that phosphorylation of -synuclein at serine 129 promoted intracellular aggregate-formation and induced ER stress that was followed by mitochondrial damage and apoptosis. These Tm - + + + + findings contribute to clarifying the pathomechanisms of PD and other related synucleinopathies, in which disturbed ER- DMAT - - 0.2 1 5 Golgi trafficking might play a central role. FIGURE 7. The effect of casein kinase 2 inhibitor in -synuclein phospho- rylation and ER stress. A, the effect of CK2 inhibitor (DMAT) in -synuclein phosphorylation and UPR activation was evaluated by Western blot analyses. Acknowledgments—We thank Dr. T. Iwatsubo for the gift of anti- Cells overexpressing -synuclein were treated with 10 nM of rotenone and 1 phosphorylated -synuclein antibodies, Dr. H. Sawada for techni- M of DMAT. Phosphorylated -synuclein antibody, -synuclein antibody, cal advice about the measurement of proteasome activity, Dr. R. and p-eIF2 antibodies were used. B, the effect of DMAT in eIF2 phospho- Takahashi for critical comments, and Mr. Brent Bell for reading rylation was evaluated by Western blots. SH-SY5Y cell lines were treated with 10 g/l of tunicamycin (Tm) and 0.2–5 M of DMAT. Antibodies for p-eIF2 the manuscript. and -tubulin were used. REFERENCES decreased proteasome activities (27). In contrast, the protea- 1. Dawson, T. M., and Dawson, V. L. (2003) Science 302, 819–822 some activity was not decreased in the present study. Another 2. Olanow, C. W., Perl, D. P., DeMartino, G. N., and McNaught, K. S. (2004) possible explanation for the UPR demonstrated here is that the Lancet Neurol. 3, 496–503 vesicular trafficking may be disturbed in this cellular model. It 3. Shults, C. W. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 1661–1668 was reported that -synuclein blocked ER-Golgi trafficking and 4. Eriksen, J. L., Dawson, T. M., Dickson, D. W., and Petrucelli, L. (2003) Neuron 40, 453–456 might induce the accumulation of proteins in the ER to produce 5. Dev, K. K., Hofele, K., Barbieri, S., Buchman, V. L., and van der Putten, H. ER stress (28). The fact that intracellular aggregates were co- (2003) Neuropharmacology 45, 14–44 localized with both -COP and ERGIC-53 (Fig. 2A, panels a–c 6. Goedert, M. (2001) Nat. Rev. Neurosci. 2, 492–501 and d–f, respectively) strongly supported this hypothesis, 7. Munoz, E., Oliva, R., Obach, V., Marti, M. J., Pastor, P., Ballesta, F., and because these marker proteins were essential molecules for the Tolosa, E. (1997) Neurosci. Lett. 235, 57–60 transport of proteins from ER to Golgi (56, 57). Furthermore, 8. Kruger, R., Kuhn, W., Muller, T., Woitalla, D., Graeber, M., Kosel, S., Przuntek, H., Epplen, J. T., Schols, L., and Riess, O. (1998) Nat. Genet. 18, we showed that some LBs in autopsied brain from patients with 106–108 PD were immunopositive for -COP (Fig. 2C). Although it has 9. Zarranz, J. J., Alegre, J., Gomez-Esteban, J. C., Lezcano, E., Ros, R., Ampu- not been clarified yet how -synuclein blocks ER-Golgi traffick- ero, I., Vidal, L., Hoenicka, J., Rodriguez, O., Atares, B., Llorens, V., Gomez ing, serine 129 phosphorylation seemed to play a key role in Tortosa, E., del Ser, T., Munoz, D. G., and de Yebenes, J. G. (2004) Ann. promoting these processes. Neurol. 55, 164–173 It was reported that WT -synuclein overexpression did not 10. Singleton, A. B., Farrer, M., Johnson, J., Singleton, A., Hague, S., Kacher- gus, J., Hulihan, M., Peuralinna, T., Dutra, A., Nussbaum, R., Lincoln, S., influence the proteasome activity in cellular and animal models Crawley, A., Hanson, M., Maraganore, D., Adler, C., Cookson, M. R., (58–60). However, we demonstrated here that the proteasome Muenter, M., Baptista, M., Miller, D., Blancato, J., Hardy, J., and Gwinn- activities were increased in WT -synuclein-overexpressing Hardy, K. (2003) Science 302, 841 cells after exposure to a low dose of rotenone. It was possible 11. Xu, J., Kao, S. Y., Lee, F. J., Song, W., Jin, L. W., and Yankner, B. A. (2002) that rotenone per se might increase the proteasome activity, Nat. Med. 8, 600–606 12. Fujiwara, H., Hasegawa, M., Dohmae, N., Kawashima, A., Masliah, E., because MPP (1-methyl-4-phenylpyridinium), another com- Goldberg, M. S., Shen, J., Takio, K., and Iwatsubo, T. (2002) Nat. Cell Biol. plex I inhibitor, was shown to induce proteasome activity in 4, 160–164 cultured cells (61). However, the dose of rotenone in the pres- 13. Kahle, P. J., Neumann, M., Ozmen, L., Muller, V., Jacobsen, H., Spooren, ent study was not sufficient to change proteasome activity, W., Fuss, B., Mallon, B., Macklin, W. B., Fujiwara, H., Hasegawa, M., Iwat- because no changes in the proteasome activities were observed subo, T., Kretzschmar, H. A., and Haass, C. (2002) EMBO Rep. 3, 583–588 in CAT and S129A -synuclein-overexpressing cells under 14. Takahashi, M., Kanuka, H., Fujiwara, H., Koyama, A., Hasegawa, M., AUGUST 22, 2008• VOLUME 283 • NUMBER 34 JOURNAL OF BIOLOGICAL CHEMISTRY 23187 Serine 129 Phosphorylation Induces ER Stress Miura, M., and Iwatsubo, T. (2003) Neurosci. Lett. 336, 155–158 Meijer, L., Kahle, P. J., and Haass, C. (2000) J. Biol. Chem. 275, 390–397 15. Anderson, J. P., Walker, D. E., Goldstein, J. M., de Laat, R., Banducci, K., 42. Arawaka, S., Wada, M., Goto, S., Karube, H., Sakamoto, M., Ren, C. H., Caccavello, R. J., Barbour, R., Huang, J., Kling, K., Lee, M., Diep, L., Keim, Koyama, S., Nagasawa, H., Kimura, H., Kawanami, T., Kurita, K., Tajima, P. S., Shen, X., Chataway, T., Schlossmacher, M. G., Seubert, P., Schenk, K., Daimon, M., Baba, M., Kido, T., Saino, S., Goto, K., Asao, H., Kitanaka, D., Sinha, S., Gai, W. P., and Chilcote, T. J. (2006) J. Biol. Chem. 281, C., Takashita, E., Hongo, S., Nakamura, T., Kayama, T., Suzuki, Y., Koba- 29739–29752 yashi, K., Katagiri, T., Kurokawa, K., Kurimura, M., Toyoshima, I., Niizato, 16. Smith, W. W., Margolis, R. L., Li, X., Troncoso, J. C., Lee, M. K., Dawson, K., Tsuchiya, K., Iwatsubo, T., Muramatsu, M., Matsumine, H., and Kato, V. L., Dawson, T. M., Iwatsubo, T., and Ross, C. A. (2005) J. Neurosci. 25, T. (2006) J. Neurosci. 26, 9227–9238 5544–5552 43. Takahashi, M., Uchikado, H., Caprotti, D., Weidenheim, K. M., Dickson, 17. Olanow, C. W., and Tatton, W. G. (1999) Annu. Rev. Neurosci. 22, D. W., Ksiezak-Reding, H., and Pasinetti, G. M. (2006) J. Neuropathol. Exp. 123–144 Neurol. 65, 1157–1169 18. Lin, M. T., and Beal, M. F. (2006) Nature 443, 787–795 44. Liu, C., Fei, E., Jia, N., Wang, H., Tao, R., Iwata, A., Nukina, N., Zhou, J., and 19. Betarbet, R., Sherer, T. B., MacKenzie, G., Garcia-Osuna, M., Panov, A. V., Wang, G. (2007) J. Biol. Chem. 282, 14558–14566 and Greenamyre, J. T. (2000) Nat. Neurosci. 3, 1301–1306 45. Takeda, A., Hasegawa, T., Matsuzaki-Kobayashi, M., Sugeno, N., Kikuchi, 20. Sherer, T. B., Richardson, J. R., Testa, C. M., Seo, B. B., Panov, A. V., Yagi, A., Itoyama, Y., and Furukawa, K. (2006) J. Biomed. Biotechnol. 2006, T., Matsuno-Yagi, A., Miller, G. W., and Greenamyre, J. T. (2007) J. Neu- 19365–19368 rochem. 100, 1469–1479 46. Sasakawa, H., Sakata, E., Yamaguchi, Y., Masuda, M., Mori, T., Kurimoto, 21. Matsuzaki, M., Hasegawa, T., Takeda, A., Kikuchi, A., Furukawa, K., Kato, E., Iguchi, T., Hisanaga, S., Iwatsubo, T., Hasegawa, M., and Kato, K. (2007) Y., and Itoyama, Y. (2004) Brain Res. 1004, 83–90 Biochem. Biophys. Res. Commun. 363, 795–799 22. Sherer, T. B., Kim, J. H., Betarbet, R., and Greenamyre, J. T. (2003) Exp. 47. Langston, J. W., Ballard, P., Tetrud, J. W., and Irwin, I. (1983) Science 219, Neurol. 179, 9–16 979–980 23. Periquet, M., Fulga, T., Myllykangas, L., Schlossmacher, M. G., and Feany, 48. Borsello, T., and Forloni, G. (2007) Curr. Pharm. Des. 13, 1875–1886 M. B. (2007) J. Neurosci. 27, 3338–3346 49. Wang, H. Q., and Takahashi, R. (2007) Antioxid. Redox. Signal 9, 553–561 24. Lansbury, P. T., and Lashuel, H. A. (2006) Nature 443, 774–779 50. Hoozemans, J. J., van Haastert, E. S., Eikelenboom, P., de Vos, R. A., Roz- 25. Masliah, E., Rockenstein, E., Veinbergs, I., Mallory, M., Hashimoto, M., emuller, J. M., and Scheper, W. (2007) Biochem. Biophys. Res. Commun. Takeda, A., Sagara, Y., Sisk, A., and Mucke, L. (2000) Science 287, 354, 707–711 1265–1269 51. Silva, R. M., Ries, V., Oo, T. F., Yarygina, O., Jackson-Lewis, V., Ryu, E. J., 26. Volles, M. J., and Lansbury, P. T., Jr. (2003) Biochemistry 42, 7871–7878 Lu, P. D., Marciniak, S. J., Ron, D., Przedborski, S., Kholodilov, N., Greene, 27. Schroder, M., and Kaufman, R. J. (2005) Annu. Rev. Biochem. 74, 739–789 L. A., and Burke, R. E. (2005) J. Neurochem. 95, 974–986 28. Cooper, A. A., Gitler, A. D., Cashikar, A., Haynes, C. M., Hill, K. J., Bhullar, 52. Ishii, A., Nonaka, T., Taniguchi, S., Saito, T., Arai, T., Mann, D., Iwatsubo, B., Liu, K., Xu, K., Strathearn, K. E., Liu, F., Cao, S., Caldwell, K. A., Cald- T., Hisanaga, S., Goedert, M., and Hasegawa, M. (2007) FEBS Lett. 581, well, G. A., Marsischky, G., Kolodner, R. D., Labaer, J., Rochet, J. C., Bonini, 4711–4717 N. M., and Lindquist, S. (2006) Science 313, 324–328 53. Ryu, M. Y., Kim, D. W., Arima, K., Mouradian, M. M., Kim, S. U., and Lee, 29. Imai, Y., Soda, M., Inoue, H., Hattori, N., Mizuno, Y., and Takahashi, R. G. (2008) J. Neurol. Sci. 266, 9–12 (2001) Cell 105, 891–902 54. Wacker, J. L., Zareie, M. H., Fong, H., Sarikaya, M., and Muchowski, P. J. 30. Smiley, S. T., Reers, M., Mottola-Hartshorn, C., Lin, M., Chen, A., Smith, (2004) Nat. Struct. Mol. Biol. 11, 1215–1222 T. W., Steele, G. D., Jr., and Chen, L. B. (1991) Proc. Natl. Acad. Sci. U. S. A. 55. Dobson, C. M. (2003) Nature 426, 884–890 88, 3671–3675 56. Pepperkok, R., Scheel, J., Horstmann, H., Hauri, H. P., Griffiths, G., and 31. Duden, R., Griffiths, G., Frank, R., Argos, P., and Kreis, T. E. (1991) Cell 64, Kreis, T. E. (1993) Cell 74, 71–82 649–665 57. Appenzeller-Herzog, C., and Hauri, H. P. (2006) J. Cell Sci. 119, 32. Chen, L., and Feany, M. B. (2005) Nat. Neurosci. 8, 657–663 2173–2183 33. Kanemoto, S., Kondo, S., Ogata, M., Murakami, T., Urano, F., and 58. Martin-Clemente, B., Alvarez-Castelao, B., Mayo, I., Sierra, A. B., Diaz, V., Imaizumi, K. (2005) Biochem. Biophys. Res. Commun. 331, 1146–1153 Milan, M., Farinas, I., Gomez-Isla, T., Ferrer, I., and Castano, J. G. (2004) 34. Ma, Y., and Hendershot, L. M. (2004) J. Biol. Chem. 279, 13792–13799 J. Biol. Chem. 279, 52984–52990 35. Baumeister, P., Luo, S., Skarnes, W. C., Sui, G., Seto, E., Shi, Y., and Lee, 59. Tanaka, Y., Engelender, S., Igarashi, S., Rao, R. K., Wanner, T., Tanzi, R. E., A. S. (2005) Mol. Cell Biol. 25, 4529–4540 Sawa, A. V. L. D., Dawson, T. M., and Ross, C. A. (2001) Hum. Mol. Genet. 36. Sherer, T. B., Trimmer, P. A., Borland, K., Parks, J. K., Bennett, J. P., Jr., and 10, 919–926 Tuttle, J. B. (2001) Brain Res. 891, 94–105 60. Stefanis, L., Larsen, K. E., Rideout, H. J., Sulzer, D., and Greene, L. A. (2001) 37. Goldman, J. E., Yen, S. H., Chiu, F. C., and Peress, N. S. (1983) Science 221, J. Neurosci. 21, 9549–9560 1082–1084 61. Holtz, W. A., and O’Malley, K. L. (2003) J. Biol. Chem. 278, 19367–19377 38. Kuzuhara, S., Mori, H., Izumiyama, N., Yoshimura, M., and Ihara, Y. 62. Holtz, W. A., Turetzky, J. M., Jong, Y. J., and O’Malley, K. L. (2006) J. Neu- (1988) Acta Neuropathol. (Berl.) 75, 345–353 rochem. 99, 54–69 39. Spillantini, M. G., Schmidt, M. L., Lee, V. M., Trojanowski, J. Q., Jakes, R., 63. McNaught, K. S., and Jenner, P. (2001) Neurosci. Lett. 297, 191–194 and Goedert, M. (1997) Nature 388, 839–840 64. Furukawa, Y., Vigouroux, S., Wong, H., Guttman, M., Rajput, A. H., Ang, 40. Pronin, A. N., Morris, A. J., Surguchov, A., and Benovic, J. L. (2000) J. Biol. Chem. 275, 26515–26522 L., Briand, M., Kish, S. J., and Briand, Y. (2002) Ann. Neurol. 51, 779–782 41. Okochi, M., Walter, J., Koyama, A., Nakajo, S., Baba, M., Iwatsubo, T., 65. Marsden, C. D. (1990) Lancet 335, 948–952 23188 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 283 • NUMBER 34 •AUGUST 22, 2008

Journal

Journal of Biological Chemistry – Unpaywall

Published: Aug 1, 2008

There are no references for this article.