Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

SIP1, a Novel Zinc Finger/Homeodomain Repressor, Interacts with Smad Proteins and Binds to 5′-CACCT Sequences in Candidate Target Genes

SIP1, a Novel Zinc Finger/Homeodomain Repressor, Interacts with Smad Proteins and Binds to... THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 274, No. 29, Issue of July 16, pp. 20489 –20498, 1999 © 1999 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. SIP1, a Novel Zinc Finger/Homeodomain Repressor, Interacts with Smad Proteins and Binds to 5*-CACCT Sequences in Candidate Target Genes* (Received for publication, March 5, 1999) a a a,b,c a,b,d,e f Kristin Verschueren, Jacques E. Remacle, Clara Collart, Harry Kraft, Betty S. Baker, a,g a a,b,c h,i h,j Przemko Tylzanowski, Luc Nelles, Gunther Wuytens, Ming-Tsan Su, Rolf Bodmer, f,k a,b,l James C. Smith, and Danny Huylebroeck, From the Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the Laboratory of Molecular Biology (CELGEN), University of Leuven, Herestraat 49, B-3000 Leuven, Belgium, the Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, London NW7 1AA, United Kingdom, and the Department of Biology, University of Michigan, Ann Arbor, Michigan 48109-1048 Activation of transforming growth factor b receptors this Smad-interacting protein opens new routes to in- causes the phosphorylation and nuclear translocation vestigate the mechanisms by which transforming b members exert their effects on expres- of Smad proteins, which then participate in the regula- growth factor tion of expression of target genes. We describe a novel sion of target genes in responsive cells and in the verte- Smad-interacting protein, SIP1, which was identified brate embryo. using the yeast two-hybrid system. Although SIP1 inter- acts with the MH2 domain of receptor-regulated Smads in yeast and in vitro, its interaction with full-length Ligands of the TGF-b family exert their biological effects by Smads in mammalian cells requires receptor-mediated activating serine/threonine kinase receptor complexes, which dEF1/ Smad activation. SIP1 is a new member of the in turn activate intracellular mediators, the Smad proteins. Zfh-1 family of two-handed zinc finger/homeodomain Smads were initially identified by means of genetic studies in dEF1, SIP1 binds to 5*-CACCT sequences proteins. Like Drosophila and Caenorhabditis elegans as Mad and Sma gene in different promoters, including the Xenopus brachyury products, respectively. Nine different vertebrate Smads have promoter. Overexpression of either full-length SIP1 or been isolated (reviewed in Refs. 1–3; Ref. 4). These proteins are its C-terminal zinc finger cluster, which bind to the characterized by a three-domain structure containing con- Xbra2 promoter in vitro, prevented expression of the served N-terminal and C-terminal domains, called the MH1 endogenous Xbra gene in early Xenopus embryos. There- and MH2 domains, which flank a more variable, proline-rich dEF1, is likely to be a transcriptional fore, SIP1, like linker region. The Smads can be classified into three subgroups repressor, which may be involved in the regulation of at based on their distinct functions. The receptor-regulated least one immediate response gene for activin-depend- Smads (Smad1, 2, 3, 5, and 8) contain a conserved SSXS motif ent signal transduction pathways. The identification of at their extreme C-terminal end. Upon ligand stimulation, two serines in this motif are directly phosphorylated by specific type I receptors. Once activated, these Smads associate with * This work was supported by the Flanders Interuniversity Institute for Biotechnology, the Fund of Scientific Research-Flanders Smad4, a common mediator Smad, and the heteromeric com- (G.0296.98), and EU-Training and Mobility of Researchers (CT98- plexes translocate to the nucleus where they mediate responses 0216). The VIB-07 group kindly acknowledges the support from Inno- to specific ligands. Smads 1, 5, and 8 act in bone morphogenetic genetics S. A. (Gent, Belgium) within the framework of collaboration protein (BMP) pathways, whereas Smads 2 and 3 act in activin agreements with the University of Leuven and the Flanders Interuni- and TGF-b pathways. A third group of Smads, the inhibitory versity Institute for Biotechnology. The costs of publication of this article were defrayed in part by the payment of page charges. This Smads (Smad6 and Smad7), prevent the activation of receptor- article must therefore be hereby marked “advertisement” in accordance regulated Smads or their heteromerization with Smad4. Func- with 18 U.S.C. Section 1734 solely to indicate this fact. tional homologues of inhibitory Smads and the common medi- Recipient of a Pre-doctoral Fellowship from the Flemish Institute ator Smad in Drosophila have been identified as Dad and for the Promotion of Industrial Research and Technology Transfer (IWT). Medea, respectively (1–3). Present address: Innogenetics S. A., Industriepark 7 box 4, B-9052 In the absence of signaling, Smads are kept in a latent Zwijnaarde, Belgium. conformation through an intramolecular interaction between Recipient of a Post-doctoral Fellowship from the National Fund of the MH1 and MH2 domains. Activation of receptor-regulated Scientific Research (NFWO) and of the Research Council of the Univer- sity of Leuven. Smads has been proposed to disrupt this autoinhibition, allow- Present address: Laboratory for Skeletal Development and Joint ing the MH1 and MH2 domains to exert distinct functions in Disorders, University of Leuven, Herestraat 49, B-3000 Leuven, the nucleus (1–3). Smad4 and the MH1 domain of activated Belgium. Supported by a Fellowship from the Organogenesis Center at the University of Michigan. j 1 Supported by grants from the National Institutes of Health and the The abbreviations used are: TGF-b, transforming growth factor b; American Heart Association. bHLH, basic helix-loop-helix; BMP, bone morphogenetic protein; bra, Supported by the UK Medical Research Council and was an Inter- brachyury; CZF, C-terminal zinc finger cluster; DBD, DNA-binding national Fellow of the Howard Hughes Medical Institute. domain; GST, glutathione S-transferase; LacZ, b-galactosidase product Supported by VIB. To whom correspondence should be addressed. of the E. coli LacZ gene; NZF, N-terminal zinc finger cluster; SBD, Tel: 132 16 34 59 16; Fax: 132 16 34 59 33; E-mail: [email protected]. Smad-binding domain; SIP, Smad-interacting protein; PCR, polymer- kuleuven.ac.be. ase chain reaction; X, Xenopus; dpc, days post coitum. This paper is available on line at http://www.jbc.org 20489 This is an Open Access article under the CC BY license. 20490 DNA-binding Direct Partner of Receptor-regulated Smads EcoRI-XhoI inserts (21) and cloned between the EcoRI and SalI sites of Smad3 can directly bind DNA. Smad-binding elements in the the bait vector pGBT-9 (Matchmaker I, CLONTECH), such that in- promoters of different immediate response genes such as JunB frame fusions with GAL4 were obtained. Similar bait plasmids with DBD and PAI-I contain 59-CAGA boxes, and multimerization of such mouse Smad1, Smad2, and Smad5 were generated by PCR starting elements creates a TGF-b -inducible enhancer (5– 8). The crys- from the respective cDNA fragments encoding the MH2 domain. The tal structure of the Smad3 MH1domain bound to a Smad- G418S XSmad1 MH2 domain was generated by oligonucleotide-directed binding element revealed that 59-GTCT represents the mini- mutagenesis (Bio-Rad). For construction of the prey cDNA library, polyadenylated RNA from 12.5-dpc mouse embryos was isolated using mal DNA-binding sequence (9). However, promoter studies on the Oligotex mRNA Kit (Qiagen). Randomly primed cDNA was synthe- other direct target genes, such as vestigial and tinman in sized (Superscript Choice; Life Technologies, Inc.) and ligated to an Drosophila and goosecoid in the mouse, have implicated GC- excess of Sfi double-stranded adaptors containing StuI and BamHI rich sequences as direct DNA targets for Mad and/or Medea sites. To facilitate cloning of the cDNAs, the prey plasmid pACT2 and for Smad3 and/or Smad4 (10 –12). Together, these data (Matchmaker II, CLONTECH) was modified into pACT2/Sfi-Sfi (data suggest that Smads display a low DNA-binding affinity and not shown). Restriction of this plasmid with Sfi generates sticky ends that are not complementary, thus preventing self-ligation of the vector. specificity but are able to achieve highly specific regulation of A library of 3.6 3 10 independent recombinant clones with an average target promoters through physical or functional interaction insert size of 1,100 base pairs was obtained. The yeast two-hybrid with nearby bound transcription factors (12–20). This has been screening was carried out with the Matchmaker II kit. The yeast trans- exemplified through detailed studies of activin/TGF-b response formations were, however, performed according to Gietz (23). Yeast elements (ARE) in the promoters of Xenopus Mix.2 and mouse strain CG-1945 was used, and the screening was done on selective goosecoid which bind the forkhead transcription factors FAST1 medium containing 5 mM 3-amino-1,2,4-triazole. To map the Smad-binding domain in SIP1, progressive deletions and FAST2, respectively (12–16). It has been proposed that were generated by PCR using Pfu polymerase (Pfu; Stratagene), and upon ligand stimulation, FAST1 or FAST2 recruit heteromeric resulting amplified DNAs were cloned into pACT2, by means of SmaI Smad2/4 complexes to the Mix.2 or goosecoid promoters and XhoI restriction sites built in the primers used for amplification. through their interaction with the MH2 domain of activated SIP1 was generated by amplifying N- and C-terminal segment- DSBD51 Smad2. This promotes binding of Smad4 to an adjacent site, encoding parts of the cDNA which were fused by means of a NcoI restriction site built into the PCR primers at the position of the deletion. resulting in enhanced transcriptional activation (12, 16). The correct sequence of all these generated constructs was verified by The MH2 domain of Smads appear to mediate the associa- DNA sequencing. tion with transcription factors and although the majority of Cell Lines and Transfections—HEK293T cells were maintained in documented interactions involve the induction of gene expres- Dulbecco’s modified Eagle’s medium containing 4.5 mg of glucose/ml sion, some block transcriptional responses to ligand stimula- and 10% fetal bovine serum. COS1 cells were grown in Dulbecco’s tion. For example, the transcription factor and oncoprotein modified Eagle’s medium with 10% fetal bovine serum. Cells were transfected using Fugene (Roche Molecular Biochemicals) according to Evi-1 specifically interacts with activated Smad3, thereby pre- the protocol of the manufacturer and collected 30 – 48 h after venting Smad3 from binding DNA and blocking TGF-b-induced transfection. growth arrest in certain cell types (20). Recruitment of Smad3/ Synthesis of SIP1 and GST Pull-down Experiments—For production Smad4 heteromeric complexes to the mouse goosecoid promoter of GST-Smad fusion proteins in Escherichia coli, the same Smad frag- blocks, rather than induces, transcription of the gene (12). ments as used in the two-hybrid assay were re-cloned in pGEX-5X-1 Overall, these data indicate that, once activated and targeted (Amersham Pharmacia Biotech). GST-fusion proteins were expressed in E. coli (strain BL21) and purified on glutathione-Sepharose beads to the nucleus, Smads are able to undergo multiple interactions according to protocols provided by the supplier (Amersham Pharmacia with DNA and/or with different transcription factors to cause Biotech). The beads were first washed four times with phosphate- both activation and repression of gene expression. buffered saline supplemented with protease inhibitors and then were Previously, we have shown that overexpression of the Xeno- mixed with 50 ml of COS1 cell lysate in 1 ml of GST buffer (50 mM pus Smad1 MH2 domain induces ventral cell types in Xenopus Tris-HCl, pH 7.5, 120 mM NaCl, 2 mM EDTA, 0.1% (v/v) Nonidet P-40, embryos. Because this domain does not have DNA-binding and protease inhibitors). The lysate was prepared from COS1 cells transiently transfected with pCS3-SIP1 using solubilization buffer (24). capacity, we anticipated that it would interact with transcrip- The beads were mixed at 4 °C for 16 h. Unbound proteins were removed tion factors in the nucleus to elicit its biological effect (21). by washing four times with GST buffer and once with phosphate- Therefore, a search for Smad-interacting proteins (SIPs) was buffered saline at 4 °C. Bound proteins were harvested by boiling in initiated using two-hybrid screening in yeast. As bait, the sample buffer, and they were resolved by SDS-polyacrylamide gel elec- XSmad1 MH2 domain was fused to the DNA-binding domain of trophoresis. Myc-tagged SIP1 was visualized after Western blotting the yeast transcription factor GAL4 (GAL4 ). As source of using anti-Myc monoclonal antibody (9E10), horseradish peroxidase- DBD conjugated anti-mouse secondary antibody (Jackson), and the enhanced preys, we used a 12.5-dpc mouse embryo cDNA library fused to chemiluminescence kit (New England Nuclear). For mammalian pull- the GAL4 transactivation domain (GAL4 ). This screen TAD down experiments, DNA inserts in pGEX-5X-1 encoding XSmad1 GST- yielded several SIPs, one of which, SIP1, is characterized here. fusion proteins were amplified by PCR using Pfu, and re-cloned into pCS2. Cell pellets of transfected COS1 cells were frozen in liquid nitro- EXPERIMENTAL PROCEDURES gen, thawed on ice, and solubilized in lysis buffer containing 1% cDNA Cloning and Mammalian Expression Plasmids—Mouse Nonidet P-40, 150 mM NaCl, 20 mM Tris, pH 7.5, 2 mM EDTA, supple- Smad1 and Smad2 cDNAs were identified by low stringency screening mented with protease inhibitors (Protease Inhibitor Mixture Tablets, of an oligo-dT-primed lExlox library made from 12-dpc mouse embryo Roche Molecular Biochemicals). Cell lysates were cleared by centrifu- (Novagen), using Smad5 (MLP1.2 clone; Ref. 21) as a probe. This library gation, and GST-fusion proteins were purified from cell extracts by was also used to screen for SIP1 cDNAs other than th1 cDNA, yielding incubation with glutathione-Sepharose beads for2hat4 °C, followed lExTW6. The 3.6-kilobase TW6 cDNA overlapped with th1 and con- by four washes in cold lysis buffer. Purified proteins were visualized by tained additional 39-coding sequences including an in-frame stop codon. Western blotting as described above. For detection of the GST-fusion The complete SIP1 open reading frame was reconstituted by fusing proteins, a polyclonal anti-GST antibody (Amersham Pharmacia Bio- TW6 cDNA with a SIP1 sequence including the ATG translation initi- tech) and a horseradish peroxidase-conjugated anti-goat secondary an- ation codon, obtained in an independent screen for mouse homologues of tibody (Jackson) were used. Zfh-1. For expression in mammalian cells and Xenopus, the SIP1 cDNA Immunoprecipitations—Extracts from transfected HEK293T cells was subcloned into pCS2 and pCS3 (22). In the latter, the SIP1 open were prepared as described above for COS1 cells in the mammalian reading frame was fused to a Myc tag at the N terminus. For expres- pull-down experiments, except that the lysis buffer was also supple- sion of SIP1 , we subcloned a cDNA fragment encoding amino acids mented with a mixture of phosphatase inhibitors (50 mM NaF, 1 mM CZF 977–1214 into pCS3. sodium pyrophosphate, and 0.1 mM okadaic acid). Immunoprecipita- Yeast Two-hybrid Cloning and Assays—XSmad1 full-size and MH2 tions were performed by incubation with the M2 Flag monoclonal an- domain bait plasmids were constructed using the previously described tibody for2hat4 °C, followed by incubation with protein-G beads for DNA-binding Direct Partner of Receptor-regulated Smads 20491 1 h at 4 °C. Beads were collected by centrifugation and washed four times with lysis buffer at 4 °C, and bound proteins were visualized as described above in the pull-down experiments. Electrophoretic Mobility Shift Assays—The sequence of the upper strand of the double-stranded oligonucleotide probes used in this work are shown in Figs. 6 and 7. The wild type and mutant kE2 sequences, the X. brachyury-binding site and MyoD-binding site were taken from Sekido et al. (25). The AREB6-binding site (26), the Nil-2a-binding site FIG.1. Association of SIP1 with different XSmad and TH1 (27), and the GATA2-binding site (28) were identical to those described mouse Smad baits (MH2 domains or full-length) in yeast two- previously. Double-stranded oligonucleotides were end-labeled with T4 hybrid assays, as illustrated by staining for LacZ (blue colonies polynucleotide kinase and [g- P]ATP and purified by polyacrylamide indicate positive LacZ staining, i.e. interaction of prey with gel electrophoresis. Gel retardation assays were carried out with either bait). Four representative colonies are shown for each interaction a bacterially expressed and purified GST-fusion protein (GST-SIP1 ) CZF analyzed. Numbering of deleted or substituted amino acids is according or with cell extracts from COS1 cells transiently transfected with ex- to their position in the full-length protein. pression constructs encoding Myc-tagged SIP1 proteins. Extracts were made from those cells as described in the GST pull-down experiments a subset of cells in the heart, and dEF1 is required for normal using solubilization buffer. Electrophoretic mobility shift assay was development of T cells and certain skeletal elements in the carried out according to Sekido et al. (25). The GST-PLAG1 fusion protein, used as a negative control, was a gift from M. Voz (Flanders mouse (38, 39), it is possible that SIP1, which is expressed Interuniversity Institute for Biotechnology, Dept. VIB-04, Leuven, during mouse embryogenesis (data not shown), also plays a role Belgium). in embryonic development. Therefore, SIP1 was subjected TH1 Experiments in Xenopus—RNA encoding SIP1 , SIP1 , and full- CZF TH1 to further analysis. length SIP1 was prepared by linearizing the appropriate pCS2 plas- Analysis of SIP1 /Smad Interactions in Yeast—Interac- mids with Asp718 and carrying out transcription reactions according to TH1 tion between SIP1 and different Smad proteins were first (29). Xenopus embryos were obtained by in vitro fertilization (30). They TH1 were maintained in 10% Normal Amphibian Medium (31) and staged examined using the yeast two-hybrid system. Interaction of according to Nieuwkoop and Faber (32). Embryos at the 2- to 4-cell SIP1 with the MH2 domain of XSmad1 was maintained TH1 stage were injected with 1 ng of RNA dissolved in 14 nl of water as upon removal of the homeodomain-like segment of SIP1 TH1 described (33). They were cultured to early gastrula stage 10.5 and (data not shown), and similar approaches enabled us to posi- processed for whole mount in situ hybridization according to the method tion the Smad-binding domain (SBD) of SIP1 to a region TH1 of Harland (33), using a probe specific for Xbra (34). within the first 192 amino acids. Strikingly, we did not observe an interaction between SIP1 and full-length XSmad1 in RESULTS TH1 yeast (Fig. 1). This was not because of inefficient expression of Two-hybrid Cloning of Smad-interacting Proteins—To carry full-length Smad1 in yeast because other Smad-interacting out the two-hybrid screening, the coding sequence of the MH2 polypeptides, that are not related to SIP1, interacted efficiently domain of XSmad1 was fused to the GAL4 in the plasmid DBD with this bait (data not shown). Additional experiments showed pGBT-9. This GAL4 -Smad1 bait protein, when tested on its DBD that SIP1 did not interact with the MH1 domain of XSmad1 TH1 own, did not give detectable levels of GAL4-dependent synthe- nor with the MH2 domain from which the last 43 amino acids sis of HIS3 and LacZ in the yeast strain used. As a source of were deleted (D424 – 466) (Fig. 1). A truncated Mad similar to prey cDNAs, a random primed library was constructed in a the D424 – 466 mutant has been shown to cause loss-of-function modified pACT2 vector using polyadenylated RNA isolated phenotypes in Drosophila, whereas a similar truncation of from 12.5-dpc mouse embryos. Screening of about 4 million Smad4 (dpc4) in a loss-of-heterozygosity background is associ- yeasts using this bait and the prey plasmids yielded approxi- ated with pancreatic carcinomas (40, 41). In contrast, SIP1 TH1 mately 500 colonies expressing both the HIS3 marker and did interact with a modified XSmad1 MH2 domain having a LacZ reporter genes. Rescreening of these colonies identified 81 single amino acid substitution (G418S, Fig. 1). This mutation in which expression of the two genes required the presence of affects a conserved glycine residue and has been reported to prey as well as bait cDNAs. One of the prey cDNAs, th72, render the Smad homologue of Drosophila inactive and to abol- encoded a protein in which the GAL4 transactivation domain ish BMP-dependent phosphorylation of Smad1 in mammalian was fused in-frame to Smad4, which started from amino acid cells (40, 42). 252 in the proline-rich domain (data not shown). Smad4 is Despite their very high degree of sequence similarity, the known to interact with other receptor-activated Smad proteins MH2 domains of Smad1 and Smad2 display striking differ- (1–3), and the isolation of this Smad4 cDNA confirmed the ences in biological effects when overexpressed in Xenopus em- feasibility of our two-hybrid approach toward identifying bryos; the former induces ventral mesoderm whereas the latter Smad-interacting proteins. induces dorsal tissues (1–3). Recently, Smad5 has also been The cDNA insert of another positive prey plasmid, th1, en- shown to induce ventral fates in the Xenopus embryo and to be coded a polypeptide of 626 amino acids, named SIP1 . TH1 a target for phosphorylation by activated BMP type I receptors; Whereas th72 (Smad4) was isolated only once from the initial it thus shares certain activities with Smad1 (43– 44). To inves- collection of 81 positive colonies, two additional SIP1 clones, tigate whether SIP1 interacts specifically with MH2 do- TH1 identical to SIP1 , were obtained. Sequence analysis re- TH1 mains of different Smads, we tested the ability of SIP1 to TH1 vealed that SIP1 has similarities to the vertebrate d-crys- TH1 interact with the MH2 domains of mouse Smads 1, 2, and 5 in tallin enhancer binding protein (dEF1) and Drosophila Zfh-1 a yeast two-hybrid assay. SIP1 was found to interact in TH1 (25, 36). These proteins, like SIP1 , contain a homeodomain TH1 yeast with the MH2 domain of all three Smad proteins tested sequence. The Zfh-1 homeodomain is a canonical domain con- (Fig. 1). Therefore, SIP1 may be a common binding protein for taining highly conserved residues in helix 3/4 critical for DNA these receptor-regulated Smads. binding, such as a conserved asparagine and arginine at posi- SIP1 Is a Novel dEF1-related DNA-binding Protein—The tions 10 and 12 within the helix (36). These critical amino acids complete SIP1 cDNA sequence was obtained from the sequence are, however, not conserved in the corresponding regions of of the SIP1 insert and by screening additional cDNA librar- TH1 dEF1 or SIP1, suggesting that their homeodomain cannot bind ies. Mouse SIP1 cDNA was also isolated in an independent directly to DNA. We therefore prefer to call this domain a homeodomain-like sequence. Because Zfh-1 is involved in pat- terning of mesoderm-derived tissues (35), including muscle and M.-T. Su, M. Fujioka, and R. Bodmer, unpublished results. 20492 DNA-binding Direct Partner of Receptor-regulated Smads FIG.2. A, schematic representation of the domain structure of SIP1 protein and its similarities with mouse dEF1. The putative zinc fingers are shown (dark gray boxes for C2H2-type zinc fingers and light gray boxes for C3H type) together with the homeodomain-like sequence (HD). The oval indicates the domain essential for interaction of SIP1with the Smad MH2 domain (SBD). SIP1 cDNAs used in this study are indicated (SIP1 TM full-length shown in red, SIP1 and SIP1 shown in yellow). The sequence of SIP1 is available from GenBank under accession number TH1 CZF AF033116. B, amino acid sequence comparison between mouse SIP1 and mouse dEF1. Gray boxes reflect identical or biochemically similar amino acids. The position of the C2H2 type zinc fingers in SIP1 is indicated by a bold overline, other zinc fingers in SIP1 are indicated by thin double overlines. screen for mammalian homologues of Drosophila Zfh-1. A the isolated MH2 domain of Smad proteins, lacks both the NZF strong sequence conservation between certain segments of and the CZF. The SBD, as defined above, maps to amino acids SIP1, dEF1, and Zfh-1 can be observed, and the three proteins 315–507 in the full-length protein. display a similar organization of putative functional domains A Smad-binding Domain of 51 Amino Acids Is Essential for (45) (Fig. 2A). As in dEF1 and Zfh-1, the homeodomain-like Interaction of SIP1 with the XSmad1 MH2 Domain—The SBD (HD) segment of SIP1 is flanked by two zinc finger (ZF) clus- of SIP1 was mapped to a segment spanning amino acids 315– ters, one (NZF) located in the N-terminal part and one (CZF) in 507 (see above). This region of 192 amino acids was sufficient to the C-terminal part. Despite the very high sequence identity of interact with the XSmad1 MH2 domain in yeast (data not these zinc finger clusters in the mammalian proteins, mouse shown). To further delineate the SBD, progressive deletions SIP1 is distinct from mouse dEF1 (Fig. 2B). Moreover, the SIP1 were made within this segment, and the resulting truncated sequence is also quite divergent from Drosophila Zfh-1 and polypeptides were tested in yeast for interaction with the thus represents a new member of the family of two-handed zinc XSmad1 MH2 domain. Mutant SIP1 SBD constructs contain- finger/homeodomain proteins. SIP1 , which interacts with TH1 ing amino acids 437–507, as well as 315– 487, still sustained interaction with the bait, whereas mutants encoding amino M.-T. Su, M. Liu, and R. Bodmer, unpublished results. acids 457–507 and 315– 467 did not (Fig. 3). Therefore, the DNA-binding Direct Partner of Receptor-regulated Smads 20493 FIG.3. Mapping of the Smad-bind- ing domain in SIP1. Schematic repre- sentation of deletion constructs to map the segment required for interaction of SIP1 with the XSmad1 MH2 domain. The original Smad-binding domain (spanning amino acids 315–507; shown in brown) was used as a starting point for the de- tailed mapping. The right column sum- marizes interaction data obtained in yeast, as assayed by ability to grow on plates lacking histidine and in the pres- ence of 5 mM 3-amino-triazole and by staining of b-galactosidase. The Smad- binding domain (SBD, shown in green)is a 51-amino acids-long peptide defined as essential for the interaction; its amino acid sequence (aa seq) is shown in the lower part of the figure. minimal domain required for interaction with the MH2 domain of XSmad1 was defined as a 51 amino acids-long region encom- passing the segment 437– 487 of full-length SIP1. To confirm that this domain is involved in mediating Smad binding in the context of full-length SIP1, a SIP1 mutant was constructed in which this minimal SBD was deleted (SIP1 ). As ex- DSBD51 pected, this mutant SIP1 protein gave no detectable interaction with the XSmad1 MH2 bait in yeast (Fig. 3). SIP1 Interacts with the MH2 Domain of Receptor-regulated Smads in Vitro—Like SIP1 , full-length SIP1 protein inter- TH1 acted with the MH2 domain of XSmad1, but not with full- length XSmad1 in yeast (data not shown). We went on to analyze this interaction further in vitro using glutathione S- transferase (GST) pull-down assays. GST-Smad MH2 domain FIG.4. In vitro association of SIP1 with the MH2 domains of fusion proteins were produced in E. coli and coupled to gluta- different Smad proteins. Myc-tagged full-size SIP1 protein was ex- thione-Sepharose beads. An unrelated GST-fusion protein pressed in COS1 cells. Upper panel, equal amounts of the same cell (GST fused to the intracytoplasmic domain of CD40, the recep- extract were used in lanes 1– 6. The 145-kDa SIP1 protein (indicated by the arrow) was efficiently pulled down from this cell lysate using the tor for the tumor necrosis factor-related CD40 ligand; Ref. 46) different GST-Smad fusion proteins (lanes 1 and 4–6; visualization is and GST itself were used as negative controls. Full-length SIP1 by Western blotting using anti-Myc antibody) but not by an unrelated protein, epitope-tagged (with six Myc epitopes) at its N-termi- GST-fusion protein (GST-CD40; lane 3) and GST (lane 2). GST fusions nal end, was produced in COS1 cells. Using GST-Smad beads, included the MH2 domains of XSmad1(G418S) (lane 4), mouse Smad5 (lane 5), mouse Smad2 (lane 6), and wild type XSmad1 (lane 1), respec- we pulled down this SIP1 protein from cell lysates, as shown by tively. Lane 7 provides a negative control with proteins pulled-down by Western blotting using anti-Myc antibody (Fig. 4, lane 1). This GST-XSmad1 from a cell lysate of mock-transfected cells. Lower panel, interaction was specific because a polypeptide consisting of six estimate of the amount of GST-fusion proteins used in the pull-down consecutive Myc tags alone was not pulled down from extracts experiments by Ponceau S staining of the used blot. Lower amounts of GST-Smad fusion proteins were used in lanes 1 and 4–7. of transfected COS1 cells (data not shown) nor was SIP1 pulled down by GST alone or by the GST-CD40 fusion protein (Fig. 4, lanes 2 and 3). In addition, full-length SIP1 protein interacted As assayed by immunoblotting, SIP1 could be co-purified with with the MH2 domain of Smad2, Smad5, and the the XSmad1 MH2 domain in these experiments (Fig. 5A, mid- XSmad1G418S mutant, confirming the results obtained in the dle panel, lane 1). The specificity of the interaction was further yeast two-hybrid assay (Fig. 4, lanes 4 – 6). Moreover, SIP1 , confirmed using the SIP1 mutant which lacks the 51-amino TH1 which lacks both zinc finger clusters, behaved like full-length acid-long SBD (SIP1 ), as defined in yeast two-hybrid DSBD51 SIP1 in these experiments (data not shown). assays. As expected from previous results, we failed to detect SIP1 Interacts with Activated, but Not Latent Full-length any interaction of this SBD deletion mutant with the MH2 Smads in Mammalian Cells—To further examine the func- domain of XSmad1 in mammalian cells (Fig. 5A, middle panel, tional relevance of the detected interaction between SIP1 and lane 2). the MH2 domain of XSmad1, we analyzed whether SIP1 could Second, binding of SIP1 with full-length Smad1 was ana- interact with this domain and with latent or activated, full- lyzed by co-immunoprecipitation experiments. Expression con- length Smad1 in mammalian cells. In the first series of exper- structs for Myc-tagged SIP1 and Flag-tagged full-length Smad1 iments, the association of SIP1 with the MH2 domain of XS- were co-transfected in HEK293T cells, with or without consti- mad1 was studied using mammalian GST pull-down assays. tutively active ALK-6 (or BMPR-IB), a well characterized BMP cDNA encoding the GST-XSmad1 fusion protein used in type I receptor, which has been shown previously to phospho- MH2 the in vitro pull-down assay was cloned in a mammalian ex- rylate and activate Smad1 (42, 47). Flag-tagged Smad1 was pression vector, and this construct was used to transiently first immunoprecipitated using anti-Flag monoclonal antibod- transfect COS1 cells, together with an expression construct for ies, and the resulting precipitate was then probed for the pres- Myc-tagged SIP1. The GST-fusion protein was subsequently ence of SIP1 by Western analysis using anti-Myc monoclonal purified from cell extracts with glutathione-Sepharose beads. antibodies. As demonstrated in Fig. 5B (lanes 1– 8), SIP1 could 20494 DNA-binding Direct Partner of Receptor-regulated Smads FIG.5. A, interaction of SIP1 with the MH2 domain of XSmad1 in mammalian cells. An expression construct encoding a fusion between GST and the MH2 domain of XSmad1 was transfected in COS1 cells together with expression constructs for Myc-tagged SIP1. As shown by immunoblotting of pulled-down material from cell extracts, SIP1 specifically interacted with the GST-XSmad1 fusion protein (middle panel, lane 1), whereas deletion of the SBD disrupted the interaction (middle panel, lane 2). Comparable affinity purification of the GST-fusion protein and equal expression of SIP1 were confirmed by immunoblotting of the pulled down material using polyclonal anti-GST antibody (upper panel) and of total cell extracts using monoclonal anti-myc antibody (lower panel), respectively. B, ligand-dependent interaction of SIP1 with full-length Smads in mammalian cells. Lanes 1–5, lanes 6 –11, and lanes 11–17 contain data from three independent experiments. HEK293T cells were transiently transfected with various combinations of expression constructs encoding Myc-tagged SIP1, Flag-tagged Smads, and type I receptors, as indicated. Cell lysates were immunoprecipitated with anti-Flag antibodies, and the precipitated proteins were visualized by SDS-polyacrylamide gel electrophoresis and immunoblotting using anti-Myc (upper panel) or anti-Flag (middle panel) antibodies. The middle panel shows the comparable immunoprecipitations of Flag-tagged Smads in each experiment, whereas the lower panel shows immunoblotting of total cell extracts using anti-Myc antibody, to confirm comparable expression of SIP1. *, indicates the heavy chain of the anti-Flag antibody used in the immunoprecipi- tations; ca, constitutively active; wt, wild type; DSBD indicates SIP1 in which the 51-amino acids-long SBD was deleted. be specifically co-immunoprecipitated with full-length Smad1 occurred as a result of Smad1 activation by constitutively ac- but only after co-transfection of the cells with constitutively tive ALK-6. In addition, as was shown for the XSmad1 MH2 active ALK-6. This shows that SIP1 did not detectably interact domain, full-length activated Smad1 did not interact with SIP1 with latent full-length Smad1 in mammalian cells and that lacking the 51-amino acids-long SBD (Fig. 5B, lane 9). activation of Smad1 does allow interaction. Our results, obtained both in yeast and in vitro, show that To confirm that the detected interaction was a direct conse- SIP1 interacts with the MH2 domain of several different quence of Smad1 activation, SIP1zSmad1 complex formation Smads. To extend these data, we analyzed the association of was analyzed after co-transfection of cells with expression con- SIP1 with Smads 2, 3, and 4 by co-immunoprecipitation. SIP1 structs for wild type ALK-6 or constitutively active ALK-4 weakly bound full-length Smad2 and Smad3 in the absence of (ActR-IB). The former cannot signal in the absence of an ap- co-transfected constitutively active ALK-4 (Fig. 5B, lanes 12 propriate type II receptor and without ligand stimulation, and 14). This weak interaction may have resulted from auto- whereas the latter specifically phosphorylates Smad2 and not crine signaling in HEK293T cells through pathways that acti- Smad1 (48, 49). Very weak (Fig. 5B, lane 10) or no interaction vate both Smad2 and Smad3, but not Smad1. Significantly, (lane 11) of SIP1 with full-length Smad1 was detected under however, co-transfection of constitutively active ALK-4 greatly these conditions, strongly indicating that complex formation enhanced complex formation between SIP1 and both Smad2 DNA-binding Direct Partner of Receptor-regulated Smads 20495 FIG.6. Interaction of the DNA-bind- ing domain of SIP1 (SIP1 ) with CZF target sites of different promoters by gel retardation analysis. A, the fusion protein GST-SIP1 (10 ng) was incu- CZF bated with the indicated P-labeled double-stranded oligonucleotides. No binding was observed with negative con- trol GST-PLAG1 (Control; the Bra- DBD binding site was used here). B, interaction of SIP1 with E2 box sequences. The CZF experiment was carried out as described in panel A, but MyoD and MyoD-Mut la- beled probes were used. Competition ex- periments were carried out with the oli- gonucleotides listed above the lanes.In the negative control lanes (Control), both MyoD and MyoD-Mut probes were incu- bated with GST-PLAG1 , and no com- DBD petitor was added. No, no competitor added. and Smad3 (Fig. 5B, lanes 13 and 15). Interaction with Smad3 which was previously shown to affect binding of the bHLH was stronger than with Smad2. In contrast, we never detected factor E47 but not of dEF1 (25), did not affect binding of any direct interaction between SIP1 and Smad4 in this SIP1 . Two other mutations in this kE2 site (Mut2 and CZF experiment (Fig. 5B, lanes 16 and 17). In conclusion, these Mut4) which abolished binding of dEF1 (25), also abolished CZF experiments demonstrate that SIP1 is a common binding pro- binding of SIP1 . SIP1 also bound to the Nil-2a-binding CZF CZF tein for different receptor-regulated Smads in mammalian cells site of the interleukin-2 (IL-2) promoter, as well as the AREB6- and that interaction of full-length Smads with SIP1 is driven binding site, both of which have previously been shown to bind by activation of these Smads by specific type I receptors. dEF1 (26, 27). Moreover, as previously proposed for dEF1 , CZF SIP1 Has the Same DNA-binding Specificity as dEF1—dEF1 SIP1 bound to a palindromic 59-CACCT sequence, which CZF is a repressor of transcription which binds specifically to the also constitutes a binding site for the transcriptional activator sequence 59-CACCT, as determined by target site selection (50, X. brachyury (Fig. 6A) (52). Fig. 6B extends these analyses to a 51, 25). This (underlined) sequence is also part of the E2 box site recognized by the bHLH factor MyoD. SIP1 was able to CZF (59-CACCTG), which is the binding site for a subgroup of bHLH bind to a probe which encompasses the muscle creatine kinase DNA-binding proteins, such as E2A, E47, and MyoD. It has (MCK) enhancer E2 box, and this complex was competed by the been proposed that dEF1 may regulate cell type-specific gene E2 box oligonucleotide or by other SIP1-binding sites. Addition- expression by competing with these activators for binding. For ally, a point mutation within this E2 box, similar to the previ- example, dEF1-mediated repression has been proposed as the ously used kE2-Mut4 site, also abolished binding of SIP1 CZF primary mechanism for silencing the IgH enhancer in non-B (Fig. 6B). These experiments show that the GST-SIP1 fu- CZF cells. dEF1 is also present in B-cells, but its activity is coun- sion protein displays the same DNA-binding specificity as the teracted by E2A, a B-cell specific bHLH factor (51). Similarly, GST-fusion protein made with the CZF region of dEF1 (25) and dEF1 represses the Igk enhancer where it competes with bHLH binds to 59-CACCT sequences. factor E47 for binding (25). SIP1 Binds to the Promoter of the Xbra Gene and Down- The C-terminal zinc finger cluster (CZF) of dEF1 is required regulates Transcription of This Gene upon Overexpression in for binding to E2 box sequences and for competition with acti- the Xenopus Embryo—Having characterized SIP1 as a DNA- vators (25). Bearing in mind the high similarity of the SIP1 and binding protein, we verified whether promoters of immediate dEF1 CZF domains, we decided to test whether they have early target genes for signaling by TGF-b members contain similar DNA-binding specificities. The DNA-binding properties 59-CACCT sequences. Examination of the Xenopus Xbra2 pro- of the CZF fragment of SIP1 (named SIP1 ) were analyzed by moter sequence revealed the presence of two potential SIP1- CZF gel retardation assays using a bacterially expressed and puri- binding sites localized in a 153-bp-long region that confers fied GST-SIP1 fusion protein. Larger GST-SIP1 fusion pro- responsiveness to FGF and activin (53). These sites are ar- CZF teins could not be produced because they were subject to pro- ranged in a palindrome and are separated by 24 nucleotides. teolytic degradation in E. coli (data not shown). This prompted us to investigate whether SIP1 or full-length CZF Purified GST-SIP1 bound to the E2 box of the Igk en- SIP1 can bind to this Xbra2 promoter element. CZF hancer (kE2 probe) (Fig. 6A). A mutation of this site (Mut1), Myc-tagged SIP1 or full-length SIP1 (SIP1 ) were ex- CZF FL 20496 DNA-binding Direct Partner of Receptor-regulated Smads FIG.7. SIP1 binds to the Xbra2 promoter. Fifty pg of P-labeled Xbra SIP1 probes (WT or D) were incubated with extracts from COS1 cells transfected with expression constructs for Myc-tagged SIP1 FIG.8. SIP1 polypeptides repress endogenous Xbra gene ex- CZF (lanes 1–2) or full-length SIP1 (SIP1 , lanes 3– 4). Lane 5 shows bind- FS pression in early Xenopus embryos. Xenopus embryos at the 2- to ing of endogenous proteins in cell extracts from mock-transfected cells. 4-cell stage were left uninjected (A) or were injected with 1 ng of RNA Specific SIP1 complexes are indicated (*) as well as endogenous encoding SIP1 (B), XOtx2(K3 E) (C), or full-length SIP1 (D). Both CZF complexes (l). Xbra-WT probe contains the sequence 59-ATCCAGGC- SIP polypeptides caused repression of Xbra expression. In panels B and CACCTAAAATATAGAATGATAAAGTGACCAGGTGTCAGTTCT, D, expression is down-regulated in half the embryo because one of two and Xbra-D contains 59-ATCCAGGCCACCTAAAATATAGAATGATA- cells of the early embryo was injected. In a typical experiment, 14 of 16 AAGTGACCAGATGTCAGTTCT. SIP1-binding sites are in bold, and embryos injected with RNA encoding SIP1 displayed down-regula- CZF the substituted nucleotide is underlined. tion of Xbra expression, as did, in a separate experiment, 18 of 19 embryos injected with full-length SIP1. Slight down-regulation of Xbra expression was seen in only 1 of 13 embryos injected with RNA encoding pressed in COS1 cells and cell extracts used in gel retardation Otx2(K3 R). assays, together with a 50-bp-long Xbra2 promoter sequence encompassing the two 59-CACCT sequences (Xbra-WT probe). is replaced by glutamic acid XOtx2(K3 E) (54). As was shown As shown in Fig. 7, lane 5, cell extracts of mock-transfected previously (53), overexpression of this mutant protein had no cells contain endogenous proteins that bind to this probe. They effect on Xbra expression (Fig. 8C). In embryos injected with are visualized as two weak and slowly migrating complexes RNA encoding either SIP1 or full-length SIP1, however, CZF and one strong, faster migrating complex. When extracts from there were gaps in the Xbra expression domains, suggesting cells expressing either full-length SIP1 or SIP1 were used, CZF that these SIP1 polypeptides abolished transcription of the an additional complex could be seen (Fig. 7, lanes 1 and 3). In endogenous Xbra gene (Fig. 8, B and D). both cases, these complexes could be supershifted with anti- DISCUSSION Myc antibody, and the signal could be competed by incubation with an excess of unlabeled Xbra-WT oligonucleotide (data not We describe here the isolation of SIP1, a Smad-interacting shown). This indicated that the complex represents binding of protein that is a new member of the family of two-handed zinc SIP or full-length SIP1, respectively, to the Xbra-WT probe finger/homeodomain transcription factors. SIP1 was isolated as CZF and that binding is specific. Integrity of at least the down- a mouse cDNA encoding a protein that interacted with the stream 59-AGGTG sequence appeared crucial for binding be- MH2 domain of XSmad1 in yeast. It was subsequently shown to cause a single nucleotide substitution in that sequence abol- bind in mammalian cells to activated, but not latent, full- ished binding of SIP1 or SIP1 to the Xbra-D probe (Fig. 7, length receptor-regulated Smads, and not to bind to the com- CZF FL lanes 2 and 4). A similar mutation disrupted binding of SIP1 mon mediator Smad4. These findings identify SIP1 as a poten- CZF to the kE2-binding site (Fig. 6A, lane 5). tial new component of signal transduction pathways triggered These results demonstrate that SIP1 binds specifically to an by members of the TGF-b superfamily and add SIP1 to the list element in the region of the Xbra2 promoter which mediates of transcription factors able to physically interact with Smads, fibroblast growth factor and activin induction. They raise the including FAST1 and FAST2, Evi-1, c-Jun, and c-Fos (14, 15, possibility that SIP1 could affect Xbra expression in the Xeno- 17, 20). These factors have been identified as mediators/ pus embryo. To address this question, RNA encoding SIP1 modulators of signaling because they either bound to ligand- CZF or full-length SIP1 was microinjected into one blastomere of responsive elements in promoters of immediate target genes Xenopus embryos at the 2- or 4-cell stage. The embryos were (12, 13, 17) or, as is the case for Evi-1, could counteract the allowed to develop to early gastrula stage (stage 10.5), and growth inhibitory effect of TGF-b (20). expression of Xbra was analyzed by whole-mount in situ hy- SIP1 is the first novel Smad-interacting protein identified by bridization. In uninjected embryos, Xbra was expressed a two-hybrid screening in yeast. Our observation that the iso- throughout the mesoderm, and its expression pattern formed lated MH2 domain of Smads could bind to SIP1 in the absence an uninterrupted circle when viewed from the vegetal hemi- of signaling, but that full-length Smads needed to be activated sphere of the embryo (Fig. 8A). As a negative control, embryos to interact, supports the view that the Smad MH1 domain were injected with RNA encoding a mutant version of XOtx2, in exerts an inhibitory effect on the MH2 domain. These auto- which the lysine at position 9 of helix 3/4 of the homeodomain inhibitory interactions are known to be disrupted upon phos- DNA-binding Direct Partner of Receptor-regulated Smads 20497 phorylation (1–3), thus allowing the MH2 domain to associate as E2A and MyoD. This competition has been proposed to provide a genetic switch in which the activity of Ig and muscle- with transcription factors. Interestingly, we were unable to detect binding of SIP1 to full-length XSmad1 in yeast. Our data specific enhancers is dictated by the relative levels of dEF1 and these bHLH activators in the nucleus (45, 51). indicate that, in yeast, full-length Smads are also in a latent Analysis of the DNA-binding activities of SIP1, as presented conformation, preventing the MH2 domain from interacting here and currently being analyzed in a separate study with certain proteins. Whether unfolding of receptor-regulated involving dissection of DNA target sites and structure-function Smads and their nuclear translocation is sufficient to drive analysis of the zinc finger clusters, has shown that SIP1, like association with SIP1 in mammalian cells, or whether high dEF1, binds to 59-CACCT sequences. Interestingly, it has been affinity interaction of SIP1 with these Smads also depends on proposed, based on the phenotypes of dEF1 knock-out mice, the phosphorylation status of the C-terminal serines remains that another transcription factor with a similar DNA-binding to be determined. In this context, it is important to mention specificity as that of dEF1 exists (39). Indeed, despite the char- that these serines map in a region shown to be critical for acterization of dEF1 as a negative regulator of muscle differ- binding of the XSmad1 MH2 domain to SIP1. This region entiation in vitro and its abundant expression in somites, these encompasses the last 43 amino acids of XSmad1, and their mice do not display any detectable phenotype in developing deletion abolishes the interaction. In contrast, substitution of muscle (39). Perhaps SIP1, with its overlapping DNA-binding the conserved Gly-418 localized in a loop required for associa- specificities and partially overlapping expression pattern (data tion of Smads with activated type I receptors (55) does not not shown), compensates for the loss of dEF1 in certain tissues significantly affect interaction of the XSmad1 MH2 domain of the knock-out mice. with SIP1. Thus, interactions of the XSmad1 MH2 domain with We have identified 59-CACCT sequences in the promoter of type I receptors and SIP1 occur through distinct sequences. X. brachyury (Xbra2), an immediate response gene for meso- We have also mapped a 51-amino acids-long Smad-binding derm inducing factors such as activin. These sequences can domain in SIP1 that is essential for its association with Smads. bind SIP1 or full-length SIP1 in vitro. Moreover, overex- CZF The SIP1 zinc finger clusters are dispensable for binding to pression of the SIP1 CZF domain or of full-length SIP1 protein Smads, in contrast to the C-terminal zinc finger cluster of in Xenopus embryos abolished expression of Xbra in presump- Evi-1, which is necessary for interaction with Smad3 (20). tive mesoderm. These data indicate that SIP1, when overex- Furthermore, there is no sequence similarity between the SBD pressed, can act as a transcriptional repressor of Xbra in vivo. and the Smad-binding domain of FAST1 (SID; Ref. 14). Smads Interestingly, the SIP1-binding sites in the Xbra2 promoter, therefore appear to be able to bind to a wide range of amino the regulation of which is very complex in the amphibian em- acid sequences. bryo, map to a region that is required for transcriptional in- We have demonstrated that SIP1 can interact with different, duction of the gene by activin (53). Results from a recent study receptor-activated Smads in mammalian cells. However, in our using transgenic Xenopus embryos have shown that these experiments, SIP1 bound more strongly to Smad3 than to SIP1-binding sites are required for the correct spatial and Smad2, both of which were activated by constitutively active temporal expression patterns of Xbra2 reporter constructs. ALK-4 (or ActR-IB), an activin type I receptor. This suggests Thus, if endogenous SIP1-like proteins are present in the Xe- that the affinity of SIP1 for these Smads differ in vivo.In nopus embryo, they may participate together with co-repres- addition, this aspect may contribute to functional differences sors (as shown for dEF1, Ref. 61) in the regulation of Xbra2 between Smad2 and Smad3, as observed before in HaCat ke- expression during early development. Overall, our results sug- ratinocyte cells (56). Alternatively, activation and nuclear gest that transcriptional induction of Xbra in response to translocation may occur more efficiently for Smad3-containing mesoderm inducing factors such as activin could (at least in Smad complexes in HEK293T cells. It has been demonstrated part) occur through interaction of activated Smads with a SIP1- previously that Smad6 can inhibit receptor-regulated phospho- like protein, thereby preventing the latter from binding to the rylation of Smad1 and Smad2, but not Smad3 (57). Thus, Xbra2 promoter and inhibiting its expression. Activation might differential activation of Smad2 and Smad3 could be regulated therefore be viewed more as relief of repression. Both the by the inhibitory Smad6 in these cells. Nuclear accumulation of Smad-SIP1 and SIP1-DNA interaction are, however, very dif- Smads is also modulated by cross-talk between different sig- ficult to analyze biochemically in the amphibian embryo, and naling pathways. For example, phosphorylation of the proline- cell-based systems in which the Xbra2 promoter can be func- rich linker region in Smad1 by the Erk family of mitogen- tionally tested are not available. Further experiments, includ- activated protein kinases prevents nuclear accumulation of ing the isolation of a Xenopus SIP1 homologue, analysis of its Smad1/4 heteromeric complexes (58). In general, which Smads expression pattern, and identification of direct target promo- are targeted to the nucleus, and consequently interact with ters which can be analyzed in cell lines, will help to unravel binding proteins such as SIP1, may indeed largely depend on further the relevance of SIP1/Smad interactions in signal cellular context. transduction pathways triggered by members of the TGF-b SIP1 displays sequence similarities with vertebrate dEF1 superfamily. and Drosophila Zfh-1, which are both involved in the control of Acknowledgments—We thank Stefan Pype and Marianne Voz for cell type specification during embryonic development (37–39). providing the GST-CD40 and GST-PLAG1-fusion proteins, Jeff Wrana dEF1 was originally identified as a chicken d1-crystallin en- and Susumi Itoh for various expression constructs encoding Flag- hancer binding protein. Likely homologues of chicken dEF1 tagged Smads and type I receptors, and Peter Vandenabeele for have also been cloned from other species. These include mouse HEK293T cells. dEF1 or MEB1, human AREB6, ZEB, or Nil-2a, hamster BZP REFERENCES and rat Zfhep (Ref. 46, and reviewed in Ref. 59). dEF1 has been 1. Heldin, C. H., Miyazono, K., and ten Dijke, P. (1997) Nature 390, 465– 471 characterized as a repressor of E2 box-mediated gene activa- 2. Kretzschmar, M., and Massague ´ , J. (1998) Curr. Opin. Genet. Dev. 8, 103–111 tion. It binds to 59-CACCT sequences, and in doing so it can 3. Whitman, M. (1998) Genes Dev. 12, 2445–2462 4. LeSueur, J. A., and Graff, J. M. (1999) Development 126, 137–146 repress transcription by two mechanisms. Either it blocks ac- tivity of transcription factors such as c-Myb and Ets bound at nearby sites in target promoters (60) or it competes for common W. Lerchner, B. V. Latinkic, L. Fairclough, J. E. Remacle, D. binding sites (E2 boxes) with a subset of bHLH activators, such Huylebroeck, and J. C. Smith, unpublished results. 20498 DNA-binding Direct Partner of Receptor-regulated Smads 5. Yingling, J., Datto, M., Wong, C., Frederick, J., Liberati, N., and Wang, X. 34. Smith, J. C., Price, M., Green, J. B., Weigel, D., and Herrmann, B. G. (1991) (1997) Mol. Cell. Biol. 17, 7019 –7028 Cell 67, 79–87 6. Zawel, L., Dai, J. L., Buckhaults, P., Zhou, S., Kinzler, K. W., Vogelstein, B., 35. Fortini, M. E., Lai, Z., and Rubin, G. M. (1991) Mech. Dev. 34, 113–122 and Kern, S. E (1998) Mol. Cell 1, 611– 617 36. Duboule, D. (1994) Guidebook to the Homeobox Genes, pp. 27–71, Oxford 7. Dennler, S., Itoh, S., Vivien, D., ten Dijke, P., Huet, S., and Gauthier, J. (1998) University Press, New York EMBO J. 17, 3091–3100 37. Lai, Z., Rushton, E., Bate, M., and Rubin, G. M.(1993) Proc. Natl. Acad. Sci. 8. Jonk, L. J., Itoh, S., Heldin, C. H., ten Dijke, P., and Kruijer, W. (1998) J. Biol. U. S. A. 90, 4122– 4126 Chem. 273, 21145–21152 38. Higashi, Y., Moribe, H., Takagi, T., Sekido, R., Kawakami, K., Kikutani, H., 9. Shi, Y., Wang, Y. F., Jayaraman, L., Massague ´ , J., and Pavletich, N. P. (1998) and Kondoh, H. (1997) J. Exp. Med. 185, 1467–1479 Cell 94, 585–594 39. Takagi, T., Moribe, H., Kondoh, H., and Higashi, Y. (1998) Development 125, 10. Kim, J., Johnson, K., Chen, H. J., Carroll, S., and Laughon, A. (1997) Nature 21–31 388, 304 –308 40. Sekelsky, J. J., Newfeld, S. J., Raftery, L. A., Chartoff, E. H., and Gelbart, 11. Xu, X., Yin, Z., Hudson, J. B., Ferguson, E. L., and Frasch, M. (1998) Genes W. M. (1995) Genetics 139, 1347–1358 Dev. 12, 2354 –2370 41. Hahn, S. A., Schutte, M., Hoque, A. T., Moskaluk, C. A., da Costa, L. T., 12. Labbe ´ , E., Silvestri, C., Hoodless, P. A., Wrana, J. L., and Attisano, L. (1998) Rozenblum, E., Weinstein, C. L., Fisher, A., Yeo, C. J., Hruban, R. H., and Mol. Cell 2, 109 –120 Kern, S. E. (1996) Science 271, 350 –353 13. Chen, X., Rubock, M. J., and Whitman, M. (1996) Nature 383, 691– 696 42. Hoodless, P. A., Haerry, T., Abdollah, S., Stapleton, M., O’Connor, M. B., 14. Chen, X., Weisberg, E., Fridmacher, V., Watanabe, M., Naco, G., and Attisano, L., and Wrana, J. L. (1996) Cell 85, 489 –500 Whitman, M. (1997) Nature 389, 85– 89 43. Suzuki, A., Chang, C. Yingling, J. M. Wang, X.-F., and Hemmati-Brivanlou, A. 15. Liu, F., Pouponnot, C., and Massague ´ , M. (1997) Genes Dev. 11, 3157–3167 (1997) Development 184, 402– 405 16. Zhou, S., Zawel, L., Lengauer, C., Kinzler, K., and Vogelstein, B. (1998) Mol. 44. Nishimura, R., Kato, Y., Chen, D., Harris, S. E., Mundy, G. R., and Yoneda, T. Cell 2, 121–127 (1998) J. Biol. Chem. 273, 1872–1879 17. Zhang, Y., Feng, X.-H., and Derynck, R. (1998) Nature 394, 909 –913 45. Sekido, R., Takagi, T., Okanami, M., Moribe, H., Yamamura, M., Higashi, Y., 18. Hua, X., Liu, X., Ansari, D. O., and Lodish, H., F. (1998) Genes Dev. 12, and Kondoh, H. (1996) Gene (Amst.) 173, 227–232 3084 –3095 46. Stamenkovic, I., Clark, E. A., and Seed, B. (1989) EMBO J. 8, 1403–1410 19. Moustakas, A., and Kardasis, D. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 47. Kretzschmar, M., Liu, F., Hata, A., Doody, J., and Massague ´ , J. (1997) Genes 6733– 6738 Dev. 11, 984 –995 20. Kurokawa, M., Mitani, K., Irie, K., Matsuyama, T., Takahashi, T., Chiba, S., 48. Macias-Silva, M., Abdollah, S., Hoodless, P. A., Pirone, R., Attisano, L., and Yazaki, Y., Matsumoto, K., and Hirai, H. (1998) Nature 394, 92–96 Wrana, J. L. (1996) Cell 87, 1215–1224 21. Meersseman, G., Verschueren, K., Nelles, L., Blumenstock, C., Kraft, H., 49. Nakao, A., Imamura, T., Souchelnytskyi, S., Kawabata, M., Ishisaki, A., Oeda, Wuytens, G., Remacle, J., Kozak, C. A., Tylzanowski, P., Niehrs, C., and E., Tamaki, K., Hanai, J., Heldin, C.-H., Miyazono, K., and ten Dijke, P. Huylebroeck, D. (1997) Mech. Dev. 61, 127–140 (1997) EMBO J. 16, 5353–5362 22. Rupp, R. A., Snider, L., and Weintraub, H. (1994) Genes Dev. 8, 1311–1323 50. Franklin, A. J., Jetton, T. L., Shelton, K. D., and Magnuson, M. (1994) Mol. 23. Gietz, D., St Jean, A., Woods, R. A., and Schiestl, R. H. (1992) Nucleic Acids Cell. Biol. 14, 6773– 6788 Res. 20, 1425 51. Genetta, T., Ruezinsky, D., and Kadesch, T. (1994) Mol. Cell. Biol. 14, 24. Verschueren, K., Dewulf, N., Goumans, M. J., Lonnoy, O., Feijen, A., Grimsby, 6153– 6163 S., Vande Spiegle, K., ten Dijke, P., More ´ n, A., Vanscheeuwijck, P., Heldin, 52. Kispert, A., and Herrmann, B. G. (1993) EMBO J. 12, 3211–3220 C. H., Miyazono, K., Mummery, C., van den Eijnden-van Raaij, A. J. M., and 53. Latinkic, B. V., Umbhauer, M., Neal, K., Lerchner, W., Smith, J. C., and Huylebroeck, D. (1995) Mech. Dev. 52, 109 –123 Cunliffe, V. (1997) Genes Dev. 11, 3265–3276 25. Sekido, R., Murai, K., Funahashi, J., Kamachi, Y., Fujisawa-Sehara, A., 54. Pannese, M., Polo, C., Andreazzolli, M., Vignali, R., Kablar, B., Barsacchi, G., Nabeshima, Y., and Kondoh, H. (1994) Mol. Cell. Biol. 14, 5692–5570 and Boncinelli, E. (1995) Development 121, 707–720 26. Ikeda, K., and Kawakami, K. (1995) Eur. J. Biochem. 233, 73– 82 55. Lo, R. S., Chen, Y. G., Shi, Y., Pavletich, N., and Massague ´ , J. (1998) EMBO J. 27. Williams, T. M., Moolten, D., Burlein, J., Romano, J., Bhaerman, R., Godillot, 17, 996 –1005 A., Mellon, M., Rauscher, F. J., and Kant, J. A. (1991) Science 254, 56. Shimizu, A., Kato, M., Nakao, A., Imamura, T., ten Dijke, P., Heldin, C.-H., 1791–1794 Kawabata, M., Shimada, S., and Miyazono, K. (1998) Genes Cells 3, 28. Lee, M. E., Temizer, D. H., Clifford, J. A., and Quertermous, T. (1991) J. Biol. 125–134 Chem. 266, 16188 –16192 57. Imamura, T., Takase, M., Nishihara, A., Oeda, E., Hanai, J., Kawabata, M., 29. Smith, J. C. (1993) Cellular Interactions in Development-a Practical Approach and Miyazono, K. (1997) Nature 389, 622– 626 (Hartley, D., ed) pp. 181–204, Oxford University Press, New York 58. Kretzschmar, M., Doody, J., and Massague ´ , J. (1997) Nature 389, 618 – 622 30. Smith, J. C., and Slack, J. M. W. (1983) J. Embryol. Exp. Morphol. 78, 299 –317 59. Genetta, T., and Kadesch, T. (1996) Gene 169, 289 –290 31. Slack, J. M. W. (1984) J. Embryol. Exp. Morphol. 80, 289 –319 60. Postigo, A. A., Sheppard, A. M., Mucenski, M. L., and Dean, D. C. (1997) 32. Nieuwkoop, P. D., and Faber, J. (1967) Normal Table of Xenopus laevis EMBO J. 16, 3924 –3934 (Daudin) North Holland, Amsterdam 61. Ikeda, K., Halle, J.-P., Stelzer, G., Meisterernst, M., and Kawakami, K. (1998) 33. Harland, R. M. (1991) Methods Cell Biol. 36, 675– 685 Mol. Cell. Biol. 18, 10 –18 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

SIP1, a Novel Zinc Finger/Homeodomain Repressor, Interacts with Smad Proteins and Binds to 5′-CACCT Sequences in Candidate Target Genes

Download PDF
10 pages

Loading next page...
 
/lp/unpaywall/sip1-a-novel-zinc-finger-homeodomain-repressor-interacts-with-smad-6nE0FMQna0

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.274.29.20489
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 274, No. 29, Issue of July 16, pp. 20489 –20498, 1999 © 1999 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. SIP1, a Novel Zinc Finger/Homeodomain Repressor, Interacts with Smad Proteins and Binds to 5*-CACCT Sequences in Candidate Target Genes* (Received for publication, March 5, 1999) a a a,b,c a,b,d,e f Kristin Verschueren, Jacques E. Remacle, Clara Collart, Harry Kraft, Betty S. Baker, a,g a a,b,c h,i h,j Przemko Tylzanowski, Luc Nelles, Gunther Wuytens, Ming-Tsan Su, Rolf Bodmer, f,k a,b,l James C. Smith, and Danny Huylebroeck, From the Department of Cell Growth, Differentiation and Development (VIB-07), Flanders Interuniversity Institute for Biotechnology (VIB), Herestraat49, B-3000 Leuven, Belgium, the Laboratory of Molecular Biology (CELGEN), University of Leuven, Herestraat 49, B-3000 Leuven, Belgium, the Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, London NW7 1AA, United Kingdom, and the Department of Biology, University of Michigan, Ann Arbor, Michigan 48109-1048 Activation of transforming growth factor b receptors this Smad-interacting protein opens new routes to in- causes the phosphorylation and nuclear translocation vestigate the mechanisms by which transforming b members exert their effects on expres- of Smad proteins, which then participate in the regula- growth factor tion of expression of target genes. We describe a novel sion of target genes in responsive cells and in the verte- Smad-interacting protein, SIP1, which was identified brate embryo. using the yeast two-hybrid system. Although SIP1 inter- acts with the MH2 domain of receptor-regulated Smads in yeast and in vitro, its interaction with full-length Ligands of the TGF-b family exert their biological effects by Smads in mammalian cells requires receptor-mediated activating serine/threonine kinase receptor complexes, which dEF1/ Smad activation. SIP1 is a new member of the in turn activate intracellular mediators, the Smad proteins. Zfh-1 family of two-handed zinc finger/homeodomain Smads were initially identified by means of genetic studies in dEF1, SIP1 binds to 5*-CACCT sequences proteins. Like Drosophila and Caenorhabditis elegans as Mad and Sma gene in different promoters, including the Xenopus brachyury products, respectively. Nine different vertebrate Smads have promoter. Overexpression of either full-length SIP1 or been isolated (reviewed in Refs. 1–3; Ref. 4). These proteins are its C-terminal zinc finger cluster, which bind to the characterized by a three-domain structure containing con- Xbra2 promoter in vitro, prevented expression of the served N-terminal and C-terminal domains, called the MH1 endogenous Xbra gene in early Xenopus embryos. There- and MH2 domains, which flank a more variable, proline-rich dEF1, is likely to be a transcriptional fore, SIP1, like linker region. The Smads can be classified into three subgroups repressor, which may be involved in the regulation of at based on their distinct functions. The receptor-regulated least one immediate response gene for activin-depend- Smads (Smad1, 2, 3, 5, and 8) contain a conserved SSXS motif ent signal transduction pathways. The identification of at their extreme C-terminal end. Upon ligand stimulation, two serines in this motif are directly phosphorylated by specific type I receptors. Once activated, these Smads associate with * This work was supported by the Flanders Interuniversity Institute for Biotechnology, the Fund of Scientific Research-Flanders Smad4, a common mediator Smad, and the heteromeric com- (G.0296.98), and EU-Training and Mobility of Researchers (CT98- plexes translocate to the nucleus where they mediate responses 0216). The VIB-07 group kindly acknowledges the support from Inno- to specific ligands. Smads 1, 5, and 8 act in bone morphogenetic genetics S. A. (Gent, Belgium) within the framework of collaboration protein (BMP) pathways, whereas Smads 2 and 3 act in activin agreements with the University of Leuven and the Flanders Interuni- and TGF-b pathways. A third group of Smads, the inhibitory versity Institute for Biotechnology. The costs of publication of this article were defrayed in part by the payment of page charges. This Smads (Smad6 and Smad7), prevent the activation of receptor- article must therefore be hereby marked “advertisement” in accordance regulated Smads or their heteromerization with Smad4. Func- with 18 U.S.C. Section 1734 solely to indicate this fact. tional homologues of inhibitory Smads and the common medi- Recipient of a Pre-doctoral Fellowship from the Flemish Institute ator Smad in Drosophila have been identified as Dad and for the Promotion of Industrial Research and Technology Transfer (IWT). Medea, respectively (1–3). Present address: Innogenetics S. A., Industriepark 7 box 4, B-9052 In the absence of signaling, Smads are kept in a latent Zwijnaarde, Belgium. conformation through an intramolecular interaction between Recipient of a Post-doctoral Fellowship from the National Fund of the MH1 and MH2 domains. Activation of receptor-regulated Scientific Research (NFWO) and of the Research Council of the Univer- sity of Leuven. Smads has been proposed to disrupt this autoinhibition, allow- Present address: Laboratory for Skeletal Development and Joint ing the MH1 and MH2 domains to exert distinct functions in Disorders, University of Leuven, Herestraat 49, B-3000 Leuven, the nucleus (1–3). Smad4 and the MH1 domain of activated Belgium. Supported by a Fellowship from the Organogenesis Center at the University of Michigan. j 1 Supported by grants from the National Institutes of Health and the The abbreviations used are: TGF-b, transforming growth factor b; American Heart Association. bHLH, basic helix-loop-helix; BMP, bone morphogenetic protein; bra, Supported by the UK Medical Research Council and was an Inter- brachyury; CZF, C-terminal zinc finger cluster; DBD, DNA-binding national Fellow of the Howard Hughes Medical Institute. domain; GST, glutathione S-transferase; LacZ, b-galactosidase product Supported by VIB. To whom correspondence should be addressed. of the E. coli LacZ gene; NZF, N-terminal zinc finger cluster; SBD, Tel: 132 16 34 59 16; Fax: 132 16 34 59 33; E-mail: [email protected]. Smad-binding domain; SIP, Smad-interacting protein; PCR, polymer- kuleuven.ac.be. ase chain reaction; X, Xenopus; dpc, days post coitum. This paper is available on line at http://www.jbc.org 20489 This is an Open Access article under the CC BY license. 20490 DNA-binding Direct Partner of Receptor-regulated Smads EcoRI-XhoI inserts (21) and cloned between the EcoRI and SalI sites of Smad3 can directly bind DNA. Smad-binding elements in the the bait vector pGBT-9 (Matchmaker I, CLONTECH), such that in- promoters of different immediate response genes such as JunB frame fusions with GAL4 were obtained. Similar bait plasmids with DBD and PAI-I contain 59-CAGA boxes, and multimerization of such mouse Smad1, Smad2, and Smad5 were generated by PCR starting elements creates a TGF-b -inducible enhancer (5– 8). The crys- from the respective cDNA fragments encoding the MH2 domain. The tal structure of the Smad3 MH1domain bound to a Smad- G418S XSmad1 MH2 domain was generated by oligonucleotide-directed binding element revealed that 59-GTCT represents the mini- mutagenesis (Bio-Rad). For construction of the prey cDNA library, polyadenylated RNA from 12.5-dpc mouse embryos was isolated using mal DNA-binding sequence (9). However, promoter studies on the Oligotex mRNA Kit (Qiagen). Randomly primed cDNA was synthe- other direct target genes, such as vestigial and tinman in sized (Superscript Choice; Life Technologies, Inc.) and ligated to an Drosophila and goosecoid in the mouse, have implicated GC- excess of Sfi double-stranded adaptors containing StuI and BamHI rich sequences as direct DNA targets for Mad and/or Medea sites. To facilitate cloning of the cDNAs, the prey plasmid pACT2 and for Smad3 and/or Smad4 (10 –12). Together, these data (Matchmaker II, CLONTECH) was modified into pACT2/Sfi-Sfi (data suggest that Smads display a low DNA-binding affinity and not shown). Restriction of this plasmid with Sfi generates sticky ends that are not complementary, thus preventing self-ligation of the vector. specificity but are able to achieve highly specific regulation of A library of 3.6 3 10 independent recombinant clones with an average target promoters through physical or functional interaction insert size of 1,100 base pairs was obtained. The yeast two-hybrid with nearby bound transcription factors (12–20). This has been screening was carried out with the Matchmaker II kit. The yeast trans- exemplified through detailed studies of activin/TGF-b response formations were, however, performed according to Gietz (23). Yeast elements (ARE) in the promoters of Xenopus Mix.2 and mouse strain CG-1945 was used, and the screening was done on selective goosecoid which bind the forkhead transcription factors FAST1 medium containing 5 mM 3-amino-1,2,4-triazole. To map the Smad-binding domain in SIP1, progressive deletions and FAST2, respectively (12–16). It has been proposed that were generated by PCR using Pfu polymerase (Pfu; Stratagene), and upon ligand stimulation, FAST1 or FAST2 recruit heteromeric resulting amplified DNAs were cloned into pACT2, by means of SmaI Smad2/4 complexes to the Mix.2 or goosecoid promoters and XhoI restriction sites built in the primers used for amplification. through their interaction with the MH2 domain of activated SIP1 was generated by amplifying N- and C-terminal segment- DSBD51 Smad2. This promotes binding of Smad4 to an adjacent site, encoding parts of the cDNA which were fused by means of a NcoI restriction site built into the PCR primers at the position of the deletion. resulting in enhanced transcriptional activation (12, 16). The correct sequence of all these generated constructs was verified by The MH2 domain of Smads appear to mediate the associa- DNA sequencing. tion with transcription factors and although the majority of Cell Lines and Transfections—HEK293T cells were maintained in documented interactions involve the induction of gene expres- Dulbecco’s modified Eagle’s medium containing 4.5 mg of glucose/ml sion, some block transcriptional responses to ligand stimula- and 10% fetal bovine serum. COS1 cells were grown in Dulbecco’s tion. For example, the transcription factor and oncoprotein modified Eagle’s medium with 10% fetal bovine serum. Cells were transfected using Fugene (Roche Molecular Biochemicals) according to Evi-1 specifically interacts with activated Smad3, thereby pre- the protocol of the manufacturer and collected 30 – 48 h after venting Smad3 from binding DNA and blocking TGF-b-induced transfection. growth arrest in certain cell types (20). Recruitment of Smad3/ Synthesis of SIP1 and GST Pull-down Experiments—For production Smad4 heteromeric complexes to the mouse goosecoid promoter of GST-Smad fusion proteins in Escherichia coli, the same Smad frag- blocks, rather than induces, transcription of the gene (12). ments as used in the two-hybrid assay were re-cloned in pGEX-5X-1 Overall, these data indicate that, once activated and targeted (Amersham Pharmacia Biotech). GST-fusion proteins were expressed in E. coli (strain BL21) and purified on glutathione-Sepharose beads to the nucleus, Smads are able to undergo multiple interactions according to protocols provided by the supplier (Amersham Pharmacia with DNA and/or with different transcription factors to cause Biotech). The beads were first washed four times with phosphate- both activation and repression of gene expression. buffered saline supplemented with protease inhibitors and then were Previously, we have shown that overexpression of the Xeno- mixed with 50 ml of COS1 cell lysate in 1 ml of GST buffer (50 mM pus Smad1 MH2 domain induces ventral cell types in Xenopus Tris-HCl, pH 7.5, 120 mM NaCl, 2 mM EDTA, 0.1% (v/v) Nonidet P-40, embryos. Because this domain does not have DNA-binding and protease inhibitors). The lysate was prepared from COS1 cells transiently transfected with pCS3-SIP1 using solubilization buffer (24). capacity, we anticipated that it would interact with transcrip- The beads were mixed at 4 °C for 16 h. Unbound proteins were removed tion factors in the nucleus to elicit its biological effect (21). by washing four times with GST buffer and once with phosphate- Therefore, a search for Smad-interacting proteins (SIPs) was buffered saline at 4 °C. Bound proteins were harvested by boiling in initiated using two-hybrid screening in yeast. As bait, the sample buffer, and they were resolved by SDS-polyacrylamide gel elec- XSmad1 MH2 domain was fused to the DNA-binding domain of trophoresis. Myc-tagged SIP1 was visualized after Western blotting the yeast transcription factor GAL4 (GAL4 ). As source of using anti-Myc monoclonal antibody (9E10), horseradish peroxidase- DBD conjugated anti-mouse secondary antibody (Jackson), and the enhanced preys, we used a 12.5-dpc mouse embryo cDNA library fused to chemiluminescence kit (New England Nuclear). For mammalian pull- the GAL4 transactivation domain (GAL4 ). This screen TAD down experiments, DNA inserts in pGEX-5X-1 encoding XSmad1 GST- yielded several SIPs, one of which, SIP1, is characterized here. fusion proteins were amplified by PCR using Pfu, and re-cloned into pCS2. Cell pellets of transfected COS1 cells were frozen in liquid nitro- EXPERIMENTAL PROCEDURES gen, thawed on ice, and solubilized in lysis buffer containing 1% cDNA Cloning and Mammalian Expression Plasmids—Mouse Nonidet P-40, 150 mM NaCl, 20 mM Tris, pH 7.5, 2 mM EDTA, supple- Smad1 and Smad2 cDNAs were identified by low stringency screening mented with protease inhibitors (Protease Inhibitor Mixture Tablets, of an oligo-dT-primed lExlox library made from 12-dpc mouse embryo Roche Molecular Biochemicals). Cell lysates were cleared by centrifu- (Novagen), using Smad5 (MLP1.2 clone; Ref. 21) as a probe. This library gation, and GST-fusion proteins were purified from cell extracts by was also used to screen for SIP1 cDNAs other than th1 cDNA, yielding incubation with glutathione-Sepharose beads for2hat4 °C, followed lExTW6. The 3.6-kilobase TW6 cDNA overlapped with th1 and con- by four washes in cold lysis buffer. Purified proteins were visualized by tained additional 39-coding sequences including an in-frame stop codon. Western blotting as described above. For detection of the GST-fusion The complete SIP1 open reading frame was reconstituted by fusing proteins, a polyclonal anti-GST antibody (Amersham Pharmacia Bio- TW6 cDNA with a SIP1 sequence including the ATG translation initi- tech) and a horseradish peroxidase-conjugated anti-goat secondary an- ation codon, obtained in an independent screen for mouse homologues of tibody (Jackson) were used. Zfh-1. For expression in mammalian cells and Xenopus, the SIP1 cDNA Immunoprecipitations—Extracts from transfected HEK293T cells was subcloned into pCS2 and pCS3 (22). In the latter, the SIP1 open were prepared as described above for COS1 cells in the mammalian reading frame was fused to a Myc tag at the N terminus. For expres- pull-down experiments, except that the lysis buffer was also supple- sion of SIP1 , we subcloned a cDNA fragment encoding amino acids mented with a mixture of phosphatase inhibitors (50 mM NaF, 1 mM CZF 977–1214 into pCS3. sodium pyrophosphate, and 0.1 mM okadaic acid). Immunoprecipita- Yeast Two-hybrid Cloning and Assays—XSmad1 full-size and MH2 tions were performed by incubation with the M2 Flag monoclonal an- domain bait plasmids were constructed using the previously described tibody for2hat4 °C, followed by incubation with protein-G beads for DNA-binding Direct Partner of Receptor-regulated Smads 20491 1 h at 4 °C. Beads were collected by centrifugation and washed four times with lysis buffer at 4 °C, and bound proteins were visualized as described above in the pull-down experiments. Electrophoretic Mobility Shift Assays—The sequence of the upper strand of the double-stranded oligonucleotide probes used in this work are shown in Figs. 6 and 7. The wild type and mutant kE2 sequences, the X. brachyury-binding site and MyoD-binding site were taken from Sekido et al. (25). The AREB6-binding site (26), the Nil-2a-binding site FIG.1. Association of SIP1 with different XSmad and TH1 (27), and the GATA2-binding site (28) were identical to those described mouse Smad baits (MH2 domains or full-length) in yeast two- previously. Double-stranded oligonucleotides were end-labeled with T4 hybrid assays, as illustrated by staining for LacZ (blue colonies polynucleotide kinase and [g- P]ATP and purified by polyacrylamide indicate positive LacZ staining, i.e. interaction of prey with gel electrophoresis. Gel retardation assays were carried out with either bait). Four representative colonies are shown for each interaction a bacterially expressed and purified GST-fusion protein (GST-SIP1 ) CZF analyzed. Numbering of deleted or substituted amino acids is according or with cell extracts from COS1 cells transiently transfected with ex- to their position in the full-length protein. pression constructs encoding Myc-tagged SIP1 proteins. Extracts were made from those cells as described in the GST pull-down experiments a subset of cells in the heart, and dEF1 is required for normal using solubilization buffer. Electrophoretic mobility shift assay was development of T cells and certain skeletal elements in the carried out according to Sekido et al. (25). The GST-PLAG1 fusion protein, used as a negative control, was a gift from M. Voz (Flanders mouse (38, 39), it is possible that SIP1, which is expressed Interuniversity Institute for Biotechnology, Dept. VIB-04, Leuven, during mouse embryogenesis (data not shown), also plays a role Belgium). in embryonic development. Therefore, SIP1 was subjected TH1 Experiments in Xenopus—RNA encoding SIP1 , SIP1 , and full- CZF TH1 to further analysis. length SIP1 was prepared by linearizing the appropriate pCS2 plas- Analysis of SIP1 /Smad Interactions in Yeast—Interac- mids with Asp718 and carrying out transcription reactions according to TH1 tion between SIP1 and different Smad proteins were first (29). Xenopus embryos were obtained by in vitro fertilization (30). They TH1 were maintained in 10% Normal Amphibian Medium (31) and staged examined using the yeast two-hybrid system. Interaction of according to Nieuwkoop and Faber (32). Embryos at the 2- to 4-cell SIP1 with the MH2 domain of XSmad1 was maintained TH1 stage were injected with 1 ng of RNA dissolved in 14 nl of water as upon removal of the homeodomain-like segment of SIP1 TH1 described (33). They were cultured to early gastrula stage 10.5 and (data not shown), and similar approaches enabled us to posi- processed for whole mount in situ hybridization according to the method tion the Smad-binding domain (SBD) of SIP1 to a region TH1 of Harland (33), using a probe specific for Xbra (34). within the first 192 amino acids. Strikingly, we did not observe an interaction between SIP1 and full-length XSmad1 in RESULTS TH1 yeast (Fig. 1). This was not because of inefficient expression of Two-hybrid Cloning of Smad-interacting Proteins—To carry full-length Smad1 in yeast because other Smad-interacting out the two-hybrid screening, the coding sequence of the MH2 polypeptides, that are not related to SIP1, interacted efficiently domain of XSmad1 was fused to the GAL4 in the plasmid DBD with this bait (data not shown). Additional experiments showed pGBT-9. This GAL4 -Smad1 bait protein, when tested on its DBD that SIP1 did not interact with the MH1 domain of XSmad1 TH1 own, did not give detectable levels of GAL4-dependent synthe- nor with the MH2 domain from which the last 43 amino acids sis of HIS3 and LacZ in the yeast strain used. As a source of were deleted (D424 – 466) (Fig. 1). A truncated Mad similar to prey cDNAs, a random primed library was constructed in a the D424 – 466 mutant has been shown to cause loss-of-function modified pACT2 vector using polyadenylated RNA isolated phenotypes in Drosophila, whereas a similar truncation of from 12.5-dpc mouse embryos. Screening of about 4 million Smad4 (dpc4) in a loss-of-heterozygosity background is associ- yeasts using this bait and the prey plasmids yielded approxi- ated with pancreatic carcinomas (40, 41). In contrast, SIP1 TH1 mately 500 colonies expressing both the HIS3 marker and did interact with a modified XSmad1 MH2 domain having a LacZ reporter genes. Rescreening of these colonies identified 81 single amino acid substitution (G418S, Fig. 1). This mutation in which expression of the two genes required the presence of affects a conserved glycine residue and has been reported to prey as well as bait cDNAs. One of the prey cDNAs, th72, render the Smad homologue of Drosophila inactive and to abol- encoded a protein in which the GAL4 transactivation domain ish BMP-dependent phosphorylation of Smad1 in mammalian was fused in-frame to Smad4, which started from amino acid cells (40, 42). 252 in the proline-rich domain (data not shown). Smad4 is Despite their very high degree of sequence similarity, the known to interact with other receptor-activated Smad proteins MH2 domains of Smad1 and Smad2 display striking differ- (1–3), and the isolation of this Smad4 cDNA confirmed the ences in biological effects when overexpressed in Xenopus em- feasibility of our two-hybrid approach toward identifying bryos; the former induces ventral mesoderm whereas the latter Smad-interacting proteins. induces dorsal tissues (1–3). Recently, Smad5 has also been The cDNA insert of another positive prey plasmid, th1, en- shown to induce ventral fates in the Xenopus embryo and to be coded a polypeptide of 626 amino acids, named SIP1 . TH1 a target for phosphorylation by activated BMP type I receptors; Whereas th72 (Smad4) was isolated only once from the initial it thus shares certain activities with Smad1 (43– 44). To inves- collection of 81 positive colonies, two additional SIP1 clones, tigate whether SIP1 interacts specifically with MH2 do- TH1 identical to SIP1 , were obtained. Sequence analysis re- TH1 mains of different Smads, we tested the ability of SIP1 to TH1 vealed that SIP1 has similarities to the vertebrate d-crys- TH1 interact with the MH2 domains of mouse Smads 1, 2, and 5 in tallin enhancer binding protein (dEF1) and Drosophila Zfh-1 a yeast two-hybrid assay. SIP1 was found to interact in TH1 (25, 36). These proteins, like SIP1 , contain a homeodomain TH1 yeast with the MH2 domain of all three Smad proteins tested sequence. The Zfh-1 homeodomain is a canonical domain con- (Fig. 1). Therefore, SIP1 may be a common binding protein for taining highly conserved residues in helix 3/4 critical for DNA these receptor-regulated Smads. binding, such as a conserved asparagine and arginine at posi- SIP1 Is a Novel dEF1-related DNA-binding Protein—The tions 10 and 12 within the helix (36). These critical amino acids complete SIP1 cDNA sequence was obtained from the sequence are, however, not conserved in the corresponding regions of of the SIP1 insert and by screening additional cDNA librar- TH1 dEF1 or SIP1, suggesting that their homeodomain cannot bind ies. Mouse SIP1 cDNA was also isolated in an independent directly to DNA. We therefore prefer to call this domain a homeodomain-like sequence. Because Zfh-1 is involved in pat- terning of mesoderm-derived tissues (35), including muscle and M.-T. Su, M. Fujioka, and R. Bodmer, unpublished results. 20492 DNA-binding Direct Partner of Receptor-regulated Smads FIG.2. A, schematic representation of the domain structure of SIP1 protein and its similarities with mouse dEF1. The putative zinc fingers are shown (dark gray boxes for C2H2-type zinc fingers and light gray boxes for C3H type) together with the homeodomain-like sequence (HD). The oval indicates the domain essential for interaction of SIP1with the Smad MH2 domain (SBD). SIP1 cDNAs used in this study are indicated (SIP1 TM full-length shown in red, SIP1 and SIP1 shown in yellow). The sequence of SIP1 is available from GenBank under accession number TH1 CZF AF033116. B, amino acid sequence comparison between mouse SIP1 and mouse dEF1. Gray boxes reflect identical or biochemically similar amino acids. The position of the C2H2 type zinc fingers in SIP1 is indicated by a bold overline, other zinc fingers in SIP1 are indicated by thin double overlines. screen for mammalian homologues of Drosophila Zfh-1. A the isolated MH2 domain of Smad proteins, lacks both the NZF strong sequence conservation between certain segments of and the CZF. The SBD, as defined above, maps to amino acids SIP1, dEF1, and Zfh-1 can be observed, and the three proteins 315–507 in the full-length protein. display a similar organization of putative functional domains A Smad-binding Domain of 51 Amino Acids Is Essential for (45) (Fig. 2A). As in dEF1 and Zfh-1, the homeodomain-like Interaction of SIP1 with the XSmad1 MH2 Domain—The SBD (HD) segment of SIP1 is flanked by two zinc finger (ZF) clus- of SIP1 was mapped to a segment spanning amino acids 315– ters, one (NZF) located in the N-terminal part and one (CZF) in 507 (see above). This region of 192 amino acids was sufficient to the C-terminal part. Despite the very high sequence identity of interact with the XSmad1 MH2 domain in yeast (data not these zinc finger clusters in the mammalian proteins, mouse shown). To further delineate the SBD, progressive deletions SIP1 is distinct from mouse dEF1 (Fig. 2B). Moreover, the SIP1 were made within this segment, and the resulting truncated sequence is also quite divergent from Drosophila Zfh-1 and polypeptides were tested in yeast for interaction with the thus represents a new member of the family of two-handed zinc XSmad1 MH2 domain. Mutant SIP1 SBD constructs contain- finger/homeodomain proteins. SIP1 , which interacts with TH1 ing amino acids 437–507, as well as 315– 487, still sustained interaction with the bait, whereas mutants encoding amino M.-T. Su, M. Liu, and R. Bodmer, unpublished results. acids 457–507 and 315– 467 did not (Fig. 3). Therefore, the DNA-binding Direct Partner of Receptor-regulated Smads 20493 FIG.3. Mapping of the Smad-bind- ing domain in SIP1. Schematic repre- sentation of deletion constructs to map the segment required for interaction of SIP1 with the XSmad1 MH2 domain. The original Smad-binding domain (spanning amino acids 315–507; shown in brown) was used as a starting point for the de- tailed mapping. The right column sum- marizes interaction data obtained in yeast, as assayed by ability to grow on plates lacking histidine and in the pres- ence of 5 mM 3-amino-triazole and by staining of b-galactosidase. The Smad- binding domain (SBD, shown in green)is a 51-amino acids-long peptide defined as essential for the interaction; its amino acid sequence (aa seq) is shown in the lower part of the figure. minimal domain required for interaction with the MH2 domain of XSmad1 was defined as a 51 amino acids-long region encom- passing the segment 437– 487 of full-length SIP1. To confirm that this domain is involved in mediating Smad binding in the context of full-length SIP1, a SIP1 mutant was constructed in which this minimal SBD was deleted (SIP1 ). As ex- DSBD51 pected, this mutant SIP1 protein gave no detectable interaction with the XSmad1 MH2 bait in yeast (Fig. 3). SIP1 Interacts with the MH2 Domain of Receptor-regulated Smads in Vitro—Like SIP1 , full-length SIP1 protein inter- TH1 acted with the MH2 domain of XSmad1, but not with full- length XSmad1 in yeast (data not shown). We went on to analyze this interaction further in vitro using glutathione S- transferase (GST) pull-down assays. GST-Smad MH2 domain FIG.4. In vitro association of SIP1 with the MH2 domains of fusion proteins were produced in E. coli and coupled to gluta- different Smad proteins. Myc-tagged full-size SIP1 protein was ex- thione-Sepharose beads. An unrelated GST-fusion protein pressed in COS1 cells. Upper panel, equal amounts of the same cell (GST fused to the intracytoplasmic domain of CD40, the recep- extract were used in lanes 1– 6. The 145-kDa SIP1 protein (indicated by the arrow) was efficiently pulled down from this cell lysate using the tor for the tumor necrosis factor-related CD40 ligand; Ref. 46) different GST-Smad fusion proteins (lanes 1 and 4–6; visualization is and GST itself were used as negative controls. Full-length SIP1 by Western blotting using anti-Myc antibody) but not by an unrelated protein, epitope-tagged (with six Myc epitopes) at its N-termi- GST-fusion protein (GST-CD40; lane 3) and GST (lane 2). GST fusions nal end, was produced in COS1 cells. Using GST-Smad beads, included the MH2 domains of XSmad1(G418S) (lane 4), mouse Smad5 (lane 5), mouse Smad2 (lane 6), and wild type XSmad1 (lane 1), respec- we pulled down this SIP1 protein from cell lysates, as shown by tively. Lane 7 provides a negative control with proteins pulled-down by Western blotting using anti-Myc antibody (Fig. 4, lane 1). This GST-XSmad1 from a cell lysate of mock-transfected cells. Lower panel, interaction was specific because a polypeptide consisting of six estimate of the amount of GST-fusion proteins used in the pull-down consecutive Myc tags alone was not pulled down from extracts experiments by Ponceau S staining of the used blot. Lower amounts of GST-Smad fusion proteins were used in lanes 1 and 4–7. of transfected COS1 cells (data not shown) nor was SIP1 pulled down by GST alone or by the GST-CD40 fusion protein (Fig. 4, lanes 2 and 3). In addition, full-length SIP1 protein interacted As assayed by immunoblotting, SIP1 could be co-purified with with the MH2 domain of Smad2, Smad5, and the the XSmad1 MH2 domain in these experiments (Fig. 5A, mid- XSmad1G418S mutant, confirming the results obtained in the dle panel, lane 1). The specificity of the interaction was further yeast two-hybrid assay (Fig. 4, lanes 4 – 6). Moreover, SIP1 , confirmed using the SIP1 mutant which lacks the 51-amino TH1 which lacks both zinc finger clusters, behaved like full-length acid-long SBD (SIP1 ), as defined in yeast two-hybrid DSBD51 SIP1 in these experiments (data not shown). assays. As expected from previous results, we failed to detect SIP1 Interacts with Activated, but Not Latent Full-length any interaction of this SBD deletion mutant with the MH2 Smads in Mammalian Cells—To further examine the func- domain of XSmad1 in mammalian cells (Fig. 5A, middle panel, tional relevance of the detected interaction between SIP1 and lane 2). the MH2 domain of XSmad1, we analyzed whether SIP1 could Second, binding of SIP1 with full-length Smad1 was ana- interact with this domain and with latent or activated, full- lyzed by co-immunoprecipitation experiments. Expression con- length Smad1 in mammalian cells. In the first series of exper- structs for Myc-tagged SIP1 and Flag-tagged full-length Smad1 iments, the association of SIP1 with the MH2 domain of XS- were co-transfected in HEK293T cells, with or without consti- mad1 was studied using mammalian GST pull-down assays. tutively active ALK-6 (or BMPR-IB), a well characterized BMP cDNA encoding the GST-XSmad1 fusion protein used in type I receptor, which has been shown previously to phospho- MH2 the in vitro pull-down assay was cloned in a mammalian ex- rylate and activate Smad1 (42, 47). Flag-tagged Smad1 was pression vector, and this construct was used to transiently first immunoprecipitated using anti-Flag monoclonal antibod- transfect COS1 cells, together with an expression construct for ies, and the resulting precipitate was then probed for the pres- Myc-tagged SIP1. The GST-fusion protein was subsequently ence of SIP1 by Western analysis using anti-Myc monoclonal purified from cell extracts with glutathione-Sepharose beads. antibodies. As demonstrated in Fig. 5B (lanes 1– 8), SIP1 could 20494 DNA-binding Direct Partner of Receptor-regulated Smads FIG.5. A, interaction of SIP1 with the MH2 domain of XSmad1 in mammalian cells. An expression construct encoding a fusion between GST and the MH2 domain of XSmad1 was transfected in COS1 cells together with expression constructs for Myc-tagged SIP1. As shown by immunoblotting of pulled-down material from cell extracts, SIP1 specifically interacted with the GST-XSmad1 fusion protein (middle panel, lane 1), whereas deletion of the SBD disrupted the interaction (middle panel, lane 2). Comparable affinity purification of the GST-fusion protein and equal expression of SIP1 were confirmed by immunoblotting of the pulled down material using polyclonal anti-GST antibody (upper panel) and of total cell extracts using monoclonal anti-myc antibody (lower panel), respectively. B, ligand-dependent interaction of SIP1 with full-length Smads in mammalian cells. Lanes 1–5, lanes 6 –11, and lanes 11–17 contain data from three independent experiments. HEK293T cells were transiently transfected with various combinations of expression constructs encoding Myc-tagged SIP1, Flag-tagged Smads, and type I receptors, as indicated. Cell lysates were immunoprecipitated with anti-Flag antibodies, and the precipitated proteins were visualized by SDS-polyacrylamide gel electrophoresis and immunoblotting using anti-Myc (upper panel) or anti-Flag (middle panel) antibodies. The middle panel shows the comparable immunoprecipitations of Flag-tagged Smads in each experiment, whereas the lower panel shows immunoblotting of total cell extracts using anti-Myc antibody, to confirm comparable expression of SIP1. *, indicates the heavy chain of the anti-Flag antibody used in the immunoprecipi- tations; ca, constitutively active; wt, wild type; DSBD indicates SIP1 in which the 51-amino acids-long SBD was deleted. be specifically co-immunoprecipitated with full-length Smad1 occurred as a result of Smad1 activation by constitutively ac- but only after co-transfection of the cells with constitutively tive ALK-6. In addition, as was shown for the XSmad1 MH2 active ALK-6. This shows that SIP1 did not detectably interact domain, full-length activated Smad1 did not interact with SIP1 with latent full-length Smad1 in mammalian cells and that lacking the 51-amino acids-long SBD (Fig. 5B, lane 9). activation of Smad1 does allow interaction. Our results, obtained both in yeast and in vitro, show that To confirm that the detected interaction was a direct conse- SIP1 interacts with the MH2 domain of several different quence of Smad1 activation, SIP1zSmad1 complex formation Smads. To extend these data, we analyzed the association of was analyzed after co-transfection of cells with expression con- SIP1 with Smads 2, 3, and 4 by co-immunoprecipitation. SIP1 structs for wild type ALK-6 or constitutively active ALK-4 weakly bound full-length Smad2 and Smad3 in the absence of (ActR-IB). The former cannot signal in the absence of an ap- co-transfected constitutively active ALK-4 (Fig. 5B, lanes 12 propriate type II receptor and without ligand stimulation, and 14). This weak interaction may have resulted from auto- whereas the latter specifically phosphorylates Smad2 and not crine signaling in HEK293T cells through pathways that acti- Smad1 (48, 49). Very weak (Fig. 5B, lane 10) or no interaction vate both Smad2 and Smad3, but not Smad1. Significantly, (lane 11) of SIP1 with full-length Smad1 was detected under however, co-transfection of constitutively active ALK-4 greatly these conditions, strongly indicating that complex formation enhanced complex formation between SIP1 and both Smad2 DNA-binding Direct Partner of Receptor-regulated Smads 20495 FIG.6. Interaction of the DNA-bind- ing domain of SIP1 (SIP1 ) with CZF target sites of different promoters by gel retardation analysis. A, the fusion protein GST-SIP1 (10 ng) was incu- CZF bated with the indicated P-labeled double-stranded oligonucleotides. No binding was observed with negative con- trol GST-PLAG1 (Control; the Bra- DBD binding site was used here). B, interaction of SIP1 with E2 box sequences. The CZF experiment was carried out as described in panel A, but MyoD and MyoD-Mut la- beled probes were used. Competition ex- periments were carried out with the oli- gonucleotides listed above the lanes.In the negative control lanes (Control), both MyoD and MyoD-Mut probes were incu- bated with GST-PLAG1 , and no com- DBD petitor was added. No, no competitor added. and Smad3 (Fig. 5B, lanes 13 and 15). Interaction with Smad3 which was previously shown to affect binding of the bHLH was stronger than with Smad2. In contrast, we never detected factor E47 but not of dEF1 (25), did not affect binding of any direct interaction between SIP1 and Smad4 in this SIP1 . Two other mutations in this kE2 site (Mut2 and CZF experiment (Fig. 5B, lanes 16 and 17). In conclusion, these Mut4) which abolished binding of dEF1 (25), also abolished CZF experiments demonstrate that SIP1 is a common binding pro- binding of SIP1 . SIP1 also bound to the Nil-2a-binding CZF CZF tein for different receptor-regulated Smads in mammalian cells site of the interleukin-2 (IL-2) promoter, as well as the AREB6- and that interaction of full-length Smads with SIP1 is driven binding site, both of which have previously been shown to bind by activation of these Smads by specific type I receptors. dEF1 (26, 27). Moreover, as previously proposed for dEF1 , CZF SIP1 Has the Same DNA-binding Specificity as dEF1—dEF1 SIP1 bound to a palindromic 59-CACCT sequence, which CZF is a repressor of transcription which binds specifically to the also constitutes a binding site for the transcriptional activator sequence 59-CACCT, as determined by target site selection (50, X. brachyury (Fig. 6A) (52). Fig. 6B extends these analyses to a 51, 25). This (underlined) sequence is also part of the E2 box site recognized by the bHLH factor MyoD. SIP1 was able to CZF (59-CACCTG), which is the binding site for a subgroup of bHLH bind to a probe which encompasses the muscle creatine kinase DNA-binding proteins, such as E2A, E47, and MyoD. It has (MCK) enhancer E2 box, and this complex was competed by the been proposed that dEF1 may regulate cell type-specific gene E2 box oligonucleotide or by other SIP1-binding sites. Addition- expression by competing with these activators for binding. For ally, a point mutation within this E2 box, similar to the previ- example, dEF1-mediated repression has been proposed as the ously used kE2-Mut4 site, also abolished binding of SIP1 CZF primary mechanism for silencing the IgH enhancer in non-B (Fig. 6B). These experiments show that the GST-SIP1 fu- CZF cells. dEF1 is also present in B-cells, but its activity is coun- sion protein displays the same DNA-binding specificity as the teracted by E2A, a B-cell specific bHLH factor (51). Similarly, GST-fusion protein made with the CZF region of dEF1 (25) and dEF1 represses the Igk enhancer where it competes with bHLH binds to 59-CACCT sequences. factor E47 for binding (25). SIP1 Binds to the Promoter of the Xbra Gene and Down- The C-terminal zinc finger cluster (CZF) of dEF1 is required regulates Transcription of This Gene upon Overexpression in for binding to E2 box sequences and for competition with acti- the Xenopus Embryo—Having characterized SIP1 as a DNA- vators (25). Bearing in mind the high similarity of the SIP1 and binding protein, we verified whether promoters of immediate dEF1 CZF domains, we decided to test whether they have early target genes for signaling by TGF-b members contain similar DNA-binding specificities. The DNA-binding properties 59-CACCT sequences. Examination of the Xenopus Xbra2 pro- of the CZF fragment of SIP1 (named SIP1 ) were analyzed by moter sequence revealed the presence of two potential SIP1- CZF gel retardation assays using a bacterially expressed and puri- binding sites localized in a 153-bp-long region that confers fied GST-SIP1 fusion protein. Larger GST-SIP1 fusion pro- responsiveness to FGF and activin (53). These sites are ar- CZF teins could not be produced because they were subject to pro- ranged in a palindrome and are separated by 24 nucleotides. teolytic degradation in E. coli (data not shown). This prompted us to investigate whether SIP1 or full-length CZF Purified GST-SIP1 bound to the E2 box of the Igk en- SIP1 can bind to this Xbra2 promoter element. CZF hancer (kE2 probe) (Fig. 6A). A mutation of this site (Mut1), Myc-tagged SIP1 or full-length SIP1 (SIP1 ) were ex- CZF FL 20496 DNA-binding Direct Partner of Receptor-regulated Smads FIG.7. SIP1 binds to the Xbra2 promoter. Fifty pg of P-labeled Xbra SIP1 probes (WT or D) were incubated with extracts from COS1 cells transfected with expression constructs for Myc-tagged SIP1 FIG.8. SIP1 polypeptides repress endogenous Xbra gene ex- CZF (lanes 1–2) or full-length SIP1 (SIP1 , lanes 3– 4). Lane 5 shows bind- FS pression in early Xenopus embryos. Xenopus embryos at the 2- to ing of endogenous proteins in cell extracts from mock-transfected cells. 4-cell stage were left uninjected (A) or were injected with 1 ng of RNA Specific SIP1 complexes are indicated (*) as well as endogenous encoding SIP1 (B), XOtx2(K3 E) (C), or full-length SIP1 (D). Both CZF complexes (l). Xbra-WT probe contains the sequence 59-ATCCAGGC- SIP polypeptides caused repression of Xbra expression. In panels B and CACCTAAAATATAGAATGATAAAGTGACCAGGTGTCAGTTCT, D, expression is down-regulated in half the embryo because one of two and Xbra-D contains 59-ATCCAGGCCACCTAAAATATAGAATGATA- cells of the early embryo was injected. In a typical experiment, 14 of 16 AAGTGACCAGATGTCAGTTCT. SIP1-binding sites are in bold, and embryos injected with RNA encoding SIP1 displayed down-regula- CZF the substituted nucleotide is underlined. tion of Xbra expression, as did, in a separate experiment, 18 of 19 embryos injected with full-length SIP1. Slight down-regulation of Xbra expression was seen in only 1 of 13 embryos injected with RNA encoding pressed in COS1 cells and cell extracts used in gel retardation Otx2(K3 R). assays, together with a 50-bp-long Xbra2 promoter sequence encompassing the two 59-CACCT sequences (Xbra-WT probe). is replaced by glutamic acid XOtx2(K3 E) (54). As was shown As shown in Fig. 7, lane 5, cell extracts of mock-transfected previously (53), overexpression of this mutant protein had no cells contain endogenous proteins that bind to this probe. They effect on Xbra expression (Fig. 8C). In embryos injected with are visualized as two weak and slowly migrating complexes RNA encoding either SIP1 or full-length SIP1, however, CZF and one strong, faster migrating complex. When extracts from there were gaps in the Xbra expression domains, suggesting cells expressing either full-length SIP1 or SIP1 were used, CZF that these SIP1 polypeptides abolished transcription of the an additional complex could be seen (Fig. 7, lanes 1 and 3). In endogenous Xbra gene (Fig. 8, B and D). both cases, these complexes could be supershifted with anti- DISCUSSION Myc antibody, and the signal could be competed by incubation with an excess of unlabeled Xbra-WT oligonucleotide (data not We describe here the isolation of SIP1, a Smad-interacting shown). This indicated that the complex represents binding of protein that is a new member of the family of two-handed zinc SIP or full-length SIP1, respectively, to the Xbra-WT probe finger/homeodomain transcription factors. SIP1 was isolated as CZF and that binding is specific. Integrity of at least the down- a mouse cDNA encoding a protein that interacted with the stream 59-AGGTG sequence appeared crucial for binding be- MH2 domain of XSmad1 in yeast. It was subsequently shown to cause a single nucleotide substitution in that sequence abol- bind in mammalian cells to activated, but not latent, full- ished binding of SIP1 or SIP1 to the Xbra-D probe (Fig. 7, length receptor-regulated Smads, and not to bind to the com- CZF FL lanes 2 and 4). A similar mutation disrupted binding of SIP1 mon mediator Smad4. These findings identify SIP1 as a poten- CZF to the kE2-binding site (Fig. 6A, lane 5). tial new component of signal transduction pathways triggered These results demonstrate that SIP1 binds specifically to an by members of the TGF-b superfamily and add SIP1 to the list element in the region of the Xbra2 promoter which mediates of transcription factors able to physically interact with Smads, fibroblast growth factor and activin induction. They raise the including FAST1 and FAST2, Evi-1, c-Jun, and c-Fos (14, 15, possibility that SIP1 could affect Xbra expression in the Xeno- 17, 20). These factors have been identified as mediators/ pus embryo. To address this question, RNA encoding SIP1 modulators of signaling because they either bound to ligand- CZF or full-length SIP1 was microinjected into one blastomere of responsive elements in promoters of immediate target genes Xenopus embryos at the 2- or 4-cell stage. The embryos were (12, 13, 17) or, as is the case for Evi-1, could counteract the allowed to develop to early gastrula stage (stage 10.5), and growth inhibitory effect of TGF-b (20). expression of Xbra was analyzed by whole-mount in situ hy- SIP1 is the first novel Smad-interacting protein identified by bridization. In uninjected embryos, Xbra was expressed a two-hybrid screening in yeast. Our observation that the iso- throughout the mesoderm, and its expression pattern formed lated MH2 domain of Smads could bind to SIP1 in the absence an uninterrupted circle when viewed from the vegetal hemi- of signaling, but that full-length Smads needed to be activated sphere of the embryo (Fig. 8A). As a negative control, embryos to interact, supports the view that the Smad MH1 domain were injected with RNA encoding a mutant version of XOtx2, in exerts an inhibitory effect on the MH2 domain. These auto- which the lysine at position 9 of helix 3/4 of the homeodomain inhibitory interactions are known to be disrupted upon phos- DNA-binding Direct Partner of Receptor-regulated Smads 20497 phorylation (1–3), thus allowing the MH2 domain to associate as E2A and MyoD. This competition has been proposed to provide a genetic switch in which the activity of Ig and muscle- with transcription factors. Interestingly, we were unable to detect binding of SIP1 to full-length XSmad1 in yeast. Our data specific enhancers is dictated by the relative levels of dEF1 and these bHLH activators in the nucleus (45, 51). indicate that, in yeast, full-length Smads are also in a latent Analysis of the DNA-binding activities of SIP1, as presented conformation, preventing the MH2 domain from interacting here and currently being analyzed in a separate study with certain proteins. Whether unfolding of receptor-regulated involving dissection of DNA target sites and structure-function Smads and their nuclear translocation is sufficient to drive analysis of the zinc finger clusters, has shown that SIP1, like association with SIP1 in mammalian cells, or whether high dEF1, binds to 59-CACCT sequences. Interestingly, it has been affinity interaction of SIP1 with these Smads also depends on proposed, based on the phenotypes of dEF1 knock-out mice, the phosphorylation status of the C-terminal serines remains that another transcription factor with a similar DNA-binding to be determined. In this context, it is important to mention specificity as that of dEF1 exists (39). Indeed, despite the char- that these serines map in a region shown to be critical for acterization of dEF1 as a negative regulator of muscle differ- binding of the XSmad1 MH2 domain to SIP1. This region entiation in vitro and its abundant expression in somites, these encompasses the last 43 amino acids of XSmad1, and their mice do not display any detectable phenotype in developing deletion abolishes the interaction. In contrast, substitution of muscle (39). Perhaps SIP1, with its overlapping DNA-binding the conserved Gly-418 localized in a loop required for associa- specificities and partially overlapping expression pattern (data tion of Smads with activated type I receptors (55) does not not shown), compensates for the loss of dEF1 in certain tissues significantly affect interaction of the XSmad1 MH2 domain of the knock-out mice. with SIP1. Thus, interactions of the XSmad1 MH2 domain with We have identified 59-CACCT sequences in the promoter of type I receptors and SIP1 occur through distinct sequences. X. brachyury (Xbra2), an immediate response gene for meso- We have also mapped a 51-amino acids-long Smad-binding derm inducing factors such as activin. These sequences can domain in SIP1 that is essential for its association with Smads. bind SIP1 or full-length SIP1 in vitro. Moreover, overex- CZF The SIP1 zinc finger clusters are dispensable for binding to pression of the SIP1 CZF domain or of full-length SIP1 protein Smads, in contrast to the C-terminal zinc finger cluster of in Xenopus embryos abolished expression of Xbra in presump- Evi-1, which is necessary for interaction with Smad3 (20). tive mesoderm. These data indicate that SIP1, when overex- Furthermore, there is no sequence similarity between the SBD pressed, can act as a transcriptional repressor of Xbra in vivo. and the Smad-binding domain of FAST1 (SID; Ref. 14). Smads Interestingly, the SIP1-binding sites in the Xbra2 promoter, therefore appear to be able to bind to a wide range of amino the regulation of which is very complex in the amphibian em- acid sequences. bryo, map to a region that is required for transcriptional in- We have demonstrated that SIP1 can interact with different, duction of the gene by activin (53). Results from a recent study receptor-activated Smads in mammalian cells. However, in our using transgenic Xenopus embryos have shown that these experiments, SIP1 bound more strongly to Smad3 than to SIP1-binding sites are required for the correct spatial and Smad2, both of which were activated by constitutively active temporal expression patterns of Xbra2 reporter constructs. ALK-4 (or ActR-IB), an activin type I receptor. This suggests Thus, if endogenous SIP1-like proteins are present in the Xe- that the affinity of SIP1 for these Smads differ in vivo.In nopus embryo, they may participate together with co-repres- addition, this aspect may contribute to functional differences sors (as shown for dEF1, Ref. 61) in the regulation of Xbra2 between Smad2 and Smad3, as observed before in HaCat ke- expression during early development. Overall, our results sug- ratinocyte cells (56). Alternatively, activation and nuclear gest that transcriptional induction of Xbra in response to translocation may occur more efficiently for Smad3-containing mesoderm inducing factors such as activin could (at least in Smad complexes in HEK293T cells. It has been demonstrated part) occur through interaction of activated Smads with a SIP1- previously that Smad6 can inhibit receptor-regulated phospho- like protein, thereby preventing the latter from binding to the rylation of Smad1 and Smad2, but not Smad3 (57). Thus, Xbra2 promoter and inhibiting its expression. Activation might differential activation of Smad2 and Smad3 could be regulated therefore be viewed more as relief of repression. Both the by the inhibitory Smad6 in these cells. Nuclear accumulation of Smad-SIP1 and SIP1-DNA interaction are, however, very dif- Smads is also modulated by cross-talk between different sig- ficult to analyze biochemically in the amphibian embryo, and naling pathways. For example, phosphorylation of the proline- cell-based systems in which the Xbra2 promoter can be func- rich linker region in Smad1 by the Erk family of mitogen- tionally tested are not available. Further experiments, includ- activated protein kinases prevents nuclear accumulation of ing the isolation of a Xenopus SIP1 homologue, analysis of its Smad1/4 heteromeric complexes (58). In general, which Smads expression pattern, and identification of direct target promo- are targeted to the nucleus, and consequently interact with ters which can be analyzed in cell lines, will help to unravel binding proteins such as SIP1, may indeed largely depend on further the relevance of SIP1/Smad interactions in signal cellular context. transduction pathways triggered by members of the TGF-b SIP1 displays sequence similarities with vertebrate dEF1 superfamily. and Drosophila Zfh-1, which are both involved in the control of Acknowledgments—We thank Stefan Pype and Marianne Voz for cell type specification during embryonic development (37–39). providing the GST-CD40 and GST-PLAG1-fusion proteins, Jeff Wrana dEF1 was originally identified as a chicken d1-crystallin en- and Susumi Itoh for various expression constructs encoding Flag- hancer binding protein. Likely homologues of chicken dEF1 tagged Smads and type I receptors, and Peter Vandenabeele for have also been cloned from other species. These include mouse HEK293T cells. dEF1 or MEB1, human AREB6, ZEB, or Nil-2a, hamster BZP REFERENCES and rat Zfhep (Ref. 46, and reviewed in Ref. 59). dEF1 has been 1. Heldin, C. H., Miyazono, K., and ten Dijke, P. (1997) Nature 390, 465– 471 characterized as a repressor of E2 box-mediated gene activa- 2. Kretzschmar, M., and Massague ´ , J. (1998) Curr. Opin. Genet. Dev. 8, 103–111 tion. It binds to 59-CACCT sequences, and in doing so it can 3. Whitman, M. (1998) Genes Dev. 12, 2445–2462 4. LeSueur, J. A., and Graff, J. M. (1999) Development 126, 137–146 repress transcription by two mechanisms. Either it blocks ac- tivity of transcription factors such as c-Myb and Ets bound at nearby sites in target promoters (60) or it competes for common W. Lerchner, B. V. Latinkic, L. Fairclough, J. E. Remacle, D. binding sites (E2 boxes) with a subset of bHLH activators, such Huylebroeck, and J. C. Smith, unpublished results. 20498 DNA-binding Direct Partner of Receptor-regulated Smads 5. Yingling, J., Datto, M., Wong, C., Frederick, J., Liberati, N., and Wang, X. 34. Smith, J. C., Price, M., Green, J. B., Weigel, D., and Herrmann, B. G. (1991) (1997) Mol. Cell. Biol. 17, 7019 –7028 Cell 67, 79–87 6. Zawel, L., Dai, J. L., Buckhaults, P., Zhou, S., Kinzler, K. W., Vogelstein, B., 35. Fortini, M. E., Lai, Z., and Rubin, G. M. (1991) Mech. Dev. 34, 113–122 and Kern, S. E (1998) Mol. Cell 1, 611– 617 36. Duboule, D. (1994) Guidebook to the Homeobox Genes, pp. 27–71, Oxford 7. Dennler, S., Itoh, S., Vivien, D., ten Dijke, P., Huet, S., and Gauthier, J. (1998) University Press, New York EMBO J. 17, 3091–3100 37. Lai, Z., Rushton, E., Bate, M., and Rubin, G. M.(1993) Proc. Natl. Acad. Sci. 8. Jonk, L. J., Itoh, S., Heldin, C. H., ten Dijke, P., and Kruijer, W. (1998) J. Biol. U. S. A. 90, 4122– 4126 Chem. 273, 21145–21152 38. Higashi, Y., Moribe, H., Takagi, T., Sekido, R., Kawakami, K., Kikutani, H., 9. Shi, Y., Wang, Y. F., Jayaraman, L., Massague ´ , J., and Pavletich, N. P. (1998) and Kondoh, H. (1997) J. Exp. Med. 185, 1467–1479 Cell 94, 585–594 39. Takagi, T., Moribe, H., Kondoh, H., and Higashi, Y. (1998) Development 125, 10. Kim, J., Johnson, K., Chen, H. J., Carroll, S., and Laughon, A. (1997) Nature 21–31 388, 304 –308 40. Sekelsky, J. J., Newfeld, S. J., Raftery, L. A., Chartoff, E. H., and Gelbart, 11. Xu, X., Yin, Z., Hudson, J. B., Ferguson, E. L., and Frasch, M. (1998) Genes W. M. (1995) Genetics 139, 1347–1358 Dev. 12, 2354 –2370 41. Hahn, S. A., Schutte, M., Hoque, A. T., Moskaluk, C. A., da Costa, L. T., 12. Labbe ´ , E., Silvestri, C., Hoodless, P. A., Wrana, J. L., and Attisano, L. (1998) Rozenblum, E., Weinstein, C. L., Fisher, A., Yeo, C. J., Hruban, R. H., and Mol. Cell 2, 109 –120 Kern, S. E. (1996) Science 271, 350 –353 13. Chen, X., Rubock, M. J., and Whitman, M. (1996) Nature 383, 691– 696 42. Hoodless, P. A., Haerry, T., Abdollah, S., Stapleton, M., O’Connor, M. B., 14. Chen, X., Weisberg, E., Fridmacher, V., Watanabe, M., Naco, G., and Attisano, L., and Wrana, J. L. (1996) Cell 85, 489 –500 Whitman, M. (1997) Nature 389, 85– 89 43. Suzuki, A., Chang, C. Yingling, J. M. Wang, X.-F., and Hemmati-Brivanlou, A. 15. Liu, F., Pouponnot, C., and Massague ´ , M. (1997) Genes Dev. 11, 3157–3167 (1997) Development 184, 402– 405 16. Zhou, S., Zawel, L., Lengauer, C., Kinzler, K., and Vogelstein, B. (1998) Mol. 44. Nishimura, R., Kato, Y., Chen, D., Harris, S. E., Mundy, G. R., and Yoneda, T. Cell 2, 121–127 (1998) J. Biol. Chem. 273, 1872–1879 17. Zhang, Y., Feng, X.-H., and Derynck, R. (1998) Nature 394, 909 –913 45. Sekido, R., Takagi, T., Okanami, M., Moribe, H., Yamamura, M., Higashi, Y., 18. Hua, X., Liu, X., Ansari, D. O., and Lodish, H., F. (1998) Genes Dev. 12, and Kondoh, H. (1996) Gene (Amst.) 173, 227–232 3084 –3095 46. Stamenkovic, I., Clark, E. A., and Seed, B. (1989) EMBO J. 8, 1403–1410 19. Moustakas, A., and Kardasis, D. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 47. Kretzschmar, M., Liu, F., Hata, A., Doody, J., and Massague ´ , J. (1997) Genes 6733– 6738 Dev. 11, 984 –995 20. Kurokawa, M., Mitani, K., Irie, K., Matsuyama, T., Takahashi, T., Chiba, S., 48. Macias-Silva, M., Abdollah, S., Hoodless, P. A., Pirone, R., Attisano, L., and Yazaki, Y., Matsumoto, K., and Hirai, H. (1998) Nature 394, 92–96 Wrana, J. L. (1996) Cell 87, 1215–1224 21. Meersseman, G., Verschueren, K., Nelles, L., Blumenstock, C., Kraft, H., 49. Nakao, A., Imamura, T., Souchelnytskyi, S., Kawabata, M., Ishisaki, A., Oeda, Wuytens, G., Remacle, J., Kozak, C. A., Tylzanowski, P., Niehrs, C., and E., Tamaki, K., Hanai, J., Heldin, C.-H., Miyazono, K., and ten Dijke, P. Huylebroeck, D. (1997) Mech. Dev. 61, 127–140 (1997) EMBO J. 16, 5353–5362 22. Rupp, R. A., Snider, L., and Weintraub, H. (1994) Genes Dev. 8, 1311–1323 50. Franklin, A. J., Jetton, T. L., Shelton, K. D., and Magnuson, M. (1994) Mol. 23. Gietz, D., St Jean, A., Woods, R. A., and Schiestl, R. H. (1992) Nucleic Acids Cell. Biol. 14, 6773– 6788 Res. 20, 1425 51. Genetta, T., Ruezinsky, D., and Kadesch, T. (1994) Mol. Cell. Biol. 14, 24. Verschueren, K., Dewulf, N., Goumans, M. J., Lonnoy, O., Feijen, A., Grimsby, 6153– 6163 S., Vande Spiegle, K., ten Dijke, P., More ´ n, A., Vanscheeuwijck, P., Heldin, 52. Kispert, A., and Herrmann, B. G. (1993) EMBO J. 12, 3211–3220 C. H., Miyazono, K., Mummery, C., van den Eijnden-van Raaij, A. J. M., and 53. Latinkic, B. V., Umbhauer, M., Neal, K., Lerchner, W., Smith, J. C., and Huylebroeck, D. (1995) Mech. Dev. 52, 109 –123 Cunliffe, V. (1997) Genes Dev. 11, 3265–3276 25. Sekido, R., Murai, K., Funahashi, J., Kamachi, Y., Fujisawa-Sehara, A., 54. Pannese, M., Polo, C., Andreazzolli, M., Vignali, R., Kablar, B., Barsacchi, G., Nabeshima, Y., and Kondoh, H. (1994) Mol. Cell. Biol. 14, 5692–5570 and Boncinelli, E. (1995) Development 121, 707–720 26. Ikeda, K., and Kawakami, K. (1995) Eur. J. Biochem. 233, 73– 82 55. Lo, R. S., Chen, Y. G., Shi, Y., Pavletich, N., and Massague ´ , J. (1998) EMBO J. 27. Williams, T. M., Moolten, D., Burlein, J., Romano, J., Bhaerman, R., Godillot, 17, 996 –1005 A., Mellon, M., Rauscher, F. J., and Kant, J. A. (1991) Science 254, 56. Shimizu, A., Kato, M., Nakao, A., Imamura, T., ten Dijke, P., Heldin, C.-H., 1791–1794 Kawabata, M., Shimada, S., and Miyazono, K. (1998) Genes Cells 3, 28. Lee, M. E., Temizer, D. H., Clifford, J. A., and Quertermous, T. (1991) J. Biol. 125–134 Chem. 266, 16188 –16192 57. Imamura, T., Takase, M., Nishihara, A., Oeda, E., Hanai, J., Kawabata, M., 29. Smith, J. C. (1993) Cellular Interactions in Development-a Practical Approach and Miyazono, K. (1997) Nature 389, 622– 626 (Hartley, D., ed) pp. 181–204, Oxford University Press, New York 58. Kretzschmar, M., Doody, J., and Massague ´ , J. (1997) Nature 389, 618 – 622 30. Smith, J. C., and Slack, J. M. W. (1983) J. Embryol. Exp. Morphol. 78, 299 –317 59. Genetta, T., and Kadesch, T. (1996) Gene 169, 289 –290 31. Slack, J. M. W. (1984) J. Embryol. Exp. Morphol. 80, 289 –319 60. Postigo, A. A., Sheppard, A. M., Mucenski, M. L., and Dean, D. C. (1997) 32. Nieuwkoop, P. D., and Faber, J. (1967) Normal Table of Xenopus laevis EMBO J. 16, 3924 –3934 (Daudin) North Holland, Amsterdam 61. Ikeda, K., Halle, J.-P., Stelzer, G., Meisterernst, M., and Kawakami, K. (1998) 33. Harland, R. M. (1991) Methods Cell Biol. 36, 675– 685 Mol. Cell. Biol. 18, 10 –18

Journal

Journal of Biological Chemistry – Unpaywall

Published: Jul 1, 1999

There are no references for this article.