Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Specificity of Insulin and Insulin-like Growth Factor I Receptors Investigated using Chimeric Mini-Receptors

Specificity of Insulin and Insulin-like Growth Factor I Receptors Investigated using Chimeric... THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 274, No. 52, Issue of December 24, pp. 37351–37356, 1999 © 1999 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Specificity of Insulin and Insulin-like Growth Factor I Receptors Investigated using Chimeric Mini-Receptors ROLE OF C-TERMINAL OF RECEPTOR a SUBUNIT* (Received for publication, September 20, 1999) Claus Kristensen‡§, Finn C. Wiberg , and Asser S. Andersen‡ From the ‡Insulin Research and Cell Technology, Health Care Discovery, Novo Nordisk, 2880 Bagsværd, Denmark structure and conformation. The structure of the insulin recep- We have investigated the role of the C-terminal of the a-subunit in the insulin receptor family by characteriz- tor has been investigated extensively and reviewed (5, 6), it is ing chimeric mini-receptor constructs comprising the a disulfide-linked heterotetrameric molecule with b-a-a-b re- first three domains (468 amino acids) of insulin receptor ceptor subunit configuration, and the disulfides responsible for (IR) or insulin-like growth factor I receptor (IGFIR) a-a and a-b contacts have been identified (7, 8). Predictions of combined with C-terminal domain from either insulin the tertiary structure of the IR ectodomain based on alignment receptor (IR) (residues 704 –719), IGFIR, or insulin re- with epidermal growth factor receptor sequences (9, 10) pro- ceptor-related receptor (IRRR). The constructs were duced the consensus that the first 468 amino acids of IR a-sub- stably expressed in baby hamster kidney cells and puri- unit comprise two large homologous domains, L1 and L2, sep- fied, and binding affinities were determined for insulin, arated by a cysteine-rich region. Recently, a crystal structure of IGFI, and a single chain insulin/IGFI hybrid. The C- the first three domains of the IGFI receptor (residues 1– 462) terminal domain of IRRR was found to abolish binding has been solved confirming this domain structure (11); how- in IR and IGFIR context, whereas other constructs ever, this IGFIR fragment does not bind ligand. In the IR we bound ligands. The two constructs with first three do- mains of the IR demonstrated low specificity for ligands, have shown that, in addition to the first three domains (resi- all affinities ranging from 3.0 to 15 nM. In contrast, the dues 1– 468), only a small peptide from the C-terminal of the constructs with the first three domains of the IGFIR had a-subunit (704 –719) is needed to obtain binding of insulin with high specificity, the affinity of the novel minimized the same affinity as the intact IR ectodomain (12), but a simi- IGFIR for IGFI was 1.5 nM, whereas the affinity for in- larly minimized IGFIR has not been described. sulin was more than 3000 nM. When swapping the The insulin and IGFI systems share common binding C-terminal domains in either receptor context only epitopes on ligands as well as receptors. The two ligands, minor changes were observed in affinities (<3-fold), insulin and IGFI, have similar amino acid sequences, but one demonstrating that the carboxyl-terminal of IR and binds weakly to the receptor for the other. However, we have IGFIR a-subunits are interchangeable and suggesting demonstrated that it is possible to make a single chain hybrid that this domain is part of the common binding site. between insulin and IGFI that binds with high affinity to both receptors (13). This single-chain insulin/IGFI hybrid (ICP) con- 1 sists of insulin A and B chains connected by the C-domain from Insulin and IGFI mediate their effects by binding to specific IGFI. The similarity of the binding sites of the receptors have tyrosine kinase receptors in the plasma membrane of target been demonstrated with chimeric receptors in which discrete cells. The insulin receptor and IGFI receptors are membrane- domains of one receptor replaced the corresponding domain of bound glycoproteins with intracellular ligand stimulated tyro- the other receptor. The chimeric receptor studies have pro- sine kinase domains, and they display similar overall struc- duced a consensus that N-terminal sequences of the insulin tural organization (1–3). A third member of this receptor receptor are critical for high-affinity insulin binding, whereas family, the insulin receptor related receptor (IRRR) was iden- the cysteine-rich domain of IGFIR is essential for high-affinity tified at the genomic level by Shier and Watt in 1989 (4), but so far no ligand for this receptor has been identified. The amino IGFI binding (14, 15). The importance of the N terminus of the acid sequences of these receptors are approximately 50% iden- insulin receptor has also been demonstrated by cross-linking tical (1, 2, 4), and the cysteines are conserved between these (16) and by alanine scanning mutagenesis (17) receptors and, therefore, they are thought to have same overall In addition to N-terminal regions, the C-terminal of the IR a-subunit containing residues 704 –719 has in particular been suggested to be important for ligand binding. This has been * The costs of publication of this article were defrayed in part by the suggested by cross-linking (18) and by alanine scanning mu- payment of page charges. This article must therefore be hereby marked tagenesis (19). Furthermore, alanine scanning has demon- “advertisement” in accordance with 18 U.S.C. Section 1734 solely to strated that Phe-701 of IGFIR (corresponds to Phe-714 in IR) is indicate this fact. § To whom correspondence should be addressed: Insulin Research, important for the binding of IGFI to IGFIR (20). Also strongly Novo Nordisk, Novo Alle ´ , 6B1.90, 2880 Bagsværd, Denmark. Tel.: stressing the importance of this C-terminal region are our 145 4442 3572; Fax: 145 4444 4250; E-mail: [email protected]. findings with the minimized IR as mentioned above (12). The abbreviations used are: IGFI, insulin-like growth factor I; BHK, To elucidate the role of the C-terminal a-subunit for ligand baby hamster kidney; BSA, bovine serum albumin; DSS, disuccinimidyl suberate; DMEM, Dulbecco’s modified Eagle’s medium; ICP, single- binding specificity in the insulin receptor family, we decided to chain insulin/IGFI hybrid; IR, insulin receptor; IGFIR, insulin-like investigate minimized IR, IGFIR, as well as chimera between growth factor I receptor; IRRR, insulin receptor-related receptor; PCR, these receptors also including constructs with the C-terminal polymerase chain reaction; mIR, minimized IR (IRD703-FLAG); sIR, soluble IR. region of IRRR. This paper is available on line at http://www.jbc.org 37351 This is an Open Access article under the CC BY license. 37352 Minimized Chimeric Insulin/IGFI Receptors EXPERIMENTAL PROCEDURES 0.02% (w/v) sodium-azide. Purified receptors were stored in elution buffer at 4 °C. The IRD703 receptor was purified as described previ- Miscellaneous—Insulin, IGFI, and Tyr-A14- I-insulin and Tyr-31- ously (12). I-IGFI were from Novo Nordisk. The ICP consists of insulin with the Immunoblotting—The expressed receptors were detected by immu- C-domain of IGFI, and a detailed description of this construct including noblotting using three antibodies. Flag-tagged proteins were detected purification is found elsewhere (13). DNA restriction enzymes and T4 using an antibody against the M2 Flag epitope. For detecting insulin ligase were from New England Biolabs, Pwo polymerase was from receptors, the monoclonal antibody mAb-F26 was used. This antibody Roche Molecular Biochemicals. Preparation of plasmid DNA and aga- was raised against a peptide corresponding to amino acids 39 –75, rose gel electrophoresis were performed according to standard methods. mapping at the N terminus of the insulin receptor a-subunit. The For DNA minipreps, QIAprep 8 kit was used (QIAGEN). Disuccinimidyl antibody was kindly donated by Jes Thorn Clausen, Novo-Nordisk. For suberate (DSS) was from Pierce Chemical Co. detecting IGFIR, the IGFIRa (N-20) from Santa Cruz Biotechnology Construction of cDNA Expression Plasmids Encoding Receptor Dele- was used, this is an affinity purified rabbit polyclonal antibody raised tion Constructs—An overview of the receptor constructs and the abbre- against a peptide corresponding to amino acids 31–50, mapping at the viations used is shown in Fig. 1 and Table I. The receptor constructs N terminus of IGFIR. comprise the first three domains of one receptor (IR or IGFIR) combined For blotting, samples were mixed with 0.33 volumes of loading buffer with a short C-terminal sequence from either of the three receptors IR, containing 100 mM dithiothreitol and incubated at 70 °C for 10 min IGFIR, or IRRR. The receptor sequences were fused to a C-terminal before loading on a 4 –12% polyacrylamide Bis-Tris gel (NuPAGE, sequence encoding the Flag epitope (SDYKDDDDK), and inserted into Novex). After electrophoresis, proteins were blotted onto Immobilon-P the Zem expression vector (14, 21). The minimized insulin receptor membrane (Millipore). The membrane was blocked by incubating with IRD703, which has previously been described (12), was used as template blocking buffer (2% defatted skim milk, 2% BSA in TBS) for 16 h at for constructing mIR which was made by extending the IRD703 se- 4 °C. The receptor antibodies and peroxidase-conjugated secondary an- quence with a Flag sequence using PCR. The antisense oligonucleotide tibodies were diluted in 1% BSA in TBS, and immunoreactive protein used was 59-TTTTTCTAGACTACTTGTCGTCGTCGTCCTTGTAGTC- was detected using ECL reagent from Amersham Pharmacia Biotech. AGATGGCCTAGGGACGAAAACC-39 (XbaI site underlined) and a Receptor Binding Assay—For displacement binding analysis, a suit- sense primer upstream from NheI site (amino acids 466 – 467). The PCR able dilution of purified receptor was incubated in a total volume of 200 fragment was digested with NheI and XbaI and ligated into the corre- 125 125 ml with 15 pM of I-insulin or I-IGFI and various concentrations of sponding site of plasmid encoding IRD703. unlabeled ligand (insulin, IGFI, or ICP) in binding buffer (100 m The mIGFIR that consists of IGFIR residues 1– 458 and 691–706 Hepes (pH 8.0), 100 mM NaCl, 10 mM MgCl , 0.05% (w/v) BSA, 0.025% fused to a C-terminal Flag epitope was made by PCR amplifying an (w/v) Triton X-100) for 16 h at 4 °C. Subsequently bound counts were IGFIR deletion construct (similar to IRD703 described above) with the g-globulin and 500 ml of 30% (w/v) recovered by precipitation with 0.2% antisense primer: 59-TTTTTCTAGACTACTTGTCGTCGTCGTCCTTG- 125 polyethylene glycol 8000. Bound I-labeled hormone was counted in a TAGTCTTCAGGTCTGGGCACGAAGATGG-39 (XbaI site underlined) g-counter. The concentration of receptor was adjusted to yield 10 –15% and a sense primer upstream from NheI site (amino acids 456 – 457). binding when no competing ligand was added in the competition assay. The PCR fragment was digested with NheI and XbaI and ligated into The binding data were fitted using nonlinear regression algorithm in the corresponding site of plasmid encoding an IGFIR deletion construct. GraphPad Prism 2.01 (GraphPad Software Inc, San Diego, CA). The mIR.IGFIR construct was obtained by replacing a 60-base pair Cross-linking of I-labeled Ligand to Receptors—For chemical 125 125 NheI/XbaI fragment of IRD703 with the corresponding fragment from cross-linking, I-insulin or I-IGFI was used, and cross-linking was mIGFIR, and conversely IGFIR.IR was obtained by replacing a NheI/ performed essentially as described (14, 22). Affinity purified receptor XbaI fragment of mIGFIR with the corresponding fragment from mIR. constructs were incubated for 60 min at room temperature with labeled For making chimeric receptors with IRRR sequence in the C termi- M) in the presence or absence of unlabeled ligand (1 ligand (0.2– 0.3 n nus, the IRRR sequence 685– 699 was first fused to amino acid 468 of mM). DSS in dimethyl sulfoxide was added from a 10 mM stock solution IR. This was obtained by amplifying the IRD703 DNA sequence using a to a final concentration of 0.1 mM. After 15 min on ice, the reaction was sense primer upstream from Bsu36I site (amino acids 417– 419) and the stopped by adding 0.33 volume of loading buffer containing 100 mM antisense primer 59-TGGCCTAGGGATGGTGATCGCGTTGTGTAGA- dithiothreitol. Samples were incubated at 70 °C for 10 min before run- AAGTTTTCAAACTTCAGCTAGCCTTGTCCCC (AvrII site is under- ning on a 4 –12% polyacrylamide Bis-Tris gel (NuPAGE, Novex). The gel lined). The resulting PCR fragment was digested with Bsu36I and AvrII was fixed in 10% acetic acid, 20% ethanol, and a PhosphorImager and ligated into the corresponding site of the plasmid encoding IRD703. screen was exposed with the dried gel. From this plasmid, the BamHI/AvrII sequence was inserted into mIR Gel Filtration—The minimized IGFI receptor (mIGFIR) was mixed resulting in the plasmid encoding mIR.IRRR, and finally the IR se- with I-IGFI (;200,000 cpm), allowed to equilibrate, and analyzed quence of this plasmid was replaced with the IGFIR sequence by taking with the Amersham Pharmacia Biotech FPLC system, using a Superose the BamHI/NheI fragment from mIGFIR plasmid, resulting in the M Tris, HCl 12 HR 10/30 gel filtration column equilibrated in 20 m plasmid encoding mIGFIR.IRRR. buffer, pH 7.5, with 100 mM NaCl. Chromatography was performed at Cell Transfection—For expression of receptors in cultured BHK cells, a flow rate of 0.5 ml/min, and 0.5 ml fractions were collected. Radioac- the expression vectors were transfected into cells by the Lipofect- tivity in fractions was counted on a g-counter. Aldolase (M 158,000), TM AMINE procedure for stable transfection of adherent cells (Life Tech- BSA (M 67,000), ovalbumin (M 43,000), and ribonuclease A (M r r r nologies Inc.). Prior to transfection, BHK cells were grown in Dulbecco’s 13,700) from Amersham Pharmacia Biotech were used for calibration of modified Eagle’s medium (DMEM) (Life Technologies Inc.) supple- the column. mented with 10% fetal calf serum, 100 units/ml penicillin, and 100 mg/ml streptomycin. Cells were seeded to 20 – 40% confluency 16 –24 h RESULTS prior to transfection, and the medium was replaced 1 h prior to trans- Cloning and Expression of Receptor Constructs—We previ- TM fection. Plasmid DNA (2 mg) was mixed with 7 ml of LipofectAMINE ously expressed a minimized insulin receptor (IRD703) consist- in a total volume of 200 ml of serum-free medium, this mixture was ing of the first three domains of the insulin receptor fused incubated for 30 min at room temperature before adding 0.8 ml of serum-free medium and overlaying onto the rinsed cells. After incuba- directly to 16 amino acids of the C-terminal of the a-subunit tion for 5 h, 1 ml of DMEM containing 20% fetal calf serum was added, (residues 704 –719) (12). In the present study the Flag epitope and then cells were incubated for 16 h before removing DNA by replac- was added to the C-terminal of the IRD703, resulting in the ing medium with DMEM containing 10% fetal calf serum. After an mIR construct, and in addition similar constructs were made additional 48 h, cells were passaged to selection medium containing 1 from the IGFIR sequence and various chimera based on these mM methotrexate. After 10 –14 days, individual colonies were isolated receptors (Fig. 1, Table I). In all constructs, a NheI restriction and expression was tested by insulin binding assay or by immunoblot- ting using Flag antibody. Selected BHK clones were grown in DMEM site was introduced corresponding to amino acids 466 – 467 of supplemented with 10% fetal calf serum and 1 mM methotrexate. IR (Fig. 1), and this site allowed shuffling the C-terminal do- Purification of Flagged Mini-receptors—Receptors with C-terminal main from one receptor to the other as described under “Ex- Flag epitope were purified by affinity chromatography using immobi- perimental Procedures” (Fig. 1 and Table I). All constructs lized M2 Flag antibody from Sigma. Flag affinity gel was mixed with were stably expressed in BHK cells, and the C-terminal Flag BHK culture supernatant and incubated at 4 °C overnight before wash- epitope facilitated purification and detection of receptors using ing with TBS (10 mM Tris (pH 7.5), 100 mM NaCl), and the bound receptor proteins were eluted with 0.1 mg/ml Flag peptide in TBS, Flag antibody. Minimized Chimeric Insulin/IGFI Receptors 37353 molecular mass that could be a dimeric mini-receptor. Size Separation of Ligand Receptor Complex—To investigate the stoichiometry further, we mixed the mIGFIR with I- IGFI and then separated this complex on a Superose 12 gel filtration column. The elution profile is shown in Fig. 3. Clearly the majority of receptor bound IGFI elutes near the BSA (67 kDa) marker which is consistent with a monomeric receptor, and a smaller fraction elutes earlier corresponding to M higher than 158,000. Detecting Receptors by Immunoblotting—The purified recep- tor constructs were confirmed by immunoblotting. The anti- body that recognizes the Flag epitope should detect all con- structs except IRD703 (Fig. 1), whereas the antibodies specific for the N terminus of IR or IGFIR should verify that the N terminus of the constructs are correct. The immunoblots are shown in Fig. 4. In panel A is shown the proteins detected with the antibody specific for the Flag peptide sequence. The Flag sequence is detected in all the new receptor constructs (lanes 2–7). The size of the immunoreactive proteins is about 80 kDa for the IR constructs (lanes 2– 4) and is somewhat lower (72 kDa) for the IGFIR constructs (lanes 5–7). This difference in part reflects that mIR is longer than mIGFIR (492 versus 482 amino acids). In addition, mIGFIR is probably less glycosylated than mIR because the mIGFIR have only seven potential N- glycosylation sites, whereas mIR has ten sites. Immunoblotting using the receptor-specific antibodies, shown in Fig. 4B, reveals bands similar to what was detected with the Flag antibody (lanes 2–7). In addition, the IRD703 is now detected using the IR antibody (panel B, lane 1). We have not investigated how efficient the purification procedure is, but the immunoblots indicate that the amounts of chimeric recep- tors with the C-terminal IRRR domain (lanes 4 and 7) are not dramatically lower than what is found for the other mini- FIG.1. Schematic representation of receptor constructs. A, receptors, indicating that the IRRR domain is well tolerated in schematic illustration of the DNA sequence encoding minimized IR mIR as well as mIGFIR context. with Flag tag (DYKDDDDK). L1, Cys, and L2 are the first three do- As demonstrated by cross-linking (Fig. 2) and gel filtration mains of the insulin receptor (9); IR residues 704 –719 are part of exon 10 in the C terminus of the a-subunit. The restriction sites NheI, AvrII, (Fig. 3), there is a small receptor fraction that dimerizes or and XbaI were used for shuffling these domains as described under aggregates to molecular mass higher than 158 kDa, and this “Experimental Procedures.” B, the receptor constructs expressed; IR probably accounts for the faint higher molecular mass band domains are black boxes, IGFIR domains are white boxes, and IRRR observed on the blots (Fig. 4, panels A and B). domains are gray boxes. C, the C-terminal domains of the three recep- tors (704 –719 from IR, 691–706 from IGFIR, and 686 – 697 from IRRR), Receptor Constructs, Binding of Ligands—The purified re- the three C-terminal amino acids of IR, RPS, (717–719), were inserted ceptors were analyzed in a competition binding assay. For the into the IRRR constructs. The boxes indicate residues that are identical three receptors that contain the N terminus of the insulin to corresponding IR residue. receptor (mIR, mIR.IGFIR, and mIR.IRRR), labeled insulin was used as tracer, and for the constructs based on IGFIR Purification of Flagged Mini-Receptors—Receptors with Flag (mIGFIR, mIGFIR.IR, and mIGFIR.IRRR), labeled IGFI was epitope were purified by absorbing on anti-Flag M2 affinity used. Binding curves are shown in Fig. 5, and an overview of column and eluting with 0.1 mg/ml of Flag peptide. This pro- the affinities is presented in Table I. cedure enabled purification of all receptors using the same To evaluate the Flag tag approach, we compared mIR with protocol. Efficient purification is required especially when in- the untagged IRD703 receptor (12). The binding affinities found vestigating IGFI binding to avoid interference from IGFI and for these two receptors are similar for insulin and ICP, whereas IGFI binding proteins present in serum and secreted by BHK for IGFI, the mIR has slightly increased affinity (2.5-fold) com- cells (23). In Fig. 2 is shown purification of two of the IGFIR- pared with IRD703. As the Flag epitope only has minor effects based receptors (mIGFIR and mIGFIR.IR). In both BHK su- on ligand binding, we decided that this system was useful for pernatants (lanes 1 and 6), the dominating protein that cross- investigating members of the insulin receptor family. links IGFI has mobility corresponding to approximately 38 kDa The second conclusion from the binding studies is that the which is the size expected for IGFI binding protein (30 kDa) IRRR domain in the C-terminal abolishes binding of insulin in cross-linked to IGFI (8 kDa), whereas the receptor/IGFI com- mIR context and abolishes binding of IGFI in mIGFIR context. plex with an apparent mass of approximately 80 kDa is seen as a faint band in the BHK supernatant of mIGFIR (Fig. 2, lane 1) As described above, the mIR.IRRR and mIGFIR.IRRR proteins are expressed and purified as judged by immunoblotting (Fig. and is not visible at all in mIGFIR.IR (lane 6). After absorption to the anti-Flag column, the binding protein is found in the 4), and therefore we conclude that replacing the cognate C- flow-through (lanes 2 and 7), whereas no bands smaller than terminal sequence with that of IRRR directly affects the the 80-kDa receptor/IGFI band in the eluates is apparent, epitope that interacts with ligand. demonstrating efficient elimination of binding protein using For the constructs that contain the first three domains of IR this affinity purification. In addition to the 80-kDa band com- (mIR, IRD703, and mIR.IGFIR), the binding affinities for either prising receptor, there seems to be a fainter band of higher of the three ligands was comparable from one receptor to the 37354 Minimized Chimeric Insulin/IGFI Receptors TABLE I Receptor domain structure and affinities for insulin, IGFI, and ICP Each affinity is the average EC 6 S.D. for at least three independent experiments. The data were determined from binding curves similar to those shown in Fig. 5, as described under “Experimental Procedures.” For the constructs containing the C-terminus, IRRR sequence binding was not detectable (2). Domain structure Binding affinities Construct N terminus (1-468) C terminus (704-719) Insulin IGFI ICP nM mIR IR IR 5.8 6 1.5 15 6 3 3.6 6 1.6 IRD703 IR IR 5.9 6 2.5 35 6 18 5.3 6 1.2 mIR.IGFIR IR IGFIR 12 6 7.2 7.2 6 1.0 8.1 6 2.2 mIR.IRRR IR IRRR mIGFIR IGFIR IGFIR 3100 6 1700 1.5 6 0.7 9.8 6 3.9 mIGFIR.IR IGFIR IR 3800 6 1700 3.4 6 1.0 6.2 6 0.8 mIGFIR.IRRR IGFIR IRRR a 125 125 For displacement experiments, I-insulin for mIR, IRD703, and mIR.IGFIR, and I-IGFI for mIGFIR and mIGFIR.IR was used. IRD703 does not have a C-terminal Flag tag. FIG.2. Purification of flagged receptors. Autoradiographs illus- trating purification of mIGFIR (lanes 1–5) and mIGFIR.IR (lanes 6 –9). Receptors were cross-linked to I-IGFI using 0.2 mM DSS, and pro- teins were separated on a 4 –12% polyacrylamide Bis-Tris gel. The samples are: input (medium from BHK cells, lanes 1 and 6), flow- through from anti-Flag affinity column (lanes 2 and 7), 0.1 mg/ml Flag elution fraction 1 (lanes 3 and 8), fraction 2 (lanes 4 and 8), and fraction 3(lane 9). In adjacent lane, an C-labeled Rainbow marker was run, with the band sizes indicated at the left of the gel. FIG.4. Immunoblotting of purified mini-receptor constructs. Samples of purified receptor were mixed with 0.33 volume of SDS loading buffer containing 100 mM dithiothreitol, and proteins were separated on 4 –12% SDS-polyacrylamide gel and blotted onto polyvi- nylidene difluoride membrane. Receptors were detected using a mono- clonal antibody specific for the Flag epitope (panel A), or antibody specific for epitope in N terminus of IR (panel B, lanes 1– 4) or IGFIR (panel B, lanes 5–7), as described under “Experimental Procedures.” The following samples were analyzed: IRD703 (lane 1), mIR (lane 2), mIR.IGFIR (lane 3), mIR.IRRR (lane 4), mIGFIR (lane 5), mIGFIR.IR FIG.3. Size separation of ligand receptor complex. The mini- (lane 6), and mIGFIR.IRRR (lane 7). Molecular mass markers (Rainbow mized IGFI receptor (mIGFIR) was equilibrated with I-IGFI and from Amersham Pharmacia Biotech) are indicated to the left. analyzed using a Superose 12 HR 10/30 gel filtration column. Radioac- tivity in each fraction is shown. Arrows indicate the location of the For the constructs with the first three domains of IGFIR, the following size markers: aldolase (M 158,000), BSA (M 67,000), ovalbu- r r binding affinities of the three ligands were conserved when min (M 43,000), and ribonuclease (M 13,000). r r swapping to the C-terminal of IR (less than two-fold differ- other (less than 5-fold differences), and in addition these recep- ences), but in clear contrast to mIR, the mIGFIR-based recep- tors displayed poor specificity, all affinities ranging from 3.6 to tors retain high specificity (.1000-fold). The affinity of the 35 nM. The affinities for insulin and ICP were 4 – 6 nM, which is mIGFIR for IGFI is 1.5 nM, whereas insulin has an EC of similar to the affinity of the soluble IR ectodomain (sIR) for more than 3000 nM (,0.05%), and ICP is close to IGFI with 9.8 insulin (14, 21). In contast to sIR that has approximately 100- nM (16%). The affinities for IGFI and ICP (1.5 and 9.8 nM) are fold specificity for binding insulin compared with IGFI (14), approximately 4-fold lower than has been reported for the these minimized IR constructs only have 3– 6-fold lower affinity soluble IGFIR ectodomain (0.4 and 1.9 nM) (13, 14, 21), but the for IGFI compared with insulin. As the affinity for insulin is relative affinities are unchanged. unchanged, the loss in specificity must be ascribed to higher The binding data for chimeric receptors based on both IR and affinity for IGFI (15–35 nM) in mIR and IRD703 as compared IGFIR demonstrate that inserting the C-terminal domain from with sIR, 500 – 800 nM (14, 21). the non-cognate receptor does not change ligand binding char- Minimized Chimeric Insulin/IGFI Receptors 37355 125 125 FIG.5. Competition curves for I-ligand binding to receptor constructs. Displacement curves for I-insulin (panels A, B, and C)or I-IGFI (panel D and E) to receptor constructs mIR (panel A), IRD703 (panel B), mIR.IGFIR (panel C), mIGFIR (panel D), and mIGFIR.IR (Panel E). The symbols used for the ligands are: insulin (●), IGFI (E), and ICP (3). acteristics. In other words, the C-terminal domains are inter- changeable with respect to ligand binding, and accordingly this domain appears to be part of the common binding site in these receptors. Cross-linking of I-labeled Ligand to Receptors—Labeled ligands were chemically cross-linked to receptor constructs with DSS, and the gels are shown in Fig. 6. The cross-linking pattern shows specific binding of tracers to the constructs with IR or IGFIR sequence in the C terminus, all yielding bands with apparent mass between 66 and 97 kDa (lanes 1, 3, 5, 9, and 11), whereas the two constructs with the C-terminal do- main from IRRR (lanes 7 and 13) do not present any bands, in 125 125 accordance with our findings that mIR.IRRR and mIGFIR- FIG.6. Covalent Cross-Linking of I-insulin or I-IGFI to .IRRR do not bind ligand in the soluble binding assay. receptor constructs. Autoradiographs of 4 –12% polyacrylamide gel showing the receptors covalently cross-linked to labeled ligand. Recep- 125 125 DISCUSSION tors were cross-linked to I-insulin (lanes 1– 8)or I-IGFI (lanes M DSS in the absence (2) or presence (1)of1 mM 9 –14) using 0.2 m To standardize and simplify the purification of multiple re- unlabeled ligand. In adjacent lane, a C-labeled Rainbow marker was ceptors with varying domains and binding characteristics, we run, with the band sizes indicated at the left of the gel. The following constructed the minimized receptors with a C-terminal 8- samples were analyzed: IRD703 (lanes 1 and 2), mIR (lanes 3 and 4), mIR.IGFIR (lanes 5 and 6), mIR.IRRR (lanes 7 and 8), mIGFIR (lanes amino acid Flag epitope. The presence of this epitope permits a 10 and 11), mIGFIR.IR (lanes 12 and 13), and mIGFIR.IRRR (lanes 14 mild single-step purification of the receptors, and more impor- and 15). tantly this procedure efficiently eliminates the IGFI binding proteins present in the BHK cell culture medium (23) (Fig. 2). The Flag epitope is close to the ligand binding domain that we three domains of IGFIR was solved recently (11), and this wanted to study, and thus it could interfere with binding as has structure led to suggestions of a putative central site that could been demonstrated in IR with exon 11 (24). We have previously accommodate IGFI. In the x-ray structure, the C-terminal of shown that ligand binding of the minimized IR (IRD703) is not the L2 domain does not face the putative ligand binding lobe, influenced by the exon11 region (12), and here we observe no whereas our data show that only 16 amino acids fused to this C difference in affinity for insulin between IRD703 and mIR terminus induces binding of IGFI. The binding affinity of mIG- which has the Flag epitope. We thus concluded that the Flag FIR for IGFI (1.5 nM) was approximately 4-fold lower than that epitope does not affect ligand binding in the mini-receptors. found for the soluble ectodomain of IGFIR (sIGFIR) (0.3– 0.4 We have previously reported that the ligand binding domain nM) (14, 25), whereas in terms of specificity, it remains highly of IR can be minimized by expressing the first three IR domains specific for IGFI compared with insulin (.1000-fold). (468 amino acids) fused to the C-terminal 16 amino acids of the In terms of binding cognate ligand, the minimized IR more a-subunit (residues 704 –719) (12). This minimized receptor faithfully reflected the binding characteristics of the ectodo- (IRD703) binds insulin with affinity similar to the full-length main; mIR and IRD703 have retained the full binding activity IR ectodomain (soluble IR). In the present study, we have of the IR ectodomain (sIR), all having affinities of 5– 6 nM for expressed a similar minimized IGFIR construct and four chi- insulin. Although mIR (and IRD703) have unchanged affinity meric mini-receptors. The minimized IGFIR construct is par- for insulin, they have increased affinity for IGFI compared with ticularly interesting because the x-ray structure of the first sIR, resulting in the mini-IRs having almost the same affinities 37356 Minimized Chimeric Insulin/IGFI Receptors for insulin and IGFI, with the affinity for IGFI being only these receptors. Finally we have demonstrated that it is possi- 3– 6-fold lower than affinity for insulin (Table I). The low spec- ble to make a minimized IGFIR that binds IGFI, this mIGFIR ificity of the minimized insulin receptors is puzzling, we spec- receptor consists of the first three domains of IGFIR fused to 16 ulate that because the sIR have all the epitopes required for amino acids from the C terminus of the a-subunit. The short binding IGFI with 20 nM affinity (like mIR and IRD703), there C-terminal domain is essential for binding ligand, whereas the must be something inhibiting receptor-IGFI interaction in sIR. crystal structure for the remaining 462 amino acids has been Possibly some of the regions deleted in the minimized IRs solved (11) and, therefore, the minimized IGFIR is a good interfere with IGFI binding in sIR, or maybe the dimeric con- candidate for crystallizing an IGFIR fragment with bound formation of sIR interferes with IGFI attaining the higher ligand. affinity. Acknowledgments—We thank Jannie Ovesen, Else Jost Jensen, and Despite that the primary sequence of IRRR is as similar to IR Lene Drube for excellent technical assistance. and IGFIR as the IR and IGFIR are to each other (4), no binding of insulin, IGFI, or any other ligand has been observed REFERENCES with the IRRR. In the present setup we have investigated the 1. Ullrich, A., Bell, J. R., Chen, E. Y., Herrera, R., Petruzzelli, L. M., Dull, T. J., role of the short C-terminal domain of the IRRR a-subunit in Gray, A., Coussens, L., Liao, Y. C., Tsubokawa, M., Mason, A., Seeburg, T. J., Grunfeld, C., Rosen, O. M., and Ramachandran, J. (1985) Nature 313, mIR and mIGFIR context. The clear conclusion from these 756 –761 chimeric receptors is that the C terminus of IRRR abolishes 2. Ebina, Y., Ellis, L., Jarnagin, K., Edery, M., Graf, L., Clauser, E., Ou, J.-H., binding of insulin and IGFI. This is somewhat surprising be- Masiarz, F., Kan, Y. W., Goldfine, I. D., Roth, R. A., and Rutter, W. J. (1985) Cell 40, 747–758 cause only four of the residues in the C-terminal region (IR 3. Ullrich, A., Gray, A., Tam, A. W., Yang-Feng, T., Tsubokawa, M., Collins, C., residues 704 –719) are different from corresponding positions of Henzel, W., Le Bon, T., Kathuria, S., Chen, E., Jacobs, S., Francke, U., both IR and IGFIR (Fig. 1C). One of these four residues, ala- Ramachandran, J., and Fujita-Yamaguchi, Y. (1986) EMBO J. 5, 2503–2512 nine 694, has been shown by alanine scanning mutagenesis to 4. Shier, P., and Watt, V. M. (1989) J. Biol. Chem. 264, 14605–14608 be acceptable at corresponding position 712 in IR (19). 5. Lee, J., and Pilch, P. F. (1994) Am. J. Physiol. 266, C319 –C334 6. Tavare ´ , J. M., and Siddle, K. (1993) Biochim. Biophys. Acta 1178, 21–39 Chimeric receptors between IR and IRRR have been de- 7. Scha ¨ ffer, L., and Ljungqvist, L. (1992) Biochem. Biophys. Res. Commun. 189, scribed previously, Zhang and Roth (26) found that a chimeric 650 – 653 receptor with the extracellular domain of IR and the kinase 8. Sparrow, L. G., McKern, N. M., Gorman, J. J., Strike, P. M., Robinson, C. P., Bentley, J. D., and Ward, C. W. (1997) J. Biol. Chem. 272, 29460 –29467 domain of IRRR exhibited high affinity insulin binding and 9. Bajaj, M., Waterfield, M. D., Schlessinger, J., Taylor, W. R., and Blundell, T. insulin-stimulated tyrosine kinase activity. They also made a (1987) Biochim. Biophys. Acta 916, 220 –226 chimeric receptor with the cysteine-rich region of IR (exon 3) 10. Ward, C. W., Hoyne, P. A., and Flegg, R. H. (1995) Proteins Struct. Func. Genet. 22, 141–153 replaced with the homologous region of IRRR that was shown 11. Garrett, T. P., McKern, N. M., Lou, M. Z., Frenkel, M. J., Bentley, J. D., to bind insulin with affinity similar to that of wild type IR; Lovrecz, G. O., Elleman, T. C., Cosgrove, L. J., and Ward, C. W. (1998) however, when replacing both exon 2 and exon 3 of IR with Nature 394, 395–399 12. Kristensen, C., Wiberg, F. C., Scha ¨ ffer, L., and Andersen, A. S. (1998) J. Biol. IRRR domains, no binding of insulin was detected (27). Chem. 273, 17780 –17786 The chimeric mini-receptors show that replacing the C-ter- 13. Kristensen, C., Andersen, A. S., Hach, M., Wiberg, F. C., Scha ¨ ffer, L., and Kjeldsen, T. (1995) Biochem. J. 305, 981–986 minal domain of IR with the corresponding domain of IGFIR 14. Andersen, A. S., Kjeldsen, T., Wiberg, F. C., Christensen, P. M., Rasmussen, only has minor effect on ligand binding. This is also true for J. S., Norris, K., Møller, K. B., and Møller, N. P. H. (1990) Biochemistry 29, mIGFIR with the C terminus of IR. So within IR and IGFIR, 7363–7366 15. Schumacher, R., Mosthaf, L., Schlessinger, J., Brandenburg, D., and Ullrich, the C-terminal domains are interchangeable in terms of ligand A. (1991) J. Biol. Chem. 266, 19288 –19295 binding, suggesting that this domain is part of the common 16. Wedekind, F., Baer-Pontzen, K., Bala-Mohan, S., Choli, D., Zahn, H., and binding site of these receptors. Brandenburg, D. (1989) Biol. Chem. Hoppe-Seyler 370, 251–258 17. Williams, P. F., Mynarcik, D. C., Yu, G. Q., and Whittaker, J. (1995) J. Biol. We have previously characterized ICP, which consists of Chem. 270, 3012–3016 insulin with IGFI C-domain, against various IR and IGFIR. 18. Kurose, T., Pashmforoush, M., Yoshimasa, Y., Carroll, R., Schwartz, G. P., Burke, G. T., Katsoyannis, P. G., and Steiner, D. F. (1994) J. Biol. Chem. The conclusion was that ICP binds with high affinity to IR 269, 29190 –29197 (55–113% of insulin) and with 19 –28% of IGFI affinity to 19. Mynarcik, D. C., Yu, G. Q., and Whittaker, J. (1996) J. Biol. Chem. 271, IGFIR (13). Here we get similar results for relative binding 2439 –2442 20. Mynarcik, D. C., Williams, P. F., Scha ¨ ffer, L., Yu, G. Q., and Whittaker, J. affinities for mini-receptors. The affinity of ICP for mIR and (1997) J. Biol. Chem. 272, 18650 –18655 IRD703 was not different from the affinity of insulin. For mIG- 21. Kjeldsen, T., Andersen, A. S., Wiberg, F. C., Rasmussen, J. S., Scha ¨ ffer, L., FIR, the affinity of ICP was 16% of IGFI, and thus previous Balschmidt, P., Møller, K. B., and Møller, N. P. H. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4404 – 4408 conclusions that the C-domain of IGFI is a major determinant 22. Waugh, S. M., and Pilch, P. F. (1989) Biochemistry 28, 2722–2727 of IGFIR specificity for IGFI is true also for the minimized 23. Blum, W. F., Jenne, E. W., Reppin, F., Kietzmann, K., Ranke, M. B., and Bierich, J. R. (1989) Endocrinology 125, 766 –772 IGFIR. 24. Pashmforoush, M., Yoshimasa, Y., and Steiner, D. F. (1994) J. Biol. Chem. 269, Based on the chimeric mini-receptors, we conclude that the 32639 –32648 C-terminal domain of IRRR abolishes binding of ligand and 25. Andersen, A. S., Kjeldsen, T., Wiberg, F. C., Vissing, H., Scha ¨ ffer, L., Rasmussen, J. S., De Meyts, P., and Møller, N. P. H. (1992) J. Biol. Chem. that swapping of C-terminal sequences from IR to IGFIR or 267, 13681–13686 vice versa does not influence ligand binding dramatically, indi- 26. Zhang, B., and Roth, R. A. (1992) J. Biol. Chem. 267, 18320 –18328 cating that this region is part of the common binding site in 27. Zhang, B., and Roth, R. A. (1991) Biochem. 30, 5113–5117 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Specificity of Insulin and Insulin-like Growth Factor I Receptors Investigated using Chimeric Mini-Receptors

Kristensen, Claus; Wiberg, Finn C.; Andersen, Asser S.
Journal of Biological Chemistry – Dec 1, 1999
Download PDF
6 pages

Loading next page...
 
/lp/unpaywall/specificity-of-insulin-and-insulin-like-growth-factor-i-receptors-CuHV4QlwkP

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.274.52.37351
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 274, No. 52, Issue of December 24, pp. 37351–37356, 1999 © 1999 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Specificity of Insulin and Insulin-like Growth Factor I Receptors Investigated using Chimeric Mini-Receptors ROLE OF C-TERMINAL OF RECEPTOR a SUBUNIT* (Received for publication, September 20, 1999) Claus Kristensen‡§, Finn C. Wiberg , and Asser S. Andersen‡ From the ‡Insulin Research and Cell Technology, Health Care Discovery, Novo Nordisk, 2880 Bagsværd, Denmark structure and conformation. The structure of the insulin recep- We have investigated the role of the C-terminal of the a-subunit in the insulin receptor family by characteriz- tor has been investigated extensively and reviewed (5, 6), it is ing chimeric mini-receptor constructs comprising the a disulfide-linked heterotetrameric molecule with b-a-a-b re- first three domains (468 amino acids) of insulin receptor ceptor subunit configuration, and the disulfides responsible for (IR) or insulin-like growth factor I receptor (IGFIR) a-a and a-b contacts have been identified (7, 8). Predictions of combined with C-terminal domain from either insulin the tertiary structure of the IR ectodomain based on alignment receptor (IR) (residues 704 –719), IGFIR, or insulin re- with epidermal growth factor receptor sequences (9, 10) pro- ceptor-related receptor (IRRR). The constructs were duced the consensus that the first 468 amino acids of IR a-sub- stably expressed in baby hamster kidney cells and puri- unit comprise two large homologous domains, L1 and L2, sep- fied, and binding affinities were determined for insulin, arated by a cysteine-rich region. Recently, a crystal structure of IGFI, and a single chain insulin/IGFI hybrid. The C- the first three domains of the IGFI receptor (residues 1– 462) terminal domain of IRRR was found to abolish binding has been solved confirming this domain structure (11); how- in IR and IGFIR context, whereas other constructs ever, this IGFIR fragment does not bind ligand. In the IR we bound ligands. The two constructs with first three do- mains of the IR demonstrated low specificity for ligands, have shown that, in addition to the first three domains (resi- all affinities ranging from 3.0 to 15 nM. In contrast, the dues 1– 468), only a small peptide from the C-terminal of the constructs with the first three domains of the IGFIR had a-subunit (704 –719) is needed to obtain binding of insulin with high specificity, the affinity of the novel minimized the same affinity as the intact IR ectodomain (12), but a simi- IGFIR for IGFI was 1.5 nM, whereas the affinity for in- larly minimized IGFIR has not been described. sulin was more than 3000 nM. When swapping the The insulin and IGFI systems share common binding C-terminal domains in either receptor context only epitopes on ligands as well as receptors. The two ligands, minor changes were observed in affinities (<3-fold), insulin and IGFI, have similar amino acid sequences, but one demonstrating that the carboxyl-terminal of IR and binds weakly to the receptor for the other. However, we have IGFIR a-subunits are interchangeable and suggesting demonstrated that it is possible to make a single chain hybrid that this domain is part of the common binding site. between insulin and IGFI that binds with high affinity to both receptors (13). This single-chain insulin/IGFI hybrid (ICP) con- 1 sists of insulin A and B chains connected by the C-domain from Insulin and IGFI mediate their effects by binding to specific IGFI. The similarity of the binding sites of the receptors have tyrosine kinase receptors in the plasma membrane of target been demonstrated with chimeric receptors in which discrete cells. The insulin receptor and IGFI receptors are membrane- domains of one receptor replaced the corresponding domain of bound glycoproteins with intracellular ligand stimulated tyro- the other receptor. The chimeric receptor studies have pro- sine kinase domains, and they display similar overall struc- duced a consensus that N-terminal sequences of the insulin tural organization (1–3). A third member of this receptor receptor are critical for high-affinity insulin binding, whereas family, the insulin receptor related receptor (IRRR) was iden- the cysteine-rich domain of IGFIR is essential for high-affinity tified at the genomic level by Shier and Watt in 1989 (4), but so far no ligand for this receptor has been identified. The amino IGFI binding (14, 15). The importance of the N terminus of the acid sequences of these receptors are approximately 50% iden- insulin receptor has also been demonstrated by cross-linking tical (1, 2, 4), and the cysteines are conserved between these (16) and by alanine scanning mutagenesis (17) receptors and, therefore, they are thought to have same overall In addition to N-terminal regions, the C-terminal of the IR a-subunit containing residues 704 –719 has in particular been suggested to be important for ligand binding. This has been * The costs of publication of this article were defrayed in part by the suggested by cross-linking (18) and by alanine scanning mu- payment of page charges. This article must therefore be hereby marked tagenesis (19). Furthermore, alanine scanning has demon- “advertisement” in accordance with 18 U.S.C. Section 1734 solely to strated that Phe-701 of IGFIR (corresponds to Phe-714 in IR) is indicate this fact. § To whom correspondence should be addressed: Insulin Research, important for the binding of IGFI to IGFIR (20). Also strongly Novo Nordisk, Novo Alle ´ , 6B1.90, 2880 Bagsværd, Denmark. Tel.: stressing the importance of this C-terminal region are our 145 4442 3572; Fax: 145 4444 4250; E-mail: [email protected]. findings with the minimized IR as mentioned above (12). The abbreviations used are: IGFI, insulin-like growth factor I; BHK, To elucidate the role of the C-terminal a-subunit for ligand baby hamster kidney; BSA, bovine serum albumin; DSS, disuccinimidyl suberate; DMEM, Dulbecco’s modified Eagle’s medium; ICP, single- binding specificity in the insulin receptor family, we decided to chain insulin/IGFI hybrid; IR, insulin receptor; IGFIR, insulin-like investigate minimized IR, IGFIR, as well as chimera between growth factor I receptor; IRRR, insulin receptor-related receptor; PCR, these receptors also including constructs with the C-terminal polymerase chain reaction; mIR, minimized IR (IRD703-FLAG); sIR, soluble IR. region of IRRR. This paper is available on line at http://www.jbc.org 37351 This is an Open Access article under the CC BY license. 37352 Minimized Chimeric Insulin/IGFI Receptors EXPERIMENTAL PROCEDURES 0.02% (w/v) sodium-azide. Purified receptors were stored in elution buffer at 4 °C. The IRD703 receptor was purified as described previ- Miscellaneous—Insulin, IGFI, and Tyr-A14- I-insulin and Tyr-31- ously (12). I-IGFI were from Novo Nordisk. The ICP consists of insulin with the Immunoblotting—The expressed receptors were detected by immu- C-domain of IGFI, and a detailed description of this construct including noblotting using three antibodies. Flag-tagged proteins were detected purification is found elsewhere (13). DNA restriction enzymes and T4 using an antibody against the M2 Flag epitope. For detecting insulin ligase were from New England Biolabs, Pwo polymerase was from receptors, the monoclonal antibody mAb-F26 was used. This antibody Roche Molecular Biochemicals. Preparation of plasmid DNA and aga- was raised against a peptide corresponding to amino acids 39 –75, rose gel electrophoresis were performed according to standard methods. mapping at the N terminus of the insulin receptor a-subunit. The For DNA minipreps, QIAprep 8 kit was used (QIAGEN). Disuccinimidyl antibody was kindly donated by Jes Thorn Clausen, Novo-Nordisk. For suberate (DSS) was from Pierce Chemical Co. detecting IGFIR, the IGFIRa (N-20) from Santa Cruz Biotechnology Construction of cDNA Expression Plasmids Encoding Receptor Dele- was used, this is an affinity purified rabbit polyclonal antibody raised tion Constructs—An overview of the receptor constructs and the abbre- against a peptide corresponding to amino acids 31–50, mapping at the viations used is shown in Fig. 1 and Table I. The receptor constructs N terminus of IGFIR. comprise the first three domains of one receptor (IR or IGFIR) combined For blotting, samples were mixed with 0.33 volumes of loading buffer with a short C-terminal sequence from either of the three receptors IR, containing 100 mM dithiothreitol and incubated at 70 °C for 10 min IGFIR, or IRRR. The receptor sequences were fused to a C-terminal before loading on a 4 –12% polyacrylamide Bis-Tris gel (NuPAGE, sequence encoding the Flag epitope (SDYKDDDDK), and inserted into Novex). After electrophoresis, proteins were blotted onto Immobilon-P the Zem expression vector (14, 21). The minimized insulin receptor membrane (Millipore). The membrane was blocked by incubating with IRD703, which has previously been described (12), was used as template blocking buffer (2% defatted skim milk, 2% BSA in TBS) for 16 h at for constructing mIR which was made by extending the IRD703 se- 4 °C. The receptor antibodies and peroxidase-conjugated secondary an- quence with a Flag sequence using PCR. The antisense oligonucleotide tibodies were diluted in 1% BSA in TBS, and immunoreactive protein used was 59-TTTTTCTAGACTACTTGTCGTCGTCGTCCTTGTAGTC- was detected using ECL reagent from Amersham Pharmacia Biotech. AGATGGCCTAGGGACGAAAACC-39 (XbaI site underlined) and a Receptor Binding Assay—For displacement binding analysis, a suit- sense primer upstream from NheI site (amino acids 466 – 467). The PCR able dilution of purified receptor was incubated in a total volume of 200 fragment was digested with NheI and XbaI and ligated into the corre- 125 125 ml with 15 pM of I-insulin or I-IGFI and various concentrations of sponding site of plasmid encoding IRD703. unlabeled ligand (insulin, IGFI, or ICP) in binding buffer (100 m The mIGFIR that consists of IGFIR residues 1– 458 and 691–706 Hepes (pH 8.0), 100 mM NaCl, 10 mM MgCl , 0.05% (w/v) BSA, 0.025% fused to a C-terminal Flag epitope was made by PCR amplifying an (w/v) Triton X-100) for 16 h at 4 °C. Subsequently bound counts were IGFIR deletion construct (similar to IRD703 described above) with the g-globulin and 500 ml of 30% (w/v) recovered by precipitation with 0.2% antisense primer: 59-TTTTTCTAGACTACTTGTCGTCGTCGTCCTTG- 125 polyethylene glycol 8000. Bound I-labeled hormone was counted in a TAGTCTTCAGGTCTGGGCACGAAGATGG-39 (XbaI site underlined) g-counter. The concentration of receptor was adjusted to yield 10 –15% and a sense primer upstream from NheI site (amino acids 456 – 457). binding when no competing ligand was added in the competition assay. The PCR fragment was digested with NheI and XbaI and ligated into The binding data were fitted using nonlinear regression algorithm in the corresponding site of plasmid encoding an IGFIR deletion construct. GraphPad Prism 2.01 (GraphPad Software Inc, San Diego, CA). The mIR.IGFIR construct was obtained by replacing a 60-base pair Cross-linking of I-labeled Ligand to Receptors—For chemical 125 125 NheI/XbaI fragment of IRD703 with the corresponding fragment from cross-linking, I-insulin or I-IGFI was used, and cross-linking was mIGFIR, and conversely IGFIR.IR was obtained by replacing a NheI/ performed essentially as described (14, 22). Affinity purified receptor XbaI fragment of mIGFIR with the corresponding fragment from mIR. constructs were incubated for 60 min at room temperature with labeled For making chimeric receptors with IRRR sequence in the C termi- M) in the presence or absence of unlabeled ligand (1 ligand (0.2– 0.3 n nus, the IRRR sequence 685– 699 was first fused to amino acid 468 of mM). DSS in dimethyl sulfoxide was added from a 10 mM stock solution IR. This was obtained by amplifying the IRD703 DNA sequence using a to a final concentration of 0.1 mM. After 15 min on ice, the reaction was sense primer upstream from Bsu36I site (amino acids 417– 419) and the stopped by adding 0.33 volume of loading buffer containing 100 mM antisense primer 59-TGGCCTAGGGATGGTGATCGCGTTGTGTAGA- dithiothreitol. Samples were incubated at 70 °C for 10 min before run- AAGTTTTCAAACTTCAGCTAGCCTTGTCCCC (AvrII site is under- ning on a 4 –12% polyacrylamide Bis-Tris gel (NuPAGE, Novex). The gel lined). The resulting PCR fragment was digested with Bsu36I and AvrII was fixed in 10% acetic acid, 20% ethanol, and a PhosphorImager and ligated into the corresponding site of the plasmid encoding IRD703. screen was exposed with the dried gel. From this plasmid, the BamHI/AvrII sequence was inserted into mIR Gel Filtration—The minimized IGFI receptor (mIGFIR) was mixed resulting in the plasmid encoding mIR.IRRR, and finally the IR se- with I-IGFI (;200,000 cpm), allowed to equilibrate, and analyzed quence of this plasmid was replaced with the IGFIR sequence by taking with the Amersham Pharmacia Biotech FPLC system, using a Superose the BamHI/NheI fragment from mIGFIR plasmid, resulting in the M Tris, HCl 12 HR 10/30 gel filtration column equilibrated in 20 m plasmid encoding mIGFIR.IRRR. buffer, pH 7.5, with 100 mM NaCl. Chromatography was performed at Cell Transfection—For expression of receptors in cultured BHK cells, a flow rate of 0.5 ml/min, and 0.5 ml fractions were collected. Radioac- the expression vectors were transfected into cells by the Lipofect- tivity in fractions was counted on a g-counter. Aldolase (M 158,000), TM AMINE procedure for stable transfection of adherent cells (Life Tech- BSA (M 67,000), ovalbumin (M 43,000), and ribonuclease A (M r r r nologies Inc.). Prior to transfection, BHK cells were grown in Dulbecco’s 13,700) from Amersham Pharmacia Biotech were used for calibration of modified Eagle’s medium (DMEM) (Life Technologies Inc.) supple- the column. mented with 10% fetal calf serum, 100 units/ml penicillin, and 100 mg/ml streptomycin. Cells were seeded to 20 – 40% confluency 16 –24 h RESULTS prior to transfection, and the medium was replaced 1 h prior to trans- Cloning and Expression of Receptor Constructs—We previ- TM fection. Plasmid DNA (2 mg) was mixed with 7 ml of LipofectAMINE ously expressed a minimized insulin receptor (IRD703) consist- in a total volume of 200 ml of serum-free medium, this mixture was ing of the first three domains of the insulin receptor fused incubated for 30 min at room temperature before adding 0.8 ml of serum-free medium and overlaying onto the rinsed cells. After incuba- directly to 16 amino acids of the C-terminal of the a-subunit tion for 5 h, 1 ml of DMEM containing 20% fetal calf serum was added, (residues 704 –719) (12). In the present study the Flag epitope and then cells were incubated for 16 h before removing DNA by replac- was added to the C-terminal of the IRD703, resulting in the ing medium with DMEM containing 10% fetal calf serum. After an mIR construct, and in addition similar constructs were made additional 48 h, cells were passaged to selection medium containing 1 from the IGFIR sequence and various chimera based on these mM methotrexate. After 10 –14 days, individual colonies were isolated receptors (Fig. 1, Table I). In all constructs, a NheI restriction and expression was tested by insulin binding assay or by immunoblot- ting using Flag antibody. Selected BHK clones were grown in DMEM site was introduced corresponding to amino acids 466 – 467 of supplemented with 10% fetal calf serum and 1 mM methotrexate. IR (Fig. 1), and this site allowed shuffling the C-terminal do- Purification of Flagged Mini-receptors—Receptors with C-terminal main from one receptor to the other as described under “Ex- Flag epitope were purified by affinity chromatography using immobi- perimental Procedures” (Fig. 1 and Table I). All constructs lized M2 Flag antibody from Sigma. Flag affinity gel was mixed with were stably expressed in BHK cells, and the C-terminal Flag BHK culture supernatant and incubated at 4 °C overnight before wash- epitope facilitated purification and detection of receptors using ing with TBS (10 mM Tris (pH 7.5), 100 mM NaCl), and the bound receptor proteins were eluted with 0.1 mg/ml Flag peptide in TBS, Flag antibody. Minimized Chimeric Insulin/IGFI Receptors 37353 molecular mass that could be a dimeric mini-receptor. Size Separation of Ligand Receptor Complex—To investigate the stoichiometry further, we mixed the mIGFIR with I- IGFI and then separated this complex on a Superose 12 gel filtration column. The elution profile is shown in Fig. 3. Clearly the majority of receptor bound IGFI elutes near the BSA (67 kDa) marker which is consistent with a monomeric receptor, and a smaller fraction elutes earlier corresponding to M higher than 158,000. Detecting Receptors by Immunoblotting—The purified recep- tor constructs were confirmed by immunoblotting. The anti- body that recognizes the Flag epitope should detect all con- structs except IRD703 (Fig. 1), whereas the antibodies specific for the N terminus of IR or IGFIR should verify that the N terminus of the constructs are correct. The immunoblots are shown in Fig. 4. In panel A is shown the proteins detected with the antibody specific for the Flag peptide sequence. The Flag sequence is detected in all the new receptor constructs (lanes 2–7). The size of the immunoreactive proteins is about 80 kDa for the IR constructs (lanes 2– 4) and is somewhat lower (72 kDa) for the IGFIR constructs (lanes 5–7). This difference in part reflects that mIR is longer than mIGFIR (492 versus 482 amino acids). In addition, mIGFIR is probably less glycosylated than mIR because the mIGFIR have only seven potential N- glycosylation sites, whereas mIR has ten sites. Immunoblotting using the receptor-specific antibodies, shown in Fig. 4B, reveals bands similar to what was detected with the Flag antibody (lanes 2–7). In addition, the IRD703 is now detected using the IR antibody (panel B, lane 1). We have not investigated how efficient the purification procedure is, but the immunoblots indicate that the amounts of chimeric recep- tors with the C-terminal IRRR domain (lanes 4 and 7) are not dramatically lower than what is found for the other mini- FIG.1. Schematic representation of receptor constructs. A, receptors, indicating that the IRRR domain is well tolerated in schematic illustration of the DNA sequence encoding minimized IR mIR as well as mIGFIR context. with Flag tag (DYKDDDDK). L1, Cys, and L2 are the first three do- As demonstrated by cross-linking (Fig. 2) and gel filtration mains of the insulin receptor (9); IR residues 704 –719 are part of exon 10 in the C terminus of the a-subunit. The restriction sites NheI, AvrII, (Fig. 3), there is a small receptor fraction that dimerizes or and XbaI were used for shuffling these domains as described under aggregates to molecular mass higher than 158 kDa, and this “Experimental Procedures.” B, the receptor constructs expressed; IR probably accounts for the faint higher molecular mass band domains are black boxes, IGFIR domains are white boxes, and IRRR observed on the blots (Fig. 4, panels A and B). domains are gray boxes. C, the C-terminal domains of the three recep- tors (704 –719 from IR, 691–706 from IGFIR, and 686 – 697 from IRRR), Receptor Constructs, Binding of Ligands—The purified re- the three C-terminal amino acids of IR, RPS, (717–719), were inserted ceptors were analyzed in a competition binding assay. For the into the IRRR constructs. The boxes indicate residues that are identical three receptors that contain the N terminus of the insulin to corresponding IR residue. receptor (mIR, mIR.IGFIR, and mIR.IRRR), labeled insulin was used as tracer, and for the constructs based on IGFIR Purification of Flagged Mini-Receptors—Receptors with Flag (mIGFIR, mIGFIR.IR, and mIGFIR.IRRR), labeled IGFI was epitope were purified by absorbing on anti-Flag M2 affinity used. Binding curves are shown in Fig. 5, and an overview of column and eluting with 0.1 mg/ml of Flag peptide. This pro- the affinities is presented in Table I. cedure enabled purification of all receptors using the same To evaluate the Flag tag approach, we compared mIR with protocol. Efficient purification is required especially when in- the untagged IRD703 receptor (12). The binding affinities found vestigating IGFI binding to avoid interference from IGFI and for these two receptors are similar for insulin and ICP, whereas IGFI binding proteins present in serum and secreted by BHK for IGFI, the mIR has slightly increased affinity (2.5-fold) com- cells (23). In Fig. 2 is shown purification of two of the IGFIR- pared with IRD703. As the Flag epitope only has minor effects based receptors (mIGFIR and mIGFIR.IR). In both BHK su- on ligand binding, we decided that this system was useful for pernatants (lanes 1 and 6), the dominating protein that cross- investigating members of the insulin receptor family. links IGFI has mobility corresponding to approximately 38 kDa The second conclusion from the binding studies is that the which is the size expected for IGFI binding protein (30 kDa) IRRR domain in the C-terminal abolishes binding of insulin in cross-linked to IGFI (8 kDa), whereas the receptor/IGFI com- mIR context and abolishes binding of IGFI in mIGFIR context. plex with an apparent mass of approximately 80 kDa is seen as a faint band in the BHK supernatant of mIGFIR (Fig. 2, lane 1) As described above, the mIR.IRRR and mIGFIR.IRRR proteins are expressed and purified as judged by immunoblotting (Fig. and is not visible at all in mIGFIR.IR (lane 6). After absorption to the anti-Flag column, the binding protein is found in the 4), and therefore we conclude that replacing the cognate C- flow-through (lanes 2 and 7), whereas no bands smaller than terminal sequence with that of IRRR directly affects the the 80-kDa receptor/IGFI band in the eluates is apparent, epitope that interacts with ligand. demonstrating efficient elimination of binding protein using For the constructs that contain the first three domains of IR this affinity purification. In addition to the 80-kDa band com- (mIR, IRD703, and mIR.IGFIR), the binding affinities for either prising receptor, there seems to be a fainter band of higher of the three ligands was comparable from one receptor to the 37354 Minimized Chimeric Insulin/IGFI Receptors TABLE I Receptor domain structure and affinities for insulin, IGFI, and ICP Each affinity is the average EC 6 S.D. for at least three independent experiments. The data were determined from binding curves similar to those shown in Fig. 5, as described under “Experimental Procedures.” For the constructs containing the C-terminus, IRRR sequence binding was not detectable (2). Domain structure Binding affinities Construct N terminus (1-468) C terminus (704-719) Insulin IGFI ICP nM mIR IR IR 5.8 6 1.5 15 6 3 3.6 6 1.6 IRD703 IR IR 5.9 6 2.5 35 6 18 5.3 6 1.2 mIR.IGFIR IR IGFIR 12 6 7.2 7.2 6 1.0 8.1 6 2.2 mIR.IRRR IR IRRR mIGFIR IGFIR IGFIR 3100 6 1700 1.5 6 0.7 9.8 6 3.9 mIGFIR.IR IGFIR IR 3800 6 1700 3.4 6 1.0 6.2 6 0.8 mIGFIR.IRRR IGFIR IRRR a 125 125 For displacement experiments, I-insulin for mIR, IRD703, and mIR.IGFIR, and I-IGFI for mIGFIR and mIGFIR.IR was used. IRD703 does not have a C-terminal Flag tag. FIG.2. Purification of flagged receptors. Autoradiographs illus- trating purification of mIGFIR (lanes 1–5) and mIGFIR.IR (lanes 6 –9). Receptors were cross-linked to I-IGFI using 0.2 mM DSS, and pro- teins were separated on a 4 –12% polyacrylamide Bis-Tris gel. The samples are: input (medium from BHK cells, lanes 1 and 6), flow- through from anti-Flag affinity column (lanes 2 and 7), 0.1 mg/ml Flag elution fraction 1 (lanes 3 and 8), fraction 2 (lanes 4 and 8), and fraction 3(lane 9). In adjacent lane, an C-labeled Rainbow marker was run, with the band sizes indicated at the left of the gel. FIG.4. Immunoblotting of purified mini-receptor constructs. Samples of purified receptor were mixed with 0.33 volume of SDS loading buffer containing 100 mM dithiothreitol, and proteins were separated on 4 –12% SDS-polyacrylamide gel and blotted onto polyvi- nylidene difluoride membrane. Receptors were detected using a mono- clonal antibody specific for the Flag epitope (panel A), or antibody specific for epitope in N terminus of IR (panel B, lanes 1– 4) or IGFIR (panel B, lanes 5–7), as described under “Experimental Procedures.” The following samples were analyzed: IRD703 (lane 1), mIR (lane 2), mIR.IGFIR (lane 3), mIR.IRRR (lane 4), mIGFIR (lane 5), mIGFIR.IR FIG.3. Size separation of ligand receptor complex. The mini- (lane 6), and mIGFIR.IRRR (lane 7). Molecular mass markers (Rainbow mized IGFI receptor (mIGFIR) was equilibrated with I-IGFI and from Amersham Pharmacia Biotech) are indicated to the left. analyzed using a Superose 12 HR 10/30 gel filtration column. Radioac- tivity in each fraction is shown. Arrows indicate the location of the For the constructs with the first three domains of IGFIR, the following size markers: aldolase (M 158,000), BSA (M 67,000), ovalbu- r r binding affinities of the three ligands were conserved when min (M 43,000), and ribonuclease (M 13,000). r r swapping to the C-terminal of IR (less than two-fold differ- other (less than 5-fold differences), and in addition these recep- ences), but in clear contrast to mIR, the mIGFIR-based recep- tors displayed poor specificity, all affinities ranging from 3.6 to tors retain high specificity (.1000-fold). The affinity of the 35 nM. The affinities for insulin and ICP were 4 – 6 nM, which is mIGFIR for IGFI is 1.5 nM, whereas insulin has an EC of similar to the affinity of the soluble IR ectodomain (sIR) for more than 3000 nM (,0.05%), and ICP is close to IGFI with 9.8 insulin (14, 21). In contast to sIR that has approximately 100- nM (16%). The affinities for IGFI and ICP (1.5 and 9.8 nM) are fold specificity for binding insulin compared with IGFI (14), approximately 4-fold lower than has been reported for the these minimized IR constructs only have 3– 6-fold lower affinity soluble IGFIR ectodomain (0.4 and 1.9 nM) (13, 14, 21), but the for IGFI compared with insulin. As the affinity for insulin is relative affinities are unchanged. unchanged, the loss in specificity must be ascribed to higher The binding data for chimeric receptors based on both IR and affinity for IGFI (15–35 nM) in mIR and IRD703 as compared IGFIR demonstrate that inserting the C-terminal domain from with sIR, 500 – 800 nM (14, 21). the non-cognate receptor does not change ligand binding char- Minimized Chimeric Insulin/IGFI Receptors 37355 125 125 FIG.5. Competition curves for I-ligand binding to receptor constructs. Displacement curves for I-insulin (panels A, B, and C)or I-IGFI (panel D and E) to receptor constructs mIR (panel A), IRD703 (panel B), mIR.IGFIR (panel C), mIGFIR (panel D), and mIGFIR.IR (Panel E). The symbols used for the ligands are: insulin (●), IGFI (E), and ICP (3). acteristics. In other words, the C-terminal domains are inter- changeable with respect to ligand binding, and accordingly this domain appears to be part of the common binding site in these receptors. Cross-linking of I-labeled Ligand to Receptors—Labeled ligands were chemically cross-linked to receptor constructs with DSS, and the gels are shown in Fig. 6. The cross-linking pattern shows specific binding of tracers to the constructs with IR or IGFIR sequence in the C terminus, all yielding bands with apparent mass between 66 and 97 kDa (lanes 1, 3, 5, 9, and 11), whereas the two constructs with the C-terminal do- main from IRRR (lanes 7 and 13) do not present any bands, in 125 125 accordance with our findings that mIR.IRRR and mIGFIR- FIG.6. Covalent Cross-Linking of I-insulin or I-IGFI to .IRRR do not bind ligand in the soluble binding assay. receptor constructs. Autoradiographs of 4 –12% polyacrylamide gel showing the receptors covalently cross-linked to labeled ligand. Recep- 125 125 DISCUSSION tors were cross-linked to I-insulin (lanes 1– 8)or I-IGFI (lanes M DSS in the absence (2) or presence (1)of1 mM 9 –14) using 0.2 m To standardize and simplify the purification of multiple re- unlabeled ligand. In adjacent lane, a C-labeled Rainbow marker was ceptors with varying domains and binding characteristics, we run, with the band sizes indicated at the left of the gel. The following constructed the minimized receptors with a C-terminal 8- samples were analyzed: IRD703 (lanes 1 and 2), mIR (lanes 3 and 4), mIR.IGFIR (lanes 5 and 6), mIR.IRRR (lanes 7 and 8), mIGFIR (lanes amino acid Flag epitope. The presence of this epitope permits a 10 and 11), mIGFIR.IR (lanes 12 and 13), and mIGFIR.IRRR (lanes 14 mild single-step purification of the receptors, and more impor- and 15). tantly this procedure efficiently eliminates the IGFI binding proteins present in the BHK cell culture medium (23) (Fig. 2). The Flag epitope is close to the ligand binding domain that we three domains of IGFIR was solved recently (11), and this wanted to study, and thus it could interfere with binding as has structure led to suggestions of a putative central site that could been demonstrated in IR with exon 11 (24). We have previously accommodate IGFI. In the x-ray structure, the C-terminal of shown that ligand binding of the minimized IR (IRD703) is not the L2 domain does not face the putative ligand binding lobe, influenced by the exon11 region (12), and here we observe no whereas our data show that only 16 amino acids fused to this C difference in affinity for insulin between IRD703 and mIR terminus induces binding of IGFI. The binding affinity of mIG- which has the Flag epitope. We thus concluded that the Flag FIR for IGFI (1.5 nM) was approximately 4-fold lower than that epitope does not affect ligand binding in the mini-receptors. found for the soluble ectodomain of IGFIR (sIGFIR) (0.3– 0.4 We have previously reported that the ligand binding domain nM) (14, 25), whereas in terms of specificity, it remains highly of IR can be minimized by expressing the first three IR domains specific for IGFI compared with insulin (.1000-fold). (468 amino acids) fused to the C-terminal 16 amino acids of the In terms of binding cognate ligand, the minimized IR more a-subunit (residues 704 –719) (12). This minimized receptor faithfully reflected the binding characteristics of the ectodo- (IRD703) binds insulin with affinity similar to the full-length main; mIR and IRD703 have retained the full binding activity IR ectodomain (soluble IR). In the present study, we have of the IR ectodomain (sIR), all having affinities of 5– 6 nM for expressed a similar minimized IGFIR construct and four chi- insulin. Although mIR (and IRD703) have unchanged affinity meric mini-receptors. The minimized IGFIR construct is par- for insulin, they have increased affinity for IGFI compared with ticularly interesting because the x-ray structure of the first sIR, resulting in the mini-IRs having almost the same affinities 37356 Minimized Chimeric Insulin/IGFI Receptors for insulin and IGFI, with the affinity for IGFI being only these receptors. Finally we have demonstrated that it is possi- 3– 6-fold lower than affinity for insulin (Table I). The low spec- ble to make a minimized IGFIR that binds IGFI, this mIGFIR ificity of the minimized insulin receptors is puzzling, we spec- receptor consists of the first three domains of IGFIR fused to 16 ulate that because the sIR have all the epitopes required for amino acids from the C terminus of the a-subunit. The short binding IGFI with 20 nM affinity (like mIR and IRD703), there C-terminal domain is essential for binding ligand, whereas the must be something inhibiting receptor-IGFI interaction in sIR. crystal structure for the remaining 462 amino acids has been Possibly some of the regions deleted in the minimized IRs solved (11) and, therefore, the minimized IGFIR is a good interfere with IGFI binding in sIR, or maybe the dimeric con- candidate for crystallizing an IGFIR fragment with bound formation of sIR interferes with IGFI attaining the higher ligand. affinity. Acknowledgments—We thank Jannie Ovesen, Else Jost Jensen, and Despite that the primary sequence of IRRR is as similar to IR Lene Drube for excellent technical assistance. and IGFIR as the IR and IGFIR are to each other (4), no binding of insulin, IGFI, or any other ligand has been observed REFERENCES with the IRRR. In the present setup we have investigated the 1. Ullrich, A., Bell, J. R., Chen, E. Y., Herrera, R., Petruzzelli, L. M., Dull, T. J., role of the short C-terminal domain of the IRRR a-subunit in Gray, A., Coussens, L., Liao, Y. C., Tsubokawa, M., Mason, A., Seeburg, T. J., Grunfeld, C., Rosen, O. M., and Ramachandran, J. (1985) Nature 313, mIR and mIGFIR context. The clear conclusion from these 756 –761 chimeric receptors is that the C terminus of IRRR abolishes 2. Ebina, Y., Ellis, L., Jarnagin, K., Edery, M., Graf, L., Clauser, E., Ou, J.-H., binding of insulin and IGFI. This is somewhat surprising be- Masiarz, F., Kan, Y. W., Goldfine, I. D., Roth, R. A., and Rutter, W. J. (1985) Cell 40, 747–758 cause only four of the residues in the C-terminal region (IR 3. Ullrich, A., Gray, A., Tam, A. W., Yang-Feng, T., Tsubokawa, M., Collins, C., residues 704 –719) are different from corresponding positions of Henzel, W., Le Bon, T., Kathuria, S., Chen, E., Jacobs, S., Francke, U., both IR and IGFIR (Fig. 1C). One of these four residues, ala- Ramachandran, J., and Fujita-Yamaguchi, Y. (1986) EMBO J. 5, 2503–2512 nine 694, has been shown by alanine scanning mutagenesis to 4. Shier, P., and Watt, V. M. (1989) J. Biol. Chem. 264, 14605–14608 be acceptable at corresponding position 712 in IR (19). 5. Lee, J., and Pilch, P. F. (1994) Am. J. Physiol. 266, C319 –C334 6. Tavare ´ , J. M., and Siddle, K. (1993) Biochim. Biophys. Acta 1178, 21–39 Chimeric receptors between IR and IRRR have been de- 7. Scha ¨ ffer, L., and Ljungqvist, L. (1992) Biochem. Biophys. Res. Commun. 189, scribed previously, Zhang and Roth (26) found that a chimeric 650 – 653 receptor with the extracellular domain of IR and the kinase 8. Sparrow, L. G., McKern, N. M., Gorman, J. J., Strike, P. M., Robinson, C. P., Bentley, J. D., and Ward, C. W. (1997) J. Biol. Chem. 272, 29460 –29467 domain of IRRR exhibited high affinity insulin binding and 9. Bajaj, M., Waterfield, M. D., Schlessinger, J., Taylor, W. R., and Blundell, T. insulin-stimulated tyrosine kinase activity. They also made a (1987) Biochim. Biophys. Acta 916, 220 –226 chimeric receptor with the cysteine-rich region of IR (exon 3) 10. Ward, C. W., Hoyne, P. A., and Flegg, R. H. (1995) Proteins Struct. Func. Genet. 22, 141–153 replaced with the homologous region of IRRR that was shown 11. Garrett, T. P., McKern, N. M., Lou, M. Z., Frenkel, M. J., Bentley, J. D., to bind insulin with affinity similar to that of wild type IR; Lovrecz, G. O., Elleman, T. C., Cosgrove, L. J., and Ward, C. W. (1998) however, when replacing both exon 2 and exon 3 of IR with Nature 394, 395–399 12. Kristensen, C., Wiberg, F. C., Scha ¨ ffer, L., and Andersen, A. S. (1998) J. Biol. IRRR domains, no binding of insulin was detected (27). Chem. 273, 17780 –17786 The chimeric mini-receptors show that replacing the C-ter- 13. Kristensen, C., Andersen, A. S., Hach, M., Wiberg, F. C., Scha ¨ ffer, L., and Kjeldsen, T. (1995) Biochem. J. 305, 981–986 minal domain of IR with the corresponding domain of IGFIR 14. Andersen, A. S., Kjeldsen, T., Wiberg, F. C., Christensen, P. M., Rasmussen, only has minor effect on ligand binding. This is also true for J. S., Norris, K., Møller, K. B., and Møller, N. P. H. (1990) Biochemistry 29, mIGFIR with the C terminus of IR. So within IR and IGFIR, 7363–7366 15. Schumacher, R., Mosthaf, L., Schlessinger, J., Brandenburg, D., and Ullrich, the C-terminal domains are interchangeable in terms of ligand A. (1991) J. Biol. Chem. 266, 19288 –19295 binding, suggesting that this domain is part of the common 16. Wedekind, F., Baer-Pontzen, K., Bala-Mohan, S., Choli, D., Zahn, H., and binding site of these receptors. Brandenburg, D. (1989) Biol. Chem. Hoppe-Seyler 370, 251–258 17. Williams, P. F., Mynarcik, D. C., Yu, G. Q., and Whittaker, J. (1995) J. Biol. We have previously characterized ICP, which consists of Chem. 270, 3012–3016 insulin with IGFI C-domain, against various IR and IGFIR. 18. Kurose, T., Pashmforoush, M., Yoshimasa, Y., Carroll, R., Schwartz, G. P., Burke, G. T., Katsoyannis, P. G., and Steiner, D. F. (1994) J. Biol. Chem. The conclusion was that ICP binds with high affinity to IR 269, 29190 –29197 (55–113% of insulin) and with 19 –28% of IGFI affinity to 19. Mynarcik, D. C., Yu, G. Q., and Whittaker, J. (1996) J. Biol. Chem. 271, IGFIR (13). Here we get similar results for relative binding 2439 –2442 20. Mynarcik, D. C., Williams, P. F., Scha ¨ ffer, L., Yu, G. Q., and Whittaker, J. affinities for mini-receptors. The affinity of ICP for mIR and (1997) J. Biol. Chem. 272, 18650 –18655 IRD703 was not different from the affinity of insulin. For mIG- 21. Kjeldsen, T., Andersen, A. S., Wiberg, F. C., Rasmussen, J. S., Scha ¨ ffer, L., FIR, the affinity of ICP was 16% of IGFI, and thus previous Balschmidt, P., Møller, K. B., and Møller, N. P. H. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4404 – 4408 conclusions that the C-domain of IGFI is a major determinant 22. Waugh, S. M., and Pilch, P. F. (1989) Biochemistry 28, 2722–2727 of IGFIR specificity for IGFI is true also for the minimized 23. Blum, W. F., Jenne, E. W., Reppin, F., Kietzmann, K., Ranke, M. B., and Bierich, J. R. (1989) Endocrinology 125, 766 –772 IGFIR. 24. Pashmforoush, M., Yoshimasa, Y., and Steiner, D. F. (1994) J. Biol. Chem. 269, Based on the chimeric mini-receptors, we conclude that the 32639 –32648 C-terminal domain of IRRR abolishes binding of ligand and 25. Andersen, A. S., Kjeldsen, T., Wiberg, F. C., Vissing, H., Scha ¨ ffer, L., Rasmussen, J. S., De Meyts, P., and Møller, N. P. H. (1992) J. Biol. Chem. that swapping of C-terminal sequences from IR to IGFIR or 267, 13681–13686 vice versa does not influence ligand binding dramatically, indi- 26. Zhang, B., and Roth, R. A. (1992) J. Biol. Chem. 267, 18320 –18328 cating that this region is part of the common binding site in 27. Zhang, B., and Roth, R. A. (1991) Biochem. 30, 5113–5117

Journal

Journal of Biological Chemistry – Unpaywall

Published: Dec 1, 1999

There are no references for this article.