Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Activation of the Discoidin Domain Receptor 2 Induces Expression of Matrix Metalloproteinase 13 Associated with Osteoarthritis in Mice *♦

Activation of the Discoidin Domain Receptor 2 Induces Expression of Matrix Metalloproteinase 13... THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 280, No. 1, Issue of January 7, pp. 548 –555, 2005 © 2005 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Activation of the Discoidin Domain Receptor 2 Induces Expression of Matrix Metalloproteinase 13 Associated with Osteoarthritis in Mice* Received for publication, September 24, 2004, and in revised form, October 25, 2004 Published, JBC Papers in Press, October 27, 2004, DOI 10.1074/jbc.M411036200 ¶   ¶ Lin Xu‡§, Haibing Peng§ , Dongying Wu , Kenpan Hu , Mary B. Goldring , Bjorn R. Olsen‡ , and Yefu Li ** From the ‡Department of Cell Biology, Harvard Medical School, Boston, Massachusetts 02115, the Division of Rheumatology, Beth Israel Deaconess Medical Center and New England Baptist Bone and Joint Institute, Harvard Institutes of Medicine, Boston, Massachusetts 02115, and the Department of Oral and Developmental Biology, Harvard School of Dental Medicine, Boston, Massachusetts 02115 eases with different etiologies but with a similar clinical out- Human genetic studies indicate that mutations in type IX and XI collagens result in early-onset osteoarthritis come. Although the causes of OA are diverse, mutations in (OA) with a wide spectrum of osteochondrodysplasia. cartilage specific collagen genes have been identified in human However, a convincing causal chain of events underly- familial OA associated with a wide range of osteochondrodys- ing the role of these collagen mutations in the pathogen- plasia, from mild to lethal forms (4 –7). In particular, mutations esis of OA has not been elucidated. Here we show that in type IX or XI collagens are associated with early-onset OA the expression of a cell surface collagen receptor, dis- (8 –10). Mutations in genes encoding type IX collagen, COL9A1, coidin domain receptor 2 (DDR2), is increased in chon- COL9A2, and COL9A3, cause multiple epiphyseal dysplasia drocytes of the articular cartilage of knee joints in mice and intervertebral disc disease in humans. Multiple epiphyseal that develop OA as a result of a heterozygous mutation dysplasia is a milder dysplasia of the epiphyses of peripheral in type XI collagen. At the same time point, 6 months, we joints that is characterized by cartilage degeneration resulting also found increased expression and activity of matrix in early-onset OA. One of the clinical features of intervertebral metalloproteinase 13 (MMP-13) in the mutant mouse disc disease is the degeneration of the articular cartilage of the knee cartilage. The expression of both DDR2 and discs. Interestingly, the amount of type IX collagen is reduced MMP-13 was increased in chondrocytes cultured on in aged people (11), in whom there is high incidence of OA. In plates coated with native type II collagen but not on humans, mutations in genes for type XI collagen, COL11A1 gelatin, and overexpression of DDR2, but not of a trun- and COL11A2, have also been identified in several forms of cated form, was found to induce the expression of familial OA (12). A reduced amount of type XI collagen is also MMP-13 when chondrocytes were cultured on type II found in aged people (11). The pathogenetic mechanisms un- collagen but not on plastic. The DDR2-induced expres- derlying the OA due to these collagen mutations are largely sion of MMP-13 appears to be specific, since we did not unknown. observe induction of MMP-1, MMP-3, MMP-8, ADAMTS-4, ADAMTS-5, and IL-1 transcripts in human chondrocytes We have used a mouse model of chondrodysplasia (cho)to or Mmp-3, Mmp-8, Adamts-4, Adamts-5, and Il-1 in mouse investigate how mutations in type XI collagen cause an OA-like chondrocytes. Our data suggest that the defect in the pathology. We found previously that the cho phenotype is due cartilage matrix of mice that are heterozygous for a type to a single nucleotide deletion leading to frameshift and pre- XI collagen mutation (cho/) permits activation and up- mature termination of translation of the 1 chain of type XI regulation of DDR2 in chondrocytes. This could be due collagen (13). Electron microscopy of the articular cartilage of to increased exposure of chondrocytes to type II colla- knee joints in heterozygous mutant (cho/) mice shows thick gen as a result of the decreased amount of type XI col- collagen fibrils (14), which is one of the early clinical charac- lagen in the mutant cartilage. The specific induction of teristics of human OA (15). The cho/ mice (homozygous cho/ MMP-13 by DDR2 in response to its cartilage-specific cho mice die at birth) reveal OA-like changes in their knee and ligand, type II collagen, may contribute to cartilage temporomandibular joints, starting at the age of 3 months, damage in hereditary OA. without other apparent skeletal abnormalities (14). We have also found increased protein expression of matrix metallopro- teinase-3 (MMP-3, stromelysin) and MMP-13 (collagenase 3) in Osteoarthritis (OA), the most common form of human ar- thritis (1–3), is considered a group of overlapping distinct dis- knee articular cartilage of cho/ mice, which is consistent with a recent study of human OA cartilages (16). Although a hered- * This work was supported by National Institutes of Health Grants itary defect in type XI collagen is not responsible for most forms P01-AR050245 (to Y. L.), R01-AR36819 (to B. R. O. and L. X.), and of human OA, disruption of matrix composition in cho/ mice R01-AR45378 and R01-AG22021 (to M. B. G.). The costs of publication results in the loss of joint stability and associated biochemical of this article were defrayed in part by the payment of page charges. alteration that mimics human OA. An additional advantage of This article must therefore be hereby marked “advertisement”inac- cordance with 18 U.S.C. Section 1734 solely to indicate this fact. the cho/ mouse is that the degradation of joint structures This article was selected as a Paper of the Week. occurs postnatally with gradual changes throughout the life § These authors contributed equally to this work. span of the mouse. ** To whom correspondence should be addressed: 188 Longwood Ave., MMPs constitute a group of zinc-dependent proteinases that Boston, MA 02115. Tel.: 617-432-1835; Fax: 617-432-3221; E-mail: [email protected]. The abbreviations used are: OA, osteoarthritis; MMP, metallopro- teinase; DDR, discoidin domain receptor; PBS, phosphate-buffered sa- line; DMEM, Dulbecco’s modified Eagle’s medium. 548 This paper is available on line at http://www.jbc.org This is an Open Access article under the CC BY license. Activation of Discoidin Domain Receptor 2 and Osteoarthritis 549 and 0.2 unit/ml instead of the homogenates, were added. Each homo- are involved in remodeling of extracellular matrices in most genate was analyzed in triplicate. Fluorescence was measured using tissues. MMP-1 (collagenase-1) and MMP-8 (collagenase-2), as the LJL Analysts microplate reader with excitation at 485  10 nm and well as MMP-3 and MMP-13 function during cartilage devel- emission detection at 530  10 nm. Relative proteinase activity was opment, postnatal growth, and homeostasis to cleave triple- calculated against the standard plot. helical type II collagen and degrade proteoglycans in articular Examination of mRNA Levels of Matrix-degrading Enzymes in Knee cartilage (17, 18). Aggrecanases, particularly ADAMTS-4 (ag- Articular Cartilages of cho/ Mice—Knee articular cartilages from six cho/ or six wild-type mice at the ages of 3 or 6 months were collected, grecanase-1) and ADAMTS-5 (aggrecanase-2), are also impor- and the cartilages from the cho/ or wild-type littermates were pooled tant matrix-degrading proteinases in the cartilage matrix (19, together for the isolation of total RNAs using the total RNA isolation 20). All of these proteinases are expressed at relatively low system (Promega, Madison, WI). The cDNA was synthesized with oli- levels in normal articular cartilage. However, a number of go(dT) primer using the Super-Script first-strand synthesis system studies have demonstrated that expression of these enzymes is (Clontech). Real-time PCR conditions were optimized for maximal PCR increased in localized regions of human OA articular cartilage efficiency by the adjustment of concentrations of the following PCR primers: Mmp-3, CCTACTTCTTTGTAGAGGAC (forward) and GTCA- and that MMP-13 may be a particularly critical enzyme in the AATTCCAACTGCGAAG (reverse); Mmp-8, GTAAACTGTAGAGTCG- degradation of type II collagen in articular cartilage (21, 22). ATGC (forward) and CATAGGGTGCGTGCAAGGAC (reverse); Mmp- This is consistent with the OA-like changes in knee joints of 13, GTGTGGAGTTATGATGATGT (forward) and TGCGATTACTCCA- mice that constitutively express MMP-13 in cartilage (23). GATACTG (reverse); Adamts-4, GCAACGCAGGGCAGAGATAC (for- Given the known ability of these enzymes to degrade major ward) and CATCTGTGTTTTAGCAGGAG (reverse); Adamts-5, ACCG- components of cartilage matrix, it is likely that their expression TGCAGTGCCAGGATGG (forward) and GGTGACAATGACATGA- AGGC (reverse); Il-1, GAATCTATACCTGTCCTGTG (forward) and TT- in chondrocytes is tightly regulated. ATGTCCTGACCACTGTTG (reverse); Gapdh, ACTGAGGACCAGGT- The discoidin domain receptors 1 (DDR1) and 2 (DDR2) were TGTC (forward) and TGCTGTAGCCGTATTCATTG (reverse). identified in humans and mice as cell surface receptor tyrosine Four different combinations of primers were tested, forward (nM)/ kinases (24 –27). The mRNA transcripts of the receptors are reverse (nM): 200/200, 200/600, 600/200, and 600/600. The optimum detected in several human and mouse tissues, such as bone, concentrations of the primers for each gene were: Mmp-3, 200/200; cartilage, skin, skeletal muscle, brain, and heart. Two research Mmp-8, 200/600; Mmp-13, 600/600; Adamts-4, 200/200; Adamts-5, 200/ 200; Il-1, 200/200; and Gapdh, 200/200. PCR was performed using 25 l groups reported in 1997 that native collagens were the DDR of 1 PCR buffer containing 50 mM KCl, 3 mM MgCl , 200 nM dNTPs, ligands (28, 29). Interestingly, a synthetic short triple-helical each primer at 200 nM or 600 nM,1 SYBR Green, 0.5 unit of TaqDNA collagen-like peptide (10 repeat of Gly-Pro-Hyp) was not able to polymerase (Qiagen), and 0.5 l of cDNA. Real-time PCR was per- activate DDRs. Studies of Ddr1-deficient mice suggest that formed using the Icycler iQ detection system (Bio-Rad), and the PCR Ddr1 plays a key role in mammary gland development and reaction was carried out at 95 °C for 3 min followed by 50 cycles of 95 °C arterial wound repair (30, 31). Ddr2-deficient mice exhibit for 30 s, 60 °C for 30 s, and 72 °C for 30 s, with a final extension at 72 °C for 4 min. At the end of the PCR cycles, a melting curve, using a short stature and a delay in the healing of skin wounds (32). temperature range between 55 and 95 °C with 0.5 °C intervals, was Activation of DDR2 by type I collagen increases the level of generated to test the specificity of the PCR product. A cDNA sample in MMP-1 in the human fibrosarcoma cell line HT 1080 (28). each experiment was tested in triplicate and each experiment was Up-regulation of DDR2 is associated with overexpression of performed twice. We used Gapdh as internal control. The efficiency of MMP-1 in synovial fibroblasts from rheumatoid arthritis PCR represented by a standard curve was also tested by plotting the patients (33). amount of PCR product versus the known amount of a template, 0.001, 0.01, 0.1, 1, and 10 ng. In theory, when the slope of the standard curve Because type XI collagen is an integral component of the type is 3.322, the efficiency of PCR is considered 100%. In these experi- II collagen fibrils in cartilage, we reasoned that the cho muta- ments, the efficiency reached 90% or higher. tion may result in a disruption of the collagen network in Examination of Degraded Type II Collagen in Articular Cartilage of cartilage matrix and enhance the interaction between chondro- cho/ Mice—Three knees from cho/ or wild-type mice at the ages of 3 cytes and type II collagen molecules. We report here that the and 6 months were collected for cryosection. The samples were fix in 4% expression of Ddr2, a cell surface receptor interacting specifi- paraformaldehyde at 4 °C overnight, followed by embedding in OCT for sectioning. Sections of 10 m were cut and incubated with polyclonal cally with native fibrillar collagen rather than with other ma- antibody C1-2C (IBEX Tech. Inc., Montreal, Quebec, Canada), which trix components such as fibronectin, proteoglycans, or cartilage recognizes the neoepitope in degraded type II collagen produced by oligomeric matrix protein (COMP) is increased in the articular collagenase cleavage. The samples were incubated with biotinylated cartilage of knee joints in cho/ mice. Studies in vitro indicate secondary antibody for the color detection. A negative control, staining that up-regulation and activation of DDR2 by native type II without primary antibody, was also performed. collagen can specifically induce the expression of MMP-13 by Transmission Electron Microscopy—A detailed experimental proce- dure has been described in the previous publication (14). Briefly, two chondrocytes. We also show that the increased expression of knee joints each from 1-month-old cho/ mice and two knee joints each Ddr2 and Mmp-13 is associated with type II collagen degrada- from their normal littermates were obtained. The articular cartilage of tion in adult cho/ mice. Our data suggest a mechanism, in- the joints was exposed, and specimens were fixed in Karnovsky’s solu- volving Ddr2 signaling and increased expression of this recep- tion with 4% gluteraldehyde overnight at room temperature. The sam- tor tyrosine kinase, for destruction of the collagen network in ples were then processed for ultra-thin (95 nm) sectioning. Ultra-thin articular cartilage leading to the age-dependent and progres- sections from each sample were examined, and multiple locations in each section were randomly selected for photographs. sive OA-like pathology in cho/ mouse joints. Immunohistochemical Staining for Collagen Receptors—Immunohis- EXPERIMENTAL PROCEDURES tochemical experiments were performed to characterize the expression Analysis of Proteinase Activity in Extracts of Knee Articular Cartilage of Ddr1, Ddr2,  integrin, and annexin V in the articular cartilage of of cho/ and Wild-type Mice—Articular cartilage samples were dis- knee joints from cho/ and wild-type mice. Three knee joints from sected from the knee joints of 12 cho/ and 12 wild-type mice at the age different cho/ mice and three knee joints from different wild-type of 3 or 6 months. We used an EnzChek gelatinase/collagenase assay kit littermates at the ages of 3 or 6 months were used. The samples were (Molecular Probes, Inc., Eugene, OR) to assay for metalloproteinase fixed in 4% paraformaldehyde in PBS overnight at 4 C and embedded activity (38). The articular cartilage samples were pooled from 12 ani- in paraffin. Serial sections of 8 m were cut from the medial side to the mals from cho/ or wild-type mice at each age and homogenized in a lateral side. From each joint, four sets of 12 evenly spaced paraffin buffer containing 100 mg (wet weight)/ml. 100 l of the homogenates, sections were collected for staining. The sections were deparaffinized, 80 lof1 reaction buffer, and 20 l of DQ gelatin solution were added quenched for endogenous peroxidase activity, and treated with hyalu- to each well of a 96-well plate for the analysis. For a negative control, ronidase. One set of the sections was incubated with an antibody in PBS 100 lof1 reaction buffer instead of the homogenates, and for a solution at 4 °C overnight. Antibodies, against human DDR1 (catalog standard curve plot, 100 l of different enzyme dilutions at 0.05, 0.1, number sc-7553), human DDR2 (catalog number sc-7554), human 1 550 Activation of Discoidin Domain Receptor 2 and Osteoarthritis integrin (catalog number sc-8978), and human annexin V (catalog num- ber sc-8300) were purchased from Santa Cruz Biotechnology and used to analyze serial sections. The sections were washed with PBS three times followed by treatment with biotinylated secondary antibody. Color detection was performed with peroxidase substrate after incuba- tion with a mixture of avidin and biotinylated horseradish peroxidase. Staining without primary antibody was performed as a negative control. Analysis of Ddr2 mRNA Levels in Mouse Articular Cartilage—The experimental procedure was as described above using the following PCR primers for Ddr2,5-CTGTCGGATGAGCAGGTTAT-3 (forward) and 5-CTCGGCTCCTTGCTGAAGAA-3 (reverse), at the concentra- tion of 200 nM/200 nM. FIG.1. Matrix metalloproteinase activity in articular cartilage Chondrocyte Cultures—Primary costochondral chondrocytes were of mouse knee joints. Articular cartilages were obtained from knee isolated from 2-week-old C57BL mice and cultured as described in a joints of 12 cho/ and 12 wild-type littermates in each age group of 3 previous study (39). The immortalized human chondrocyte cell line, and 6 months. The matrix metalloproteinase activity in homogenates C-28/I2, obtained after infection of juvenile costal chondrocytes with a was increased about 2-fold (left panel) and 6-fold (right panel)in cho/ neomycin-resistant retroviral vector encoding SV40 virus large T-anti- mice at the ages of 3 and 6 months, respectively, compared with wild- gen, selection in G418 and cloning (40) were cultured in Dulbecco’s type littermates. modified Eagle’s medium (DMEM)/Ham’s F-12 (1/1, v/v; Invitrogen) containing 10% fetal calf serum. The cells were cultured in 5% CO at 2 EndoFree plasmid maxi-kit (Qiagen). 37 °C and passaged at a ratio of 1:8 at 95% confluence every 5 to 6 Transient transfection experiments were carried out in human days. For preparation of culture plates, type II collagen from chicken C-28/I2 cells using Lipofectamine PLUS™ Reagent (Invitrogen). Cells sternal cartilage (catalog number C-9301, Sigma) was dissolved in were seeded 24 h prior to transfection in 6-well plates at 3.5  10 0.25% acetic acid at a concentration of 1 mg/ml and used to coat 6-well cells/well in DMEM/F-12 containing 10% fetal calf serum. For each well, plates. We also prepared plates coated with denatured type II collagen 200 ng of plasmid construct, 6 l of PLUS reagent, and 92 lof (gelatin) and re-natured type II collagen as follows. The type II collagen serum-free DMEM/F-12 were mixed and incubated for 15 min at room solution (1 mg/ml) was heated at 70 °C for 45 min, and one-half of the temperature. Lipofectamine PLUS reagent (4 l) in 100 l of serum- denatured type II collagen was used to coat 6-well plates. The other half free medium was then added to each reaction mixture, and incubation of the denatured collagen preparation was left at room temperature was continued for an additional 30 min at room temperature. Finally, overnight to generate renatured type II collagen and then used for the transfection mixture was combined with 800 l of serum-free me- coating of 6-well plates. A portion (200 l) of each sample, including dium, and the lipid-nucleic acid complex was transferred to the washed native (commercial), denatured, and renatured type II collagens, was cell monolayer in each well. After incubation for4hat37 °C,the subjected to SDS-PAGE to confirm the quality of the preparation. For transfection mix was diluted with an equal volume of DMEM/F-12 experiments, culture plates coated with the various collagen prepara- containing 20% fetal calf serum, and incubation was continued for 24 h tions and non-coated plates (controls) were seeded with either mouse or to permit expression of the wild-type and truncated DDR2 cDNAs. The human chondrocytes. The cells were cultured in DMEM/Ham’s F-12 cells were then scraped and transferred to 6-well plates without or with (1/1, v/v; Invitrogen) containing 10% fetal calf serum for 12 or 24 h. For coating with type II collagen and incubations were continued for 24 h. real-time PCR, cells from 3 wells for each experimental condition were The levels of MMP-1, MMP-3, and MMP-13 mRNA were examined by pooled and collected for total RNA isolation and real-time PCR analysis. real-time PCR, and the PCR conditions were the same as those de- The cDNA was synthesized with oligo(dT) primer. PCR conditions were scribed above. GAPDH was used as internal control. optimized by the adjustment of concentrations of the following PCR Treatment of Chondrocyte Cultures with Protein Kinase Inhibitors— primers for each human gene (see above for mouse genes): DDR2, The C-28/I2 cells were cultured in type II collagen-coated 10-cm plates CTCCCAGAATTTGCTCCAG (forward) and GCCACATCTTTTCCT- for 4 h allowing the cells to adhere. Protein kinase inhibitors were GAGA (reverse); MMP-1, GCCACAAAGTTGATGCAGTT (forward) and added as follows: 1) MEK inhibitor, PD98059 at 10 M (from CALBIO- GCAGTTGAACCAGCTATTAG (reverse); MMP-3, ACTGTGATCCT- CHEM); 2) phosphatidylinositol 3-kinase/Akt inhibitor, Wortmannin at GCTTTGTCC (forward) and ACGCCTGAAGGAAGAGATGG (reverse); 25 nM (from Calbiochem); and 3) JAK2 inhibitor, AG490 at 10 M (from MMP-8, GTTTTCCAGCAAGAACATTT (forward) and AACTTCCCT- Calbiochem). No protein kinase inhibitor was added to control cultures. TCAACATTCTG (reverse); MMP-13, GCTGCCTTCCTCTTCTTGAG Incubations were carried out for 24 h, and the cells were washed twice (forward) and TGCTGCATTCTCCTTCAGGA (reverse); ADAMTS-4, with cold PBS and harvested for RNA extraction. GCACCGAAGAGCACAGATTC (forward) and ATGAGGCAGCAACA- GAAGC (reverse); ADAMTS-5, GAAGTTAGCAAAAGGATGTC (for- RESULTS ward) and TTCTGTGCGTTAGGTAGACC (reverse); IL-1, CAACTGG- Age-related Increase in Matrix Metalloproteinase Activity in TACATCGACACCT (forward) and GGGATTGAGTCCACATTCAG Articular Cartilage of Knee Joints in cho/ Mice—To determine (reverse); GAPDH, TTCGACAGTCAGCCGCATCTTCTT (forward) and whether the age-related articular cartilage destruction that we CAGGCGCCCAATACGACCAAATC (reverse). The optimum concentrations of the primers for the genes were: previously observed in cho/ mice was associated with in- DDR2, 200/200, MMP-1, 200/200; MMP-3, 200/200; MMP-8, 200/600; creased activities of cartilage-degrading proteinases, we ana- MMP-13, 600/600; ADAMTS-4, 600/200; ADAMTS-5, 200/200; IL-1, lyzed metalloproteinase activity in extracts of articular carti- 200/200; and GAPDH, 200/200. The PCR was performed as described lage from knee joints. Using a fluorescent substrate to detect above. combined collagenase/gelatinase activity, we found that metal- Transient Overexpression of Full-length and Truncated DDR2—To loproteinase activity was increased about 2-fold at the age of 3 generate full-length cDNA of human DDR2, total RNA was isolated from the human chondrocyte C-28/I2 cell line. The cDNA was synthe- months in cho/ mouse articular cartilage compared with car- sized using the oligo(dT) primer. The primers for the PCR were de- tilage from wild-type littermates (Fig. 1, left panel). At the age signed according to the published human DDR2 sequence. The 5-end of of 6 months, metalloproteinase activity was increased about the forward primer was designed with a KpnI site, 5-ggggtaccccagat- 6-fold in articular cartilage of cho/ mice compared with wild- gatcctgattccca-3, and the 5-end of the reverse primer was designed type littermates (Fig. 1, right panel). These results indicate with an EcoRI site, 5-ggaattccctgacagcatcactcgtc-3. After amplifica- that the age-related articular cartilage destruction observed in tion, the PCR product was subcloned into the expression vector pcDNA3.1 (Invitrogen). The truncated cDNA of DDR2, containing only cho/ mice is associated with increased metalloproteinase the extracellular and transmembrane domains, was obtained using the activity. following PCR primers, which were designed with BstXI sites at the Age-related Increase of Mmp-13 mRNA Level in Articular 5-ends: forward primer, 5-ccaaaaaaatggatgatcctgattccca-3 and re- Cartilage of cho/ Mice—To determine more specifically which verse primer, 5-ccaaaaaaatggtgggctggactggcttcaca-3. The sequences of matrix-degrading enzymes are up-regulated in the articular the constructs were confirmed by DNA sequencing. Expression vectors cartilage of knee joints in cho/ mice, we examined the levels of containing either the full-length or the truncated human DDR2 were prepared and purified for transfection into chondrocytes using the Mmp-3, Mmp-8, Mmp-13, Adamts-4, and Adamts-5 mRNAs Activation of Discoidin Domain Receptor 2 and Osteoarthritis 551 FIG.3. Immunostaining of type II collagen degradation. Cryo- sections from three cho/ mice and three wild-type littermates at the ages of 3 and 6 months were stained using a polyclonal antibody against FIG.2. The mRNA levels of matrix-degrading enzymes in ar- the degraded type II collagen. More intense staining in cho/ sections ticular cartilage of mouse knee joints. Total RNA was isolated from than in wild-type sections at the age of 6 months is indicated by the six cho/ and six wild-type littermates at the ages of 3 or 6 months. The arrows. Bar  50 m. levels of mRNAs coding for matrix-degrading enzymes were measured by real-time PCR. The level of Mmp-13 mRNA was elevated about 3-fold in cho/ mice at the age of 6 months compared with their wild-type As shown in Fig. 4B (top panels), increased numbers of Ddr2- littermates (right panel) but not at 3 months (left panel). The level of positive cells were observed in the articular cartilage of cho/ Mmp-3 mRNA was the same at the ages of 3 months (the left panel) and mice at the age of 6 months compared with wild-type mice, 6 months (the right panel). Mmp-8 was unchanged in 3 months and whereas no difference could be detected at 3 months (data not undetectable in 6 months. Values representing levels in wild-type mice shown). There was no difference observed in the staining in- were set at 1.0. tensity of annexin V when cho/ and wild-type mice were using real-time PCR. We also examined interleukin-1 (Il-1) compared at either age (Fig. 4B, lower panels). Ddr1 and mRNA, since Il-1 may be associated with increased cartilage integrins were barely detected by immunohistochemistry at degradation in this model. Real-time PCR analysis of cartilage both ages, and no difference could be detected between cho/ extracts showed that the mRNA level of Mmp-13 was increased and wild type mice (data not shown). 3-fold in cho/ mice at the age of 6 months; no difference To determine whether the increased protein expression of between mutant and wild-type mice was seen at 3 months (Fig. Ddr2 was due to increased gene expression, we examined the 2). In contrast, the mRNA levels of the other proteinases tested level of Ddr2 mRNA in mice at the ages of 3 and 6 months by were either not increased (Mmp-3) or undetectable (Mmp-8)in real-time PCR. As shown in Fig. 4C, the level of Ddr2 mRNA in articular cartilage from cho/ mice compared with wild-type cho/ knee joints was not increased at the age of 3 months, but littermates at the age of 6 months. These results suggest that it was increased 3-fold compared with wild-type mice at the age Mmp-13 may be a major factor contributing to the age-related of 6 months. These data indicate that the expression of Ddr2 in articular cartilage degradation in cho/ knee joints. the articular cartilage of cho/ knee joints at 6 months of age Increased Degradation of Type II Collagen in Articular Car- is increased at both the mRNA and protein levels. tilage of cho/ Mice—To understand whether the high-level Increased DDR2 and MMP-13 mRNA Levels in Chondrocytes expression of Mmp-13 in articular cartilage of cho/ mice re- Cultured on Type II Collagen-coated Plates—Since fibrillar col- sults in the increased activity of the enzyme, we examined the lagens are known to activate DDR2 and thereby induce expres- degraded type II collagen in the articular cartilage by immu- sion of a metalloproteinase (MMP-1) (28, 29), we performed in nostaining using an antibody that recognizes the carboxyl ter- vitro experiments to determine the effects of culturing chon- minus of the three-quarter fragment produced by collagenase drocytes on type II collagen-coated plates on the expression of activity. There was no difference in degraded type II collagen at matrix-degrading enzymes. Mouse cells with phenotypic char- the age of 3 months in cho/ mice compared with wild-type acteristics of chondrocytes, including polygonal morphology mice (data not shown). However, more degraded type II colla- and extracellular matrix staining by Alcian blue, were obtained gen molecules (brown color staining) were observed in cho/ from costal cartilage. Col2a1 mRNA was detected in cultured mice at the age of 6 months (Fig. 3). We noticed that more mouse chondrocytes by RT-PCR, whereas Col10a1 mRNA, a degraded type II collagen appeared in the pericellular matrix. marker for hypertrophic chondrocytes (34), was absent, indi- These data suggest that the collagenase activity of Mmp-13 is cating that the cells in the cultures were proliferating, nonhy- increased in cho/ mice. pertrophic chondrocytes. The immortalized human chondro- Altered Ultrastructure of Extracellular Matrix and Expres- cyte cell line, C-28/I2, was also used as a model to further sion of a Collagen Receptor in Articular Cartilage of cho/ experiments to study mechanisms. We prepared culture plates Mice—Altered contact between type II collagen fibrils and a coated with native type II collagen and used non-coated plates collagen receptor on chondrocytes may play a role in initial as controls. and/or progression in OA pathogenesis, at least in the case of Real-time PCR analysis demonstrated that the level of hereditary OA caused by type IX and type XI collagen muta- MMP-13 mRNA was elevated about 5-fold in human chondro- tions. In the articular cartilage of wild-type mouse knee joints, cytes cultured on type II collagen for 24 h (Fig. 5A). However, we observed some type II collagen fibrils around the chondro- the level of MMP-1 mRNA was not increased above the low con- cytes, but more fibrils are located in the interterritorial region stitutive level. The mRNAs for MMP-3, MMP-8, ADAMTS-4, (Fig. 4A, bottom panel). In contrast, the increased number of ADAMTS-5, and IL-1 were not detectable. Surprisingly, we thick type II collagen fibrils were concentrated in the pericel- found that the level of DDR2 mRNA in human chondrocytes lular region in cho/ mice (Fig. 4A, top panel). These results was also increased (about 6-fold) after incubation on collagen suggest the possibility that the exposure of chondrocytes to for 24 h. In mouse chondrocytes, Mmp-13 and Ddr2 mRNA type II collagen fibrils in the pericellular matrix is enhanced in levels were increased about 7- and 8-fold, respectively, in cells cho/ mice. cultured in type II collagen-coated wells for 24 h compared with To determine whether the expression of collagen receptors on cells cultured in non-coated wells (Fig. 5B). The level of Mmp-3 chondrocytes is affected by the cho/ mutation, we examined mRNA was not increased. The mRNAs for Mmp-8, Adamts-4, the protein expression of three different types of collagen re- Adamts-5, and Il-1 were not detectable in cultured mouse chon- ceptors, Ddr1 and Ddr2, integrins, and annexin V, in the drocytes. These results indicate that chondrocytes exposed to articular cartilage of knee joints at the ages of 3 and 6 months. native type II collagen for 24 h are induced to express increased 552 Activation of Discoidin Domain Receptor 2 and Osteoarthritis FIG.4. Comparison of cartilage from cho/ and wild-type mice. A, ul- trastructure of extracellular matrix in ar- ticular cartilage of mouse knee joints. Two knee joints from different cho/ mice and two knee joints from different normal littermates at the age of 1 month old were obtained for transmission electron mi- croscopy. In ultra-thin sections, there is an increased number of thick type II col- lagen fibers in close contact with chondro- cyte cell membranes in cho/ mice (see the cross-section of the fibrils indicated by arrows at the top panel) compared with wild-type littermates (see the space be- tween the cell membrane and the fibrils indicated by arrows at the bottom panel). Bar  500 nm. B, expression of collagen receptors in articular cartilage of mouse knee joints. Immunostaining shows in- creased numbers of cells staining positive for Ddr2 (brown color) in the articular cartilage of cho/ mice at the age of 6 months (top panels). Annexin V can be detected at 6 months, but the staining intensities in cho/ and wild-type mice are similar (lower panels). Bar  50 m. C, the levels of Ddr2 mRNA in the artic- ular cartilage of cho/ and wild-type mice. The level of Ddr-2 mRNA was ele- vated 3-fold in the cartilage of cho/ mice at the age of 6 months, but not at 3 months, compared with their wild-type littermates. levels of DDR2 and MMP-13 mRNA. The absence of induction to denatured (gelatin) and renatured type II collagen. Culture at 12 h suggests that the response requires early cellular on denatured collagen had no effect on levels of expression of events such as activation of gene expression and protein MMP13 and DDR2 mRNA, whereas culture on renatured type synthesis. II collagen increased the levels of DDR2 and MMP-13 mRNAs We also examined the responses of the human chondrocytes by 4- and 5-fold, respectively (Fig. 5C). These results indicate Activation of Discoidin Domain Receptor 2 and Osteoarthritis 553 FIG.5. Induction of DDR2 and MMP-13 mRNA in chondrocytes cultured on type II collagen. A, analysis of mRNA levels in human chondrocytes. The mRNA levels of DDR2, MMP1, and MMP13 were FIG.6. Response of human chondrocytes to transient overex- detected but not increased in C-28/I2 cells cultured in collagen-coated pression of full-length or truncated DDR2 cDNA. A, construct for plates for 12 h compared with uncoated plates. However, DDR2 and expressing full-length and truncated DDR2 cDNAs. The full-length MMP-13, but not MMP-1, mRNA levels were increased about 6- and DDR2 cDNA contained 2568 nucleotides including extracellular do- 5-fold, respectively, in chondrocytes cultured in collagen-coated plates main, 1–1200, transmembrane domain, 1201–1263, and intracellular for 24 h. B, analysis of mRNA levels in mouse chondrocytes. Ddr2 and domain, 1264 –2568. Within the cytoplasmic domain, the tyrosine ki- Mmp13 mRNA levels were increased in chondrocytes cultured for 24 h nase catalytic unit corresponds to the region 1687–2547 nucleotides. in collagen-coated plates compared with uncoated control. Mmp3 The truncated DDR2 cDNA construct does not contain the tyrosine mRNA was detected and but showed no increase. C, analysis of mRNA kinase catalytic unit. B, overexpression of full-length DDR2 or trun- levels in human chondrocytes cultured in plates with denatured (gela- cated DDR2 cDNA in human chondrocytes cultured on type II collagen. tin) or renatured type II collagen. There was no difference in the mRNA Levels of DDR2 and MMP-13 mRNA were increased in the C-28/I2 cells levels of DDR2 and MMP-13 in C-28/I2cells cultured on gelatin. How- transfected with full-length DDR2 cDNA compared with cells trans- ever, the DDR2 and MMP-13 mRNA levels were elevated about 4- and fected with the vector alone, whereas there was no change in the level 5-fold, respectively, in cells cultured on renatured type II collagen. of MMP-1 mRNA (left panel). When the chondrocytes were transfected Values representing levels in uncoated plates were set at 1.0. with the truncated DDR2 cDNA and cultured on type II collagen for 24 h, the levels of endogenous DDR2 and MMP-13 mRNA were reduced by about 60 and 65%, respectively (right panel) (note: the difference in that chondrocytes respond in a specific manner to triple-helical scale between the left and right panels). C, overexpression of full-length or truncated DDR2 cDNA in C-28/I2 cells cultured in non coated plates. type II collagen. There was no change in the MMP-13 mRNA level when cells transfected Increased MMP-13 mRNA Level in Human Chondrocytes in either with the full-length or truncated DDR2 were compared with cells Response to Transient Overexpression of Full-length DDR2 transfected with vector alone. Values representing levels in cells trans- cDNA—To better understand the cause-effect relationship be- fected with vector alone were set at 1.0. tween DDR2 and MMP-13, we transfected full-length DDR2 cDNA (Fig. 6A) into human chondrocytes and cultured the cells (lacking the cytoplasmic domain) (Fig. 6A) into human chon- on type II collagen-coated plates for 24 h. As shown in Fig. 6B, drocytes. After the transfected cells were cultured on type II left panel, the level of DDR2 mRNA was increased about 4-fold, collagen-coated plates for 24 h, the levels of endogenous DDR2 and MMP-13 mRNA was increased about 8-fold. This result and MMP-13 mRNA were reduced by about 65% compared indicates that overexpression of DDR2 and its activation by with cells transfected with vector alone (as control) (Fig. 6B, type II collagen results in induction of MMP-13 mRNA in right panel). In addition, we also found that there was no chondrocytes. change in the level of MMP-13 mRNA in human chondrocytes To further establish that the MMP-13 response is linked to transfected with the full-length or truncated DDR2 and cul- activation of DDR2, we transfected a truncated DDR2 cDNA tured on non-coated plates for 24 h (Fig. 6C). These results 554 Activation of Discoidin Domain Receptor 2 and Osteoarthritis collagen between wild-type and cho/ mice at the age of 3 months. However, the further increase in metalloproteinase activity with age in cho/ mice at the age of 6 months is associated with the easily detectable increase in Mmp-13 mRNA and protein levels. In addition, more degraded type II collagen molecules appear in cho/ articular cartilages as the consequence of a high level activity of Mmp-13. Levels of mRNAs encoding other enzymes with collagen- and proteogly- can-degrading activities either were not increased or were un- detectable in the articular cartilage of knee joints of cho/ mice. These results suggest that level and activity of Mmp-13, FIG.7. Effects of protein kinase inhibitors on the levels of an enzyme that can degrade aggrecan as well as collagen (35), DDR2 and MMP-13 mRNA in human chondrocytes cultured on may be a critical factor in the progression of OA in knee joints type II collagen. The C-28/I2 cells were plated on type II collagen and treated with different protein kinase inhibitors for 24 h, and the levels of cho/ mice. This finding is consistent with numerous reports of DDR2 (left panel) and MMP-13 mRNA (right panel) were analyzed by that MMP-13 is up-regulated in the articular cartilage of real-time PCR. human OA joints (16, 21, 22). As a result of the type XI collagen mutation in cho mice, thick demonstrate that activation of DDR2 induces MMP-13 mRNA type II collagen fibers are present and the integrity of the type levels and that the interaction between chondrocytes and type II collagen fibril network is altered (14). Although the amount II collagen is required for the elevation of MMP-13 and DDR2 of type II collagen in the articular cartilage of mutant knee mRNA levels in chondrocytes. joints may not be affected, the distribution of type II collagen in The MEK1 Inhibitor, PD98059, Suppresses the Induction of the articular cartilage is affected, the increased number of MMP-13 mRNA Levels in Human Chondrocytes Cultured on thick type II collagen fibers in close contact with chondrocytes. Type II Collagen-coated Plates—To examine the potential sig- This altered distribution of type II collagen may enhance the naling pathways involved in the up-regulation of MMP-13 by interactions between chondrocytes and type II collagen result- type II collagen-dependent DDR2 activation, we examined the ing in the altered expression of a collagen receptor. Our data effects of pretreatment with three protein kinase inhibitors, demonstrate that the protein and mRNA levels of Ddr2 are AG490 (JAK-2 inhibitor), wortmannin (phosphatidylinositol increased in the articular cartilage of cho/ mice at the age of 3-kinase inhibitor), and PD98059 (MEK1 inhibitor). As shown 6 months. We did not detect an altered expression of other in Fig. 7, the DDR2 mRNA levels in all three inhibitor-treated collagen receptors, including  integrins, annexin V, and Ddr1 cells were increased, but the level of MMP-13 mRNA in chon- on chondrocytes. This suggests that the up-regulation of Ddr2 drocytes cultured on type II collagen-coated plates with the mRNA and protein may result from the receptor binding to its inhibitor, PD98059, was reduced to 25% of the level in cells own ligand, type II collagen, in cho/ mice. cultured on type II collagen-coated plates in the absence of The correspondence between the increased levels of Ddr2 inhibitor (as control). In chondrocytes treated with the other and Mmp-13 protein in the articular cartilage of cho/ mice two inhibitors, AG490 and wortmannin, the MMP-13 mRNA prompted us to investigate a possible role of Ddr2 in regulating levels were the same as in the control cells. These results the expression and activities of other matrix-degrading pro- indicate that the MEK1 inhibitor does not interfere with the teinases in chondrocytes. Data from our in vitro experiments pathways involved in up-regulation of DDR2 mRNA but inhib- demonstrate that the mRNA level of MMP-13 is increased in its signaling downstream of DDR2, resulting in decreased human and mouse chondrocytes when the cells are cultured on MMP13 expression. type II collagen-coated plates for 24 h and that the mRNA DISCUSSION levels of other matrix-degrading proteinases including MMP-1, MMP-3, MMP-8, ADAMTS-4, and ADAMTS-5 are either not In this study, we found that metalloproteinase activity was increased or undetectable. Our data also showed that the slightly increased in articular cartilage of knee joints of cho/ mRNA level of DDR2 is increased in cells cultured on type II mice at the age of 3 months and further increased with aging. collagen. Furthermore, we showed that transfection of a full- This is consistent with our previous observation that the initial length DDR2 cDNA in human chondrocytes results in elevated sign of articular cartilage degeneration in knee and temporo- levels of MMP-13 mRNA. In contrast, the level of MMP-13 mandibular joints of cho/ mice is detected at the age of 3 mRNA is reduced after transfer of a truncated DDR2, lacking months. By real-time PCR we found that mRNA levels of sev- the cytoplasmic domain, into human chondrocytes cultured on eral proteinases including Mmp3, Mmp8, Mmp13, Adamts-4, type II collagen. On the basis of these data, we conclude that and Adamts-5 were not elevated in the articular cartilage of signaling through DDR2 results in up-regulation of MMP-13 in knee joints in cho/ mice at the age of 3 months. It is possible chondrocytes cultured on type II collagen-coated plates. In that the increased enzyme activity at 3 months is due to accu- addition, we conclude that interaction between chondrocytes mulation of protein synthesized over time and to the post- and type II collagen is required, since the MMP-13 mRNA level translational modification and activation of the previously syn- is not changed in chondrocytes, when they are cultured on thesized enzymes. In our previous study, we found that the plastic, after transfection with either full-length or truncated protein expression of Mmp-3 is increased in cho/ mice at the DDR2 cDNA. age of 3 months (14). However, the increased protein expres- The data indicate that the activation of DDR2 by type II sion is not reflected in elevated Mmp-3 mRNA level in cho/ collagen, not only increases expression of MMP-13, but also mice in analysis performed by real-time PCR at a single time up-regulates the expression of DDR2 itself in chondrocytes. point. One possibility is that the pooling of the cartilages from cho/ mice for real-time PCR may dilute the regional increase Since there is little information on the immediate downstream signaling pathways activated by DDR2, we examined three of Mmp-3 mRNA. Furthermore, it is unlikely that the expres- sion and activity of Mmp-13 in cho/ mice at the age of 3 signaling pathways to understand if these pathways are impli- months are elevated because we do not observe the difference cated in the up-regulation of MMP-13 by DDR2 activation. in Mmp-13 immunostaining (14) or in the degradation of type II Based on our results, we conclude that the Ras/Raf/MEK/ERK Activation of Discoidin Domain Receptor 2 and Osteoarthritis 555 12. Spranger, J. (1998) Pediatr. Radiol. 28, 745–750 pathway is involved in the increased expression of MMP-13 by 13. Li, Y., Lacerda, D. A., Warman, M. L., Beier, D. R., Yoshioka, H., Ninomiya, Y., DDR2 activation but not in the up-regulation of DDR2 Oxford, J. T., Morris, N. P., Andrikopoulos, K., Ramirez, F., Wardell, B. B., expression. Lifferth, G. D., Teuscher, C., Woodward, S. R., Taylor, B. A., Seegmiller, R. E., and Olsen, B. R. (1995) Cell 80, 423– 430 It has been reported that IL-1 can induce MMP-13 expres- 14. Xu, L., Flahiff, C. M., Waldman, B. A., Wu, D., Olsen, B. R., Setton, L. A., and sion in chondrocytes and that signal transduction by the NF- Li, Y. (2003) Arthritis Rheum. 48, 2509 –2518 15. Weiss, C. (1973) Fed. Proc. 32, 1459 –1466 B, p38 MAPK, and JNK pathways are required for IL-1- 16. Tetlow, L. C., Adlam, D. J., and Woolley, D. E. (2001) Arthritis Rheum. 44, induced transcription of MMP-13 (36, 37). To know whether 585–594 IL-1 is an intermediate in the regulation of MMP-13 expression 17. Sternlicht, M. D., and Werb, Z. (2001) Annu. Rev. Cell Dev. Biol. 17, 463–516 18. Nagase, H., and Woessner, J. F., Jr. (1999) J. Biol. Chem. 274, 21491–21494 by activation of DDR2, we examined IL-1 mRNA levels in 19. Tortorella, M. D., Burn, T. C., Pratta, M. A., Abbaszade, I., Hollis, J. M., Liu, mouse and human chondrocytes cultured on type II collagen for R., Rosenfeld, S. A., Copeland, R. A., Decicco, C. P., Wynn, R., Rockwell, A., 12 or 24 h. Since IL-1 mRNA was undetectable in the chondro- Yang, F., Duke, J. L., Solomon, K., George, H., Bruckner, R., Nagase, H., Itoh, Y., Ellis, D. M., Ross, H., Wiswall, B. H., Murphy, K., Hillman Jr., cytes cultured on type II collagen-coated plates, it is unlikely M. C., Hollis, G. F., Newton, R. C., Magolda, R. L., Trzaskos, J. M., and that IL-1 plays a role in the regulation of MMP-13 expression Arner, E. C. (1999) Science 284, 1664 –1666 20. Tang, B. L. (2001) Int. J. Biochem. Cell Biol. 33, 33– 44 by DDR2 activation in our chondrocyte culture system. 21. Knauper, V., Lopez-Otin, C., Smith, B., Knight, G., and Murphy. G. (1996) The activation of DDRs requires native collagens such as J. Biol. Chem. 271, 1544 –1550 type I, II, and III collagens (28, 29). Interestingly, we found 22. Mitchell, P. G., Magna, H. A., Reeves, L. M., Lopresti-Morrow, L. L., Yocum, S. A., Rosner, P. J., Geoghegan, K. F., and Hambor, J. E. (1996) J. Clin. that the increased number of thick type II collagen fibers in Invest. 97, 761–768 pericellular region in cho/ articular cartilage. We speculate 23. Neuhold, L. A., Killar, L., Zhao, W., Sung, M. A., Warner, L., Kulik, J., Turner, that the altered structure and arrangement of type II collagen J., Wu, W., Billinghurst, C., Meijers, T., Poole, A. R., Babij, P., and De- Gennaro, L. J. (2001) J. Clin. Invest. 107, 35– 44 fibrils in the cartilages of cho/ mice may elicit the interaction 24. Di Marco, E., Cutuli, N., Guerra, L., Cancedda, R., and De Luca, M. (1993) between chondrocytes and type II collagen fibrils. As a conse- J. Biol. Chem. 268, 24290 –24295 quence, DDR2 is activated to trigger a series of cellular events 25. Lai, C., Gore, M., and Lemke, G. (1994) Oncogene 9, 2567–2578 26. Karn, T., Holtrich, U., Brauninger, A., Bohme, B., Wolf, G., Rubsamen-Waig- leading to synthesis, release, and activation of matrix-degrad- mann, H., and Strebhardt, K. (1993) Oncogene 8, 3433–3440 ing proteinases such as MMP-13 resulting in OA. 27. Alves, F., Vogel, W., Mossie, K., Millauer, B., Hofler, H., and Ullrich, A. (1995) Oncogene 10, 609 – 618 Acknowledgment—The antibody, C1-2C, was a gift provided by Dr. A. 28. Shrivastava, A., Radziejewski, C., Campbell, E., Kovac, L., McGlynn, M., Robin Poole at Shriners Hospitals for Children, Montreal, Quebec, Ryan, T. E., Davis, S., Goldfarb, M. P., Glass, D. J., Lemke, G., and Yancopoulos, G. D. (1997) Mol. Cell 1, 25–34 Canada. 29. Vogel, W., Gish, G. D., Alves, F., and Pawson, T. (1997) Mol. Cell 1, 13–23 REFERENCES 30. Vogel, W., Aszodi, A., Alves, F., and Pawson, T. (2001) Mol. Cell. Biol. 21, 2906 –29017 1. Felson, D. T., Lawrence, R. C., Dieppe, P. A., Hirsch, R., Helmick, C. G., 31. Hou, G., Vogel, W., and Bendeck, M. P. (2001) J. Clin. Invest. 107, 727–735 Jordan, J. M., Kington, R. S., Lane, N. E., Nevitt, M. C., Zhang, Y., Sowers, 32. Labrador, J. P., Azcoitia, V., Tuckermann, J., Lin, C., Olaso, E., Man ˜ es, S., M. F., McAlindon, T., Spector, T. D., Poole, A. R., Yanovski, S. Z., Ateshian, Bru ¨ ckner, K., Goergen, J., Lemke, G., Yancopoulos, G., Angel, P., Martı ´nez, G., Sharma, L., Buckwalter, J. A., Brandt, K. D., and Fries, J. F. (2000) Ann. C., and Klein, R. (2001) EMBO Rep. 2, 446 – 452 Intern. Med. 133, 635– 646 33. Wang, J., Lu, H., Liu, X., Deng, Y., Sun, T., Li, F., Ji, S., Nie, S., and Yao, L. 2. Scott, J. C., Lethbridge-Cejku, M., and Hochberg, M. C. (1999) in Osteoarthri- (2002) J. Autoimmun. 19, 161–168 tis: Clinical and Experimental Aspects (Reginster, J. Y., Pelletier, J. P., 34. Apte, S. S., and Olsen, B. R. (1993) Matrix 13, 165–179 Martel-Pelletier, J., and Henrotin, Y., eds) pp. 20 –52, Springer, Milan, Italy 35. Fosang, A. J., Last, K., Knauper, V., Murphy, G., and Neame, P. J. (1996) 3. Peyron, J. G., and Altman, R. D. (1992) in Ostoarthritis (Moskowitz, R. W., FEBS Lett. 380, 17–20 Howell, D. S., Goldberg, V. M., and Mankin, H. J., eds) pp. 15–37, W. B. 36. Mengshol, J. A., Vincenti, M. P., and Brinckerhoff, C. E. (2001) Nucleic Acids Saunders Co., Philadelphia Res. 29, 4361– 4372 4. Spector, T. D., and MacGregor, A. J. (2004) Osteoarthritis Cartilage 12, 37. Mengshol, J. A., Vincenti, M. P., Coon, C. I., Barchowsky, A., and Brinckerhoff, S39 –SS44 C. E. (2000) Arthritis Rheum. 43, 801– 811 5. Simonet, W. S. (2002) Mol. Genet. Metab. 77, 31–34 38. Ricke, W. A., Smith, G. W., Reynolds, L. P., Redmer, D. A., and Smith, M. F. 6. Loughlin, J. (2002) Rheum. Dis. Clin. North Am. 28, 95–109 (2002) Biol. Reprod. 66, 1083–1094 7. Jimenez, S. A., and Dharmavaram, R. M. (1994) Ann. Rheum. Dis. 53, 789 –797 8. Diab, M. (1993) Orthop. Rev. 22, 165–170 39. Xu, L., Tan, L., Goldring, M. B., Olsen, B. R., and Li, Y. (2001) Matrix Biol. 20, 147–151 9. Reginato, A. M., and Olsen, B. R. (2002) Arthritis Res. 4, 337–345 10. Vikkula, M., and Olsen, B. R. (1996) Ann. Med. 28, 301–304 40. Goldring, M. B., Birkhead, J. R., Suen, L. F., Yamin, R., Mizuno, S., Glowacki, 11. Duance, V. C., and Wotton, S. F. (1991) Biochem. Soc. Trans. 19, 376S J., Arbiser, J. L., and Apperley, J. F. (1994) J. Clin. Invest. 94, 2307–2316 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry American Society for Biochemistry and Molecular Biology

Activation of the Discoidin Domain Receptor 2 Induces Expression of Matrix Metalloproteinase 13 Associated with Osteoarthritis in Mice *♦

Download PDF
8 pages

Loading next page...
 
/lp/american-society-for-biochemistry-and-molecular-biology/activation-of-the-discoidin-domain-receptor-2-induces-expression-of-HcmHWrZS6P

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
American Society for Biochemistry and Molecular Biology
Copyright
Copyright © 2005 Elsevier Inc.
ISSN
0021-9258
eISSN
1083-351X
DOI
10.1074/jbc.m411036200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 280, No. 1, Issue of January 7, pp. 548 –555, 2005 © 2005 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Activation of the Discoidin Domain Receptor 2 Induces Expression of Matrix Metalloproteinase 13 Associated with Osteoarthritis in Mice* Received for publication, September 24, 2004, and in revised form, October 25, 2004 Published, JBC Papers in Press, October 27, 2004, DOI 10.1074/jbc.M411036200 ¶   ¶ Lin Xu‡§, Haibing Peng§ , Dongying Wu , Kenpan Hu , Mary B. Goldring , Bjorn R. Olsen‡ , and Yefu Li ** From the ‡Department of Cell Biology, Harvard Medical School, Boston, Massachusetts 02115, the Division of Rheumatology, Beth Israel Deaconess Medical Center and New England Baptist Bone and Joint Institute, Harvard Institutes of Medicine, Boston, Massachusetts 02115, and the Department of Oral and Developmental Biology, Harvard School of Dental Medicine, Boston, Massachusetts 02115 eases with different etiologies but with a similar clinical out- Human genetic studies indicate that mutations in type IX and XI collagens result in early-onset osteoarthritis come. Although the causes of OA are diverse, mutations in (OA) with a wide spectrum of osteochondrodysplasia. cartilage specific collagen genes have been identified in human However, a convincing causal chain of events underly- familial OA associated with a wide range of osteochondrodys- ing the role of these collagen mutations in the pathogen- plasia, from mild to lethal forms (4 –7). In particular, mutations esis of OA has not been elucidated. Here we show that in type IX or XI collagens are associated with early-onset OA the expression of a cell surface collagen receptor, dis- (8 –10). Mutations in genes encoding type IX collagen, COL9A1, coidin domain receptor 2 (DDR2), is increased in chon- COL9A2, and COL9A3, cause multiple epiphyseal dysplasia drocytes of the articular cartilage of knee joints in mice and intervertebral disc disease in humans. Multiple epiphyseal that develop OA as a result of a heterozygous mutation dysplasia is a milder dysplasia of the epiphyses of peripheral in type XI collagen. At the same time point, 6 months, we joints that is characterized by cartilage degeneration resulting also found increased expression and activity of matrix in early-onset OA. One of the clinical features of intervertebral metalloproteinase 13 (MMP-13) in the mutant mouse disc disease is the degeneration of the articular cartilage of the knee cartilage. The expression of both DDR2 and discs. Interestingly, the amount of type IX collagen is reduced MMP-13 was increased in chondrocytes cultured on in aged people (11), in whom there is high incidence of OA. In plates coated with native type II collagen but not on humans, mutations in genes for type XI collagen, COL11A1 gelatin, and overexpression of DDR2, but not of a trun- and COL11A2, have also been identified in several forms of cated form, was found to induce the expression of familial OA (12). A reduced amount of type XI collagen is also MMP-13 when chondrocytes were cultured on type II found in aged people (11). The pathogenetic mechanisms un- collagen but not on plastic. The DDR2-induced expres- derlying the OA due to these collagen mutations are largely sion of MMP-13 appears to be specific, since we did not unknown. observe induction of MMP-1, MMP-3, MMP-8, ADAMTS-4, ADAMTS-5, and IL-1 transcripts in human chondrocytes We have used a mouse model of chondrodysplasia (cho)to or Mmp-3, Mmp-8, Adamts-4, Adamts-5, and Il-1 in mouse investigate how mutations in type XI collagen cause an OA-like chondrocytes. Our data suggest that the defect in the pathology. We found previously that the cho phenotype is due cartilage matrix of mice that are heterozygous for a type to a single nucleotide deletion leading to frameshift and pre- XI collagen mutation (cho/) permits activation and up- mature termination of translation of the 1 chain of type XI regulation of DDR2 in chondrocytes. This could be due collagen (13). Electron microscopy of the articular cartilage of to increased exposure of chondrocytes to type II colla- knee joints in heterozygous mutant (cho/) mice shows thick gen as a result of the decreased amount of type XI col- collagen fibrils (14), which is one of the early clinical charac- lagen in the mutant cartilage. The specific induction of teristics of human OA (15). The cho/ mice (homozygous cho/ MMP-13 by DDR2 in response to its cartilage-specific cho mice die at birth) reveal OA-like changes in their knee and ligand, type II collagen, may contribute to cartilage temporomandibular joints, starting at the age of 3 months, damage in hereditary OA. without other apparent skeletal abnormalities (14). We have also found increased protein expression of matrix metallopro- teinase-3 (MMP-3, stromelysin) and MMP-13 (collagenase 3) in Osteoarthritis (OA), the most common form of human ar- thritis (1–3), is considered a group of overlapping distinct dis- knee articular cartilage of cho/ mice, which is consistent with a recent study of human OA cartilages (16). Although a hered- * This work was supported by National Institutes of Health Grants itary defect in type XI collagen is not responsible for most forms P01-AR050245 (to Y. L.), R01-AR36819 (to B. R. O. and L. X.), and of human OA, disruption of matrix composition in cho/ mice R01-AR45378 and R01-AG22021 (to M. B. G.). The costs of publication results in the loss of joint stability and associated biochemical of this article were defrayed in part by the payment of page charges. alteration that mimics human OA. An additional advantage of This article must therefore be hereby marked “advertisement”inac- cordance with 18 U.S.C. Section 1734 solely to indicate this fact. the cho/ mouse is that the degradation of joint structures This article was selected as a Paper of the Week. occurs postnatally with gradual changes throughout the life § These authors contributed equally to this work. span of the mouse. ** To whom correspondence should be addressed: 188 Longwood Ave., MMPs constitute a group of zinc-dependent proteinases that Boston, MA 02115. Tel.: 617-432-1835; Fax: 617-432-3221; E-mail: [email protected]. The abbreviations used are: OA, osteoarthritis; MMP, metallopro- teinase; DDR, discoidin domain receptor; PBS, phosphate-buffered sa- line; DMEM, Dulbecco’s modified Eagle’s medium. 548 This paper is available on line at http://www.jbc.org This is an Open Access article under the CC BY license. Activation of Discoidin Domain Receptor 2 and Osteoarthritis 549 and 0.2 unit/ml instead of the homogenates, were added. Each homo- are involved in remodeling of extracellular matrices in most genate was analyzed in triplicate. Fluorescence was measured using tissues. MMP-1 (collagenase-1) and MMP-8 (collagenase-2), as the LJL Analysts microplate reader with excitation at 485  10 nm and well as MMP-3 and MMP-13 function during cartilage devel- emission detection at 530  10 nm. Relative proteinase activity was opment, postnatal growth, and homeostasis to cleave triple- calculated against the standard plot. helical type II collagen and degrade proteoglycans in articular Examination of mRNA Levels of Matrix-degrading Enzymes in Knee cartilage (17, 18). Aggrecanases, particularly ADAMTS-4 (ag- Articular Cartilages of cho/ Mice—Knee articular cartilages from six cho/ or six wild-type mice at the ages of 3 or 6 months were collected, grecanase-1) and ADAMTS-5 (aggrecanase-2), are also impor- and the cartilages from the cho/ or wild-type littermates were pooled tant matrix-degrading proteinases in the cartilage matrix (19, together for the isolation of total RNAs using the total RNA isolation 20). All of these proteinases are expressed at relatively low system (Promega, Madison, WI). The cDNA was synthesized with oli- levels in normal articular cartilage. However, a number of go(dT) primer using the Super-Script first-strand synthesis system studies have demonstrated that expression of these enzymes is (Clontech). Real-time PCR conditions were optimized for maximal PCR increased in localized regions of human OA articular cartilage efficiency by the adjustment of concentrations of the following PCR primers: Mmp-3, CCTACTTCTTTGTAGAGGAC (forward) and GTCA- and that MMP-13 may be a particularly critical enzyme in the AATTCCAACTGCGAAG (reverse); Mmp-8, GTAAACTGTAGAGTCG- degradation of type II collagen in articular cartilage (21, 22). ATGC (forward) and CATAGGGTGCGTGCAAGGAC (reverse); Mmp- This is consistent with the OA-like changes in knee joints of 13, GTGTGGAGTTATGATGATGT (forward) and TGCGATTACTCCA- mice that constitutively express MMP-13 in cartilage (23). GATACTG (reverse); Adamts-4, GCAACGCAGGGCAGAGATAC (for- Given the known ability of these enzymes to degrade major ward) and CATCTGTGTTTTAGCAGGAG (reverse); Adamts-5, ACCG- components of cartilage matrix, it is likely that their expression TGCAGTGCCAGGATGG (forward) and GGTGACAATGACATGA- AGGC (reverse); Il-1, GAATCTATACCTGTCCTGTG (forward) and TT- in chondrocytes is tightly regulated. ATGTCCTGACCACTGTTG (reverse); Gapdh, ACTGAGGACCAGGT- The discoidin domain receptors 1 (DDR1) and 2 (DDR2) were TGTC (forward) and TGCTGTAGCCGTATTCATTG (reverse). identified in humans and mice as cell surface receptor tyrosine Four different combinations of primers were tested, forward (nM)/ kinases (24 –27). The mRNA transcripts of the receptors are reverse (nM): 200/200, 200/600, 600/200, and 600/600. The optimum detected in several human and mouse tissues, such as bone, concentrations of the primers for each gene were: Mmp-3, 200/200; cartilage, skin, skeletal muscle, brain, and heart. Two research Mmp-8, 200/600; Mmp-13, 600/600; Adamts-4, 200/200; Adamts-5, 200/ 200; Il-1, 200/200; and Gapdh, 200/200. PCR was performed using 25 l groups reported in 1997 that native collagens were the DDR of 1 PCR buffer containing 50 mM KCl, 3 mM MgCl , 200 nM dNTPs, ligands (28, 29). Interestingly, a synthetic short triple-helical each primer at 200 nM or 600 nM,1 SYBR Green, 0.5 unit of TaqDNA collagen-like peptide (10 repeat of Gly-Pro-Hyp) was not able to polymerase (Qiagen), and 0.5 l of cDNA. Real-time PCR was per- activate DDRs. Studies of Ddr1-deficient mice suggest that formed using the Icycler iQ detection system (Bio-Rad), and the PCR Ddr1 plays a key role in mammary gland development and reaction was carried out at 95 °C for 3 min followed by 50 cycles of 95 °C arterial wound repair (30, 31). Ddr2-deficient mice exhibit for 30 s, 60 °C for 30 s, and 72 °C for 30 s, with a final extension at 72 °C for 4 min. At the end of the PCR cycles, a melting curve, using a short stature and a delay in the healing of skin wounds (32). temperature range between 55 and 95 °C with 0.5 °C intervals, was Activation of DDR2 by type I collagen increases the level of generated to test the specificity of the PCR product. A cDNA sample in MMP-1 in the human fibrosarcoma cell line HT 1080 (28). each experiment was tested in triplicate and each experiment was Up-regulation of DDR2 is associated with overexpression of performed twice. We used Gapdh as internal control. The efficiency of MMP-1 in synovial fibroblasts from rheumatoid arthritis PCR represented by a standard curve was also tested by plotting the patients (33). amount of PCR product versus the known amount of a template, 0.001, 0.01, 0.1, 1, and 10 ng. In theory, when the slope of the standard curve Because type XI collagen is an integral component of the type is 3.322, the efficiency of PCR is considered 100%. In these experi- II collagen fibrils in cartilage, we reasoned that the cho muta- ments, the efficiency reached 90% or higher. tion may result in a disruption of the collagen network in Examination of Degraded Type II Collagen in Articular Cartilage of cartilage matrix and enhance the interaction between chondro- cho/ Mice—Three knees from cho/ or wild-type mice at the ages of 3 cytes and type II collagen molecules. We report here that the and 6 months were collected for cryosection. The samples were fix in 4% expression of Ddr2, a cell surface receptor interacting specifi- paraformaldehyde at 4 °C overnight, followed by embedding in OCT for sectioning. Sections of 10 m were cut and incubated with polyclonal cally with native fibrillar collagen rather than with other ma- antibody C1-2C (IBEX Tech. Inc., Montreal, Quebec, Canada), which trix components such as fibronectin, proteoglycans, or cartilage recognizes the neoepitope in degraded type II collagen produced by oligomeric matrix protein (COMP) is increased in the articular collagenase cleavage. The samples were incubated with biotinylated cartilage of knee joints in cho/ mice. Studies in vitro indicate secondary antibody for the color detection. A negative control, staining that up-regulation and activation of DDR2 by native type II without primary antibody, was also performed. collagen can specifically induce the expression of MMP-13 by Transmission Electron Microscopy—A detailed experimental proce- dure has been described in the previous publication (14). Briefly, two chondrocytes. We also show that the increased expression of knee joints each from 1-month-old cho/ mice and two knee joints each Ddr2 and Mmp-13 is associated with type II collagen degrada- from their normal littermates were obtained. The articular cartilage of tion in adult cho/ mice. Our data suggest a mechanism, in- the joints was exposed, and specimens were fixed in Karnovsky’s solu- volving Ddr2 signaling and increased expression of this recep- tion with 4% gluteraldehyde overnight at room temperature. The sam- tor tyrosine kinase, for destruction of the collagen network in ples were then processed for ultra-thin (95 nm) sectioning. Ultra-thin articular cartilage leading to the age-dependent and progres- sections from each sample were examined, and multiple locations in each section were randomly selected for photographs. sive OA-like pathology in cho/ mouse joints. Immunohistochemical Staining for Collagen Receptors—Immunohis- EXPERIMENTAL PROCEDURES tochemical experiments were performed to characterize the expression Analysis of Proteinase Activity in Extracts of Knee Articular Cartilage of Ddr1, Ddr2,  integrin, and annexin V in the articular cartilage of of cho/ and Wild-type Mice—Articular cartilage samples were dis- knee joints from cho/ and wild-type mice. Three knee joints from sected from the knee joints of 12 cho/ and 12 wild-type mice at the age different cho/ mice and three knee joints from different wild-type of 3 or 6 months. We used an EnzChek gelatinase/collagenase assay kit littermates at the ages of 3 or 6 months were used. The samples were (Molecular Probes, Inc., Eugene, OR) to assay for metalloproteinase fixed in 4% paraformaldehyde in PBS overnight at 4 C and embedded activity (38). The articular cartilage samples were pooled from 12 ani- in paraffin. Serial sections of 8 m were cut from the medial side to the mals from cho/ or wild-type mice at each age and homogenized in a lateral side. From each joint, four sets of 12 evenly spaced paraffin buffer containing 100 mg (wet weight)/ml. 100 l of the homogenates, sections were collected for staining. The sections were deparaffinized, 80 lof1 reaction buffer, and 20 l of DQ gelatin solution were added quenched for endogenous peroxidase activity, and treated with hyalu- to each well of a 96-well plate for the analysis. For a negative control, ronidase. One set of the sections was incubated with an antibody in PBS 100 lof1 reaction buffer instead of the homogenates, and for a solution at 4 °C overnight. Antibodies, against human DDR1 (catalog standard curve plot, 100 l of different enzyme dilutions at 0.05, 0.1, number sc-7553), human DDR2 (catalog number sc-7554), human 1 550 Activation of Discoidin Domain Receptor 2 and Osteoarthritis integrin (catalog number sc-8978), and human annexin V (catalog num- ber sc-8300) were purchased from Santa Cruz Biotechnology and used to analyze serial sections. The sections were washed with PBS three times followed by treatment with biotinylated secondary antibody. Color detection was performed with peroxidase substrate after incuba- tion with a mixture of avidin and biotinylated horseradish peroxidase. Staining without primary antibody was performed as a negative control. Analysis of Ddr2 mRNA Levels in Mouse Articular Cartilage—The experimental procedure was as described above using the following PCR primers for Ddr2,5-CTGTCGGATGAGCAGGTTAT-3 (forward) and 5-CTCGGCTCCTTGCTGAAGAA-3 (reverse), at the concentra- tion of 200 nM/200 nM. FIG.1. Matrix metalloproteinase activity in articular cartilage Chondrocyte Cultures—Primary costochondral chondrocytes were of mouse knee joints. Articular cartilages were obtained from knee isolated from 2-week-old C57BL mice and cultured as described in a joints of 12 cho/ and 12 wild-type littermates in each age group of 3 previous study (39). The immortalized human chondrocyte cell line, and 6 months. The matrix metalloproteinase activity in homogenates C-28/I2, obtained after infection of juvenile costal chondrocytes with a was increased about 2-fold (left panel) and 6-fold (right panel)in cho/ neomycin-resistant retroviral vector encoding SV40 virus large T-anti- mice at the ages of 3 and 6 months, respectively, compared with wild- gen, selection in G418 and cloning (40) were cultured in Dulbecco’s type littermates. modified Eagle’s medium (DMEM)/Ham’s F-12 (1/1, v/v; Invitrogen) containing 10% fetal calf serum. The cells were cultured in 5% CO at 2 EndoFree plasmid maxi-kit (Qiagen). 37 °C and passaged at a ratio of 1:8 at 95% confluence every 5 to 6 Transient transfection experiments were carried out in human days. For preparation of culture plates, type II collagen from chicken C-28/I2 cells using Lipofectamine PLUS™ Reagent (Invitrogen). Cells sternal cartilage (catalog number C-9301, Sigma) was dissolved in were seeded 24 h prior to transfection in 6-well plates at 3.5  10 0.25% acetic acid at a concentration of 1 mg/ml and used to coat 6-well cells/well in DMEM/F-12 containing 10% fetal calf serum. For each well, plates. We also prepared plates coated with denatured type II collagen 200 ng of plasmid construct, 6 l of PLUS reagent, and 92 lof (gelatin) and re-natured type II collagen as follows. The type II collagen serum-free DMEM/F-12 were mixed and incubated for 15 min at room solution (1 mg/ml) was heated at 70 °C for 45 min, and one-half of the temperature. Lipofectamine PLUS reagent (4 l) in 100 l of serum- denatured type II collagen was used to coat 6-well plates. The other half free medium was then added to each reaction mixture, and incubation of the denatured collagen preparation was left at room temperature was continued for an additional 30 min at room temperature. Finally, overnight to generate renatured type II collagen and then used for the transfection mixture was combined with 800 l of serum-free me- coating of 6-well plates. A portion (200 l) of each sample, including dium, and the lipid-nucleic acid complex was transferred to the washed native (commercial), denatured, and renatured type II collagens, was cell monolayer in each well. After incubation for4hat37 °C,the subjected to SDS-PAGE to confirm the quality of the preparation. For transfection mix was diluted with an equal volume of DMEM/F-12 experiments, culture plates coated with the various collagen prepara- containing 20% fetal calf serum, and incubation was continued for 24 h tions and non-coated plates (controls) were seeded with either mouse or to permit expression of the wild-type and truncated DDR2 cDNAs. The human chondrocytes. The cells were cultured in DMEM/Ham’s F-12 cells were then scraped and transferred to 6-well plates without or with (1/1, v/v; Invitrogen) containing 10% fetal calf serum for 12 or 24 h. For coating with type II collagen and incubations were continued for 24 h. real-time PCR, cells from 3 wells for each experimental condition were The levels of MMP-1, MMP-3, and MMP-13 mRNA were examined by pooled and collected for total RNA isolation and real-time PCR analysis. real-time PCR, and the PCR conditions were the same as those de- The cDNA was synthesized with oligo(dT) primer. PCR conditions were scribed above. GAPDH was used as internal control. optimized by the adjustment of concentrations of the following PCR Treatment of Chondrocyte Cultures with Protein Kinase Inhibitors— primers for each human gene (see above for mouse genes): DDR2, The C-28/I2 cells were cultured in type II collagen-coated 10-cm plates CTCCCAGAATTTGCTCCAG (forward) and GCCACATCTTTTCCT- for 4 h allowing the cells to adhere. Protein kinase inhibitors were GAGA (reverse); MMP-1, GCCACAAAGTTGATGCAGTT (forward) and added as follows: 1) MEK inhibitor, PD98059 at 10 M (from CALBIO- GCAGTTGAACCAGCTATTAG (reverse); MMP-3, ACTGTGATCCT- CHEM); 2) phosphatidylinositol 3-kinase/Akt inhibitor, Wortmannin at GCTTTGTCC (forward) and ACGCCTGAAGGAAGAGATGG (reverse); 25 nM (from Calbiochem); and 3) JAK2 inhibitor, AG490 at 10 M (from MMP-8, GTTTTCCAGCAAGAACATTT (forward) and AACTTCCCT- Calbiochem). No protein kinase inhibitor was added to control cultures. TCAACATTCTG (reverse); MMP-13, GCTGCCTTCCTCTTCTTGAG Incubations were carried out for 24 h, and the cells were washed twice (forward) and TGCTGCATTCTCCTTCAGGA (reverse); ADAMTS-4, with cold PBS and harvested for RNA extraction. GCACCGAAGAGCACAGATTC (forward) and ATGAGGCAGCAACA- GAAGC (reverse); ADAMTS-5, GAAGTTAGCAAAAGGATGTC (for- RESULTS ward) and TTCTGTGCGTTAGGTAGACC (reverse); IL-1, CAACTGG- Age-related Increase in Matrix Metalloproteinase Activity in TACATCGACACCT (forward) and GGGATTGAGTCCACATTCAG Articular Cartilage of Knee Joints in cho/ Mice—To determine (reverse); GAPDH, TTCGACAGTCAGCCGCATCTTCTT (forward) and whether the age-related articular cartilage destruction that we CAGGCGCCCAATACGACCAAATC (reverse). The optimum concentrations of the primers for the genes were: previously observed in cho/ mice was associated with in- DDR2, 200/200, MMP-1, 200/200; MMP-3, 200/200; MMP-8, 200/600; creased activities of cartilage-degrading proteinases, we ana- MMP-13, 600/600; ADAMTS-4, 600/200; ADAMTS-5, 200/200; IL-1, lyzed metalloproteinase activity in extracts of articular carti- 200/200; and GAPDH, 200/200. The PCR was performed as described lage from knee joints. Using a fluorescent substrate to detect above. combined collagenase/gelatinase activity, we found that metal- Transient Overexpression of Full-length and Truncated DDR2—To loproteinase activity was increased about 2-fold at the age of 3 generate full-length cDNA of human DDR2, total RNA was isolated from the human chondrocyte C-28/I2 cell line. The cDNA was synthe- months in cho/ mouse articular cartilage compared with car- sized using the oligo(dT) primer. The primers for the PCR were de- tilage from wild-type littermates (Fig. 1, left panel). At the age signed according to the published human DDR2 sequence. The 5-end of of 6 months, metalloproteinase activity was increased about the forward primer was designed with a KpnI site, 5-ggggtaccccagat- 6-fold in articular cartilage of cho/ mice compared with wild- gatcctgattccca-3, and the 5-end of the reverse primer was designed type littermates (Fig. 1, right panel). These results indicate with an EcoRI site, 5-ggaattccctgacagcatcactcgtc-3. After amplifica- that the age-related articular cartilage destruction observed in tion, the PCR product was subcloned into the expression vector pcDNA3.1 (Invitrogen). The truncated cDNA of DDR2, containing only cho/ mice is associated with increased metalloproteinase the extracellular and transmembrane domains, was obtained using the activity. following PCR primers, which were designed with BstXI sites at the Age-related Increase of Mmp-13 mRNA Level in Articular 5-ends: forward primer, 5-ccaaaaaaatggatgatcctgattccca-3 and re- Cartilage of cho/ Mice—To determine more specifically which verse primer, 5-ccaaaaaaatggtgggctggactggcttcaca-3. The sequences of matrix-degrading enzymes are up-regulated in the articular the constructs were confirmed by DNA sequencing. Expression vectors cartilage of knee joints in cho/ mice, we examined the levels of containing either the full-length or the truncated human DDR2 were prepared and purified for transfection into chondrocytes using the Mmp-3, Mmp-8, Mmp-13, Adamts-4, and Adamts-5 mRNAs Activation of Discoidin Domain Receptor 2 and Osteoarthritis 551 FIG.3. Immunostaining of type II collagen degradation. Cryo- sections from three cho/ mice and three wild-type littermates at the ages of 3 and 6 months were stained using a polyclonal antibody against FIG.2. The mRNA levels of matrix-degrading enzymes in ar- the degraded type II collagen. More intense staining in cho/ sections ticular cartilage of mouse knee joints. Total RNA was isolated from than in wild-type sections at the age of 6 months is indicated by the six cho/ and six wild-type littermates at the ages of 3 or 6 months. The arrows. Bar  50 m. levels of mRNAs coding for matrix-degrading enzymes were measured by real-time PCR. The level of Mmp-13 mRNA was elevated about 3-fold in cho/ mice at the age of 6 months compared with their wild-type As shown in Fig. 4B (top panels), increased numbers of Ddr2- littermates (right panel) but not at 3 months (left panel). The level of positive cells were observed in the articular cartilage of cho/ Mmp-3 mRNA was the same at the ages of 3 months (the left panel) and mice at the age of 6 months compared with wild-type mice, 6 months (the right panel). Mmp-8 was unchanged in 3 months and whereas no difference could be detected at 3 months (data not undetectable in 6 months. Values representing levels in wild-type mice shown). There was no difference observed in the staining in- were set at 1.0. tensity of annexin V when cho/ and wild-type mice were using real-time PCR. We also examined interleukin-1 (Il-1) compared at either age (Fig. 4B, lower panels). Ddr1 and mRNA, since Il-1 may be associated with increased cartilage integrins were barely detected by immunohistochemistry at degradation in this model. Real-time PCR analysis of cartilage both ages, and no difference could be detected between cho/ extracts showed that the mRNA level of Mmp-13 was increased and wild type mice (data not shown). 3-fold in cho/ mice at the age of 6 months; no difference To determine whether the increased protein expression of between mutant and wild-type mice was seen at 3 months (Fig. Ddr2 was due to increased gene expression, we examined the 2). In contrast, the mRNA levels of the other proteinases tested level of Ddr2 mRNA in mice at the ages of 3 and 6 months by were either not increased (Mmp-3) or undetectable (Mmp-8)in real-time PCR. As shown in Fig. 4C, the level of Ddr2 mRNA in articular cartilage from cho/ mice compared with wild-type cho/ knee joints was not increased at the age of 3 months, but littermates at the age of 6 months. These results suggest that it was increased 3-fold compared with wild-type mice at the age Mmp-13 may be a major factor contributing to the age-related of 6 months. These data indicate that the expression of Ddr2 in articular cartilage degradation in cho/ knee joints. the articular cartilage of cho/ knee joints at 6 months of age Increased Degradation of Type II Collagen in Articular Car- is increased at both the mRNA and protein levels. tilage of cho/ Mice—To understand whether the high-level Increased DDR2 and MMP-13 mRNA Levels in Chondrocytes expression of Mmp-13 in articular cartilage of cho/ mice re- Cultured on Type II Collagen-coated Plates—Since fibrillar col- sults in the increased activity of the enzyme, we examined the lagens are known to activate DDR2 and thereby induce expres- degraded type II collagen in the articular cartilage by immu- sion of a metalloproteinase (MMP-1) (28, 29), we performed in nostaining using an antibody that recognizes the carboxyl ter- vitro experiments to determine the effects of culturing chon- minus of the three-quarter fragment produced by collagenase drocytes on type II collagen-coated plates on the expression of activity. There was no difference in degraded type II collagen at matrix-degrading enzymes. Mouse cells with phenotypic char- the age of 3 months in cho/ mice compared with wild-type acteristics of chondrocytes, including polygonal morphology mice (data not shown). However, more degraded type II colla- and extracellular matrix staining by Alcian blue, were obtained gen molecules (brown color staining) were observed in cho/ from costal cartilage. Col2a1 mRNA was detected in cultured mice at the age of 6 months (Fig. 3). We noticed that more mouse chondrocytes by RT-PCR, whereas Col10a1 mRNA, a degraded type II collagen appeared in the pericellular matrix. marker for hypertrophic chondrocytes (34), was absent, indi- These data suggest that the collagenase activity of Mmp-13 is cating that the cells in the cultures were proliferating, nonhy- increased in cho/ mice. pertrophic chondrocytes. The immortalized human chondro- Altered Ultrastructure of Extracellular Matrix and Expres- cyte cell line, C-28/I2, was also used as a model to further sion of a Collagen Receptor in Articular Cartilage of cho/ experiments to study mechanisms. We prepared culture plates Mice—Altered contact between type II collagen fibrils and a coated with native type II collagen and used non-coated plates collagen receptor on chondrocytes may play a role in initial as controls. and/or progression in OA pathogenesis, at least in the case of Real-time PCR analysis demonstrated that the level of hereditary OA caused by type IX and type XI collagen muta- MMP-13 mRNA was elevated about 5-fold in human chondro- tions. In the articular cartilage of wild-type mouse knee joints, cytes cultured on type II collagen for 24 h (Fig. 5A). However, we observed some type II collagen fibrils around the chondro- the level of MMP-1 mRNA was not increased above the low con- cytes, but more fibrils are located in the interterritorial region stitutive level. The mRNAs for MMP-3, MMP-8, ADAMTS-4, (Fig. 4A, bottom panel). In contrast, the increased number of ADAMTS-5, and IL-1 were not detectable. Surprisingly, we thick type II collagen fibrils were concentrated in the pericel- found that the level of DDR2 mRNA in human chondrocytes lular region in cho/ mice (Fig. 4A, top panel). These results was also increased (about 6-fold) after incubation on collagen suggest the possibility that the exposure of chondrocytes to for 24 h. In mouse chondrocytes, Mmp-13 and Ddr2 mRNA type II collagen fibrils in the pericellular matrix is enhanced in levels were increased about 7- and 8-fold, respectively, in cells cho/ mice. cultured in type II collagen-coated wells for 24 h compared with To determine whether the expression of collagen receptors on cells cultured in non-coated wells (Fig. 5B). The level of Mmp-3 chondrocytes is affected by the cho/ mutation, we examined mRNA was not increased. The mRNAs for Mmp-8, Adamts-4, the protein expression of three different types of collagen re- Adamts-5, and Il-1 were not detectable in cultured mouse chon- ceptors, Ddr1 and Ddr2, integrins, and annexin V, in the drocytes. These results indicate that chondrocytes exposed to articular cartilage of knee joints at the ages of 3 and 6 months. native type II collagen for 24 h are induced to express increased 552 Activation of Discoidin Domain Receptor 2 and Osteoarthritis FIG.4. Comparison of cartilage from cho/ and wild-type mice. A, ul- trastructure of extracellular matrix in ar- ticular cartilage of mouse knee joints. Two knee joints from different cho/ mice and two knee joints from different normal littermates at the age of 1 month old were obtained for transmission electron mi- croscopy. In ultra-thin sections, there is an increased number of thick type II col- lagen fibers in close contact with chondro- cyte cell membranes in cho/ mice (see the cross-section of the fibrils indicated by arrows at the top panel) compared with wild-type littermates (see the space be- tween the cell membrane and the fibrils indicated by arrows at the bottom panel). Bar  500 nm. B, expression of collagen receptors in articular cartilage of mouse knee joints. Immunostaining shows in- creased numbers of cells staining positive for Ddr2 (brown color) in the articular cartilage of cho/ mice at the age of 6 months (top panels). Annexin V can be detected at 6 months, but the staining intensities in cho/ and wild-type mice are similar (lower panels). Bar  50 m. C, the levels of Ddr2 mRNA in the artic- ular cartilage of cho/ and wild-type mice. The level of Ddr-2 mRNA was ele- vated 3-fold in the cartilage of cho/ mice at the age of 6 months, but not at 3 months, compared with their wild-type littermates. levels of DDR2 and MMP-13 mRNA. The absence of induction to denatured (gelatin) and renatured type II collagen. Culture at 12 h suggests that the response requires early cellular on denatured collagen had no effect on levels of expression of events such as activation of gene expression and protein MMP13 and DDR2 mRNA, whereas culture on renatured type synthesis. II collagen increased the levels of DDR2 and MMP-13 mRNAs We also examined the responses of the human chondrocytes by 4- and 5-fold, respectively (Fig. 5C). These results indicate Activation of Discoidin Domain Receptor 2 and Osteoarthritis 553 FIG.5. Induction of DDR2 and MMP-13 mRNA in chondrocytes cultured on type II collagen. A, analysis of mRNA levels in human chondrocytes. The mRNA levels of DDR2, MMP1, and MMP13 were FIG.6. Response of human chondrocytes to transient overex- detected but not increased in C-28/I2 cells cultured in collagen-coated pression of full-length or truncated DDR2 cDNA. A, construct for plates for 12 h compared with uncoated plates. However, DDR2 and expressing full-length and truncated DDR2 cDNAs. The full-length MMP-13, but not MMP-1, mRNA levels were increased about 6- and DDR2 cDNA contained 2568 nucleotides including extracellular do- 5-fold, respectively, in chondrocytes cultured in collagen-coated plates main, 1–1200, transmembrane domain, 1201–1263, and intracellular for 24 h. B, analysis of mRNA levels in mouse chondrocytes. Ddr2 and domain, 1264 –2568. Within the cytoplasmic domain, the tyrosine ki- Mmp13 mRNA levels were increased in chondrocytes cultured for 24 h nase catalytic unit corresponds to the region 1687–2547 nucleotides. in collagen-coated plates compared with uncoated control. Mmp3 The truncated DDR2 cDNA construct does not contain the tyrosine mRNA was detected and but showed no increase. C, analysis of mRNA kinase catalytic unit. B, overexpression of full-length DDR2 or trun- levels in human chondrocytes cultured in plates with denatured (gela- cated DDR2 cDNA in human chondrocytes cultured on type II collagen. tin) or renatured type II collagen. There was no difference in the mRNA Levels of DDR2 and MMP-13 mRNA were increased in the C-28/I2 cells levels of DDR2 and MMP-13 in C-28/I2cells cultured on gelatin. How- transfected with full-length DDR2 cDNA compared with cells trans- ever, the DDR2 and MMP-13 mRNA levels were elevated about 4- and fected with the vector alone, whereas there was no change in the level 5-fold, respectively, in cells cultured on renatured type II collagen. of MMP-1 mRNA (left panel). When the chondrocytes were transfected Values representing levels in uncoated plates were set at 1.0. with the truncated DDR2 cDNA and cultured on type II collagen for 24 h, the levels of endogenous DDR2 and MMP-13 mRNA were reduced by about 60 and 65%, respectively (right panel) (note: the difference in that chondrocytes respond in a specific manner to triple-helical scale between the left and right panels). C, overexpression of full-length or truncated DDR2 cDNA in C-28/I2 cells cultured in non coated plates. type II collagen. There was no change in the MMP-13 mRNA level when cells transfected Increased MMP-13 mRNA Level in Human Chondrocytes in either with the full-length or truncated DDR2 were compared with cells Response to Transient Overexpression of Full-length DDR2 transfected with vector alone. Values representing levels in cells trans- cDNA—To better understand the cause-effect relationship be- fected with vector alone were set at 1.0. tween DDR2 and MMP-13, we transfected full-length DDR2 cDNA (Fig. 6A) into human chondrocytes and cultured the cells (lacking the cytoplasmic domain) (Fig. 6A) into human chon- on type II collagen-coated plates for 24 h. As shown in Fig. 6B, drocytes. After the transfected cells were cultured on type II left panel, the level of DDR2 mRNA was increased about 4-fold, collagen-coated plates for 24 h, the levels of endogenous DDR2 and MMP-13 mRNA was increased about 8-fold. This result and MMP-13 mRNA were reduced by about 65% compared indicates that overexpression of DDR2 and its activation by with cells transfected with vector alone (as control) (Fig. 6B, type II collagen results in induction of MMP-13 mRNA in right panel). In addition, we also found that there was no chondrocytes. change in the level of MMP-13 mRNA in human chondrocytes To further establish that the MMP-13 response is linked to transfected with the full-length or truncated DDR2 and cul- activation of DDR2, we transfected a truncated DDR2 cDNA tured on non-coated plates for 24 h (Fig. 6C). These results 554 Activation of Discoidin Domain Receptor 2 and Osteoarthritis collagen between wild-type and cho/ mice at the age of 3 months. However, the further increase in metalloproteinase activity with age in cho/ mice at the age of 6 months is associated with the easily detectable increase in Mmp-13 mRNA and protein levels. In addition, more degraded type II collagen molecules appear in cho/ articular cartilages as the consequence of a high level activity of Mmp-13. Levels of mRNAs encoding other enzymes with collagen- and proteogly- can-degrading activities either were not increased or were un- detectable in the articular cartilage of knee joints of cho/ mice. These results suggest that level and activity of Mmp-13, FIG.7. Effects of protein kinase inhibitors on the levels of an enzyme that can degrade aggrecan as well as collagen (35), DDR2 and MMP-13 mRNA in human chondrocytes cultured on may be a critical factor in the progression of OA in knee joints type II collagen. The C-28/I2 cells were plated on type II collagen and treated with different protein kinase inhibitors for 24 h, and the levels of cho/ mice. This finding is consistent with numerous reports of DDR2 (left panel) and MMP-13 mRNA (right panel) were analyzed by that MMP-13 is up-regulated in the articular cartilage of real-time PCR. human OA joints (16, 21, 22). As a result of the type XI collagen mutation in cho mice, thick demonstrate that activation of DDR2 induces MMP-13 mRNA type II collagen fibers are present and the integrity of the type levels and that the interaction between chondrocytes and type II collagen fibril network is altered (14). Although the amount II collagen is required for the elevation of MMP-13 and DDR2 of type II collagen in the articular cartilage of mutant knee mRNA levels in chondrocytes. joints may not be affected, the distribution of type II collagen in The MEK1 Inhibitor, PD98059, Suppresses the Induction of the articular cartilage is affected, the increased number of MMP-13 mRNA Levels in Human Chondrocytes Cultured on thick type II collagen fibers in close contact with chondrocytes. Type II Collagen-coated Plates—To examine the potential sig- This altered distribution of type II collagen may enhance the naling pathways involved in the up-regulation of MMP-13 by interactions between chondrocytes and type II collagen result- type II collagen-dependent DDR2 activation, we examined the ing in the altered expression of a collagen receptor. Our data effects of pretreatment with three protein kinase inhibitors, demonstrate that the protein and mRNA levels of Ddr2 are AG490 (JAK-2 inhibitor), wortmannin (phosphatidylinositol increased in the articular cartilage of cho/ mice at the age of 3-kinase inhibitor), and PD98059 (MEK1 inhibitor). As shown 6 months. We did not detect an altered expression of other in Fig. 7, the DDR2 mRNA levels in all three inhibitor-treated collagen receptors, including  integrins, annexin V, and Ddr1 cells were increased, but the level of MMP-13 mRNA in chon- on chondrocytes. This suggests that the up-regulation of Ddr2 drocytes cultured on type II collagen-coated plates with the mRNA and protein may result from the receptor binding to its inhibitor, PD98059, was reduced to 25% of the level in cells own ligand, type II collagen, in cho/ mice. cultured on type II collagen-coated plates in the absence of The correspondence between the increased levels of Ddr2 inhibitor (as control). In chondrocytes treated with the other and Mmp-13 protein in the articular cartilage of cho/ mice two inhibitors, AG490 and wortmannin, the MMP-13 mRNA prompted us to investigate a possible role of Ddr2 in regulating levels were the same as in the control cells. These results the expression and activities of other matrix-degrading pro- indicate that the MEK1 inhibitor does not interfere with the teinases in chondrocytes. Data from our in vitro experiments pathways involved in up-regulation of DDR2 mRNA but inhib- demonstrate that the mRNA level of MMP-13 is increased in its signaling downstream of DDR2, resulting in decreased human and mouse chondrocytes when the cells are cultured on MMP13 expression. type II collagen-coated plates for 24 h and that the mRNA DISCUSSION levels of other matrix-degrading proteinases including MMP-1, MMP-3, MMP-8, ADAMTS-4, and ADAMTS-5 are either not In this study, we found that metalloproteinase activity was increased or undetectable. Our data also showed that the slightly increased in articular cartilage of knee joints of cho/ mRNA level of DDR2 is increased in cells cultured on type II mice at the age of 3 months and further increased with aging. collagen. Furthermore, we showed that transfection of a full- This is consistent with our previous observation that the initial length DDR2 cDNA in human chondrocytes results in elevated sign of articular cartilage degeneration in knee and temporo- levels of MMP-13 mRNA. In contrast, the level of MMP-13 mandibular joints of cho/ mice is detected at the age of 3 mRNA is reduced after transfer of a truncated DDR2, lacking months. By real-time PCR we found that mRNA levels of sev- the cytoplasmic domain, into human chondrocytes cultured on eral proteinases including Mmp3, Mmp8, Mmp13, Adamts-4, type II collagen. On the basis of these data, we conclude that and Adamts-5 were not elevated in the articular cartilage of signaling through DDR2 results in up-regulation of MMP-13 in knee joints in cho/ mice at the age of 3 months. It is possible chondrocytes cultured on type II collagen-coated plates. In that the increased enzyme activity at 3 months is due to accu- addition, we conclude that interaction between chondrocytes mulation of protein synthesized over time and to the post- and type II collagen is required, since the MMP-13 mRNA level translational modification and activation of the previously syn- is not changed in chondrocytes, when they are cultured on thesized enzymes. In our previous study, we found that the plastic, after transfection with either full-length or truncated protein expression of Mmp-3 is increased in cho/ mice at the DDR2 cDNA. age of 3 months (14). However, the increased protein expres- The data indicate that the activation of DDR2 by type II sion is not reflected in elevated Mmp-3 mRNA level in cho/ collagen, not only increases expression of MMP-13, but also mice in analysis performed by real-time PCR at a single time up-regulates the expression of DDR2 itself in chondrocytes. point. One possibility is that the pooling of the cartilages from cho/ mice for real-time PCR may dilute the regional increase Since there is little information on the immediate downstream signaling pathways activated by DDR2, we examined three of Mmp-3 mRNA. Furthermore, it is unlikely that the expres- sion and activity of Mmp-13 in cho/ mice at the age of 3 signaling pathways to understand if these pathways are impli- months are elevated because we do not observe the difference cated in the up-regulation of MMP-13 by DDR2 activation. in Mmp-13 immunostaining (14) or in the degradation of type II Based on our results, we conclude that the Ras/Raf/MEK/ERK Activation of Discoidin Domain Receptor 2 and Osteoarthritis 555 12. Spranger, J. (1998) Pediatr. Radiol. 28, 745–750 pathway is involved in the increased expression of MMP-13 by 13. Li, Y., Lacerda, D. A., Warman, M. L., Beier, D. R., Yoshioka, H., Ninomiya, Y., DDR2 activation but not in the up-regulation of DDR2 Oxford, J. T., Morris, N. P., Andrikopoulos, K., Ramirez, F., Wardell, B. B., expression. Lifferth, G. D., Teuscher, C., Woodward, S. R., Taylor, B. A., Seegmiller, R. E., and Olsen, B. R. (1995) Cell 80, 423– 430 It has been reported that IL-1 can induce MMP-13 expres- 14. Xu, L., Flahiff, C. M., Waldman, B. A., Wu, D., Olsen, B. R., Setton, L. A., and sion in chondrocytes and that signal transduction by the NF- Li, Y. (2003) Arthritis Rheum. 48, 2509 –2518 15. Weiss, C. (1973) Fed. Proc. 32, 1459 –1466 B, p38 MAPK, and JNK pathways are required for IL-1- 16. Tetlow, L. C., Adlam, D. J., and Woolley, D. E. (2001) Arthritis Rheum. 44, induced transcription of MMP-13 (36, 37). To know whether 585–594 IL-1 is an intermediate in the regulation of MMP-13 expression 17. Sternlicht, M. D., and Werb, Z. (2001) Annu. Rev. Cell Dev. Biol. 17, 463–516 18. Nagase, H., and Woessner, J. F., Jr. (1999) J. Biol. Chem. 274, 21491–21494 by activation of DDR2, we examined IL-1 mRNA levels in 19. Tortorella, M. D., Burn, T. C., Pratta, M. A., Abbaszade, I., Hollis, J. M., Liu, mouse and human chondrocytes cultured on type II collagen for R., Rosenfeld, S. A., Copeland, R. A., Decicco, C. P., Wynn, R., Rockwell, A., 12 or 24 h. Since IL-1 mRNA was undetectable in the chondro- Yang, F., Duke, J. L., Solomon, K., George, H., Bruckner, R., Nagase, H., Itoh, Y., Ellis, D. M., Ross, H., Wiswall, B. H., Murphy, K., Hillman Jr., cytes cultured on type II collagen-coated plates, it is unlikely M. C., Hollis, G. F., Newton, R. C., Magolda, R. L., Trzaskos, J. M., and that IL-1 plays a role in the regulation of MMP-13 expression Arner, E. C. (1999) Science 284, 1664 –1666 20. Tang, B. L. (2001) Int. J. Biochem. Cell Biol. 33, 33– 44 by DDR2 activation in our chondrocyte culture system. 21. Knauper, V., Lopez-Otin, C., Smith, B., Knight, G., and Murphy. G. (1996) The activation of DDRs requires native collagens such as J. Biol. Chem. 271, 1544 –1550 type I, II, and III collagens (28, 29). Interestingly, we found 22. Mitchell, P. G., Magna, H. A., Reeves, L. M., Lopresti-Morrow, L. L., Yocum, S. A., Rosner, P. J., Geoghegan, K. F., and Hambor, J. E. (1996) J. Clin. that the increased number of thick type II collagen fibers in Invest. 97, 761–768 pericellular region in cho/ articular cartilage. We speculate 23. Neuhold, L. A., Killar, L., Zhao, W., Sung, M. A., Warner, L., Kulik, J., Turner, that the altered structure and arrangement of type II collagen J., Wu, W., Billinghurst, C., Meijers, T., Poole, A. R., Babij, P., and De- Gennaro, L. J. (2001) J. Clin. Invest. 107, 35– 44 fibrils in the cartilages of cho/ mice may elicit the interaction 24. Di Marco, E., Cutuli, N., Guerra, L., Cancedda, R., and De Luca, M. (1993) between chondrocytes and type II collagen fibrils. As a conse- J. Biol. Chem. 268, 24290 –24295 quence, DDR2 is activated to trigger a series of cellular events 25. Lai, C., Gore, M., and Lemke, G. (1994) Oncogene 9, 2567–2578 26. Karn, T., Holtrich, U., Brauninger, A., Bohme, B., Wolf, G., Rubsamen-Waig- leading to synthesis, release, and activation of matrix-degrad- mann, H., and Strebhardt, K. (1993) Oncogene 8, 3433–3440 ing proteinases such as MMP-13 resulting in OA. 27. Alves, F., Vogel, W., Mossie, K., Millauer, B., Hofler, H., and Ullrich, A. (1995) Oncogene 10, 609 – 618 Acknowledgment—The antibody, C1-2C, was a gift provided by Dr. A. 28. Shrivastava, A., Radziejewski, C., Campbell, E., Kovac, L., McGlynn, M., Robin Poole at Shriners Hospitals for Children, Montreal, Quebec, Ryan, T. E., Davis, S., Goldfarb, M. P., Glass, D. J., Lemke, G., and Yancopoulos, G. D. (1997) Mol. Cell 1, 25–34 Canada. 29. Vogel, W., Gish, G. D., Alves, F., and Pawson, T. (1997) Mol. Cell 1, 13–23 REFERENCES 30. Vogel, W., Aszodi, A., Alves, F., and Pawson, T. (2001) Mol. Cell. Biol. 21, 2906 –29017 1. Felson, D. T., Lawrence, R. C., Dieppe, P. A., Hirsch, R., Helmick, C. G., 31. Hou, G., Vogel, W., and Bendeck, M. P. (2001) J. Clin. Invest. 107, 727–735 Jordan, J. M., Kington, R. S., Lane, N. E., Nevitt, M. C., Zhang, Y., Sowers, 32. Labrador, J. P., Azcoitia, V., Tuckermann, J., Lin, C., Olaso, E., Man ˜ es, S., M. F., McAlindon, T., Spector, T. D., Poole, A. R., Yanovski, S. Z., Ateshian, Bru ¨ ckner, K., Goergen, J., Lemke, G., Yancopoulos, G., Angel, P., Martı ´nez, G., Sharma, L., Buckwalter, J. A., Brandt, K. D., and Fries, J. F. (2000) Ann. C., and Klein, R. (2001) EMBO Rep. 2, 446 – 452 Intern. Med. 133, 635– 646 33. Wang, J., Lu, H., Liu, X., Deng, Y., Sun, T., Li, F., Ji, S., Nie, S., and Yao, L. 2. Scott, J. C., Lethbridge-Cejku, M., and Hochberg, M. C. (1999) in Osteoarthri- (2002) J. Autoimmun. 19, 161–168 tis: Clinical and Experimental Aspects (Reginster, J. Y., Pelletier, J. P., 34. Apte, S. S., and Olsen, B. R. (1993) Matrix 13, 165–179 Martel-Pelletier, J., and Henrotin, Y., eds) pp. 20 –52, Springer, Milan, Italy 35. Fosang, A. J., Last, K., Knauper, V., Murphy, G., and Neame, P. J. (1996) 3. Peyron, J. G., and Altman, R. D. (1992) in Ostoarthritis (Moskowitz, R. W., FEBS Lett. 380, 17–20 Howell, D. S., Goldberg, V. M., and Mankin, H. J., eds) pp. 15–37, W. B. 36. Mengshol, J. A., Vincenti, M. P., and Brinckerhoff, C. E. (2001) Nucleic Acids Saunders Co., Philadelphia Res. 29, 4361– 4372 4. Spector, T. D., and MacGregor, A. J. (2004) Osteoarthritis Cartilage 12, 37. Mengshol, J. A., Vincenti, M. P., Coon, C. I., Barchowsky, A., and Brinckerhoff, S39 –SS44 C. E. (2000) Arthritis Rheum. 43, 801– 811 5. Simonet, W. S. (2002) Mol. Genet. Metab. 77, 31–34 38. Ricke, W. A., Smith, G. W., Reynolds, L. P., Redmer, D. A., and Smith, M. F. 6. Loughlin, J. (2002) Rheum. Dis. Clin. North Am. 28, 95–109 (2002) Biol. Reprod. 66, 1083–1094 7. Jimenez, S. A., and Dharmavaram, R. M. (1994) Ann. Rheum. Dis. 53, 789 –797 8. Diab, M. (1993) Orthop. Rev. 22, 165–170 39. Xu, L., Tan, L., Goldring, M. B., Olsen, B. R., and Li, Y. (2001) Matrix Biol. 20, 147–151 9. Reginato, A. M., and Olsen, B. R. (2002) Arthritis Res. 4, 337–345 10. Vikkula, M., and Olsen, B. R. (1996) Ann. Med. 28, 301–304 40. Goldring, M. B., Birkhead, J. R., Suen, L. F., Yamin, R., Mizuno, S., Glowacki, 11. Duance, V. C., and Wotton, S. F. (1991) Biochem. Soc. Trans. 19, 376S J., Arbiser, J. L., and Apperley, J. F. (1994) J. Clin. Invest. 94, 2307–2316

Journal

Journal of Biological Chemistry – American Society for Biochemistry and Molecular Biology

Published: Jan 7, 2005

There are no references for this article.