Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Enolases from Gram-positive bacterial pathogens and commensal lactobacilli share functional similarity in virulence-associated traits

Enolases from Gram-positive bacterial pathogens and commensal lactobacilli share functional... Microbiology, Faculty of Biosciences, Enolase occurs as a cytoplasmic and a surface-associated protein in bacteria. University of Helsinki, PO Box 56, FIN-00014, Enolases of the bacterial pathogens Streptococcus pyogenes, Streptococcus pneumo- Helsinki, Finland. Tel.: 1358 9 19159249; niae and Staphylococcus aureus, as well as of the commensal lactic acid bacteria, fax: 1358 9 19159262; e-mail: jenni.antikainen@helsinki.fi Lactobacillus crispatus and Lactobacillus johnsonii, were purified as His -fusion proteins from recombinant Escherichia coli. The fusion proteins were compared for Present address: Jenni Antikainen, Helsinki putative virulence-associated functions, i.e., binding of human plasminogen, University Central Hospital Laboratory, PO Box enhancement of plasminogen activation by human plasminogen activators, as well 400, 00029 HUS, Helsinki, Finland. as binding to immobilized laminin, fibronectin and collagens. The individual enolases showed varying efficiencies in these functions. In particular, highly and Received 27 February 2007; revised 23 July equally effective interactions with plasminogen and laminin were seen with 2007; accepted 7 August 2007. lactobacillar and staphylococcal enolases. First published online 24 September 2007. DOI:10.1111/j.1574-695X.2007.00330.x Editor: Ewa Sadowy Keywords enolase; lactobacilli; streptococci; laminin; plasminogen. yotic organisms (Miles et al., 1991; Pancholi & Fischetti, Introduction 1998; summarized by Pancholi, 2001). Predicted a-enolase a-Enolase is a metalloenzyme that catalyzes the reversible sequences lack classical protein-sorting elements, such as a conversion of 2-phospho-D-glycerate (2-PGE) to phospho- signal sequence or domains known to anchor proteins onto enolpyruvate; the forward reaction is central in glycolytic the bacterial cell wall, and therefore surface-associated a- pathways of bacteria and higher organisms, whereas the enolases have been included in the family of ‘anchorless’ reverse reaction occurs in gluconeogenesis. The enolase surface proteins expressed by important Gram-positive reaction has a key position in fermentation and glycolysis; bacterial pathogens (reviewed by Chhatwal, 2002; Pan- the enzyme is ubiquitously present in prokaryotic and choli & Chhatwal, 2003). The surface-associated form of eukaryotic organisms, and it is one of the most abundantly a-enolase has multiple functions in bacterium–host interac- expressed cytoplasmic proteins in many organisms (for a tions, which, in particular, have been described in strepto- review, see Pancholi, 2001). Enzymatically active eukaryotic coccal infections (Pancholi, 2001; Bergmann et al., 2005; a-enolase is a dimer of c. 41–50 kDa subunits, whereas some Walker et al., 2005). Streptococcus pneumoniae is one of the bacterial enolases are octameric (Pawluk et al., 1986; Schurig most prevalent agents of pneumonia, otitis media, septice- et al., 1995; Brown et al., 1998; Ehinger et al., 2004). Enolases mia and meningitis, whereas Streptococcus pyogenes (group from different species have over 40% sequence identity, A streptococci) causes tonsillitis, erysipelas, and occasionally conserved catalytic residues, and are comprised of two more severe invasive diseases. In both S. pneumoniae and domains: a small N-terminal and a large C-terminal domain S. pyogenes, enolase binds the abundant human plasmin (Pancholi, 2001). zymogen plasminogen (Plg) and in this way enhances the In addition to the cytoplasmic location, a-enolase is formation of proteolytic plasmin activity (Pancholi & found on the cell surface in many eukaryotic and prokar- Fischetti, 1998; Bergmann et al., 2001, 2003, 2005; Derbise c 2007 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 51 (2007) 526–534 Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 Functions of bacterial enolases 527 et al., 2004), which is important in the pathogenesis of similar Plg-binding proteins in and efficient enhancement of pneumococcal (Bergmann et al., 2005) as well as group A Plg activation by lactobacilli and streptococci offer an streptococcal (Sun et al., 2004) infections. interesting model to compare the Plg system and enolases Plasmin is a serine protease, whose activation on the in bacterial commensalism and pathogenicity. Here, a bacterial surface creates uncontrolled proteolysis and en- comparison of enolases from lactobacilli with enolases from hances bacterial migration in the host by damaging tissue important streptococcal and staphylococcal pathogens is ¨ ¨ barriers (Lahteenmaki et al., 2000, 2005; Bergmann et al., reported. 2005). The binding of Plg onto bacterial and mammalian cells or tissue surfaces is mediated by its lysine-binding Materials and methods kringle domains and thus is sensitive to lysine and its analogs. Binding to lysines alters the conformation of the Bacterial strains and cultivation Plg molecule so that it is more susceptible to activation by human Plg activators, and the forming plasmin is less Lactobacillus crispatus ST1 and Lactobacillus johnsonii F133 susceptible to inactivation by the circulating antiprotease isolated from chicken and calf feces (Fujisawa et al., 1992; a -antiplasmin (Wiman et al., 1979; Mangel et al., 1990). Edelman et al., 2002) were cultivated in static De Man, Conversion of Plg to plasmin results from a single proteo- Rogosa, and Sharpe broth (MRS; Difco Laboratories). The lytic cut by human Plg activators, tissue-type Plg virulent S. pneumoniae TIGR4 had been isolated from the activator (tPA) and urokinase (uPA). Streptococcal and blood of a male patient (Aaberge et al., 1995; Tettelin et al., staphylococcal pathogens express streptokinase and staphy- 2001) and was cultivated in the presence of lokinase, which are Plg activators that nonenzymatically 5% CO in Todd–Hewitt broth (Difco Laboratories) supple- enhance Plg autocleavage and autoactivation (Boyle & mented with 0.2% (w/v) yeast extract. The S. pyogenes strain Lottenberg, 1997; Lahteenm ¨ aki ¨ et al., 2001, 2005; Walker IH32030 of the serotype T1, isolated from a child with et al., 2005). bacteremia (Miettinen et al., 1998), was cultivated in TY a-Enolase may enhance bacterial invasiveness and tissue broth supplemented with 0.2% glucose (Holm & Falsen, damage in the host also by adhesive properties. Laminin, 1967) in the presence of 5% CO . Staphylococcus aureus collagens, and fibronectin are important components of 8325-4, which is derived from the strain NCTC 8325 by basement membranes and extracellular matrices in tissue curing of a prophage (Novick, 1967), was cultivated in barriers, and a-enolase of Staphylococcus aureus mediates tryptic soy broth. Recombinant Escherichia coli strains were bacterial adherence to laminin (Carneiro et al., 2004). cultivated in Luria broth supplemented with relevant anti- Further, enolase of S. pneumoniae enhances plasmin- biotics. All the bacterial cultivations were performed at mediated degradation of the reconstituted basement mem- 37 1C. brane (Bergmann et al., 2005). Evidence also from other bacterial pathogens suggests that bacterial adherence onto Cloning and phylogenetic studies tissue barriers, in concert with engagement of the powerful plasmin proteolysis, increases metastasis of pathogenic Bacterial DNA was extracted with the Qiagen Genomic tip- bacteria into secondary tissue sites or organs (Lahteenm ¨ aki ¨ 20/G (Qiagen) according to the manufacturer’s instructions et al., 2005). after treating the bacteria with lysozyme (20 mg mL ; Recently, the unexpected observation was reported that Sigma Aldrich). Lactobacilli were additionally treated with Lactobacillus crispatus and other commensal species of mutanolysin (50 U mL ; Sigma Aldrich) and Staphylococcus Lactobacillus very efficiently enhance tPA-mediated Plg aureus cells with lysostaphin (0.4 mg mL ; Ambicin L, activation (Hurmalainen et al., 2007). Notably, this activity Ambi Inc.). The enolase genes were amplified using the was attributed to the extracellular proteome of the bacteria, available genomic DNA sequences from S. pneumoniae and a-enolase was identified as a major protein component TIGR4 (NC_003028; Tettelin et al., 2001), S. pyogenes M1 with Plg-binding capacity. The predicted sequence of L. (NC_002737; Ferretti et al., 2001), Staphylococcus aureus crispatus enolase is 49% identical to the virulence-associated 8325-4 (NC_007795; Gillaspy et al., 2006), and L. johnsonii enolase of S. pneumoniae and contains features typical of NCC 533 (NC_005362; Pridmore et al., 2004). The primers enolase proteins (e.g. a monomer size of c. 47 kDa, con- used in this study are listed in Table 1. The eno gene of L. served catalytic site, and Mg -binding sequences). Lacto- crispatus was recently described (AJ849471; Hurmalainen bacilli are members of the normal flora in humans and other et al., 2007). The amplified eno genes from strains L. mammals and are very rarely associated with opportunistic johnsonii F133 and S. pyogenes IH32030 were sequenced in infections (Salvana & Frank, 2006). Rather, the possible the Sequencing Core Facility, Haartman Institute, Univer- health-promoting effects of lactobacilli in humans have sity of Helsinki, Finland. Sequence homologies were ana- focused efforts on their use as probiotics. The presence of lyzed by the CLUSTALW program and the Drawtree application FEMS Immunol Med Microbiol 51 (2007) 526–534  c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 528 J. Antikainen et al. Table 1. Primers used in this study 0 0 Primer 5 –3 sequence Reference Lactobacillus crispatus eno forward CCCGGCATGCATGCTCAAATCAGTTATTG Hurmalainen et al. (2007) eno reverse CCCGTCGACTTAATCGTGATCAACATCGTC Hurmalainen et al. (2007) Lactobacillus johnsonii eno1 forward CCCGGCATGCATGCTCAAATCAGTTATTG This study eno1 reverse CCCGTCGACTTAATCTAAGTCAACGTTGTCTG This study eno2 forward CCCGGCATGCATGACTGTTTATGTAG This study eno2 internal forward GGAGGGAAGCACGCTGATAATGG This study eno2 internal reverse CCATTATCAGCGTGCTTCCCTCC This study eno2 reverse CCCGTCGACCTAATCAAAATCTACATTATTTGG This study eno3 forward CCCGGCATGCATGTCTGTTATTACTG This study eno3 reverse CCCGTCGACTTAAAATTGTTTGTGTAAGTTGTAG This study Streptococcus pneumoniae eno forward CTCCTCGCATGCATGTCAATTATTACTGATGTTTAC This study eno reverse CTCCTCGTCGACTTATTTTTTAAGGTTGTAGAATGATTTC This study Streptococcus pyogenes eno forward CTCCTCGCATGCATGTCAATTATTACTGATGTTTAC This study eno reverse CTCCTCGCATGCTTATTTTTTTAAGTTATAGAATG This study Staphylococcus aureus eno forward CTCCTCGCATGCATGCCAATTATTACAGATGTTTAC This study eno reverse CTCCTCGTCGACTTATTTATCTAAGTTATAGAATG This study Primers were produced by Eurogentec. in PHYLIP (Felsenstein, 2005). The novel nucleotide sequences Enzyme assay of the eno genes sequenced in this work are deposited in The enzymatic activity of His -enolases was assayed by GenBank under the accession numbers EF362411 (L. john- measuring the transformation of 2-PGE to phosphoenol- sonii F133 enolase 1), EF362412 (L. johnsonii F133 enolase pyruvate; the substrate 2-PGE was generated from 3-PGE 2), EF362413 (L. johnsonii F133 enolase 3), and EF362410 (Fluka Chemie) by recombinant His -phosphoglycerate (S. pyogenes IH32030 enolase). mutase cloned from Staphylococcus aureus 8325-4. The assays were performed at 22 1C in 100 mM Hepes, pH 7.0, 10 mM MgCl , 10 mM KCl, 15 mM 3-PGA, and 300 pmol Overexpression and purification of His -tagged 2 phosphoglycerate mutase in a final volume of 0.5 mL. recombinant enolases The reaction was started by adding 20 pmol His -enolase The eno genes were cloned to the SphI–SalI site of pQE-30 in 10 mL PBS, and the increase in the formation of phos- vector (Qiagen) for expression as N-terminal His -fusion phoenolpyruvate was measured spectrophotometrically at proteins. The eno2 gene of L. johnsonii contains an internal 240 nm. SphI site, and therefore the internal primers were designed to mutate the nucleotides CAT to the degenerate triplet Transcription of eno1--3 genes by L. johnsonii CAC also encoding histidine. The His -enolase construct F133 of L. crispatus ST1 was available from previous studies (Hurmalainen et al., 2007). The His -enolase proteins were Lactobacillus johnsonii F133 cells from exponential growth expressed in E. coli M15 (pREP4) and purified under phase were treated with mutanolysin (50 U mL ) and s 1 nondenaturating conditions using the Qiaexpress Protein lysozyme (20 mg mL )at37 1C for 15 min in 50 mM Tris- Purification System (Qiagen). The proteins were extensively HCl, pH 8, and total RNA was extracted with the RNeasy dialyzed against phosphate-buffered saline (PBS; pH 7.1), mini kit (Qiagen) according to the manufacturer’s instruc- and their concentrations were adjusted after sodium dodecyl tions. The RNA was incubated at 37 1C with RQ1 DNase sulfate polyacrylamide gel electrophoresis (SDS-PAGE) as (Promega), and the presence of eno mRNAs was assessed by ¨¨ described by Sillanpaa et al. (2000). In each functional reverse transcriptase PCR (RT-PCR) with the RobusT RT- assay, freshly prepared His -enolase protein preparations PCR kit (Finnzymes) according to the manufacturer’s 0 0 were used. instructions, using as primers the 5 and 3 end sequences c 2007 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 51 (2007) 526–534 Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 Functions of bacterial enolases 529 of the eno genes (Table 1). After 30 amplification cycles, the Results PCR products were analyzed by agarose gel electrophoresis. The specificity of each primer pair was analyzed by PCR Predicted enolase sequences from pathogens using amplified eno1–3 genes as templates. and commensals The eno genes were cloned from three pathogenic species (S. pneumoniae, S. pyogenes, Staphylococcus aureus) and two Molecular mass of enolase of L. crispatus commensal lactobacillar species (L. crispatus and L. johnso- To estimate the molecular mass, enolases were eluted in an nii). A single eno gene is present in the published genomes of analytical gel filtration column (HiLoad 16/60 Superdex 200 S. pneumoniae, S. pyogenes, and Staphylococcus aureus (Fer- prep grade; GE Healthcare). High-molecular-weight stan- retti et al., 2001; Tettelin et al., 2001; Gillaspy et al., 2006), dard markers were from GE Healthcare. Enolase-containing and according to the present analysis also in L. crispatus ST1 fractions were determined by Western blotting using a His - (Hurmalainen et al., 2007). However, three predicted eno monoclonal antibody (Clontech) and alkaline-phosphatase- genes are present in the genome of L. johnsonii NCC 533 conjugated anti-mouse immunoglobulins (Dako), or using (Pridmore et al., 2004), and their nucleotide sequences were antienolase immunoglobulins (Hurmalainen et al., 2007) utilized to clone eno1–3 from genomic DNA of L. johnsonii and alkaline-phosphatase-conjugated anti-rabbit immuno- F133. The obtained reading frames EF362411 (eno1), globulins (Dako). EF362412 (eno2), and EF362413 (eno3) showed over 97% sequence identity with the corresponding genes of L. johnso- nii NCC 533 (LJ1416, LJ1246, LJ0875). The predicted amino Binding to tissue proteins and plasminogen acid sequence of S. pyogenes IH32030 enolase (EF362410) is The binding of His -enolases to laminin (Upstate), fibro- 100% identical to the sequence of enolase from S. pyogenes nectin (Sigma Aldrich), collagen types I and IV (Sigma M1 (Ferretti et al., 2001). Figure 1 shows a cladogram Aldrich), bovine serum albumin (BSA; Sigma Aldrich), and presentation of the predicted amino acid sequence identity Plg (American Diagnostica) was measured by an enzyme- of the seven enolase proteins of this study. Two subfamilies linked immunosorbent assay (ELISA) as detailed (Sillanpa¨a¨ are apparent; L. crispatus enolase shares 93% sequence et al., 2000). Briefly, polystyrene microtiter plates were identity with Eno1 of L. johnsonii and 72% identity with coated with the target proteins at 2.5 pmol well and His - Eno2 of L. johnsonii. The other subfamily is formed by enolases (12.5 pmol) were incubated in the wells for 1 h at enolases from Staphylococcus aureus and streptococci as well 50 mM Tris-HCl, pH 8. After washing, detection of the as by Eno3 of L. johnsonii. The sequences of S. pneumoniae bound proteins was performed with the His -monoclonal and S. pyogenes enolases have 94% identity with each other, antibody and alkaline-phosphatase-conjugated anti-mouse 81% identity with Staphylococcus aureus enolase, and 68% immunoglobulins. In inhibition assays, 1 mM e-aminoca- identity with L. johnsonii enolase 3. proic acid (EACA; Sigma Aldrich) was added. The reactivity of each His -enolase with the His -monoclonal antibody 6 6 Expression of enolases as His -fusion proteins was ascertained by ELISA. To assess the protein binding by enolase in the extracellular proteome of L. crispatus ST1, the The enolases were expressed as His -fusion proteins and cell-free supernatant of ST1 obtained after a 1-h incubation purified by affinity chromatography under nondenaturating at 50 mM Tris-HCl, pH 8 (Hurmalainen et al., 2007), was conditions. The SDS-PAGE analysis of the His -enolases is incubated with the immobilized target proteins for 1 h, and shown in Fig. 2a. The apparent molecular weights of after extensive washing, the bound enolase was detected using antienolase immunoglobulins and alkaline-phospha- tase-conjugated anti-rabbit immunoglobulins as secondary antibodies. Enhancement of plasminogen activation The enhancement of tPA-mediated Plg activation in the presence of the His -enolases was measured as described recently (Hurmalainen et al., 2007). Briefly, 137 nM of the Fig. 1. Phylogenetic relationship of the enolases. A phylogenetic un- His -enolase protein was incubated with 4 mg of Plg, 2 ng of rooted tree of amino acid sequence alignment of the single enolase either tPA (Biopool) or uPA (American Diagnostica), and proteins from Lactobacillus crispatus, Streptococcus pneumoniae, Strep- 0.45 mM of the chromogenic substrate S-2251 of plasmin tococcus pyogenes, and Staphylococcus aureus as well as of the three enolases (Eno1–3) from Lactobacillus johnsonii. (Kabivitrum) in a final volume of 200 mL of PBS. FEMS Immunol Med Microbiol 51 (2007) 526–534  c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 530 J. Antikainen et al. enolases varied from 46.6 to 47.3 kDa; their calculated to be specific for the particular eno variant of L. johnsonii molecular sizes varied between 46.6 and 47.4 kDa. The F133 (data not shown). enolase proteins reacted equally well with the anti-His - monoclonal antibody in an ELISA assay (data not shown). Multimeric state of enolase from L. crispatus Next, the enolase activity of each His -protein was assessed Ehinger et al. (2004) reported that the enolase of by a coupled reaction using 2-PGE as a substrate. All S. pneumoniae has an octameric structure 377 kDa in size; enolases were enzymatically active (data not shown). this was assessed by analytical gel filtration as well as by crystal structure determination. To compare the L. crispatus enolase with the pneumococcal one, the possible multimeric Transcription of enolases 1--3 of L. johnsonii state of enolase of L. crispatus ST1 was analyzed by analytical The transcription of the eno1–3 genes of L. johnsonii F133 gel filtration. The enolase in the extracellular proteome was next assessed by RT-PCR using primers complementary obtained from L. crispatus ST1 eluted as a 370 kDa protein, 0 0 to the 5 and the 3 ends of each eno ORF. The eno1 and the which corresponds to the predicted molecular weight of eno3 genes were transcribed in cells from the logarithmic an octameric multimer (374 kDa). The His -enolase of growth phase, whereas no transcription of eno2 was detected L. crispatus eluted as a 415 kDa protein. Similarly, the His - (Fig. 2b). The amplicons are consistent with the nucleotide enolase of S. pneumoniae eluted as a 415 kDa protein. These sizes 1284 bp for eno1 and 1296 bp for eno3. Control reac- results suggest that the enolase of L. crispatus ST1, as tions without reverse transcriptase gave no amplicons (Fig. reported earlier for the pneumococcal enolase (Ehinger 2b). The primer pairs in each of amplifications were found et al., 2004), forms an octameric structure both in L. crispatus and in recombinant E. coli. Plasminogen binding and enhancement of plasmin formation by the enolases Binding of human Plg is a virulence function of enolases from bacterial pathogens (Bergmann et al., 2005). The Plg- binding property of the seven His -enolase proteins was compared (Fig. 3a). Lactobacillus crispatus enolase, L. john- sonii enolases 1 and 2, as well as the Staphylococcus aureus enolase efficiently bound Plg, whereas a lower level of Plg binding was detected with the L. johnsonii enolase 3 and with the S. pneumoniae and S. pyogenes enolases (Fig. 3a). With all enolases, the lysine analog EACA inhibited Plg binding. Next, the enhancement of tPA- and uPA-mediated Plg activation by the His -enolases was assessed. In the presence of either tPA or uPA, enolases of Staphylococcus aureus and L. crispatus as well as L. johnsonii enolase 1 and 2 enhanced plasmin formation more efficiently than did the L. johnsonii enolase 3 and the streptococcal enolases (Fig. 3b). Binding of the enolases to extracellular matrix proteins Enolase of Staphylococcus aureus has been identified as a laminin-binding protein on the bacterial surface (Carneiro Fig. 2. SDS-PAGE analysis and enzymatic activity of the His6-enolases, and transcription of eno1–3 genes in Lactobacillus johnsonii. (a) SDS- et al., 2004) and adhesive properties have also been identi- PAGE analysis of the His -enolases of Lactobacillus (Lactobacillus crispa- fied with other ‘anchorless’ surface proteins (Pancholi & tus, L. johnsonii), Streptococcus (Streptococcus pneumoniae, Strepto- Chhatwal, 2003). Here, the binding of the His -enolases to coccus pyogenes)and Staphylococcus (Staphylococcus aureus) purified laminin, fibronectin, collagen I and IV as well as to BSA was from recombinant Escherichia coli. The migration distances of molecular assessed. Enolases of Staphylococcus aureus and L. crispatus markers (size in kilodaltons) are indicated on the left. (b) Presence of eno- as well as the enolases of L. johnsonii bound to laminin, specific mRNA in L. johnsonii F133; the analysis is shown with (1)and whereas the streptococcal enolases showed lower affinity without ( ) reverse transcriptase in the reaction. Size markers in kilobasepairs are indicated on the left. (Fig. 4). Further, a strong binding to collagen I was seen with c 2007 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 51 (2007) 526–534 Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 Functions of bacterial enolases 531 Fig. 3. Binding of plasminogen and enhancement of plasmin formation by the His -enolases. (a) Binding of His -enolases of Lactobacillus 6 6 (Lactobacillus crispatus, Lactobacillus johnsonii ), Streptococcus (Strepto- Fig. 4. Binding of His -enolases and enolase in lactobacillar extracellular coccus pneumoniae, Streptococcus pyogenes), and Staphylococcus proteome to extracellular matrix proteins. Binding of His -enolases of (Staphylococcus aureus) to plasminogen (black columns) was measured Lactobacillus (Lactobacillus crispatus, Lactobacillus johnsonii ), Strepto- by ELISA; binding in the presence of the lysine analog EACA (gray coccus (Streptococcus pneumoniae, Streptococcus pyogenes), and Sta- columns) is also shown. (b) Enhancement of tPA-mediated and uPA- phylococcus (Staphylococcus aureus) to laminin, fibronectin, collagen I, mediated plasminogen activation by the His -enolases. The means and and BSA was quantitated with the anti-His monoclonal antibody (left the range of values in duplicate samples from a representative experi- panel). Binding of enolase in the extracellular proteome of L. crispatus ment are shown. was assessed with anti-enolase immunoglobulins (right panel). The results are means of duplicate samples from a representative experiment; the range of values are also shown. L. crispatus enolase and with the Staphylococcus aureus enolase, whereas the other enolases were moderate or poor in binding. None of the proteins bound to immobi- lized human plasma fibronectin, collagen IV, or to BSA. extracellular proteome of commensal lactobacilli (Hurma- Detection by ELISA with immunoglobulins specific for L. lainen et al., 2007). As a first step in the characterization of crispatus enolase showed that also the enolase in the extra- the biological role(s) of lactobacillar surface enolases and in cellular proteome of L. crispatus bound to laminin comparing the Plg system in bacterial pathogenesis and and collagen I, but not to fibronectin, collagen IV, or BSA commensalism, enolases were compared in vitro for putative (Fig. 4). virulence- or colonization-associated functions. Enolases were assessed for binding and activation of human Plg as well as for adhesiveness to proteins of the extracellular Discussion matrix, which are important features in bacterial invasive- Enolases are multifunctional and important virulence fac- ness and colonization. In these functions, the individual tors for streptococcal and staphylococcal pathogens, where enolases showed differences that are not correlated with the they occur as cell-wall-associated as well as intracellular virulence of the bacterial species or with the overall sequence proteins (Pancholi & Fischetti, 1998; Bergmann et al., 2003, identity of the enolase molecules. 2005; Pancholi & Chhatwal, 2003; Derbise et al., 2004; Lactobacilli are fermentative organisms and dependent Walker et al., 2005). Enolases, however, are ubiquitous on glycolysis as a source of energy. The importance of enzymes and are also present on the cell wall and in the enolase for these bacteria is stressed by the fact that the FEMS Immunol Med Microbiol 51 (2007) 526–534  c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 532 J. Antikainen et al. genome of L. johnsonii contains three eno genes, eno1–3 lactobacillar enolases, which suggests that domain structures (Pridmore et al., 2004), and that a few other published in enolase proteins are involved in Plg binding. genomic sequences of lactobacilli also encode more than one The comparison of the enolases from pathogens and enolase variant (Kleerebezem et al., 2003; Makarova et al., commensals in this study relied on using His -enolases from 2006). The eno1 gene of L. johnsonii NCC 533 is located next recombinant E. coli. Ehinger et al. (2004) showed that the to genes involved in the glycolytic pathway (Pridmore et al., enolase from S. pneumoniae is an octamer with a size of 2004), whereas the eno2 and eno3 genes are located on other 377 kDa. Apparently, L. crispatus enolase also is an octamer chromosomal regions. It was found that the eno2 of L. both in the extracellular proteome from L. crispatus and as a johnsonii F133 was not transcribed under the culture condi- His -protein purified from E. coli. His -enolase as well as 6 6 tions that were used. The His -enolase 2 protein from enolase in the extracellular proteome released from recombinant E. coli was, however, of apparently full size, L. crispatus adhered to laminin and type I collagen, which enzymatically active, and highly efficient in Plg binding. The indicates that the binding is not a property of recombinant biological roles of multiple enolases in lactobacilli remain to His -enolase alone. Adhesion to laminin, previously shown be characterized. with enolase purified from the Staphylococcus aureus cell The assays showed that His -enolases from L. crispatus, surface (Carneiro et al., 2004), was confirmed with the His - 6 6 L. johnsonii (enolases 1 and 2) as well as from Staphylococcus enolase in this study, and it was shown that the Staphylo- aureus were equally efficient in Plg binding and enhance- coccus aureus enolase also adheres to type I collagen. Further, ment of its activation by tPA and uPA, whereas enolase 3 the His -enolases were enzymatically active towards the from L. johnsonii and the streptococcal enolases were less substrate 2-PGE. Thus, it appears that the His -enolases are active. The high activity of lactobacillar enolases is consis- functionally similar to the bacterial enolases expressed by tent with a previous work showing that L. crispatus and their natural host species. L. johnsonii rapidly enhance tPA-mediated Plg activation The results show that virulence-associated functions of (Hurmalainen et al., 2007). Binding of Plg to the enolases streptococcal and staphylococcal enolases, Plg activation was inhibited by the lysine analog EACA, which indicates and adhesiveness, are exhibited by enolases from commensal involvement of the kringle domains of Plg in the binding. lactobacilli as well. Lactobacilli release their enolase at C-terminal lysines form active epitopes in several Plg-binding neutral pH into the medium, whereas at acidic pH enolase proteins, including the enolases of S. pyogenes (Derbise et al., is attached to the cell wall (Antikainen et al., 2007). This 2004) and pneumococci (Bergmann et al., 2001). It is variation is likely to influence the effectiveness of the noteworthy that the sequences of the lactobacillar enolases lactobacillar enolases in engagement of cell-associated plas- studied here do not contain C-terminal lysines (Pridmore min as well as in bacterial adhesion. The Plg activator et al., 2004; Hurmalainen et al., 2007). Bergmann et al. streptokinase has a well-established role in the pathogenesis (2003) identified another, internal Plg-binding site in the of S. pyogenes infections (Khil et al., 2003); its homologs are pneumococcal enolase, i.e., the sequence FYDKERKVY not present in the sequenced genomes of Lactobacillus that is located on the outer surface of the octameric species. Further, significant formation of plasmin was de- molecule (Ehinger et al., 2004) and where the lysines and tected with L. crispatus and L. johnsonii only in the presence glutamic acid are important for Plg binding (Bergmann of tPA or uPA (Hurmalainen et al., 2007), suggesting that et al., 2005). A related sequence FYNKDDHKY is present lactobacilli lack the endogenous potential for Plg activation. in L. crispatus enolase, but ongoing analyses have shown that Thus, the interaction with the Plg system may serve different substitution of the two lysines in this sequence only margin- purposes in lactobacilli than in pathogenic bacteria. The ally decreased enhancement of tPA-mediated Plg activation biological role of enolases in Lactobacillus–host interactions by the protein (J. Antikainen and V. Kuparinen, unpublished and commensalism as well as their potential health risk in data). The His -enolase from Staphylococcus aureus was opportunistic infections (Salvana & Frank, 2006) deserve highly active in Plg binding and enhancement of its activa- further studies. tion. It is notable that its sequence does not contain a consensus sequence for the internal Plg-binding site; the sequence is FYENGVYDY. Thus, it seems that basic Acknowledgements amino acid residues elsewhere in enolases of L. crispatus and Staphylococcus aureus are critical for Plg binding; it was The authors thank Raili Lameranta and Vesa Kirjavainen recently reported that arginine and histidine residues in target for technical assistance. This study has been supported proteins are also important in immobilization of Plg (San- by the Academy of Finland (grant number 1116507, the derson-Smith et al., 2006, 2007). Interestingly, the staphylo- Microbes and Man Programme, grant numbers 105824, coccal enolase is in overall sequence more close to enolases 211300, 80666, and 201967), the Alfred Kordelin Founda- showing poor Plg-binding activity than to the highly active tion, the Foundation for Nutritional Research, the c 2007 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 51 (2007) 526–534 Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 Functions of bacterial enolases 533 EuroPathoGenomics Network of Excellence of the European Ferretti JJ, McShan WM, Ajdic D et al. (2001) Complete genome Union, as well as the University of Helsinki. sequence of an M1 strain of Streptococcus pyogenes. Proc Natl Acad Sci USA 98: 4658–4663. Fujisawa T, Benno Y, Yaeshima T & Mitsuoka T (1992) Taxonomic study of the Lactobacillus acidophilus group, with References recognition of Lactobacillus gallinarum sp. nov. and Aaberge IS, Eng J, Lermark G & Lvik M (1995) Virulence of Lactobacillus johnsonii sp. nov. and synonymy of Lactobacillus acidophilus group A3 (Johnson et al. 1980) with the type strain Streptococcus pneumoniae in mice: a standardized method for preparation and frozen storage of the experimental bacterial of Lactobacillus amylovorus (Nakamura 1981). Int J Syst inoculum. Microb Pathog 18: 141–152. Bacteriol 42: 487–491. Antikainen J, Kuparinen V, Lahteenm ¨ aki ¨ K & Korhonen TK Gillaspy AF, Worrell V, Orvis J, Roe BA, Dyer DW & Iandolo JJ (2007) pH-dependent association of enolase and GAPDH of (2006) The Staphylococcus aureus NCTC 8325 genome. Gram- Lactobacillus crispatus with the cell wall and lipoteichoic acids. positive pathogens (Fischetti VA, Novick R, Ferretti JJ, Portnoy J Bacteriol 189: 4539–4543. DA & Rood JI, eds), pp. 381–412. ASM Press, Washington, Bergmann S, Rohde M, Chhatwal GS & Hammerschmidt S DC. (2001) alpha-Enolase of Streptococcus pneumoniae is a Holm SE & Falsen E (1967) An antigenin-free medium for plasmin(ogen)-binding protein displayed on the bacterial cell cultivation of b-hemolytic streptococci. Acta Path Microbiol surface. Mol Microbiol 40: 1273–1287. Scand 69: 264–276. Bergmann S, Wild D, Diekmann O, Frank R, Bracht D, Chhatwal Hurmalainen V, Edelman S, Antikainen J, Baumann M, GS & Hammerschmidt S (2003) Identification of a novel Lahteenm ¨ aki ¨ K & Korhonen TK (2007) Extracellular proteins plasmin(ogen)-binding motif in surface displayed alpha- of Lactobacillus crispatus enhance activation of human enolase of Streptococcus pneumoniae. Mol Microbiol 49: plasminogen. Microbiol 153: 1112–1122. 411–423. Khil J, Im M, Heath A, Ringdahl U, Mundada L, Engleberg NC & Bergmann S, Rohde M, Preissner KT & Hammerschmidt S Fay WP (2003) Plasminogen enhances virulence of group A (2005) The nine residue plasminogen-binding motif of the streptococci by streptokinase-dependent and streptokinase- pneumococcal enolase is the major cofactor of plasmin- independent mechanisms. J Infect Dis 188: 497–505. mediated degradation of extracellular matrix, dissolution of Kleerebezem M, Boekhorst J, van Kranenburg R et al. (2003) fibrin and transmigration. Thromb Haemost 94: 304–311. Complete genome sequence of Lactobacillus plantarum Boyle MD & Lottenberg R (1997) Plasminogen activation by WCFS1. Proc Natl Acad Sci USA 100: 1990–1995. invasive human pathogens. Thromb Haemost 77: 1–10. Lahteenm ¨ aki ¨ K, Kuusela P & Korhonen TK (2000) Plasminogen Brown CK, Kuhlman PL, Mattingly S, Slates K, Calie PJ & Farrar activation in degradation and penetration of extracellular WW (1998) A model of the quaternary structure of enolases, matrices and basement membranes by invasive bacteria. based on structural and evolutionary analysis of the octameric Methods 21: 125–132. enolase from Bacillus subtilis. J Protein Chem 17: 855–866. Lahteenm ¨ aki ¨ K, Kuusela P & Korhonen TK (2001) Bacterial Carneiro CR, Postol E, Nomizo R, Reis LF & Brentani RR (2004) plasminogen activators and receptors. FEMS Microbiol Rev 25: Identification of enolase as a laminin-binding protein on the 531–552. surface of Staphylococcus aureus. Microbes Infect 6: 604–608. Lahteenm ¨ aki ¨ K, Edelman S & Korhonen TK (2005) Bacterial Chhatwal GS (2002) Anchorless adhesins and invasins of Gram- metastasis: the host plasminogen system in bacterial invasion. positive bacteria: a new class of virulence factors. Trends Trends Microbiol 13: 79–85. Microbiol 10: 205–208. Makarova K, Slesarev A, Wolf Y et al. (2006) Comparative Derbise A, Song YP, Parikh S, Fischetti VA & Pancholi V (2004) genomics of the lactic acid bacteria. Proc Natl Acad Sci USA Role of the C-terminal lysine residues of streptococcal surface 103: 15611–15616. enolase in Glu- and Lys-plasminogen-binding activities of Mangel WF, Lin BH & Ramakrishnan V (1990) Characterization group A streptococci. Infect Immun 72: 94–105. of an extremely large, ligand-induced conformational change Edelman S, Westerlund-Wikstrom ¨ B, Leskela¨ S, Kettunen H, in plasminogen. Science 248: 69–73. Rautonen N, Apajalahti J & Korhonen TK (2002) In vitro Miettinen M, Matikainen S, Vuopio-Varkila J, Pirhonen J, Varkila adhesion specificity of indigenous lactobacilli within the avian K, Kurimoto M & Julkunen I (1998) Lactobacilli and intestinal tract. Appl Environ Microbiol 68: 5155–5159. streptococci induce interleukin-12 (IL-12), IL-18, and gamma Ehinger S, Schubert WD, Bergmann S, Hammerschmidt S & interferon production in human peripheral blood Heinz DW (2004) Plasmin(ogen)-binding alpha-enolase from mononuclear cells. Infect Immun 66: 6058–6062. Streptococcus pneumoniae: crystal structure and evaluation of Miles LA, Dahlberg CM, Plescia J, Felez J, Kato K & Plow EF plasmin(ogen)-binding sites. J Mol Biol 343: 997–1005. Felsenstein J (2005). PHYLIP (Phylogeny Inference Package) (1991) Role of cell-surface lysines in plasminogen binding to version 3.6. Distributed by the author. Department of Genome cells: identification of alpha-enolase as a candidate Sciences, University of Washington, Seattle. plasminogen receptor. Biochemistry 30: 1682–1691. FEMS Immunol Med Microbiol 51 (2007) 526–534  c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 534 J. Antikainen et al. Novick R (1967) Properties of a cryptic high-frequency by arginine and histidine residues within the a1 and a2 repeat transducing phage in Staphylococcus aureus. Virology 33: domains. J Biol Chem 281: 25965–25971. 155–166. Sanderson-Smith ML, Dowton M, Ranson M & Walker MJ Pancholi V (2001) Multifunctional alpha-enolase: its role in (2007) The PAM related protein Prp binds plasminogen via diseases. Cell Mol Life Sci 58: 902–920. arginine and histidine residues. J Bacteriol 189: 1435–1440. Pancholi V & Chhatwal GS (2003) Housekeeping enzymes as Schurig H, Rutkat K, Rachel R & Jaenicke R (1995) Octameric virulence factors for pathogens. Int J Med Microbiol 293: enolase from the hyperthermophilic bacterium Thermotoga 391–401. maritima: purification, characterization, and image Pancholi V & Fischetti VA (1998) alpha-enolase, a novel strong processing. Protein Sci 4: 228–236. ¨¨ ´ plasmin(ogen) binding protein on the surface of pathogenic SillanpaaJ,Martınez B, Antikainen J et al. (2000) streptococci. J Biol Chem 273: 14503–14515. Characterization of the collagen-binding S-layer protein CbsA Pawluk A, Scopes RK & Griffiths-Smith K (1986) Isolation and of Lactobacillus crispatus. J Bacteriol 182: 6440–6450. properties of the glycolytic enzymes from Zymomonas mobilis. Sun H, Ringdahl U, Homeister JW, Fay WP, Engleberg NC, Yang The five enzymes from glyceraldehyde-3-phosphate AY, Rozek LS, Wang X, Sjobring ¨ U & Ginsburg D (2004) dehydrogenase through to pyruvate kinase. Biochem J 238: Plasminogen is a critical host pathogenicity factor for group A 275–281. : 1283–1286. streptococcal infection. Science 305 Pridmore RD, Berger B, Desiere F et al. (2004) The genome Tettelin H, Nelson KE, Paulsen IT et al. (2001) Complete genome sequence of the probiotic intestinal bacterium Lactobacillus sequence of a virulent isolate of Streptococcus pneumoniae. johnsonii NCC 533. Proc Natl Acad Sci USA 101: Science 293: 498–506. 2512–2517. Walker MJ, McArthur JD, McKay F & Ranson M (2005) Is Salvana EM & Frank M (2006) Lactobacillus endocarditis: case plasminogen deployed as a Streptococcus pyogenes virulence report and review of cases reported since 1992. J Infect 53: factor? Trends Microbiol 13: 308–313. e5–e10. Wiman B, Linjen HR & Collen D (1979) On the specific Sanderson-Smith ML, Walker MJ & Ranson M (2006) The interaction between the lysine-binding sites in plasmin and maintenance of high affinity plasminogen binding by group A complementary sites in a2-antiplasmin and in fibrinogen. streptococcal plasminogen-binding M-like protein is mediated Biochim Biophys Acta 579: 142–154. c 2007 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 51 (2007) 526–534 Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of the Endocrine Society Oxford University Press

Enolases from Gram-positive bacterial pathogens and commensal lactobacilli share functional similarity in virulence-associated traits

Download PDF
9 pages

Loading next page...
 
/lp/oxford-university-press/enolases-from-gram-positive-bacterial-pathogens-and-commensal-HpFpQqmrpl

References (44)

Publisher
Oxford University Press
Copyright
© 2007 Federation of European Microbiological Societies
eISSN
2472-1972
DOI
10.1111/j.1574-695X.2007.00330.x
pmid
17892475
Publisher site
See Article on Publisher Site

Abstract

Microbiology, Faculty of Biosciences, Enolase occurs as a cytoplasmic and a surface-associated protein in bacteria. University of Helsinki, PO Box 56, FIN-00014, Enolases of the bacterial pathogens Streptococcus pyogenes, Streptococcus pneumo- Helsinki, Finland. Tel.: 1358 9 19159249; niae and Staphylococcus aureus, as well as of the commensal lactic acid bacteria, fax: 1358 9 19159262; e-mail: jenni.antikainen@helsinki.fi Lactobacillus crispatus and Lactobacillus johnsonii, were purified as His -fusion proteins from recombinant Escherichia coli. The fusion proteins were compared for Present address: Jenni Antikainen, Helsinki putative virulence-associated functions, i.e., binding of human plasminogen, University Central Hospital Laboratory, PO Box enhancement of plasminogen activation by human plasminogen activators, as well 400, 00029 HUS, Helsinki, Finland. as binding to immobilized laminin, fibronectin and collagens. The individual enolases showed varying efficiencies in these functions. In particular, highly and Received 27 February 2007; revised 23 July equally effective interactions with plasminogen and laminin were seen with 2007; accepted 7 August 2007. lactobacillar and staphylococcal enolases. First published online 24 September 2007. DOI:10.1111/j.1574-695X.2007.00330.x Editor: Ewa Sadowy Keywords enolase; lactobacilli; streptococci; laminin; plasminogen. yotic organisms (Miles et al., 1991; Pancholi & Fischetti, Introduction 1998; summarized by Pancholi, 2001). Predicted a-enolase a-Enolase is a metalloenzyme that catalyzes the reversible sequences lack classical protein-sorting elements, such as a conversion of 2-phospho-D-glycerate (2-PGE) to phospho- signal sequence or domains known to anchor proteins onto enolpyruvate; the forward reaction is central in glycolytic the bacterial cell wall, and therefore surface-associated a- pathways of bacteria and higher organisms, whereas the enolases have been included in the family of ‘anchorless’ reverse reaction occurs in gluconeogenesis. The enolase surface proteins expressed by important Gram-positive reaction has a key position in fermentation and glycolysis; bacterial pathogens (reviewed by Chhatwal, 2002; Pan- the enzyme is ubiquitously present in prokaryotic and choli & Chhatwal, 2003). The surface-associated form of eukaryotic organisms, and it is one of the most abundantly a-enolase has multiple functions in bacterium–host interac- expressed cytoplasmic proteins in many organisms (for a tions, which, in particular, have been described in strepto- review, see Pancholi, 2001). Enzymatically active eukaryotic coccal infections (Pancholi, 2001; Bergmann et al., 2005; a-enolase is a dimer of c. 41–50 kDa subunits, whereas some Walker et al., 2005). Streptococcus pneumoniae is one of the bacterial enolases are octameric (Pawluk et al., 1986; Schurig most prevalent agents of pneumonia, otitis media, septice- et al., 1995; Brown et al., 1998; Ehinger et al., 2004). Enolases mia and meningitis, whereas Streptococcus pyogenes (group from different species have over 40% sequence identity, A streptococci) causes tonsillitis, erysipelas, and occasionally conserved catalytic residues, and are comprised of two more severe invasive diseases. In both S. pneumoniae and domains: a small N-terminal and a large C-terminal domain S. pyogenes, enolase binds the abundant human plasmin (Pancholi, 2001). zymogen plasminogen (Plg) and in this way enhances the In addition to the cytoplasmic location, a-enolase is formation of proteolytic plasmin activity (Pancholi & found on the cell surface in many eukaryotic and prokar- Fischetti, 1998; Bergmann et al., 2001, 2003, 2005; Derbise c 2007 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 51 (2007) 526–534 Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 Functions of bacterial enolases 527 et al., 2004), which is important in the pathogenesis of similar Plg-binding proteins in and efficient enhancement of pneumococcal (Bergmann et al., 2005) as well as group A Plg activation by lactobacilli and streptococci offer an streptococcal (Sun et al., 2004) infections. interesting model to compare the Plg system and enolases Plasmin is a serine protease, whose activation on the in bacterial commensalism and pathogenicity. Here, a bacterial surface creates uncontrolled proteolysis and en- comparison of enolases from lactobacilli with enolases from hances bacterial migration in the host by damaging tissue important streptococcal and staphylococcal pathogens is ¨ ¨ barriers (Lahteenmaki et al., 2000, 2005; Bergmann et al., reported. 2005). The binding of Plg onto bacterial and mammalian cells or tissue surfaces is mediated by its lysine-binding Materials and methods kringle domains and thus is sensitive to lysine and its analogs. Binding to lysines alters the conformation of the Bacterial strains and cultivation Plg molecule so that it is more susceptible to activation by human Plg activators, and the forming plasmin is less Lactobacillus crispatus ST1 and Lactobacillus johnsonii F133 susceptible to inactivation by the circulating antiprotease isolated from chicken and calf feces (Fujisawa et al., 1992; a -antiplasmin (Wiman et al., 1979; Mangel et al., 1990). Edelman et al., 2002) were cultivated in static De Man, Conversion of Plg to plasmin results from a single proteo- Rogosa, and Sharpe broth (MRS; Difco Laboratories). The lytic cut by human Plg activators, tissue-type Plg virulent S. pneumoniae TIGR4 had been isolated from the activator (tPA) and urokinase (uPA). Streptococcal and blood of a male patient (Aaberge et al., 1995; Tettelin et al., staphylococcal pathogens express streptokinase and staphy- 2001) and was cultivated in the presence of lokinase, which are Plg activators that nonenzymatically 5% CO in Todd–Hewitt broth (Difco Laboratories) supple- enhance Plg autocleavage and autoactivation (Boyle & mented with 0.2% (w/v) yeast extract. The S. pyogenes strain Lottenberg, 1997; Lahteenm ¨ aki ¨ et al., 2001, 2005; Walker IH32030 of the serotype T1, isolated from a child with et al., 2005). bacteremia (Miettinen et al., 1998), was cultivated in TY a-Enolase may enhance bacterial invasiveness and tissue broth supplemented with 0.2% glucose (Holm & Falsen, damage in the host also by adhesive properties. Laminin, 1967) in the presence of 5% CO . Staphylococcus aureus collagens, and fibronectin are important components of 8325-4, which is derived from the strain NCTC 8325 by basement membranes and extracellular matrices in tissue curing of a prophage (Novick, 1967), was cultivated in barriers, and a-enolase of Staphylococcus aureus mediates tryptic soy broth. Recombinant Escherichia coli strains were bacterial adherence to laminin (Carneiro et al., 2004). cultivated in Luria broth supplemented with relevant anti- Further, enolase of S. pneumoniae enhances plasmin- biotics. All the bacterial cultivations were performed at mediated degradation of the reconstituted basement mem- 37 1C. brane (Bergmann et al., 2005). Evidence also from other bacterial pathogens suggests that bacterial adherence onto Cloning and phylogenetic studies tissue barriers, in concert with engagement of the powerful plasmin proteolysis, increases metastasis of pathogenic Bacterial DNA was extracted with the Qiagen Genomic tip- bacteria into secondary tissue sites or organs (Lahteenm ¨ aki ¨ 20/G (Qiagen) according to the manufacturer’s instructions et al., 2005). after treating the bacteria with lysozyme (20 mg mL ; Recently, the unexpected observation was reported that Sigma Aldrich). Lactobacilli were additionally treated with Lactobacillus crispatus and other commensal species of mutanolysin (50 U mL ; Sigma Aldrich) and Staphylococcus Lactobacillus very efficiently enhance tPA-mediated Plg aureus cells with lysostaphin (0.4 mg mL ; Ambicin L, activation (Hurmalainen et al., 2007). Notably, this activity Ambi Inc.). The enolase genes were amplified using the was attributed to the extracellular proteome of the bacteria, available genomic DNA sequences from S. pneumoniae and a-enolase was identified as a major protein component TIGR4 (NC_003028; Tettelin et al., 2001), S. pyogenes M1 with Plg-binding capacity. The predicted sequence of L. (NC_002737; Ferretti et al., 2001), Staphylococcus aureus crispatus enolase is 49% identical to the virulence-associated 8325-4 (NC_007795; Gillaspy et al., 2006), and L. johnsonii enolase of S. pneumoniae and contains features typical of NCC 533 (NC_005362; Pridmore et al., 2004). The primers enolase proteins (e.g. a monomer size of c. 47 kDa, con- used in this study are listed in Table 1. The eno gene of L. served catalytic site, and Mg -binding sequences). Lacto- crispatus was recently described (AJ849471; Hurmalainen bacilli are members of the normal flora in humans and other et al., 2007). The amplified eno genes from strains L. mammals and are very rarely associated with opportunistic johnsonii F133 and S. pyogenes IH32030 were sequenced in infections (Salvana & Frank, 2006). Rather, the possible the Sequencing Core Facility, Haartman Institute, Univer- health-promoting effects of lactobacilli in humans have sity of Helsinki, Finland. Sequence homologies were ana- focused efforts on their use as probiotics. The presence of lyzed by the CLUSTALW program and the Drawtree application FEMS Immunol Med Microbiol 51 (2007) 526–534  c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 528 J. Antikainen et al. Table 1. Primers used in this study 0 0 Primer 5 –3 sequence Reference Lactobacillus crispatus eno forward CCCGGCATGCATGCTCAAATCAGTTATTG Hurmalainen et al. (2007) eno reverse CCCGTCGACTTAATCGTGATCAACATCGTC Hurmalainen et al. (2007) Lactobacillus johnsonii eno1 forward CCCGGCATGCATGCTCAAATCAGTTATTG This study eno1 reverse CCCGTCGACTTAATCTAAGTCAACGTTGTCTG This study eno2 forward CCCGGCATGCATGACTGTTTATGTAG This study eno2 internal forward GGAGGGAAGCACGCTGATAATGG This study eno2 internal reverse CCATTATCAGCGTGCTTCCCTCC This study eno2 reverse CCCGTCGACCTAATCAAAATCTACATTATTTGG This study eno3 forward CCCGGCATGCATGTCTGTTATTACTG This study eno3 reverse CCCGTCGACTTAAAATTGTTTGTGTAAGTTGTAG This study Streptococcus pneumoniae eno forward CTCCTCGCATGCATGTCAATTATTACTGATGTTTAC This study eno reverse CTCCTCGTCGACTTATTTTTTAAGGTTGTAGAATGATTTC This study Streptococcus pyogenes eno forward CTCCTCGCATGCATGTCAATTATTACTGATGTTTAC This study eno reverse CTCCTCGCATGCTTATTTTTTTAAGTTATAGAATG This study Staphylococcus aureus eno forward CTCCTCGCATGCATGCCAATTATTACAGATGTTTAC This study eno reverse CTCCTCGTCGACTTATTTATCTAAGTTATAGAATG This study Primers were produced by Eurogentec. in PHYLIP (Felsenstein, 2005). The novel nucleotide sequences Enzyme assay of the eno genes sequenced in this work are deposited in The enzymatic activity of His -enolases was assayed by GenBank under the accession numbers EF362411 (L. john- measuring the transformation of 2-PGE to phosphoenol- sonii F133 enolase 1), EF362412 (L. johnsonii F133 enolase pyruvate; the substrate 2-PGE was generated from 3-PGE 2), EF362413 (L. johnsonii F133 enolase 3), and EF362410 (Fluka Chemie) by recombinant His -phosphoglycerate (S. pyogenes IH32030 enolase). mutase cloned from Staphylococcus aureus 8325-4. The assays were performed at 22 1C in 100 mM Hepes, pH 7.0, 10 mM MgCl , 10 mM KCl, 15 mM 3-PGA, and 300 pmol Overexpression and purification of His -tagged 2 phosphoglycerate mutase in a final volume of 0.5 mL. recombinant enolases The reaction was started by adding 20 pmol His -enolase The eno genes were cloned to the SphI–SalI site of pQE-30 in 10 mL PBS, and the increase in the formation of phos- vector (Qiagen) for expression as N-terminal His -fusion phoenolpyruvate was measured spectrophotometrically at proteins. The eno2 gene of L. johnsonii contains an internal 240 nm. SphI site, and therefore the internal primers were designed to mutate the nucleotides CAT to the degenerate triplet Transcription of eno1--3 genes by L. johnsonii CAC also encoding histidine. The His -enolase construct F133 of L. crispatus ST1 was available from previous studies (Hurmalainen et al., 2007). The His -enolase proteins were Lactobacillus johnsonii F133 cells from exponential growth expressed in E. coli M15 (pREP4) and purified under phase were treated with mutanolysin (50 U mL ) and s 1 nondenaturating conditions using the Qiaexpress Protein lysozyme (20 mg mL )at37 1C for 15 min in 50 mM Tris- Purification System (Qiagen). The proteins were extensively HCl, pH 8, and total RNA was extracted with the RNeasy dialyzed against phosphate-buffered saline (PBS; pH 7.1), mini kit (Qiagen) according to the manufacturer’s instruc- and their concentrations were adjusted after sodium dodecyl tions. The RNA was incubated at 37 1C with RQ1 DNase sulfate polyacrylamide gel electrophoresis (SDS-PAGE) as (Promega), and the presence of eno mRNAs was assessed by ¨¨ described by Sillanpaa et al. (2000). In each functional reverse transcriptase PCR (RT-PCR) with the RobusT RT- assay, freshly prepared His -enolase protein preparations PCR kit (Finnzymes) according to the manufacturer’s 0 0 were used. instructions, using as primers the 5 and 3 end sequences c 2007 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 51 (2007) 526–534 Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 Functions of bacterial enolases 529 of the eno genes (Table 1). After 30 amplification cycles, the Results PCR products were analyzed by agarose gel electrophoresis. The specificity of each primer pair was analyzed by PCR Predicted enolase sequences from pathogens using amplified eno1–3 genes as templates. and commensals The eno genes were cloned from three pathogenic species (S. pneumoniae, S. pyogenes, Staphylococcus aureus) and two Molecular mass of enolase of L. crispatus commensal lactobacillar species (L. crispatus and L. johnso- To estimate the molecular mass, enolases were eluted in an nii). A single eno gene is present in the published genomes of analytical gel filtration column (HiLoad 16/60 Superdex 200 S. pneumoniae, S. pyogenes, and Staphylococcus aureus (Fer- prep grade; GE Healthcare). High-molecular-weight stan- retti et al., 2001; Tettelin et al., 2001; Gillaspy et al., 2006), dard markers were from GE Healthcare. Enolase-containing and according to the present analysis also in L. crispatus ST1 fractions were determined by Western blotting using a His - (Hurmalainen et al., 2007). However, three predicted eno monoclonal antibody (Clontech) and alkaline-phosphatase- genes are present in the genome of L. johnsonii NCC 533 conjugated anti-mouse immunoglobulins (Dako), or using (Pridmore et al., 2004), and their nucleotide sequences were antienolase immunoglobulins (Hurmalainen et al., 2007) utilized to clone eno1–3 from genomic DNA of L. johnsonii and alkaline-phosphatase-conjugated anti-rabbit immuno- F133. The obtained reading frames EF362411 (eno1), globulins (Dako). EF362412 (eno2), and EF362413 (eno3) showed over 97% sequence identity with the corresponding genes of L. johnso- nii NCC 533 (LJ1416, LJ1246, LJ0875). The predicted amino Binding to tissue proteins and plasminogen acid sequence of S. pyogenes IH32030 enolase (EF362410) is The binding of His -enolases to laminin (Upstate), fibro- 100% identical to the sequence of enolase from S. pyogenes nectin (Sigma Aldrich), collagen types I and IV (Sigma M1 (Ferretti et al., 2001). Figure 1 shows a cladogram Aldrich), bovine serum albumin (BSA; Sigma Aldrich), and presentation of the predicted amino acid sequence identity Plg (American Diagnostica) was measured by an enzyme- of the seven enolase proteins of this study. Two subfamilies linked immunosorbent assay (ELISA) as detailed (Sillanpa¨a¨ are apparent; L. crispatus enolase shares 93% sequence et al., 2000). Briefly, polystyrene microtiter plates were identity with Eno1 of L. johnsonii and 72% identity with coated with the target proteins at 2.5 pmol well and His - Eno2 of L. johnsonii. The other subfamily is formed by enolases (12.5 pmol) were incubated in the wells for 1 h at enolases from Staphylococcus aureus and streptococci as well 50 mM Tris-HCl, pH 8. After washing, detection of the as by Eno3 of L. johnsonii. The sequences of S. pneumoniae bound proteins was performed with the His -monoclonal and S. pyogenes enolases have 94% identity with each other, antibody and alkaline-phosphatase-conjugated anti-mouse 81% identity with Staphylococcus aureus enolase, and 68% immunoglobulins. In inhibition assays, 1 mM e-aminoca- identity with L. johnsonii enolase 3. proic acid (EACA; Sigma Aldrich) was added. The reactivity of each His -enolase with the His -monoclonal antibody 6 6 Expression of enolases as His -fusion proteins was ascertained by ELISA. To assess the protein binding by enolase in the extracellular proteome of L. crispatus ST1, the The enolases were expressed as His -fusion proteins and cell-free supernatant of ST1 obtained after a 1-h incubation purified by affinity chromatography under nondenaturating at 50 mM Tris-HCl, pH 8 (Hurmalainen et al., 2007), was conditions. The SDS-PAGE analysis of the His -enolases is incubated with the immobilized target proteins for 1 h, and shown in Fig. 2a. The apparent molecular weights of after extensive washing, the bound enolase was detected using antienolase immunoglobulins and alkaline-phospha- tase-conjugated anti-rabbit immunoglobulins as secondary antibodies. Enhancement of plasminogen activation The enhancement of tPA-mediated Plg activation in the presence of the His -enolases was measured as described recently (Hurmalainen et al., 2007). Briefly, 137 nM of the Fig. 1. Phylogenetic relationship of the enolases. A phylogenetic un- His -enolase protein was incubated with 4 mg of Plg, 2 ng of rooted tree of amino acid sequence alignment of the single enolase either tPA (Biopool) or uPA (American Diagnostica), and proteins from Lactobacillus crispatus, Streptococcus pneumoniae, Strep- 0.45 mM of the chromogenic substrate S-2251 of plasmin tococcus pyogenes, and Staphylococcus aureus as well as of the three enolases (Eno1–3) from Lactobacillus johnsonii. (Kabivitrum) in a final volume of 200 mL of PBS. FEMS Immunol Med Microbiol 51 (2007) 526–534  c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 530 J. Antikainen et al. enolases varied from 46.6 to 47.3 kDa; their calculated to be specific for the particular eno variant of L. johnsonii molecular sizes varied between 46.6 and 47.4 kDa. The F133 (data not shown). enolase proteins reacted equally well with the anti-His - monoclonal antibody in an ELISA assay (data not shown). Multimeric state of enolase from L. crispatus Next, the enolase activity of each His -protein was assessed Ehinger et al. (2004) reported that the enolase of by a coupled reaction using 2-PGE as a substrate. All S. pneumoniae has an octameric structure 377 kDa in size; enolases were enzymatically active (data not shown). this was assessed by analytical gel filtration as well as by crystal structure determination. To compare the L. crispatus enolase with the pneumococcal one, the possible multimeric Transcription of enolases 1--3 of L. johnsonii state of enolase of L. crispatus ST1 was analyzed by analytical The transcription of the eno1–3 genes of L. johnsonii F133 gel filtration. The enolase in the extracellular proteome was next assessed by RT-PCR using primers complementary obtained from L. crispatus ST1 eluted as a 370 kDa protein, 0 0 to the 5 and the 3 ends of each eno ORF. The eno1 and the which corresponds to the predicted molecular weight of eno3 genes were transcribed in cells from the logarithmic an octameric multimer (374 kDa). The His -enolase of growth phase, whereas no transcription of eno2 was detected L. crispatus eluted as a 415 kDa protein. Similarly, the His - (Fig. 2b). The amplicons are consistent with the nucleotide enolase of S. pneumoniae eluted as a 415 kDa protein. These sizes 1284 bp for eno1 and 1296 bp for eno3. Control reac- results suggest that the enolase of L. crispatus ST1, as tions without reverse transcriptase gave no amplicons (Fig. reported earlier for the pneumococcal enolase (Ehinger 2b). The primer pairs in each of amplifications were found et al., 2004), forms an octameric structure both in L. crispatus and in recombinant E. coli. Plasminogen binding and enhancement of plasmin formation by the enolases Binding of human Plg is a virulence function of enolases from bacterial pathogens (Bergmann et al., 2005). The Plg- binding property of the seven His -enolase proteins was compared (Fig. 3a). Lactobacillus crispatus enolase, L. john- sonii enolases 1 and 2, as well as the Staphylococcus aureus enolase efficiently bound Plg, whereas a lower level of Plg binding was detected with the L. johnsonii enolase 3 and with the S. pneumoniae and S. pyogenes enolases (Fig. 3a). With all enolases, the lysine analog EACA inhibited Plg binding. Next, the enhancement of tPA- and uPA-mediated Plg activation by the His -enolases was assessed. In the presence of either tPA or uPA, enolases of Staphylococcus aureus and L. crispatus as well as L. johnsonii enolase 1 and 2 enhanced plasmin formation more efficiently than did the L. johnsonii enolase 3 and the streptococcal enolases (Fig. 3b). Binding of the enolases to extracellular matrix proteins Enolase of Staphylococcus aureus has been identified as a laminin-binding protein on the bacterial surface (Carneiro Fig. 2. SDS-PAGE analysis and enzymatic activity of the His6-enolases, and transcription of eno1–3 genes in Lactobacillus johnsonii. (a) SDS- et al., 2004) and adhesive properties have also been identi- PAGE analysis of the His -enolases of Lactobacillus (Lactobacillus crispa- fied with other ‘anchorless’ surface proteins (Pancholi & tus, L. johnsonii), Streptococcus (Streptococcus pneumoniae, Strepto- Chhatwal, 2003). Here, the binding of the His -enolases to coccus pyogenes)and Staphylococcus (Staphylococcus aureus) purified laminin, fibronectin, collagen I and IV as well as to BSA was from recombinant Escherichia coli. The migration distances of molecular assessed. Enolases of Staphylococcus aureus and L. crispatus markers (size in kilodaltons) are indicated on the left. (b) Presence of eno- as well as the enolases of L. johnsonii bound to laminin, specific mRNA in L. johnsonii F133; the analysis is shown with (1)and whereas the streptococcal enolases showed lower affinity without ( ) reverse transcriptase in the reaction. Size markers in kilobasepairs are indicated on the left. (Fig. 4). Further, a strong binding to collagen I was seen with c 2007 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 51 (2007) 526–534 Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 Functions of bacterial enolases 531 Fig. 3. Binding of plasminogen and enhancement of plasmin formation by the His -enolases. (a) Binding of His -enolases of Lactobacillus 6 6 (Lactobacillus crispatus, Lactobacillus johnsonii ), Streptococcus (Strepto- Fig. 4. Binding of His -enolases and enolase in lactobacillar extracellular coccus pneumoniae, Streptococcus pyogenes), and Staphylococcus proteome to extracellular matrix proteins. Binding of His -enolases of (Staphylococcus aureus) to plasminogen (black columns) was measured Lactobacillus (Lactobacillus crispatus, Lactobacillus johnsonii ), Strepto- by ELISA; binding in the presence of the lysine analog EACA (gray coccus (Streptococcus pneumoniae, Streptococcus pyogenes), and Sta- columns) is also shown. (b) Enhancement of tPA-mediated and uPA- phylococcus (Staphylococcus aureus) to laminin, fibronectin, collagen I, mediated plasminogen activation by the His -enolases. The means and and BSA was quantitated with the anti-His monoclonal antibody (left the range of values in duplicate samples from a representative experi- panel). Binding of enolase in the extracellular proteome of L. crispatus ment are shown. was assessed with anti-enolase immunoglobulins (right panel). The results are means of duplicate samples from a representative experiment; the range of values are also shown. L. crispatus enolase and with the Staphylococcus aureus enolase, whereas the other enolases were moderate or poor in binding. None of the proteins bound to immobi- lized human plasma fibronectin, collagen IV, or to BSA. extracellular proteome of commensal lactobacilli (Hurma- Detection by ELISA with immunoglobulins specific for L. lainen et al., 2007). As a first step in the characterization of crispatus enolase showed that also the enolase in the extra- the biological role(s) of lactobacillar surface enolases and in cellular proteome of L. crispatus bound to laminin comparing the Plg system in bacterial pathogenesis and and collagen I, but not to fibronectin, collagen IV, or BSA commensalism, enolases were compared in vitro for putative (Fig. 4). virulence- or colonization-associated functions. Enolases were assessed for binding and activation of human Plg as well as for adhesiveness to proteins of the extracellular Discussion matrix, which are important features in bacterial invasive- Enolases are multifunctional and important virulence fac- ness and colonization. In these functions, the individual tors for streptococcal and staphylococcal pathogens, where enolases showed differences that are not correlated with the they occur as cell-wall-associated as well as intracellular virulence of the bacterial species or with the overall sequence proteins (Pancholi & Fischetti, 1998; Bergmann et al., 2003, identity of the enolase molecules. 2005; Pancholi & Chhatwal, 2003; Derbise et al., 2004; Lactobacilli are fermentative organisms and dependent Walker et al., 2005). Enolases, however, are ubiquitous on glycolysis as a source of energy. The importance of enzymes and are also present on the cell wall and in the enolase for these bacteria is stressed by the fact that the FEMS Immunol Med Microbiol 51 (2007) 526–534  c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 532 J. Antikainen et al. genome of L. johnsonii contains three eno genes, eno1–3 lactobacillar enolases, which suggests that domain structures (Pridmore et al., 2004), and that a few other published in enolase proteins are involved in Plg binding. genomic sequences of lactobacilli also encode more than one The comparison of the enolases from pathogens and enolase variant (Kleerebezem et al., 2003; Makarova et al., commensals in this study relied on using His -enolases from 2006). The eno1 gene of L. johnsonii NCC 533 is located next recombinant E. coli. Ehinger et al. (2004) showed that the to genes involved in the glycolytic pathway (Pridmore et al., enolase from S. pneumoniae is an octamer with a size of 2004), whereas the eno2 and eno3 genes are located on other 377 kDa. Apparently, L. crispatus enolase also is an octamer chromosomal regions. It was found that the eno2 of L. both in the extracellular proteome from L. crispatus and as a johnsonii F133 was not transcribed under the culture condi- His -protein purified from E. coli. His -enolase as well as 6 6 tions that were used. The His -enolase 2 protein from enolase in the extracellular proteome released from recombinant E. coli was, however, of apparently full size, L. crispatus adhered to laminin and type I collagen, which enzymatically active, and highly efficient in Plg binding. The indicates that the binding is not a property of recombinant biological roles of multiple enolases in lactobacilli remain to His -enolase alone. Adhesion to laminin, previously shown be characterized. with enolase purified from the Staphylococcus aureus cell The assays showed that His -enolases from L. crispatus, surface (Carneiro et al., 2004), was confirmed with the His - 6 6 L. johnsonii (enolases 1 and 2) as well as from Staphylococcus enolase in this study, and it was shown that the Staphylo- aureus were equally efficient in Plg binding and enhance- coccus aureus enolase also adheres to type I collagen. Further, ment of its activation by tPA and uPA, whereas enolase 3 the His -enolases were enzymatically active towards the from L. johnsonii and the streptococcal enolases were less substrate 2-PGE. Thus, it appears that the His -enolases are active. The high activity of lactobacillar enolases is consis- functionally similar to the bacterial enolases expressed by tent with a previous work showing that L. crispatus and their natural host species. L. johnsonii rapidly enhance tPA-mediated Plg activation The results show that virulence-associated functions of (Hurmalainen et al., 2007). Binding of Plg to the enolases streptococcal and staphylococcal enolases, Plg activation was inhibited by the lysine analog EACA, which indicates and adhesiveness, are exhibited by enolases from commensal involvement of the kringle domains of Plg in the binding. lactobacilli as well. Lactobacilli release their enolase at C-terminal lysines form active epitopes in several Plg-binding neutral pH into the medium, whereas at acidic pH enolase proteins, including the enolases of S. pyogenes (Derbise et al., is attached to the cell wall (Antikainen et al., 2007). This 2004) and pneumococci (Bergmann et al., 2001). It is variation is likely to influence the effectiveness of the noteworthy that the sequences of the lactobacillar enolases lactobacillar enolases in engagement of cell-associated plas- studied here do not contain C-terminal lysines (Pridmore min as well as in bacterial adhesion. The Plg activator et al., 2004; Hurmalainen et al., 2007). Bergmann et al. streptokinase has a well-established role in the pathogenesis (2003) identified another, internal Plg-binding site in the of S. pyogenes infections (Khil et al., 2003); its homologs are pneumococcal enolase, i.e., the sequence FYDKERKVY not present in the sequenced genomes of Lactobacillus that is located on the outer surface of the octameric species. Further, significant formation of plasmin was de- molecule (Ehinger et al., 2004) and where the lysines and tected with L. crispatus and L. johnsonii only in the presence glutamic acid are important for Plg binding (Bergmann of tPA or uPA (Hurmalainen et al., 2007), suggesting that et al., 2005). A related sequence FYNKDDHKY is present lactobacilli lack the endogenous potential for Plg activation. in L. crispatus enolase, but ongoing analyses have shown that Thus, the interaction with the Plg system may serve different substitution of the two lysines in this sequence only margin- purposes in lactobacilli than in pathogenic bacteria. The ally decreased enhancement of tPA-mediated Plg activation biological role of enolases in Lactobacillus–host interactions by the protein (J. Antikainen and V. Kuparinen, unpublished and commensalism as well as their potential health risk in data). The His -enolase from Staphylococcus aureus was opportunistic infections (Salvana & Frank, 2006) deserve highly active in Plg binding and enhancement of its activa- further studies. tion. It is notable that its sequence does not contain a consensus sequence for the internal Plg-binding site; the sequence is FYENGVYDY. Thus, it seems that basic Acknowledgements amino acid residues elsewhere in enolases of L. crispatus and Staphylococcus aureus are critical for Plg binding; it was The authors thank Raili Lameranta and Vesa Kirjavainen recently reported that arginine and histidine residues in target for technical assistance. This study has been supported proteins are also important in immobilization of Plg (San- by the Academy of Finland (grant number 1116507, the derson-Smith et al., 2006, 2007). Interestingly, the staphylo- Microbes and Man Programme, grant numbers 105824, coccal enolase is in overall sequence more close to enolases 211300, 80666, and 201967), the Alfred Kordelin Founda- showing poor Plg-binding activity than to the highly active tion, the Foundation for Nutritional Research, the c 2007 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 51 (2007) 526–534 Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 Functions of bacterial enolases 533 EuroPathoGenomics Network of Excellence of the European Ferretti JJ, McShan WM, Ajdic D et al. (2001) Complete genome Union, as well as the University of Helsinki. sequence of an M1 strain of Streptococcus pyogenes. Proc Natl Acad Sci USA 98: 4658–4663. Fujisawa T, Benno Y, Yaeshima T & Mitsuoka T (1992) Taxonomic study of the Lactobacillus acidophilus group, with References recognition of Lactobacillus gallinarum sp. nov. and Aaberge IS, Eng J, Lermark G & Lvik M (1995) Virulence of Lactobacillus johnsonii sp. nov. and synonymy of Lactobacillus acidophilus group A3 (Johnson et al. 1980) with the type strain Streptococcus pneumoniae in mice: a standardized method for preparation and frozen storage of the experimental bacterial of Lactobacillus amylovorus (Nakamura 1981). Int J Syst inoculum. Microb Pathog 18: 141–152. Bacteriol 42: 487–491. Antikainen J, Kuparinen V, Lahteenm ¨ aki ¨ K & Korhonen TK Gillaspy AF, Worrell V, Orvis J, Roe BA, Dyer DW & Iandolo JJ (2007) pH-dependent association of enolase and GAPDH of (2006) The Staphylococcus aureus NCTC 8325 genome. Gram- Lactobacillus crispatus with the cell wall and lipoteichoic acids. positive pathogens (Fischetti VA, Novick R, Ferretti JJ, Portnoy J Bacteriol 189: 4539–4543. DA & Rood JI, eds), pp. 381–412. ASM Press, Washington, Bergmann S, Rohde M, Chhatwal GS & Hammerschmidt S DC. (2001) alpha-Enolase of Streptococcus pneumoniae is a Holm SE & Falsen E (1967) An antigenin-free medium for plasmin(ogen)-binding protein displayed on the bacterial cell cultivation of b-hemolytic streptococci. Acta Path Microbiol surface. Mol Microbiol 40: 1273–1287. Scand 69: 264–276. Bergmann S, Wild D, Diekmann O, Frank R, Bracht D, Chhatwal Hurmalainen V, Edelman S, Antikainen J, Baumann M, GS & Hammerschmidt S (2003) Identification of a novel Lahteenm ¨ aki ¨ K & Korhonen TK (2007) Extracellular proteins plasmin(ogen)-binding motif in surface displayed alpha- of Lactobacillus crispatus enhance activation of human enolase of Streptococcus pneumoniae. Mol Microbiol 49: plasminogen. Microbiol 153: 1112–1122. 411–423. Khil J, Im M, Heath A, Ringdahl U, Mundada L, Engleberg NC & Bergmann S, Rohde M, Preissner KT & Hammerschmidt S Fay WP (2003) Plasminogen enhances virulence of group A (2005) The nine residue plasminogen-binding motif of the streptococci by streptokinase-dependent and streptokinase- pneumococcal enolase is the major cofactor of plasmin- independent mechanisms. J Infect Dis 188: 497–505. mediated degradation of extracellular matrix, dissolution of Kleerebezem M, Boekhorst J, van Kranenburg R et al. (2003) fibrin and transmigration. Thromb Haemost 94: 304–311. Complete genome sequence of Lactobacillus plantarum Boyle MD & Lottenberg R (1997) Plasminogen activation by WCFS1. Proc Natl Acad Sci USA 100: 1990–1995. invasive human pathogens. Thromb Haemost 77: 1–10. Lahteenm ¨ aki ¨ K, Kuusela P & Korhonen TK (2000) Plasminogen Brown CK, Kuhlman PL, Mattingly S, Slates K, Calie PJ & Farrar activation in degradation and penetration of extracellular WW (1998) A model of the quaternary structure of enolases, matrices and basement membranes by invasive bacteria. based on structural and evolutionary analysis of the octameric Methods 21: 125–132. enolase from Bacillus subtilis. J Protein Chem 17: 855–866. Lahteenm ¨ aki ¨ K, Kuusela P & Korhonen TK (2001) Bacterial Carneiro CR, Postol E, Nomizo R, Reis LF & Brentani RR (2004) plasminogen activators and receptors. FEMS Microbiol Rev 25: Identification of enolase as a laminin-binding protein on the 531–552. surface of Staphylococcus aureus. Microbes Infect 6: 604–608. Lahteenm ¨ aki ¨ K, Edelman S & Korhonen TK (2005) Bacterial Chhatwal GS (2002) Anchorless adhesins and invasins of Gram- metastasis: the host plasminogen system in bacterial invasion. positive bacteria: a new class of virulence factors. Trends Trends Microbiol 13: 79–85. Microbiol 10: 205–208. Makarova K, Slesarev A, Wolf Y et al. (2006) Comparative Derbise A, Song YP, Parikh S, Fischetti VA & Pancholi V (2004) genomics of the lactic acid bacteria. Proc Natl Acad Sci USA Role of the C-terminal lysine residues of streptococcal surface 103: 15611–15616. enolase in Glu- and Lys-plasminogen-binding activities of Mangel WF, Lin BH & Ramakrishnan V (1990) Characterization group A streptococci. Infect Immun 72: 94–105. of an extremely large, ligand-induced conformational change Edelman S, Westerlund-Wikstrom ¨ B, Leskela¨ S, Kettunen H, in plasminogen. Science 248: 69–73. Rautonen N, Apajalahti J & Korhonen TK (2002) In vitro Miettinen M, Matikainen S, Vuopio-Varkila J, Pirhonen J, Varkila adhesion specificity of indigenous lactobacilli within the avian K, Kurimoto M & Julkunen I (1998) Lactobacilli and intestinal tract. Appl Environ Microbiol 68: 5155–5159. streptococci induce interleukin-12 (IL-12), IL-18, and gamma Ehinger S, Schubert WD, Bergmann S, Hammerschmidt S & interferon production in human peripheral blood Heinz DW (2004) Plasmin(ogen)-binding alpha-enolase from mononuclear cells. Infect Immun 66: 6058–6062. Streptococcus pneumoniae: crystal structure and evaluation of Miles LA, Dahlberg CM, Plescia J, Felez J, Kato K & Plow EF plasmin(ogen)-binding sites. J Mol Biol 343: 997–1005. Felsenstein J (2005). PHYLIP (Phylogeny Inference Package) (1991) Role of cell-surface lysines in plasminogen binding to version 3.6. Distributed by the author. Department of Genome cells: identification of alpha-enolase as a candidate Sciences, University of Washington, Seattle. plasminogen receptor. Biochemistry 30: 1682–1691. FEMS Immunol Med Microbiol 51 (2007) 526–534  c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018 534 J. Antikainen et al. Novick R (1967) Properties of a cryptic high-frequency by arginine and histidine residues within the a1 and a2 repeat transducing phage in Staphylococcus aureus. Virology 33: domains. J Biol Chem 281: 25965–25971. 155–166. Sanderson-Smith ML, Dowton M, Ranson M & Walker MJ Pancholi V (2001) Multifunctional alpha-enolase: its role in (2007) The PAM related protein Prp binds plasminogen via diseases. Cell Mol Life Sci 58: 902–920. arginine and histidine residues. J Bacteriol 189: 1435–1440. Pancholi V & Chhatwal GS (2003) Housekeeping enzymes as Schurig H, Rutkat K, Rachel R & Jaenicke R (1995) Octameric virulence factors for pathogens. Int J Med Microbiol 293: enolase from the hyperthermophilic bacterium Thermotoga 391–401. maritima: purification, characterization, and image Pancholi V & Fischetti VA (1998) alpha-enolase, a novel strong processing. Protein Sci 4: 228–236. ¨¨ ´ plasmin(ogen) binding protein on the surface of pathogenic SillanpaaJ,Martınez B, Antikainen J et al. (2000) streptococci. J Biol Chem 273: 14503–14515. Characterization of the collagen-binding S-layer protein CbsA Pawluk A, Scopes RK & Griffiths-Smith K (1986) Isolation and of Lactobacillus crispatus. J Bacteriol 182: 6440–6450. properties of the glycolytic enzymes from Zymomonas mobilis. Sun H, Ringdahl U, Homeister JW, Fay WP, Engleberg NC, Yang The five enzymes from glyceraldehyde-3-phosphate AY, Rozek LS, Wang X, Sjobring ¨ U & Ginsburg D (2004) dehydrogenase through to pyruvate kinase. Biochem J 238: Plasminogen is a critical host pathogenicity factor for group A 275–281. : 1283–1286. streptococcal infection. Science 305 Pridmore RD, Berger B, Desiere F et al. (2004) The genome Tettelin H, Nelson KE, Paulsen IT et al. (2001) Complete genome sequence of the probiotic intestinal bacterium Lactobacillus sequence of a virulent isolate of Streptococcus pneumoniae. johnsonii NCC 533. Proc Natl Acad Sci USA 101: Science 293: 498–506. 2512–2517. Walker MJ, McArthur JD, McKay F & Ranson M (2005) Is Salvana EM & Frank M (2006) Lactobacillus endocarditis: case plasminogen deployed as a Streptococcus pyogenes virulence report and review of cases reported since 1992. J Infect 53: factor? Trends Microbiol 13: 308–313. e5–e10. Wiman B, Linjen HR & Collen D (1979) On the specific Sanderson-Smith ML, Walker MJ & Ranson M (2006) The interaction between the lysine-binding sites in plasmin and maintenance of high affinity plasminogen binding by group A complementary sites in a2-antiplasmin and in fibrinogen. streptococcal plasminogen-binding M-like protein is mediated Biochim Biophys Acta 579: 142–154. c 2007 Federation of European Microbiological Societies FEMS Immunol Med Microbiol 51 (2007) 526–534 Published by Blackwell Publishing Ltd. All rights reserved Downloaded from https://academic.oup.com/femspd/article-abstract/51/3/526/631799 by Ed 'DeepDyve' Gillespie user on 28 April 2018

Journal

Journal of the Endocrine Society – Oxford University Press

Published: Dec 1, 2007

There are no references for this article.