Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Lagging Strand DNA Synthesis at the Eukaryotic Replication Fork Involves Binding and Stimulation of FEN-1 by Proliferating Cell Nuclear Antigen

Lagging Strand DNA Synthesis at the Eukaryotic Replication Fork Involves Binding and Stimulation... THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 270, No. 38, Issue of September 22, pp. 22109–22112, 1995 Communication © 1995 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. as an endonuclease on nicked double-stranded DNA substrates Lagging Strand DNA Synthesis with the 59-end of the nick expanded into a single-stranded tail at the Eukaryotic Replication (see structure in Fig. 2A), cutting these so-called flap struc- tures at the base of the tail (5). These types of DNA interme- Fork Involves Binding and diates likely occur during end joining reactions in which DNA Stimulation of FEN-1 by ends with limited homology are joined. Mammalian FEN-1 has also been identified as DNase IV, or maturation factor I, a Proliferating Cell Nuclear nick-specific 59 3 39-exonuclease required for nick translation Antigen* during Okazaki fragment maturation (6–10). Consistent with its corresponding functional activity, mammalian FEN-1 shows (Received for publication, July 10, 1995) sequence homology with the 59 3 39-exonuclease domain pres- ent in Escherichia coli DNA polymerase I (10). The yeast RTH1 Xiangyang Li‡§, Jun Li¶, John Harrington¶, gene is dispensable for cell growth, but rth1 deletion mutants Michael R. Lieber¶, and Peter M. J. Burgers‡i are temperature-sensitive for growth and show a terminal phe- From the Departments of Biochemistry, ‡Molecular notype consistent with a defect in DNA replication (2, 3). Ge- Biophysics, and Pathology, Washington University netic studies with yeast rth1 deletion mutants have also shown School of Medicine, St. Louis, Missouri 63110 that FEN-1 functions in the repair of alkylation damage and in The 5* 3 3*-exonuclease domain of Escherichia coli recombinational repair. However, yFEN-1 (RTH1) does not DNA polymerase I is required for the completion of lag- function in nucleotide excision repair (2, 3). Rather, in vitro ging strand DNA synthesis, and yet this domain is not studies have shown that the endonucleolytic activity of XP-G present in any of the eukaryotic DNA polymerases. Re- (the mammalian homologue of RAD2) is required for this repair cently, the gene encoding the functional and evolution- process (11). ary equivalent of this 5* 3 3*-exonuclease domain has The yeast proliferating cell nuclear antigen (PCNA) is the been identified. It is called FEN-1 in mouse and human processivity factor for DNA polymerases d and e.Itisaho- cells and RTH1 in Saccharomyces cerevisiae. This 42- motrimer with a subunit molecular mass of 29 kDa and is kDa enzyme is required for Okazaki fragment process- highly conserved from yeast to mammalian cells. The crystal ing. Here we report that FEN-1 physically interacts with structure of yeast PCNA shows that the trimer forms a closed proliferating cell nuclear antigen (PCNA), the processiv- ring with the appropriate dimensions and electrostatic proper- ity factor for DNA polymerases d and e. Through protein- ties to encircle double-stranded DNA and to interact with it protein interactions, PCNA focuses FEN-1 on branched using nonspecific contacts (12). Processivity in DNA synthesis DNA substrates (flap structures) and on nicked DNA substrates, thereby stimulating its activity 10–50-fold is achieved by protein-protein interactions between PCNA and but only if PCNA can functionally assemble as a toroidal the polymerase, thereby tethering the DNA polymerase at the trimer around the DNA. This interaction is important in primer terminus (13). In addition to this structural function the physical orchestration of lagging strand synthesis during the elongation phase of DNA replication, mammalian and may have implications for how PCNA stimulates PCNA, through its interactions with the cyclin-dependent pro- other members of the FEN-1 nuclease family in a broad tein kinase inhibitor p21 (CIP1/WAF1/SDI1), has also been range of DNA metabolic transactions. implicated in cell cycle control (14, 15). In this communication we show that PCNA physically interacts with FEN-1 and se- questers it to its site of action, thereby stimulating the activity In eukaryotic cells, a family of structure-specific endonucle- of FEN-1 10–50-fold. ases can be defined based on conserved domains within FEN-1 EXPERIMENTAL PROCEDURES (flap endonuclease), a 42-kDa enzyme that is both a 59 flap Materials—The yeast strains used were PY26 (Mata, ura3–52, DNA endonuclease and a nick specific 59-exonuclease (1). The leu2–3, 112,trp1D, prb1–1122, prc1–407, pep4–3, Dnuc1::LEU2) and its Saccharomyces cerevisiae analog of FEN-1 is encoded by the 1 Drth1 derivative PY59 (as PY26, but Drth1::hisG), which was made by RTH1 gene (2, 3). Both human and yeast FEN-1 (yFEN-1) are insertional activation of the RTH1 gene using plasmid pR2.10 (3). highly homologous to the human DNA repair gene XP-G and its Strains were grown and extracts prepared and concentrated with 0.35 yeast homologue RAD2 (4). Various DNA metabolic processes g/ml ammonium sulfate as described (16). E. coli single-stranded DNA are thought to require processing of intermediates by the binding protein, yeast FEN-1, and yeast PCNA were overproduced in E. coli and purified as described (1, 17). Yeast replication factor C (RF-C) FEN-1 endonuclease. The enzyme shows the greatest activity was purified as described (18). PCNA or bovine serum albumin was coupled to Affi-Gel 10 (Bio-Rad) according to the manufacturer’s proto- * This work was supported in part by Grants GM32431 (to col. Beads contained 3 mg of PCNA/ml of beads or 4 mg of BSA/ml of P. M. J. B.) and CA51105 and GM43236 (to M. R. L.) from the National beads. Institutes of Health. The costs of publication of this article were de- Two-hybrid Analysis—The entire POL30 gene or pol30–52 gene (con- frayed in part by the payment of page charges. This article must taining the S115P mutation) was fused to the bacterial lexA DNA therefore be hereby marked “advertisement” in accordance with 18 binding domain in vector pCH435 (17). Screening of a library of yeast U.S.C. Section 1734 solely to indicate this fact. cDNAs fused to the GAL4 activation domain using the lexA-pol30–52 § Present address: Dept. of Biochemistry, University of Washington construct as bait was carried out essentially as described (19). In the School of Medicine, Seattle, WA. one positive RTH1 isolate obtained, fusion with the activation domain To whom correspondence should be addressed. Tel.: 314-362-3872; of GAL4 occurred at amino acid 81. The strength of the interaction was Fax: 314-362-7183; E-mail: [email protected]. 2.5 units of b-galactosidase activity for lexA-POL30 and 2.2 units for The abbreviations used are: yFEN-1, yeast FEN-1; PCNA, prolifer- ating cell nuclear antigen; RF, replication factor; BSA, bovine serum lexA-pol30–52, whereas negative controls were 0.5–0.8 units of b-ga- albumin. lactosidase activity. This is an Open Access article under the CC BY license. 22110 PCNA Interaction with FEN-1 FIG.1. Immunoblot analysis of yFEN-1 binding to PCNA beads. A, fractionation of yFEN-1 on BSA or PCNA beads. See “Exper- imental Procedures” for details. B, competition assay. The assay was as described, except that yFEN-1 was preincubated for 10 min at 4 °C with FIG.2. PCNA stimulates yFEN-1 endonuclease activity on a 100 mg of BSA (lane 1)or30or100 mg of PCNA (lanes 2 and 4)or30or flap substrate. A, diagram of a DNA flap substrate. The position of the 100 mg of pcna-52 (lanes 3 and 5)in100 ml of buffer A prior to addition label is indicated by the asterisk on the flap strand, SC5. Oligonucleo- of PCNA beads. The 0.6 M NaCl eluate was analyzed. C, PCNA beads tides are: SC1, CAGCAACGCAAGCTTG (strand adjacent to the flap bind yFEN-1 in crude extracts. Extracts (500 mg) were incubated with strand); SC3, GTCGACCTGCAGCCCAAGCTTGCGTTGCTG (strand 10 ml of PCNA beads in 200 ml of buffer A, washed, and eluted with a annealed to the flap and the adjacent strand); and SC5, ATGTG- total of 20 ml of buffer A containing 0.6 M NaCl as described. Lane 1,15 GAAAATCTCTAGCAGGCTGCAGGTCGAC (flap strand, which is the ng of purified FEN-1; lane 2, 10 ng of FEN-1 plus 10 mlof0.6 M NaCl one labeled) (see Ref. 1 for a full description). The 59 ends are indicated. eluate from strain PY26; lane 3,10 ml of eluate from strain PY26; lane B, stimulation of yFEN-1 endonuclease by PCNA. The endonuclease 4,10 ml of eluate from strain PY59. assay was done in a 15-ml total volume containing 50 mM Tris-HCl, pH 8.0, 10 mM MgCl , 0.5 mM b-mercaptoethanol, 500 mg/ml BSA, 10 fmol Affinity Binding to Beads—BSA or PCNA beads (3 ml) were gently of flap substrate, 50 fmol of FEN-1, and, when present, 26,000 fmol as agitated in a thin walled 0.5-ml microcentrifuge tube with 10 ng of trimer of PCNA (2.3 mg), 30 fmol of RF-C, and 100 mM ATP. C, mutant yFEN-1 in 100 mlof40mM Hepes-NaOH, pH 7.4, 2 mM MgCl , 150 mM PCNA fails to stimulate. The assay was done as in panel B, but the PCNA concentration was varied as indicated. pcna-52, which is a mon- NaCl (buffer A) at 4 °C for 1 h. The bottom of the tube was pierced with omer in solution, was added at the indicated level. Products of the a 27-gauge needle and the solvent gently spun out in a clinical centri- reaction were separated on a denaturing 15% polyacrylamide gel and fuge. The beads were washed with 2 3 10 ml of buffer A and eluted with visualized on a PhosphorImager. The mobility of the top band is 33 2 3 3 ml of buffer A containing 0.3 M NaCl, 2 3 3 ml of buffer A nucleotides and that of the cleaved product is 20 nucleotides. Control containing 0.6 M NaCl, and finally 2 3 3 ml of buffer A containing 1% experiments showed no detectable nuclease activity by PCNA alone SDS, each time by pipetting the buffer on top of the beads and after 5 (data not shown). min at 0 °C, gently spinning through. Proteins in the fractions were separated on a 10% polyacrylamide gel containing sodium dodecyl sul- fate and subjected to immunoblot analysis using immunopurified rabbit hybrid method, an excess of the latter mutant protein also antisera to yFEN-1 for detection. blocked the binding of yFEN-1 to PCNA beads. Finally, we RESULTS AND DISCUSSION showed that the beads can bind yFEN-1 from crude yeast The RTH1 gene was isolated by us as a PCNA-interacting extracts. That the species detected on the Western blot is gene using the yeast two-hybrid method (20). In this search for yFEN-1 follows from its comigration with purified yFEN-1 and interacting genes, the bacterial lexA DNA binding domain was the absence of a signal with Drth1 extracts (Fig. 1C). Although fused to a cold-sensitive PCNA mutant (pol30–52) rather than yFEN-1 is not the major polypeptide species from crude ex- to the wild-type POL30 gene as strains with the latter con- tracts bound to PCNA beads, it can be detected as a distinct struct grew poorly and had a very low transformation fre- band on silver stained gels, which is absent when extracts are quency (17). The measured interaction signals between POL30- used from an isogenic Drth1 strain (data not shown). lexA or pol30–52-lexA and RTH1 fused to the GAL4 activation The functional interaction between yFEN-1 and PCNA was domain were identical and weak (see “Experimental Proce- probed with DNA substrates that are probable intermediates in DNA end joining (flap structures, Fig. 2A) and in DNA dures”). As the two-hybrid method may detect both direct and indirect interactions, we turned to biochemical methods to in- replication (nicked duplexes). On a model flap structure, PCNA vestigate a possible interaction between yFEN-1 and PCNA. stimulated the activity of yFEN-1 about 10-fold (Fig. 2B) based The existence of a specific protein-protein interaction be- on PhosphorImager quantitation. It is important to note that, tween yFEN-1 and PCNA was confirmed by affinity chroma- in contrast to assays with nicked substrates described below, tography on PCNA beads. Yeast FEN-1 bound specifically to only PCNA and yFEN-1 were added in this assay. Therefore, PCNA beads but not to control BSA beads (Fig. 1A). Elution stimulation of yFEN-1 activity can be directly attributed to its from the PCNA beads was accomplished at 0.6 M NaCl, indi- interaction with PCNA rather than with other accessory fac- cating that salt bridges contribute substantially to the PCNA- tors. Stimulation requires that PCNA is a trimer. The pcna-52 FEN-1 interaction. Subsequent treatment with ionic deter- mutant exists as a monomer in solution (17). Despite the fact gents did not release additional yFEN-1 (Fig. 1A). The that this mutant protein exhibits a similar affinity for yFEN-1 specificity of the interaction was demonstrated by the observa- as wild-type PCNA, it failed to stimulate yFEN-1 activity (Fig. tion that an excess of PCNA blocked binding of yFEN-1 to the 2C; see also Fig. 1B). The most straightforward conclusion of beads (Fig. 1B). As expected from the observed in vivo interac- these experiments is that PCNA must encircle the double- tion between yFEN-1 and the mutant pcna-52 by the two- stranded DNA in order to stimulate yFEN-1, and the mutant PCNA Interaction with FEN-1 22111 FIG.4. Hypothetical positioning of PCNA and FEN-1 at recom- binational flap intermediates (left) and during Okazaki frag- ment maturation (right). RF-C and polymerase d are also shown in the Okazaki fragment model. Indicated contacts with PCNA are based on physical and functional interaction studies. activity by PCNA but only if RF-C and ATP were also present. Interestingly, the inclusion of salt (75 mM NaCl) in the assay revealed the functional interaction between PCNA and yFEN-1 most profoundly. As PCNA is efficiently loaded by RF-C onto the DNA at physiological salt levels, it in turn is capable of loading yFEN-1 and hence stimulating its activity (Fig. 3). In FIG.3. Stimulation of FEN-1 by PCNA at DNA nicks. A59- labeled 24-mer oligonucleotide and a 36-mer oligonucleotide, represent- the absence of PCNA, yFEN-1 fails to interact with the DNA at ing positions 6353–6330 and 6329–6294, respectively, were hybridized these salt concentrations, and a modification of the assay to to single-stranded mp18 DNA (upper structure). Assays were as de- very low salt and magnesium concentrations is essential to scribed in the legend to Fig. 2, except for adjustment to 10 mM Tris, pH detect yFEN-1 activity at nicks (5). No stimulation was ob- 8,5mM MgCl , and 75 mM NaCl. In a 15-ml total volume, 20 fmol of substrate coated with 400 ng of E. coli single-stranded DNA binding served with the monomeric mutant pcna-52 (data not shown). protein and, where indicated, 100 fmol of FEN-1, 1300 fmol of PCNA, 30 The interaction between FEN-1 and PCNA may have bear- fmol of RF-C, and 100 mM ATP were incubated for 10 min at 30 °C. ing on the structure of the lagging strand DNA replication Analysis was as described in the legend to Fig. 2. The top band is the complex. Because FEN-1 does not negatively affect DNA syn- labeled 24-nucleotide oligonucleotide. The bottom band (arrow)isthe released 59 mononucleotide. Control experiments showed no nuclease thesis by DNA polymerase d or e holoenzyme (i.e. does not activity in all analogous experiments lacking FEN-1 (data not shown). compete with these polymerases for binding to PCNA), it may form an integral part of this complex and mediate coupled form is unable to do so. Because this mode of PCNA loading synthesis and maturation of Okazaki fragments (Fig. 4). In the occurs by nonspecific diffusion onto DNA ends, a large excess is presence of DNA polymerase d or e, the complex would carry required to observe substantial stimulation (21). Thus, at the out nick translation until DNA ligase I seals the nick (9). In lowest concentration of PCNA tested (0.02 mg), which repre- mammalian cells, an RNase H is also required for in vitro sents a 20-fold molar excess over DNA substrate, very little Okazaki fragment maturation (7, 26). However, it is not known stimulation was observed (Fig. 2C). RF-C is required for the at this time whether this enzyme forms an integral component efficient loading of PCNA at primer termini in an ATP-depend- of this maturation complex. ent manner (18, 22–24). If RF-C would efficiently and appro- In addition to replication, the interaction between FEN-1 priately load PCNA at flap structures one would expect to and PCNA may have broader implications in DNA metabolism observe stimulation of yFEN-1 activity at PCNA levels stoichi- as well. In nucleotide excision repair, for example, PCNA has ometric with DNA substrate. However, inclusion of RF-C and been shown to play an important role (27, 28). Although FEN-1 ATP in the nuclease assay did not give a significant further likely is not involved in this reaction, a highly homologous stimulation of yFEN-1 beyond that observed by PCNA alone, structure-specific nuclease, XP-G or RAD2, is absolutely re- either at high concentrations of PCNA (Fig. 2B)oratlow quired. Based on the involvement of PCNA in nucleotide exci- concentrations of PCNA, which show only minimal stimulation sion repair and the presence of homology between FEN-1 and (data not shown). Possibly, RF-C fails to recognize the flap RAD2, it is possible that PCNA may also interact with RAD2 to structure as a docking site for PCNA. Or, alternatively, PCNA facilitate its loading and thereby excision of damaged nucleo- loaded by RF-C is on the wrong double-stranded side of the flap tides. Thus, there may be a common theme in various aspects structure necessary for yFEN-1 stimulation. These observa- of DNA metabolism, in addition to DNA replication, in which a tions with the yeast enzymes were extended to the human processivity factor stimulates a structure-specific nuclease in system. Human PCNA stimulated the endonucleolytic activity processing nicked and branched DNA intermediates. of human FEN-1 on the flap structure substrate to a similar Based on the studies here, we conclude that the functional degree (data not shown). interaction between PCNA and FEN-1 is important in the In contrast to these results with flap substrates, we observed orchestration of lagging strand processing at the eukaryotic no obvious stimulation of yFEN-1 activity by PCNA on model DNA replication fork. The interaction of PCNA with other oligonucleotides containing a nick (data not shown). PCNA is FEN-1 family members may be generally important to a wide known to slide rapidly across linear DNA molecules (25). As the variety of transactions involving branched DNA intermediates. more rapid sliding of PCNA across these small linear double- Acknowledgments—We thank John Majors and Tim Lohman for stranded DNA substrates, in comparison to the sterically hin- critical discussions, and Louise and Satya Prakash for a gift of plasmid dered flap substrates, might not provide a significant mean pR2.10 for making a RTH1 deletion strain. residence time for PCNA in order to interact productively with yFEN-1, we turned to circular DNA substrates from which REFERENCES PCNA, once loaded, would not be able to dissociate (Fig. 3). 1. Harrington, J. J., and Lieber, M. R. (1994) Genes & Dev. 8, 1344–1355 2. Reagan, M. S., Pittenberger, C., Siede, W., and Friedberg, E. C. (1995) RF-C and ATP are absolutely required to load PCNA at primer J. Bacteriol. 177, 364–371 termini of circular substrates (21). In agreement with these 3. Sommers, C. H., Miller, E. J., Dujon, B., Prakash, S., and Prakash, L. (1995) known properties of PCNA, we observed stimulation of yFEN-1 DNA polymerase d holoenzyme assays were carried out as described PCNA stimulation assays were carried out at various salt levels, in Ref. 18 with subsaturating levels of PCNA (3 ng, 35 fmol). Addition either with or without RF-C and ATP. The maximum observed stimu- of a 20-fold molar excess of FEN-1 (30 ng, 700 fmol) inhibited the lation was about 1.5-fold. reaction by about 10%. 22112 PCNA Interaction with FEN-1 J. Biol. Chem. 270, 4193–4196 15. Flores, R. H., Kelman, Z., Dean, F. B., Pan, Z. Q., Harper, J. W., Elledge, S. J., 4. Hiraoka, L., Harrington, J. J., Gerhard, D. S., Lieber, M. R., and Hsieh, C.-L. O’Donnell, M., and Hurwitz, J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, (1995) Genomics 25, 220–225 8655–8659 5. Harrington, J. J., and Lieber, M. R. (1994) EMBO J. 13, 1235–1246 16. Bauer, G. A., Heller, H. M., and Burgers, P. M. J. (1988) J. Biol. Chem. 263, 6. Ishimi, Y., Claude, A., Bullock, P., and Hurwitz, J. (1988) J. Biol. Chem. 263, 917–924 19723–19733 17. Ayyagari, R., Impellizzeri, K. J., Yoder, B. L., Gary, S. J., and Burgers, P. M. 7. Goulian, M., Richards, S. H., Heard, C. J., and Bigsby, B. M. (1990) J. Biol. (1995) Mol. Cell. Biol., 15, 4420–4429 Chem. 265, 18461–18471 18. Yoder, B. L., and Burgers, P. M. J. (1991) J. Biol. Chem. 266, 22689–22697 8. Murante, R. S., Huang, L., Turchi, J. J., and Bambara, R. A. (1994) J. Biol. 19. Staudinger, J., Perry, M., Elledge, S. J., and Olson, E. N. (1993) J. Biol. Chem. Chem. 269, 1191–1196 268, 4608–4611 9. Waga, S., Bauer, G., and Stillman, B. (1994) J. Biol. Chem. 269, 10923–10934 20. Fields, S., and Song, O. (1989) Nature 340, 245–246 10. Robins, P., Pappin, D., Wood, R. D., and Lindahl, T. (1994) J. Biol. Chem. 269, 21. Burgers, P. M. J., and Yoder, B. L. (1993) J. Biol. Chem. 268, 19923–19936 28535–28538 22. Tsurimoto, T., and Stillman, B. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 11. O’Donovan, A., Davies, A. A., Moggs, J. G., West, S. C., and Wood, R. D. (1994) 1023–1027 Nature 371, 432–435 23. Lee, S. H., and Hurwitz, J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5672–5676 12. Krishna, T. S., Kong, X.-P., Gary, S., Burgers, P. M., and Kuriyan, J. (1994) 24. Fien, K., and Stillman, B. (1992) Mol. Cell. Biol. 12, 155–163 Cell 79, 1233–1243 25. Podust, L. M., Podust, V. N., Floth, C., and Hubscher, U. (1994) Nucleic Acids 13. Bauer, G. A., and Burgers, P. M. J. (1988) Biochim. Biophys. Acta 951, Res. 22, 2970–2975 274–279 26. Turchi, J. J., and Bambara, R. A. (1993) J. Biol. Chem. 268, 15136–15141 14. Li, R., Waga, S., Hannon, G. J., Beach, D., and Stillman, B. (1994) Nature 371, 27. Shivji, K. K., Kenny, M. K., and Wood, R. D. (1992) Cell 69, 367–374 534–537 28. Nichols, A. F., and Sancar, A. (1992) Nucleic Acids Res. 20, 2441–2446 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Lagging Strand DNA Synthesis at the Eukaryotic Replication Fork Involves Binding and Stimulation of FEN-1 by Proliferating Cell Nuclear Antigen

Li, Xiangyang; Li, Jun; Harrington, John; Lieber, Michael R.; Burgers, Peter M.J.
Journal of Biological Chemistry – Sep 1, 1995
Download PDF
4 pages

Loading next page...
 
/lp/unpaywall/lagging-strand-dna-synthesis-at-the-eukaryotic-replication-fork-I0HfKOrxW0

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.270.38.22109
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 270, No. 38, Issue of September 22, pp. 22109–22112, 1995 Communication © 1995 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. as an endonuclease on nicked double-stranded DNA substrates Lagging Strand DNA Synthesis with the 59-end of the nick expanded into a single-stranded tail at the Eukaryotic Replication (see structure in Fig. 2A), cutting these so-called flap struc- tures at the base of the tail (5). These types of DNA interme- Fork Involves Binding and diates likely occur during end joining reactions in which DNA Stimulation of FEN-1 by ends with limited homology are joined. Mammalian FEN-1 has also been identified as DNase IV, or maturation factor I, a Proliferating Cell Nuclear nick-specific 59 3 39-exonuclease required for nick translation Antigen* during Okazaki fragment maturation (6–10). Consistent with its corresponding functional activity, mammalian FEN-1 shows (Received for publication, July 10, 1995) sequence homology with the 59 3 39-exonuclease domain pres- ent in Escherichia coli DNA polymerase I (10). The yeast RTH1 Xiangyang Li‡§, Jun Li¶, John Harrington¶, gene is dispensable for cell growth, but rth1 deletion mutants Michael R. Lieber¶, and Peter M. J. Burgers‡i are temperature-sensitive for growth and show a terminal phe- From the Departments of Biochemistry, ‡Molecular notype consistent with a defect in DNA replication (2, 3). Ge- Biophysics, and Pathology, Washington University netic studies with yeast rth1 deletion mutants have also shown School of Medicine, St. Louis, Missouri 63110 that FEN-1 functions in the repair of alkylation damage and in The 5* 3 3*-exonuclease domain of Escherichia coli recombinational repair. However, yFEN-1 (RTH1) does not DNA polymerase I is required for the completion of lag- function in nucleotide excision repair (2, 3). Rather, in vitro ging strand DNA synthesis, and yet this domain is not studies have shown that the endonucleolytic activity of XP-G present in any of the eukaryotic DNA polymerases. Re- (the mammalian homologue of RAD2) is required for this repair cently, the gene encoding the functional and evolution- process (11). ary equivalent of this 5* 3 3*-exonuclease domain has The yeast proliferating cell nuclear antigen (PCNA) is the been identified. It is called FEN-1 in mouse and human processivity factor for DNA polymerases d and e.Itisaho- cells and RTH1 in Saccharomyces cerevisiae. This 42- motrimer with a subunit molecular mass of 29 kDa and is kDa enzyme is required for Okazaki fragment process- highly conserved from yeast to mammalian cells. The crystal ing. Here we report that FEN-1 physically interacts with structure of yeast PCNA shows that the trimer forms a closed proliferating cell nuclear antigen (PCNA), the processiv- ring with the appropriate dimensions and electrostatic proper- ity factor for DNA polymerases d and e. Through protein- ties to encircle double-stranded DNA and to interact with it protein interactions, PCNA focuses FEN-1 on branched using nonspecific contacts (12). Processivity in DNA synthesis DNA substrates (flap structures) and on nicked DNA substrates, thereby stimulating its activity 10–50-fold is achieved by protein-protein interactions between PCNA and but only if PCNA can functionally assemble as a toroidal the polymerase, thereby tethering the DNA polymerase at the trimer around the DNA. This interaction is important in primer terminus (13). In addition to this structural function the physical orchestration of lagging strand synthesis during the elongation phase of DNA replication, mammalian and may have implications for how PCNA stimulates PCNA, through its interactions with the cyclin-dependent pro- other members of the FEN-1 nuclease family in a broad tein kinase inhibitor p21 (CIP1/WAF1/SDI1), has also been range of DNA metabolic transactions. implicated in cell cycle control (14, 15). In this communication we show that PCNA physically interacts with FEN-1 and se- questers it to its site of action, thereby stimulating the activity In eukaryotic cells, a family of structure-specific endonucle- of FEN-1 10–50-fold. ases can be defined based on conserved domains within FEN-1 EXPERIMENTAL PROCEDURES (flap endonuclease), a 42-kDa enzyme that is both a 59 flap Materials—The yeast strains used were PY26 (Mata, ura3–52, DNA endonuclease and a nick specific 59-exonuclease (1). The leu2–3, 112,trp1D, prb1–1122, prc1–407, pep4–3, Dnuc1::LEU2) and its Saccharomyces cerevisiae analog of FEN-1 is encoded by the 1 Drth1 derivative PY59 (as PY26, but Drth1::hisG), which was made by RTH1 gene (2, 3). Both human and yeast FEN-1 (yFEN-1) are insertional activation of the RTH1 gene using plasmid pR2.10 (3). highly homologous to the human DNA repair gene XP-G and its Strains were grown and extracts prepared and concentrated with 0.35 yeast homologue RAD2 (4). Various DNA metabolic processes g/ml ammonium sulfate as described (16). E. coli single-stranded DNA are thought to require processing of intermediates by the binding protein, yeast FEN-1, and yeast PCNA were overproduced in E. coli and purified as described (1, 17). Yeast replication factor C (RF-C) FEN-1 endonuclease. The enzyme shows the greatest activity was purified as described (18). PCNA or bovine serum albumin was coupled to Affi-Gel 10 (Bio-Rad) according to the manufacturer’s proto- * This work was supported in part by Grants GM32431 (to col. Beads contained 3 mg of PCNA/ml of beads or 4 mg of BSA/ml of P. M. J. B.) and CA51105 and GM43236 (to M. R. L.) from the National beads. Institutes of Health. The costs of publication of this article were de- Two-hybrid Analysis—The entire POL30 gene or pol30–52 gene (con- frayed in part by the payment of page charges. This article must taining the S115P mutation) was fused to the bacterial lexA DNA therefore be hereby marked “advertisement” in accordance with 18 binding domain in vector pCH435 (17). Screening of a library of yeast U.S.C. Section 1734 solely to indicate this fact. cDNAs fused to the GAL4 activation domain using the lexA-pol30–52 § Present address: Dept. of Biochemistry, University of Washington construct as bait was carried out essentially as described (19). In the School of Medicine, Seattle, WA. one positive RTH1 isolate obtained, fusion with the activation domain To whom correspondence should be addressed. Tel.: 314-362-3872; of GAL4 occurred at amino acid 81. The strength of the interaction was Fax: 314-362-7183; E-mail: [email protected]. 2.5 units of b-galactosidase activity for lexA-POL30 and 2.2 units for The abbreviations used are: yFEN-1, yeast FEN-1; PCNA, prolifer- ating cell nuclear antigen; RF, replication factor; BSA, bovine serum lexA-pol30–52, whereas negative controls were 0.5–0.8 units of b-ga- albumin. lactosidase activity. This is an Open Access article under the CC BY license. 22110 PCNA Interaction with FEN-1 FIG.1. Immunoblot analysis of yFEN-1 binding to PCNA beads. A, fractionation of yFEN-1 on BSA or PCNA beads. See “Exper- imental Procedures” for details. B, competition assay. The assay was as described, except that yFEN-1 was preincubated for 10 min at 4 °C with FIG.2. PCNA stimulates yFEN-1 endonuclease activity on a 100 mg of BSA (lane 1)or30or100 mg of PCNA (lanes 2 and 4)or30or flap substrate. A, diagram of a DNA flap substrate. The position of the 100 mg of pcna-52 (lanes 3 and 5)in100 ml of buffer A prior to addition label is indicated by the asterisk on the flap strand, SC5. Oligonucleo- of PCNA beads. The 0.6 M NaCl eluate was analyzed. C, PCNA beads tides are: SC1, CAGCAACGCAAGCTTG (strand adjacent to the flap bind yFEN-1 in crude extracts. Extracts (500 mg) were incubated with strand); SC3, GTCGACCTGCAGCCCAAGCTTGCGTTGCTG (strand 10 ml of PCNA beads in 200 ml of buffer A, washed, and eluted with a annealed to the flap and the adjacent strand); and SC5, ATGTG- total of 20 ml of buffer A containing 0.6 M NaCl as described. Lane 1,15 GAAAATCTCTAGCAGGCTGCAGGTCGAC (flap strand, which is the ng of purified FEN-1; lane 2, 10 ng of FEN-1 plus 10 mlof0.6 M NaCl one labeled) (see Ref. 1 for a full description). The 59 ends are indicated. eluate from strain PY26; lane 3,10 ml of eluate from strain PY26; lane B, stimulation of yFEN-1 endonuclease by PCNA. The endonuclease 4,10 ml of eluate from strain PY59. assay was done in a 15-ml total volume containing 50 mM Tris-HCl, pH 8.0, 10 mM MgCl , 0.5 mM b-mercaptoethanol, 500 mg/ml BSA, 10 fmol Affinity Binding to Beads—BSA or PCNA beads (3 ml) were gently of flap substrate, 50 fmol of FEN-1, and, when present, 26,000 fmol as agitated in a thin walled 0.5-ml microcentrifuge tube with 10 ng of trimer of PCNA (2.3 mg), 30 fmol of RF-C, and 100 mM ATP. C, mutant yFEN-1 in 100 mlof40mM Hepes-NaOH, pH 7.4, 2 mM MgCl , 150 mM PCNA fails to stimulate. The assay was done as in panel B, but the PCNA concentration was varied as indicated. pcna-52, which is a mon- NaCl (buffer A) at 4 °C for 1 h. The bottom of the tube was pierced with omer in solution, was added at the indicated level. Products of the a 27-gauge needle and the solvent gently spun out in a clinical centri- reaction were separated on a denaturing 15% polyacrylamide gel and fuge. The beads were washed with 2 3 10 ml of buffer A and eluted with visualized on a PhosphorImager. The mobility of the top band is 33 2 3 3 ml of buffer A containing 0.3 M NaCl, 2 3 3 ml of buffer A nucleotides and that of the cleaved product is 20 nucleotides. Control containing 0.6 M NaCl, and finally 2 3 3 ml of buffer A containing 1% experiments showed no detectable nuclease activity by PCNA alone SDS, each time by pipetting the buffer on top of the beads and after 5 (data not shown). min at 0 °C, gently spinning through. Proteins in the fractions were separated on a 10% polyacrylamide gel containing sodium dodecyl sul- fate and subjected to immunoblot analysis using immunopurified rabbit hybrid method, an excess of the latter mutant protein also antisera to yFEN-1 for detection. blocked the binding of yFEN-1 to PCNA beads. Finally, we RESULTS AND DISCUSSION showed that the beads can bind yFEN-1 from crude yeast The RTH1 gene was isolated by us as a PCNA-interacting extracts. That the species detected on the Western blot is gene using the yeast two-hybrid method (20). In this search for yFEN-1 follows from its comigration with purified yFEN-1 and interacting genes, the bacterial lexA DNA binding domain was the absence of a signal with Drth1 extracts (Fig. 1C). Although fused to a cold-sensitive PCNA mutant (pol30–52) rather than yFEN-1 is not the major polypeptide species from crude ex- to the wild-type POL30 gene as strains with the latter con- tracts bound to PCNA beads, it can be detected as a distinct struct grew poorly and had a very low transformation fre- band on silver stained gels, which is absent when extracts are quency (17). The measured interaction signals between POL30- used from an isogenic Drth1 strain (data not shown). lexA or pol30–52-lexA and RTH1 fused to the GAL4 activation The functional interaction between yFEN-1 and PCNA was domain were identical and weak (see “Experimental Proce- probed with DNA substrates that are probable intermediates in DNA end joining (flap structures, Fig. 2A) and in DNA dures”). As the two-hybrid method may detect both direct and indirect interactions, we turned to biochemical methods to in- replication (nicked duplexes). On a model flap structure, PCNA vestigate a possible interaction between yFEN-1 and PCNA. stimulated the activity of yFEN-1 about 10-fold (Fig. 2B) based The existence of a specific protein-protein interaction be- on PhosphorImager quantitation. It is important to note that, tween yFEN-1 and PCNA was confirmed by affinity chroma- in contrast to assays with nicked substrates described below, tography on PCNA beads. Yeast FEN-1 bound specifically to only PCNA and yFEN-1 were added in this assay. Therefore, PCNA beads but not to control BSA beads (Fig. 1A). Elution stimulation of yFEN-1 activity can be directly attributed to its from the PCNA beads was accomplished at 0.6 M NaCl, indi- interaction with PCNA rather than with other accessory fac- cating that salt bridges contribute substantially to the PCNA- tors. Stimulation requires that PCNA is a trimer. The pcna-52 FEN-1 interaction. Subsequent treatment with ionic deter- mutant exists as a monomer in solution (17). Despite the fact gents did not release additional yFEN-1 (Fig. 1A). The that this mutant protein exhibits a similar affinity for yFEN-1 specificity of the interaction was demonstrated by the observa- as wild-type PCNA, it failed to stimulate yFEN-1 activity (Fig. tion that an excess of PCNA blocked binding of yFEN-1 to the 2C; see also Fig. 1B). The most straightforward conclusion of beads (Fig. 1B). As expected from the observed in vivo interac- these experiments is that PCNA must encircle the double- tion between yFEN-1 and the mutant pcna-52 by the two- stranded DNA in order to stimulate yFEN-1, and the mutant PCNA Interaction with FEN-1 22111 FIG.4. Hypothetical positioning of PCNA and FEN-1 at recom- binational flap intermediates (left) and during Okazaki frag- ment maturation (right). RF-C and polymerase d are also shown in the Okazaki fragment model. Indicated contacts with PCNA are based on physical and functional interaction studies. activity by PCNA but only if RF-C and ATP were also present. Interestingly, the inclusion of salt (75 mM NaCl) in the assay revealed the functional interaction between PCNA and yFEN-1 most profoundly. As PCNA is efficiently loaded by RF-C onto the DNA at physiological salt levels, it in turn is capable of loading yFEN-1 and hence stimulating its activity (Fig. 3). In FIG.3. Stimulation of FEN-1 by PCNA at DNA nicks. A59- labeled 24-mer oligonucleotide and a 36-mer oligonucleotide, represent- the absence of PCNA, yFEN-1 fails to interact with the DNA at ing positions 6353–6330 and 6329–6294, respectively, were hybridized these salt concentrations, and a modification of the assay to to single-stranded mp18 DNA (upper structure). Assays were as de- very low salt and magnesium concentrations is essential to scribed in the legend to Fig. 2, except for adjustment to 10 mM Tris, pH detect yFEN-1 activity at nicks (5). No stimulation was ob- 8,5mM MgCl , and 75 mM NaCl. In a 15-ml total volume, 20 fmol of substrate coated with 400 ng of E. coli single-stranded DNA binding served with the monomeric mutant pcna-52 (data not shown). protein and, where indicated, 100 fmol of FEN-1, 1300 fmol of PCNA, 30 The interaction between FEN-1 and PCNA may have bear- fmol of RF-C, and 100 mM ATP were incubated for 10 min at 30 °C. ing on the structure of the lagging strand DNA replication Analysis was as described in the legend to Fig. 2. The top band is the complex. Because FEN-1 does not negatively affect DNA syn- labeled 24-nucleotide oligonucleotide. The bottom band (arrow)isthe released 59 mononucleotide. Control experiments showed no nuclease thesis by DNA polymerase d or e holoenzyme (i.e. does not activity in all analogous experiments lacking FEN-1 (data not shown). compete with these polymerases for binding to PCNA), it may form an integral part of this complex and mediate coupled form is unable to do so. Because this mode of PCNA loading synthesis and maturation of Okazaki fragments (Fig. 4). In the occurs by nonspecific diffusion onto DNA ends, a large excess is presence of DNA polymerase d or e, the complex would carry required to observe substantial stimulation (21). Thus, at the out nick translation until DNA ligase I seals the nick (9). In lowest concentration of PCNA tested (0.02 mg), which repre- mammalian cells, an RNase H is also required for in vitro sents a 20-fold molar excess over DNA substrate, very little Okazaki fragment maturation (7, 26). However, it is not known stimulation was observed (Fig. 2C). RF-C is required for the at this time whether this enzyme forms an integral component efficient loading of PCNA at primer termini in an ATP-depend- of this maturation complex. ent manner (18, 22–24). If RF-C would efficiently and appro- In addition to replication, the interaction between FEN-1 priately load PCNA at flap structures one would expect to and PCNA may have broader implications in DNA metabolism observe stimulation of yFEN-1 activity at PCNA levels stoichi- as well. In nucleotide excision repair, for example, PCNA has ometric with DNA substrate. However, inclusion of RF-C and been shown to play an important role (27, 28). Although FEN-1 ATP in the nuclease assay did not give a significant further likely is not involved in this reaction, a highly homologous stimulation of yFEN-1 beyond that observed by PCNA alone, structure-specific nuclease, XP-G or RAD2, is absolutely re- either at high concentrations of PCNA (Fig. 2B)oratlow quired. Based on the involvement of PCNA in nucleotide exci- concentrations of PCNA, which show only minimal stimulation sion repair and the presence of homology between FEN-1 and (data not shown). Possibly, RF-C fails to recognize the flap RAD2, it is possible that PCNA may also interact with RAD2 to structure as a docking site for PCNA. Or, alternatively, PCNA facilitate its loading and thereby excision of damaged nucleo- loaded by RF-C is on the wrong double-stranded side of the flap tides. Thus, there may be a common theme in various aspects structure necessary for yFEN-1 stimulation. These observa- of DNA metabolism, in addition to DNA replication, in which a tions with the yeast enzymes were extended to the human processivity factor stimulates a structure-specific nuclease in system. Human PCNA stimulated the endonucleolytic activity processing nicked and branched DNA intermediates. of human FEN-1 on the flap structure substrate to a similar Based on the studies here, we conclude that the functional degree (data not shown). interaction between PCNA and FEN-1 is important in the In contrast to these results with flap substrates, we observed orchestration of lagging strand processing at the eukaryotic no obvious stimulation of yFEN-1 activity by PCNA on model DNA replication fork. The interaction of PCNA with other oligonucleotides containing a nick (data not shown). PCNA is FEN-1 family members may be generally important to a wide known to slide rapidly across linear DNA molecules (25). As the variety of transactions involving branched DNA intermediates. more rapid sliding of PCNA across these small linear double- Acknowledgments—We thank John Majors and Tim Lohman for stranded DNA substrates, in comparison to the sterically hin- critical discussions, and Louise and Satya Prakash for a gift of plasmid dered flap substrates, might not provide a significant mean pR2.10 for making a RTH1 deletion strain. residence time for PCNA in order to interact productively with yFEN-1, we turned to circular DNA substrates from which REFERENCES PCNA, once loaded, would not be able to dissociate (Fig. 3). 1. Harrington, J. J., and Lieber, M. R. (1994) Genes & Dev. 8, 1344–1355 2. Reagan, M. S., Pittenberger, C., Siede, W., and Friedberg, E. C. (1995) RF-C and ATP are absolutely required to load PCNA at primer J. Bacteriol. 177, 364–371 termini of circular substrates (21). In agreement with these 3. Sommers, C. H., Miller, E. J., Dujon, B., Prakash, S., and Prakash, L. (1995) known properties of PCNA, we observed stimulation of yFEN-1 DNA polymerase d holoenzyme assays were carried out as described PCNA stimulation assays were carried out at various salt levels, in Ref. 18 with subsaturating levels of PCNA (3 ng, 35 fmol). Addition either with or without RF-C and ATP. The maximum observed stimu- of a 20-fold molar excess of FEN-1 (30 ng, 700 fmol) inhibited the lation was about 1.5-fold. reaction by about 10%. 22112 PCNA Interaction with FEN-1 J. Biol. Chem. 270, 4193–4196 15. Flores, R. H., Kelman, Z., Dean, F. B., Pan, Z. Q., Harper, J. W., Elledge, S. J., 4. Hiraoka, L., Harrington, J. J., Gerhard, D. S., Lieber, M. R., and Hsieh, C.-L. O’Donnell, M., and Hurwitz, J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, (1995) Genomics 25, 220–225 8655–8659 5. Harrington, J. J., and Lieber, M. R. (1994) EMBO J. 13, 1235–1246 16. Bauer, G. A., Heller, H. M., and Burgers, P. M. J. (1988) J. Biol. Chem. 263, 6. Ishimi, Y., Claude, A., Bullock, P., and Hurwitz, J. (1988) J. Biol. Chem. 263, 917–924 19723–19733 17. Ayyagari, R., Impellizzeri, K. J., Yoder, B. L., Gary, S. J., and Burgers, P. M. 7. Goulian, M., Richards, S. H., Heard, C. J., and Bigsby, B. M. (1990) J. Biol. (1995) Mol. Cell. Biol., 15, 4420–4429 Chem. 265, 18461–18471 18. Yoder, B. L., and Burgers, P. M. J. (1991) J. Biol. Chem. 266, 22689–22697 8. Murante, R. S., Huang, L., Turchi, J. J., and Bambara, R. A. (1994) J. Biol. 19. Staudinger, J., Perry, M., Elledge, S. J., and Olson, E. N. (1993) J. Biol. Chem. Chem. 269, 1191–1196 268, 4608–4611 9. Waga, S., Bauer, G., and Stillman, B. (1994) J. Biol. Chem. 269, 10923–10934 20. Fields, S., and Song, O. (1989) Nature 340, 245–246 10. Robins, P., Pappin, D., Wood, R. D., and Lindahl, T. (1994) J. Biol. Chem. 269, 21. Burgers, P. M. J., and Yoder, B. L. (1993) J. Biol. Chem. 268, 19923–19936 28535–28538 22. Tsurimoto, T., and Stillman, B. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 11. O’Donovan, A., Davies, A. A., Moggs, J. G., West, S. C., and Wood, R. D. (1994) 1023–1027 Nature 371, 432–435 23. Lee, S. H., and Hurwitz, J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5672–5676 12. Krishna, T. S., Kong, X.-P., Gary, S., Burgers, P. M., and Kuriyan, J. (1994) 24. Fien, K., and Stillman, B. (1992) Mol. Cell. Biol. 12, 155–163 Cell 79, 1233–1243 25. Podust, L. M., Podust, V. N., Floth, C., and Hubscher, U. (1994) Nucleic Acids 13. Bauer, G. A., and Burgers, P. M. J. (1988) Biochim. Biophys. Acta 951, Res. 22, 2970–2975 274–279 26. Turchi, J. J., and Bambara, R. A. (1993) J. Biol. Chem. 268, 15136–15141 14. Li, R., Waga, S., Hannon, G. J., Beach, D., and Stillman, B. (1994) Nature 371, 27. Shivji, K. K., Kenny, M. K., and Wood, R. D. (1992) Cell 69, 367–374 534–537 28. Nichols, A. F., and Sancar, A. (1992) Nucleic Acids Res. 20, 2441–2446

Journal

Journal of Biological Chemistry – Unpaywall

Published: Sep 1, 1995

There are no references for this article.