Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Sin1: an evolutionarily conserved component of the eukaryotic SAPK pathway

Sin1: an evolutionarily conserved component of the eukaryotic SAPK pathway The EMBO Journal Vol.18 No.15 pp.4210–4221, 1999 Sin1: an evolutionarily conserved component of the eukaryotic SAPK pathway 1,2 1,3 to activation of the extracellular-signal-regulated kinases Marc G.Wilkinson , Teresa Soto Pino , 1 1 ERK1 and ERK2 in response to a variety of growth factors Sylvie Tournier , Vicky Buck , 1,4 5 and mitogens, and which are involved in the control of Humberto Martin , Jeffrey Christiansen , 5 cell proliferation and differentiation (Marshall, 1994). David G.Wilkinson and More recently, a family of MAP kinases has been identified 1,6 Jonathan B.A.Millar in metazoan cells whose members are activated by a 1 5 Division of Yeast Genetics and Division of Developmental variety of environmental stress conditions, DNA damaging Neurobiology, National Institute for Medical Research, The Ridgeway, agents, inflammatory cytokines and certain vasoactive Mill Hill, London NW7 1AA, UK neuropeptides (De´rijard et al., 1994; Freshney et al., 1994; Galcheva-Gargova et al., 1994; Han et al., 1994; Kyriakis Present address: Department of Molecular Neurobiology, SmithKline Beecham Pharmaceuticals, New Frontiers Science Park, Third Avenue, et al., 1994; Lee et al., 1994; Rouse et al., 1994). Harlow, Essex CM14 5AW, UK These stress-activated MAP kinases (SAPKs) fall into two Present address: Departmento de Genetica y Microbiologia, Facultad distinct classes based on sequence and are termed the de Biologia, Universitad de Murcia, 30071 Murcia, Spain c-Jun N-terminal kinase (JNK) and p38 kinases. Roles for Present address: Departmento de Microbiologia II, Facultad de Farmacia, Universidad Complutense de Madrid, Plaza de Ramo´n y the SAPKs have been demonstrated in the adaptive Cajal s/n, E-28040 Madrid, Spain response of cells to stress and in T-cell activation, inflam- mation and ischaemic injury (Davies, 1994; Waskiewicz Corresponding author e-mail: [email protected] and Cooper, 1995). As such the SAPKs are receiving a great deal of attention as potential targets for novel The fission yeast Sty1/Spc1 mitogen-activated protein therapeutics. (MAP) kinase is a member of the eukaryotic stress- Since activation of MAPK pathways results in changes activated MAP kinase (SAPK) family. We have identi- in gene expression, understanding how MAP kinases fied a protein, Sin1, that interacts with Sty1/Spc1 which trigger transcriptional activation is a key issue. Attention is a member of a new evolutionarily conserved gene has been focussed on the identification and characterization family. Cells lacking Sin1 display many, but not all, of of transcription factors whose activity is modulated by the phenotypes of cells lacking the Sty1/Spc1 MAP MAPK-phosphorylation. In mammalian cells, a number kinase including sterility, multiple stress sensitivity and of factors have now been identified that are phosphorylated a cell-cycle delay. Sin1 is phosphorylated after stress by the SAPKs (Treisman, 1996). Elk-1, a member of the but this is not Sty1/Spc1-dependent. Importantly, Sin1 ternary complex factor (TCF) family of erythroblastosis is not required for activation of Sty1/Spc1 but is virus E26 (ETS) domain proteins that synergizes with the required for stress-dependent transcription via its sub- serum response factor (SRF) factor to mediate activation strate, Atf1. We find that in the absence of Sin1, Sty1/ of certain immediate early genes such as the c-fos gene, Spc1 appears to translocate to the nucleus but Atf1 is has been shown to be a target of both JNK and p38 (Gille not fully phosphorylated and becomes unstable in et al., 1992, 1995; Marais et al., 1993; Whitmarsh et al., response to environmental stress. Sin1 is also required 1995; Zinck et al., 1995). The c-Jun factor is regulated for effective transcription via the AP-1 factor Pap1 but by JNK (Hibi et al., 1993; Derijard et al., 1994; Kyriakis does not prevent its nuclear translocation. Remarkably et al., 1994) but not by p38, whereas ATF2 is phosphoryl- chimaeric fusions of sin1 with chicken sin1 sequences ated and regulated by both JNK (Gupta et al., 1995; rescue loss of sin1 function. We conclude that Sin1 is Livingstone et al., 1995; van Dam et al., 1995) and p38 a novel component of the eukaryotic SAPK pathway. (Raingeaud et al., 1995). In all three cases phosphorylation Keywords: cell cycle/environmental stress/MAP kinase/ results in an increase in the activation potential of the factor Schizosaccharomyces pombe/transcription factor although the mechanisms that underlie these increases are not understood. The molecular dissection of the SAPK pathways has been greatly aided by the identification of a similar Introduction pathway in the unicellular fission yeast Schizosaccharo- myces pombe. The central elements of this pathway are The mitogen-activated protein kinase (MAPK) signalling the Sty1 MAP kinase (also known as Spc1 or Phh1), Wis1 pathways are critical for the response of cells to changes MAPKK and Wak1 (also known as Wis4 or Wik1) and in their external environment (Marshall, 1994; Herskowitz, Win1 MAPKKKs (Warbrick and Fantes, 1991; Millar 1995; Waskiewicz and Cooper, 1995; Treisman, 1996). They serve to transduce signals generated at the cell et al., 1995; Shiozaki and Russell, 1995; Kato et al., 1996; surface to the nucleus, where changes in gene expression Shieh et al., 1997, 1998; Samejima et al., 1998). Cells result. In mammalian cells multiple distinct pathways have lacking the Sty1 MAP kinase are sensitive to multiple been identified, the best characterized of which leads environmental stresses, are unable to undergo sexual 4210 © European Molecular Biology Organization A novel component of eukaryotic SAPK pathway conjugation or differentiation and are delayed in the Table I. Two-hybrid analysis of protein interaction timing of mitotic initiation. Importantly, Sty1 is not only structurally related to the mammalian SAPKs but is Bait plasmid Prey plasmid β-galactosidase (A.U.) activated by a similar range of environmental insults pAS2 pACTII 2.1  0.3 (Millar et al., 1995; Shiozaki and Russell, 1995; Degols pAS2 pACTII-Sin1 2.3  0.3 et al., 1996, Degols and Russell, 1997; Shieh et al., 1997). pAS2-Sty1 pACTII 2.1  0.5 Most notably Sty1 stimulates gene expression via the Atf1 pAS2-Sty1 pACTII-Sin1 50.6  1.3 and Pap1 transcription factors, homologues of human pAS2-Wis1 pACTII 2.4  0.1 pAS2-Wis1 pACTII-Sin1 2.5  0.3 ATF2 and c-Jun, respectively; indicating that these path- pAS2-Wak1 pACTII 1.7  0.4 ways are likely to have derived from a common ancestor pAS2-Wak1 pACTII-Sin1 2.0  0.6 (Toda et al., 1991; Takeda et al., 1995; Kanoh et al., 1996; Shiozaki and Russell, 1996; Wilkinson et al., 1996; Diploids from a cross of S.cerevisiae strains CG1945 and Y187 (Fromont-Racine et al., 1997) were co-transformed with either pAS2, Gaits et al., 1998; Toone et al., 1998; Wilkinson and pAS2-Sty1, pAS2-Wis1 or pAS2-Wak1 bait plasmids and either Millar, 1998). Nuclear translocation of activated Sty1 pACTII or pACT1-Sin1 prey plasmid and grown in the absence of allows it to bind and phosphorylate Atf1, but the precise leucine and tryptophan. Expression of LacZ was measured by mechanism by which this phosphorylation induces tran- assessing β-galactosidase activity in extracts as described in Materials scriptional activation is not known (Shiozaki et al., 1996; and methods. Measurements are expressed in arbitrary units (A.U.) as the mean of three independent determinations (SD). Wilkinson et al., 1996). Sty1 also binds to Pap1 but, in this case, the mechanism of activation appears to be distinct. In contrast to Atf1 the bulk of Pap1 protein is cytoplasmic in unstressed cells and its translocation to the Wis4 MAPKKK (Table I). Sin1 also did not interact in nucleus is controlled by Sty1 (Toone et al., 1998). The this assay with unrelated MAPKs such as Pmk1 or mechanism by which this occurs does not seem to involve unrelated clones such as Mcs2 or Mcs6, components of phosphorylation since Pap1 is not a phosphorylation target fission yeast CAK (data not shown). This suggests that of Sty1 in vitro. Nevertheless, Atf1 and Pap1 control the the Sin1 protein interacts only with the MAPK and not expression of a distinct but overlapping set of genes in other components of the Sty1 pathway. response to Sty1 activation (reviewed in Wilkinson and A genomic clone bearing the full-length sin1 gene was Millar, 1998). isolated (Figure 1A). Sequencing revealed an open reading Although the Atf1 and Pap1 transcription factors are frame (ORF) of 1953 bp, interrupted by a small intron key components of the fission yeast SAPK pathway they located close to the termination codon, which encodes a are not the only targets for Sty1. In particular, cells lacking protein with a predicted molecular weight of ~72 kDa. Sty1 are delayed in the timing of mitotic initiation, whereas Database searches indicate that Sin1 does not contain any cells lacking both Atf1 and Pap1 are not. In an effort to known structural motifs but is homologous to the gene understand how the Sty1 MAPK pathway controls cell- product encoded by a partial human cDNA, JC310 cycle progression we have sought additional SAPK targets. (Figure 1B). The JC310 clone was isolated based on its Here we describe a new Sty1-interacting protein that is a ability to suppress the temperature sensitive defect of a Val19 key component of the fission yeast SAPK pathway and RAS2 mutation when overexpressed in S.cerevisiae which is structurally and functionally conserved in all (Colicelli et al., 1991). While this work was underway a eukaryotes. full-length cDNA with 98% sequence homology to JC310 was isolated in a screen for segmentally expressed genes in the chicken hindbrain (Figure 1B; J.Christiansen and Results D. G.Wilkinson, manuscript in preparation). Two hypothet- Sin1 is a member of an evolutionarily conserved ical proteins, one from S.cerevisiae and and the other from gene family Caenorhabditis elegans, also show extensive homology To identify new effectors of the fission yeast SAPK to these sequences (H.Martin and J.Millar, data not shown). pathway, we undertook a two-hybrid screen in Saccharo- These and functional complementation studies described myces cerevisiae for S.pombe proteins which would inter- below indicate that Sin1 is a novel conserved protein. act with Sty1. Amongst the isolates we identified were partial cDNAs that corresponded to three distinct gene Sin1 interacts with Sty1 and is phosphorylated in products. These were termed Sin1 (eight isolates), Sin2 response to environmental stress (five isolates) and Sin3 (three isolates) for Sty1 (or SAPK) To determine whether Sin1 and Sty1 interact in fission yeast interacting protein. We found that Sin2 is a member of a Sin1 was N-terminally tagged with three tandem haem- novel evolutionarily conserved gene family and will be agglutinin (HA) epitopes and expressed from the thiamine described elsewhere (S.Tournier and J.B.A.Millar, unpub- repressible nmt41 promoter in fission yeast cells bearing lished data) and that Sin3 is identical to the Pyp2 MAP Sty1 C-terminally tagged with six histidines (His) kinase phosphatase, which has previously been shown to (Figure 2A). Complexes were purified on Ni –NTA interact with Sty1 (Millar et al., 1995). We have character- agarose beads and proteins visualized by Western blot. We ized Sin1 in this paper. The ability of Sin1 to interact found that Sin1 specifically co-precipitated with tagged but with other components of the Sty1 pathway and unrelated not untagged Sty1 (Figure 2A). We were also able to show proteins was tested by two-hybrid analysis. We found that that a bacterially produced glutathione S-transferase (GST)– the Sin1 induces expression of the β-galactosidase reporter Sin1 fusion protein effectively precipitates epitope-tagged gene only when co-transformed with a plasmid expressing Sty1 from cell lysates (data not shown). the Sty1 MAPK and not the Wis1 MAPKK or Wak1/ We noted that Sin1 migrates in a diffuse manner on 4211 M.G.Wilkinson et al. Fig. 1. Sin1 is a member of an evolutionarily conserved gene family. (A) Restriction map of the sin1 genomic clone. The position of the ORF (closed bar) and intron (open bar) are shown. Arrows indicate the cDNAs isolated from the two-hybrid screen. The ura4 gene (hatched bar) was introduced between the XhoI and SpeI sites to generate pSin1::ura4. (B) Alignment of the complete fission yeast Sin1 amino acid sequence (S.p. Sin1) to the predicted sequence from a partial cDNA from humans (H.s. JC310) and a full cDNA sequence from chicken (G.g. Sin1). Boxes indicate identities amongst all three proteins. Homologies were generated using a MegAlign work package based on a Jotun Hein algorithm (DNASTAR). The nucleotide sequence of the fission yeast and chicken sin1 genes will appear in the and DDBJ/EMBL/GenBank nucleotide sequence databases under the accession Nos AF155208 and AF153127, respectively. SDS–PAGE, indicating that the protein may be subject to to treatment with phosphatase in vitro, indicating that Sin1 post-translational modifications, such as phosphorylation. is hyperphosphorylated after stress (Figure 2B). Indeed In particular, Sin1 contains a number of potential serine– hyperphosphorylation of Sin1 was also rapidly induced after proline or threonine–proline motifs which may act as targets treatment of cells with 1 mM H O , mild heat shock (to 2 2 for phosphorylation, although only one of these conforms 42°C) or 5 min centrifugation, cellular stresses known to to a consensus MAP kinase site. To investigate whether Sin1 cause Sty1 activation (Figure 2C). To determine whether is a phosphoprotein in vivo, Sin1 was immunoprecipitated this phosphorylation was due to Sty1, epitope-tagged Sin1 from log phase wild-type cells before being treated in vitro was expressed in Δsty1 cells. No change in the mobility of with alkaline phosphosphatase. Treatment with phosphatase Sin1 on SDS–PAGE gels was observed in the absence of caused Sin1 to migrate as a single non-diffuse band of Sty1 before or after the cells were challenged with an high electrophoretic mobility, indicating that it is multiply- osmotic stress, indicating that an alternative kinase(s) phosphorylated in unstressed cells (Figure 2B). Following phosphorylates Sin1 (Figure 2D). In keeping with this inter- treatment of wild-type cells with 0.5 M NaCl, slower migrat- pretation, a bacterially produced, full-length GST–Sin1 ing forms of Sin1 were observed which were also sensitive fusion protein was not phosphorylated by Sty1 in vitro (data 4212 A novel component of eukaryotic SAPK pathway conditions. We reasoned that disrupting the function of new components of this pathway would effect one or more of these processes. To investigate the cellular function of Sin1 we replaced internal sin1 sequences with the ura4 gene (Figure 1A) and integrated the disrupt into a sporulating diploid strain. Tetrad dissection of asci from heterozygous diploids gave rise to four viable spores, which on germination showed a 2:2 segregation of uracil auxotrophs to uracil prototrophs (data not shown), indicat- ing that sin1 is a non-essential gene. Cells lacking Sty1, but not either of the Atf1 or Pap1 transcription factors, divide at a greater cell size than wild-type (Figure 3A; Millar et al., 1995, Shiozaki and Russell, 1995). Import- antly, Δsin1 cells were also found to be elongated at division with respect to wild-type dividing at 20.2  1.4 μm indicating that, like Sty1, Sin1 plays a role in the timing of mitotic initiation (Figure 3A). In rich medium we noted that Δsin1 cells also appear to be somewhat wider than wild-type cells, the reason for which is unknown. Sin1 is required for sexual conjugation and differentiation The Sty1 kinase and the Atf1 transcription factor, but not Pap1, are required for the onset of sexual conjugation and differentiation (Shiozaki and Russell, 1996; Wilkinson Fig. 2. Sin1 associates with Sty1 and is a stress-induced et al., 1996). Cells lacking these proteins mate with only phosphoprotein. (A) Sin1 interacts with Sty1 in vivo. Wild-type (JM 1059) or tagged Sty1(6His HA) cells (JM1521) were transformed with 5–10% efficiency of the wild-type. Homothallic strains pREP41-3HA-Sin1 and grown to log-phase in minimal medium bearing a deletion in either Sty1 or Sin1 were grown to lacking leucine at 30°C either in the absence (–) or presence ()of stationary phase for 48 h in minimal medium lacking a 10 μg/ml thiamine. Cell extracts from these cells were made following 2 nitrogen source and the number of cells that had undergone centrifugation and bead lysis. Proteins were precipitated on Ni –NTA sexual conjugation and meiosis was assessed. Cells lacking beads and the presence of the HA epitope determined by Western blot (Ni –NTA). As a control 50 μg of total cell extract was probed functional Sin1 display a complete mating defect which directly for the presence of the HA epitope (Cell extract). (B) Sin1 is could be fully restored by reintroduction of a Sin1 genomic a phosphoprotein. Wild-type (wt) (JM 1059) were transformed with clone but not control plasmid (Table II). It should be pREP41-3HA-Sin1 and grown to log-phase in minimal medium noted that this defect was more profound than in cells lacking leucine. Cultures was then either incubated in the same medium either untreated (0 min) or with 0.5 M NaCl for 10 min lacking Sty1 and that the mating defect of Δsty1 cells (10 min). Cells were harvested and the Sin1 protein could not be restored by overexpressing sin1 (Table II). immunoprecipitated from cell lysates with a monoclonal anibody to These results indicate Sin1 is also absolutely required for the HA epitope (12CA5). Immunoprecipitates were washed and then initiation of sexual differentiation. incubated at 30°C in phosphatase buffer for 20 min either in the presence () or absence (–) of 10 units alkaline phosphatase (PPase). Proteins were then separated by SDS–PAGE and probed for the Cells lacking Sin1 are sensitive to multiple presence of the HA epitope as in (A). (C) Phosphorylation of Sin1 is environmental stresses increased after stress. Wild-type cells expressing pREP41-3HA-Sin1 as The Sty1 MAP kinase pathway is required for the survival above were grown in minimal medium lacking leucine and then either of cells to multiple environmental insults. To examine the heat shocked (42°C) or incubated in the presence of an oxidative role of Sin1 in the stress response, Δsin1 cells or cells stress (1 mM H O ) or centrifuged at 4000 r.p.m. (Cent.) for the times 2 2 indicated. Cells were harvested and extracts made. Twenty micrograms lacking various components of the Sty1 MAP kinase of total cell protein was probed for the presence of Sin1 by Western pathway were grown on rich medium either at normal blot as in (A). (D) Sin1 is not phosphorylated by Sty1. Wild-type (JM temperature (30°C), high temperature (37°C) or in the 1059) or Δsty1 (JM 1160) cells transformed with pREP41-3HA-Sin1 presence or absence of an osmotic stress (1 M KCl) or and grown to log-phase in minimal medium lacking leucine before being incubated in the same medium containing 0.5 M NaCl for times oxidative stress (50 μM CdSO ). Importantly, as with cells indicated. The Sin1 protein was detected by Western blot as in (A). lacking either Sty1 or Atf1, Δsin1 cells were unable to grow under conditions of osmotic stress (Figure 3B). In not shown). These results indicate that Sin1 binds the Sty1 addition Δsin1 cells, like Δsty1 cells, were also temperature MAP kinase and is the target of one or more stress-activated sensitive, a phenotype not displayed by cells lacking either kinases in vivo. Atf1 or Pap1 or both (Figure 3B). However in contrast to Δsty1 cells, Δsin1 cells are able to proliferate in the Cells lacking Sin1 are delayed in the timing of presence of 50 μm CdSO (Figure 3B) or 1 mM t-butyl mitotic initiation hydrogen peroxide (data not shown). Thus Sin1 is required The Sty1 MAP kinase pathway is required for several for many, but not all, of the processes controlled by Sty1 functions in fission yeast including maintaining the MAP kinase, in particular those controlled by Atf1, correct timing of mitotic initiation, for onset of cellular supporting the notion that Sin1 is an authentic component differentiation and for protection of the cells under adverse of the fission yeast SAPK pathway. 4213 M.G.Wilkinson et al. Fig. 3. Cells lacking Sin1 are delayed at the G /M transition and sensitive to environmental stress. (A) Δsin1 cells are elongated at division. Wild-type (wt) (JM 1059), sty1::ura4 (Δsty1) (JM 1160) or sin1::ura4 (Δsin1) (JM 1797) cells were grown to log-phase in minimal medium and photographed using Normarski optics. Cell size at cell division was measured using a Nikon filar eyepiece drum micrometer at 1200 magnification. (B) Δsin1 cells are stress sensitive. Wild-type (wt) (JM 1059), sty1::ura4 (Δsty1) (JM 1160), sin1::ura4 (Δsin1) (JM 1797), atf1::ura4 (Δatf1) (JM 1529), pap1::ura4 (Δpap1) (TP 103–3C) or atf1::ura4 pap1::ura4 (Δatf1 Δpap1) (JM 1733) cells were grown on yeast extract and supplement (YES) at 30°C and then streaked to the same medium at 30°C (top left plate) or to YES at 37°C (top right), to the same medium containing 1 M KCl at 30°C (bottom left plate), or YES containing 50 μM CdSO (bottom right plate) and incubated for two days. Table II. Induction of sexual conjugation and differentiation others are either dependent solely on Pap1 (e.g. trr1)or on both Atf1 and Pap1 (e.g. ctt1). In the latter case, the Strain Plasmid Mating efficiency (%) requirement for Atf1 and Pap1 is dependent on the nature of the inductive stress (Toone et al., 1998; Wilkinson and wt h pIRT2 41.5 wt h pIRT2-Sin1 43.8 Millar, 1998). Since Sin1 is required for proliferation Δsty1 h pIRT2 3.8 under certain adverse conditions, we next investigated the Δsty1 h pIRT2-Sin1 3.6 role of Sin1 in rapid activation of gene expression follow- Δsin1 h pIRT2 0.0 ing the exposure of cells to multiple stresses. In response Δsin1 h pIRT2-Sin1 39.4 to either an osmotic shock (0.9 M KCl), oxidative stress Homothallic cultures of wild-type (wt) (JY878), sty1::ura4 (Δsty1) (1 mM hydrogen peroxide) or a mild heat shock (42°C) (1264) or sin1::ura4 (Δsin1) (JM820) cells were transformed with expression of pyp2 and gpd1 was virtually absent in Δsin1 either pIRT2 or pIRT2-Sin1, grown to log-phase in liquid EMM and cells, although some residual induction of gpd1 occurred then transferred to the same medium lacking a nitrogen source in response to osmotic stress (Figure 4). Loss of Sin1 did (NH Cl) for two days. Mating efficiency was assessed microscopically. not, however, effect the expression of cdc2, or other unrelated genes, implying that Sin1 does not control Sin1 is required for Atf1-dependent gene general transcription (Figure 4; data not shown). These transcription findings indicate that Sin1 is required for rapid stress- Induction of a number of genes in response to stress induced expression of genes under the control of the including glycerol-3-phosphate dehydrogenase (gpd1), the Wis1–Sty1–Atf1 pathway. Pyp2 tyrosine-specific MAP kinase phosphatase (pyp2), thioredoxin reductase (trr1) and catalase (ctt1) are entirely dependent on the Sty1 MAP kinase (Millar et al., 1995, Sin1 is not required for Sty1 activation Degols et al., 1996; Wilkinson et al., 1996; Toone et al., The previous results establish Sin1 as a component of a 1998). Some of these (including pyp2 and gpd1) are signal transduction cascade leading to stress-activated targets of the Atf1 transcription factor alone, whereas gene expression. Since Sty1 is required for this response, 4214 A novel component of eukaryotic SAPK pathway Fig. 5. Sin1 is not required for Sty1 phosphorylation. Effect of Sin1 on Sty1 activation. Log phase cultures of wild-type (wt) (JM1521) or Δsin1 (1849) cells bearing an integrated and epitope-tagged version of Sty1 growing in YES medium at 30°C were incubated in the same medium containing either 0.5 M NaCl or shifted to 42°C for the times indicated. Approximately 210 cells were harvested at each time point, lysed under denaturing conditions and the Sty1 protein precipitated using Ni –NTA agarose. Precipitates were probed by Western blot for the presence of phosphorylated MAP kinase (α-p38). Table III. Strains used in this study Strain No. Genotype Reference /source CH 428 ade6-M210 his7-366 h C.Hoffman CH 429 ade6-M216 his7-366 h C.Hoffman JM 1160 ade6-216 sty1::ura4 h Millar et al., 1995 JM 1529 his7-366 atf1::ura4 h this study TP 103– pap1::ura4 h Toone et al., 1998 3C JM 1733 his7-366 atf1::ura4 pap1::ura4 h this study JM 1797 ade6-M216 his7-366 sin1::ura4 h this study JY 878 ade6-M216 h David Hughes Fig. 4. Sin1 is required for Atf1-dependent gene transcription. JM 1264 ade6-M216 sty1::ura4 h Shieh et al., 1997 Log-phase cultures growing in YES at 30°C of either wild-type (wt) JM 1820 ade6-M210 his7-366 sin1::ura4 h this study (JM1059) or Δsin1 cells (JM1797) cells were either shifted to 42°C KS 1479 atf1 (HA6His):ura4 h Shiozaki et al., (A) or incubated in the same medium containing 0.9 M KCl (B)or 1mMH O (C) at 30°C for the times indicated. Total RNA was 2 2 JM 1852 atf1 (HA6His):ura4 sin1::ura4 this study extracted and equal quantities were separated by electrophoresis. JM 1521 ade6-M210 his7-366 sty1 (HA6His):ura4 Shieh et al., 1997 Northern blots were then sequentially probed using DNA specific to the pyp2, gpd1 and cdc2 genes. JM 1849 ade6-M210 his7-366 sty1 (HA6His):ura4 this study sin1::ura4 HM 1689 ade6-M216 his7-366 sty1 (9myc):ura4 h this study we next asked whether Sin1 is required for Sty1 activation. JM 1809 ade6-M216 his7-366 sty1 (9myc):ura4 Wild-type or Δsin1 cells bearing a His -tagged sty1 allele sin1::ura4 this study were grown to log-phase in rich medium and then chal- All strains were leu1-32 ura4-D18 unless otherwise stated. lenged to either a heat shock (42°C) or osmotic stress (0.5 M NaCl). Phosphorylation of Sty1 was monitored by Western blot using an antibody that recognizes only the immunofluorescence. In both wild-type and Δsin1 cells, phosphorylated, and by inference activated, form of Sty1 Sty1 was found to be localized throughout the cytoplasm (Gaits et al., 1998). No difference in the degree or kinetics in unstressed cells but concentrated in the nucleus (as of Sty1 phosphorylation could be observed either in the assessed by co-incidence with DAPi staining) after 10 min presence or absence of Sin1 (Figure 5). However, in this stimulation with an osmotic stress (0.5 M NaCl) and other experiments we noted that dephosphorylation (Figure 6A). However, in three independent experiments of Sty1 was delayed, probably due to the lack of induction the intensity of nuclear Sty1 staining in Δsin1 cells was of the Pyp2 MAP kinase phosphatase. Since Sin1 does found to be ~50% that of wild-type (Figure 6A). These not appear to interact with other components of the Sty1 results indicate that Sin1 is not absolutely required for pathway and is not required for Sty1 activation it is nuclear translocation of the Sty1 MAP kinase, but may unlikely to be part of the pre-activated MAPK complex. facilitate the transport process. We have previously shown that Sty1 associates with Sin1 is required for full phosphorylation of Atf1 in Atf1 in vivo and is required for its phosphorylation after the nucleus stress (Shiozaki and Russell, 1996; Wilkinson et al., The Sty1 MAP kinase is cytoplasmic in unstressed cells 1996). Although not formally demonstrated for Atf1, and translocates to the nucleus only in response to stress. phosphorylation of ATF2 by the JNK or p38 MAP kinase Transport to the nucleus requires dual phosphorylation but leads to its transcriptional activation. To analyse the not activity of the MAP kinase (Gaits et al., 1998). To role of Sin1 in Atf1-mediated transcriptional activation, assess whether Sin1 may be required for this process, a phosphorylation of Atf1 was assessed in the absence of sty1-9myc allele was generated and Sty1 was localized Sin1. For these experiments, a chromosomal version of in either a wild-type or Δsin1 background by indirect atf1 was used that expresses Atf1 tagged with His and 4215 M.G.Wilkinson et al. the HA epitope (Shiozaki and Russell, 1996). Previous results have shown that this shift is due to phosphorylation and is entirely dependent on the Sty1 MAP kinase (Shiozaki and Russell, 1996). Treatment of wild-type cells with osmotic stress induces a rapid phosphorylation of Atf1 in vivo which is retained for up to an hour, as previously observed. The level of Atf1 protein also increases at later times, probably because Atf1 stimulates its own expression (Degols and Russell, 1997). In the absence of Sin1, Atf1 undergoes a rapid stress-dependent phosphorylation, the extent of which is notably less than that observed in wild-type cells (Figure 6B). This is consistent with our observation that a proportion of Sty1 does enter the nucleus. More strikingly, the level of Atf1 protein rapidly decreases and no increase in the level of the protein is observed after prolonged incubation (Figure 6B). We presume this latter result is because Δsin1 cells do not support Atf1-dependent transcription. By indirect immunofluorescence Atf1 protein is still observed in the nucleus in the absence of Sin1 but to a some what lesser intensity (data not shown). The steady-state level and full stress-induced phosphorylation of Atf1 were restored when an episomal plasmid expressing sin1, but not empty vector, was reintroduced to Δsin1 cells (data not shown). These results suggest that Sin1 is required both for full phosphorylation and stability of Atf1 after stimulation of cells by environmental stress. This is likely to account for the requirement for Sin1 in Atf1-dependent gene transcription. Sin1 controls Pap1-dependent gene transcription but not nuclear entry To investigate the role of Sin1 in Pap1-dependent transcription the induction of the ctt1 and trr1 genes was investigated in cells lacking Sin1. In response to either heat shock or oxidative stress, induction of catalase (ctt1) and thioredoxin reductase (trr1) is dependent on the Pap1 transcription factor. As the results in Figure 7 indicate, rapid induction of ctt1 after either heat shock or oxidative stress was severely compromised in the absence of Sin1, although the message eventually accumulated to near wild-type levels after prolonged exposure (Figure 7A and B). Induction of trr1 under the same conditions was virtually abolished (Figure 7A and B). Previous results have suggested that Sty1 controls transcriptional activation of Pap1 by controlling its nuclear translocation (Toone et al., 1998). In contrast, we find that loss of Sin1 does not block the nuclear accumulation of ectopically expressed GFP–pap1 fusion protein (Figure 7C). These results indicate that Sin1 is also required for the induction Fig. 6. Effect of Sin1 on translocation of Sty1 and phosphorylation of of both Pap1-dependent gene transcription in fission yeast, Atf1. (A) Log phase cultures of wild-type (wt) (HM 1689) or Δsin1 by a mechanism that is distinct from control of Pap1 (JM 1809) cells bearing an integrated and nine myc epitope-tagged version of Sty1 growing in YES medium at 30°C (Control) were nuclear entry. incubated in the same medium containing 0.5 M NaCl for the times indicated. Cells were fixed and probed by indirect immunofluorescence Sin1 is functionally conserved for the presence of the myc epitope (Sty1-9myc) or nuclei (DAPi) as Since many of the components of the fission yeast SAPK described in Materials and methods. (B) Log phase cultures of wild- pathway are conserved in metazoans, we next tested type (wt) (KS 1479) or Δsin1 (JM 1852) cells both bearing an integrated and C-terminally tagged version of Atf1 containing His and 6 whether the structural homologues of Sin1 from either two HA epitopes growing in YES medium at 30°C were incubated in mammalian or avian origin could substitute for Sin1 in the same medium containing 0.5 M NaCl for the times indicated. fission yeast. Various full-length, truncated or fusion Approximately 210 cells were harvested at each time point, lysed proteins between fission yeast and chicken sin1 sequences under denaturing conditions and the Atf1 protein precipitated using Ni –NTA agarose. Precipitates were probed by Western blot for the were constructed and cloned behind the thiamine presence of the HA-epitope tag (α-HA). repressible nmt1 promoter. The ability of these constructs 4216 A novel component of eukaryotic SAPK pathway Fig. 7. Sin1 controls Pap1-dependent gene transcription but not its nuclear translocation. Sin1 is required for rapid Pap1-dependent transcription. Log-phase cultures growing in YES at 30°C of either wild-type (JM1059) or Δsin1 cells (JM1797) cells were incubated in the same medium containing either (A)1mMH O or (B) shifted to 42°C for the times indicated. Total RNA was extracted and equal quantities were separated by 2 2 electrophoresis. Northern blots were then sequentially probed using DNA specific to the ctt1, trr1 and cdc2 genes. (C) Sin1 is not required for Pap1 nuclear translocation. Δsin1 cells (JM1797) transformed with pREP41-GFP–pap1 (Toone et al., 1998) were grown to log-phase in minimal medium lacking thiamine and leucine. Localization of Pap1 was assessed by direct immunofluorescence as detailed in Materials and methods before (Control) and after addition of 1 mM H O for 30 min (30 min). 2 2 to suppress the temperature sensitivity of Δsin1 cells was then assessed. Whereas the full-length fission yeast gene [S.pombe Sin1(1–650)] could rescue the defect of Δsin1 cells at high temperature, a construct expressing only the first 486 amino acids [S.pombe Sin1 (1–486)] could not, indicating that the C-terminal 164 amino acids are essential for Sin1 function in vivo (Figure 8). Surprisingly, fusion of the first 486 amino acids of the S.pombe Sin1 to the C-terminal 182 amino acids of the chicken Sin1 sequence restored the ability of Δsin1 cells to grow at high temper- ature, indicating that the C-terminal domain of fission yeast and chicken sequences are functionally related (Figure 8). Notably we isolated a clone by the two-hybrid screen that expresses only the C-terminal 244 amino acids of Sin1, suggesting that this region is the presumptive binding domain for Sty1. Full-length chicken Sin1 was also able to suppress the temperature sensitivity of a Δsin1 Fig. 8. Functional conservation of Sin1. Diagrammatic representation strain, although in this case the rescue was very poor. We of full-length and chimaeric fusion proteins from S.pombe and Gallus note that the fission yeast sequence contains additional gallus sin1 sequences. Δsin1 cells (JM 1852) were transformed with amino acids between residues 419 and 490 that are not either pREP41 (Control), pREP41-Sin1(ΔC) expressing only the first 486 amino acids of fission yeast Sin1 [S.p. Sin1 (1–486)] or pREP41- represented in either human or chicken sequences, which Sin1 (S.p.–G.g.) expressing a chimaeric fusion protein between fission may be important for functional rescue. Together these yeast and chicken sequences (S.p.–G.g. Sin1). Cells were grown on data suggest that Sin1 is a member of a new class of EMM plates lacking leucine at 30°C and then streaked onto the same evolutionarily conserved signal transducer. plates at either 30 or 37°C for 2 days. 4217 M.G.Wilkinson et al. Discussion communication). It is conceivable that deregulated entry of Sty1 to the nucleus may lead to incomplete Atf1 Here we have identified Sin1 as a new component of the phosphorylation and subsequent degradation. Alternat- fission yeast stress-activated Sty1 MAP kinase pathway. ively, Sin1 may function to protect phosphorylated Atf1 This conclusion is based on the following observations. from ubiquitination. We are currently attempting to distin- First, Sin1 binds specifically to the Sty1 MAP kinase guish between these possibilities. in vivo and is phosphorylated after environmental stress. Our results indicate that Sin1 is also partly required for Secondly, cells lacking Sin1 display many of the pheno- Pap1-dependent transcription. The regulation of Pap1 is types of cells lacking Sty1 including stress sensitivity, distinct from that of Atf1, in that Pap1 is not an in vitro sterility and cell-cycle delay. Lastly, Sin1 is required for target for Sty1 MAP kinase (Toone et al., 1998). Instead the induction of a number of genes including pyp2, gpd1, translocation of cytoplasmic Pap1 to the nucleus is thought ctt1 and trr1 which are under the control of both the to be the primary mechanism by which Pap1-dependent Sty1 MAP kinase and its targets, the Atf1 and Pap1 transcription is controlled by Sty1. One caveat to this is transcription factors. that translocation of Pap1 appears to be too slow to fully Although stress-activated and Sty1-dependent gene tran- account for the rapid induction of gene expression (Toone scription is defective in the absence of Sin1, activation of et al., 1998). We find that in the absence of Sin1, Sty1 kinase, as judged by appearance of the doubly rapid induction of Pap1-dependent transcription of ctt1 is phosphorylated form of Sty1, appears to be normal. This defective, but this eventually recovers after prolonged distinguishes Sin1 from recently identified regulators of incubation as Pap1 is translocated to the nucleus. It is MAP kinases in mammalian cells such as JIP-1 or MP1, conceivable that a small nuclear pool of Pap1 is rapidly which act as scaffold proteins that support the integrity activated by Sty1 after exposure to stress and subsequently of the pre-activation MAPK complex (Dickens et al., reinforced by a Sin1-independent bulk import of Pap1 1997; Schaeffer et al., 1998; Whitmarsh et al., 1998). from the cytoplasm at later times. Regardless, the eventual Indeed Sin1 does not interact with other components of increase in ctt1 expression explains why sin1-deletes are the Sty1 MAP kinase pathway, including the Wis1 able to proliferate under conditions of prolonged exposure MAPKK and Wak1 MAPKKK. Rather, it places Sin1 to oxidative stresses such as heavy metals and hydrogen function between MAP kinase activation and stimulation peroxide. It is important to point out that cells lacking of gene transcription. Since Sty1, like many MAP kinases, Sin1, like Δsty1 cells, are both temperature sensitive and is cytoplasmic in unstimulated cells and translocates to delayed in the timing of mitotic initiation whereas cells the nucleus after activation, we considered the possibility lacking both Atf1 and Pap1 are not. This suggests that that Sin1 may be required for translocation of the doubly Sin1 controls processes in fission yeast other than those phosphorylated MAP kinase to the nucleus. Indirect regulated by Atf1 and Pap1, including control of cell- immunocytochemical analysis using an integrated epitope- cycle progression. The lack of known structural motifs in tagged Sty1 suggests that this is not the case. This the Sin1 protein at present prevents further speculation as observation is consistent with the fact that, in the absence to its function. Importantly, however, Sin1 itself is a of Sin1, Sty1 is still able to phosphorylate constitutively phosphoprotein that is hyperphosphorylated after environ- nuclear Atf1. However, neither the intensity of nuclear mental stress but not a substrate of Sty1, suggesting Sin1 accumulation nor Sty1-dependent Atf1 phosphorylation may act at a focal point between the Sty1 pathway and are as pronounced as in wild-type cells. This suggests that other stress-activated kinases. Sin1 may facilitate, but is not absolutely required for, the In conclusion, here we have presented data which transport process. It will be highly informative, in this establishes Sin1 as a component of the stress-activated regard, to identify additional proteins that bind Sin1, its Sty1/Spc1 MAP kinase pathway in fission yeast. Since requirements for association with Sty1 and its cellular the fission yeast Sty1 pathway displays many of the location before and after challenge by environmental characteristics of the JNK and p38 MAP kinase pathways stress. These experiments are now underway. in mammals, a prediction from our results is that Sin1 We observe that Atf1 is not only under-phosphorylated homologues play a central role in stress-activated gene in the absence of Sin1 but rapidly degraded. Importantly, transcription by SAPKs in other species. Future work will recent evidence from mammalian cells has implicated be aimed at testing this hypothesis. protein stability of SAPK targets as a means of controlling stress-dependent stimulation of gene transcription (Fuchs Materials and methods et al., 1998). The ability of JNK to phosphorylate the Media and general techniques c-Jun transcription factor requires its association with the Media and genetic methods for studying fission yeast have been reviewed delta domain, which is positioned between amino acids (Moreno et al., 1991). General DNA methods were performed using 30–57 in the N-terminus. Association of JNK to this standard techniques (Sambrook et al., 1989). Cell length measurements domain also controls the proteolytic degradation of c-Jun were made using log-phase cells with a Nikon filar eyepiece drum micrometer at 1200 magnification. Transformations were regularly through the 26S proteasome, although, importantly in this performed by electroporation (Prentice, 1991) using a Bio-Rad Gene case, JNK does not need to be active as a kinase (Treier TM Pulser . et al., 1994; Fuchs et al., 1996; Musti et al., 1997). This lead researchers to find that JNK also targets ATF2 for Assessment of mating efficiency Homothallic (h ) cells were grown to log-phase for two days in liquid ubiquitination by a similar process (Fuchs et al., 1997). Edinburgh minimal medium (EMM) and then transferred for various Although a number of phosphorylation sites for Sty1 have lengths of time to the same medium lacking a nitrogen source. Mating been identified on the Atf1 protein, the function of these efficiency was determined microscopically by scoring the percentage of phosphorylations is not understood (N.Jones, personal spore-containing asci or cells undergoing sexual conjugation. 4218 A novel component of eukaryotic SAPK pathway Two-hybrid screening and β-galactosidase assays CCTGGACAACCC (Sin1-GGF) incorporating an NdeI site (shown The full-length sty1 ORF was fused to the 3 end of the GAL4 DNA- italicized) which hybridized to sequences surrounding the ATG initiation binding domain by digesting pREP41-sty1(HA6His) (Millar et al., 1995) codon, whereas the 3 oligonucleotide TTAATCGGATCCTCACT- with NdeI and BamHI and cloning the fragment into the NdeI and GCTGTCCCGATTTCTT (Sin1-GGC) incorporating a BamHI site BamHI sites of pAS2ΔΔ-BC to construct pAS2ΔΔ-BC-sty1. An S.pombe (shown italicized) hybridized to sequences 3 to the TGA termination cDNA library (Durfee et al., 1993) was screened using an improved codon. The PCR product was cleaved with NdeI and BamHI and cloned mating strategy (Fromont-Racine et al., 1997). We obtained 32 clones, into pREP41 to form pREP41-Sin1(G.g.). A chimaeric fusion protein of positive for HIS3 and LacZ expression from 210 diploid colonies. the first 486 amino acids of the fission yeast Sin1 with the last 186 amino Interacting proteins were identified by automated DNA sequencing. acids of chicken Sin1 was constructed by combined PCR using the Quantification of interactions was performed by assessing β-galactosidase 5 oligonucleotides Sin1-N1 and the 3 oligonucleotide CTGGCTCT- activity in cell extracts as previously described (Buck et al., 1995). CCAAGGTACTAAATGTTTTATCAAGTGG (Sin1-CP2) and the 5 oligonucleotide CCACTTGATAAAACATTTAGTACCTTGGAG- Identification and sequencing of fission yeast Sin1 AGCCAG (Sin1-CP1) in combination with the 3 oligonucleotide Sin1- An XhoI fragment from pACT-Sin1 containing a partial sin1 cDNA was GGC. Products from each reaction were then combined and a second used to probe an S.pombe pURB1 genomic library (Barbet et al., 1992). round of amplification performed using the oligonucleotides Sin1-N1 Two positive clones with overlapping inserts were isolated and designated and Sin1-GGC. The resulting product was cleaved with NdeI and BamHI pURB1-Sin1-1 and pURB1-Sin1-2. Sequencing of the partial cDNAs and cloned into pREP41 to form pREP41-Sin1 (S.p.-G.g.). Plasmids from pACT-Sin1 and the two genomic clones revealed an ORF of were used to transformed strains bearing the leu1-32 mutation and 1953 bp, interrupted by a small intron located close to the termination leucine prototrophs selected. Stable overexpression was reached after at codon. Dideoxy sequencing was performed using a T7 sequencing kit least 48 h growth in the absence of thiamine. from Pharmacia. Immunocytochemical analysis of Sty1 location Overexpression and tagging of fission yeast Sin1 A tandem 9 myc epitope was amplified by PCR from the plasmid The plasmid pURB1-Sin1-1 was digested with SacI and SphI and the pC3280 (a gift of K.Nasmyth) using the 5 oligonucleotide GAAAAA- insert cloned into pIRT2 to form pIRT2-Sin1. The sin1 ORF was GGGCGGCCGCATGGTTCAC and the 3 oligonucleotide ATATA- amplified from the genomic clone pIRT2-Sin1 by PCR amplification. TATGCGGCCGCCTTATGTCGGCATATTCGAG bearing NotI sites The 5 oligonucleotide TTACCATGGATCATATGCAATATTCTCAT- (italicized). The resulting PCR fragment was cloned into pBSSK-Ura4- ATATACTTC (Sin1-N1) incorporating NcoI and NdeI sites (shown Sty1(6HisHA) (Shieh et al., 1998) that had been digested with NotIto italicized) hybridized to sequences surrounding the ATG initiation codon, form pBSSK-Ura4-Sty1(9myc). pBSSK-Ura4-Sty1(9myc) was linearized whereas the 3 oligonucleotide ACATGGATCCACCTATGTATTCATA- with PacI and the resulting fragment transformed into wild-type S.pombe GAA (Sin1-REPC2) incorporating a BamHI site (shown italicized) cells bearing the ura4-D18 auxotrophic marker. Stable integration of the hybridized to sequences 3 to the TGA termination codon. The PCR tagged sty1 gene at the genomic sty1 locus was confirmed by Southern product was cleaved with NdeI and BamHI and cloned into pREP41- blot analysis and PCR. Indirect immunofluorescence microscopy and 3HA to form pREP41-3HA-Sin1 which expresses a 3HA-tagged sin1 DAPi staining were performed by methanol fixation as previously gene under the control of a partially defective version of the nmt1 described (Alfa et al., 1993). A monoclonal antibody to the myc epitope thiamine repressible promoter (Basi et al., 1993). The same fragment (9E10) and a rhodamine-conjugated antimouse antibody were used to was cloned into pREP41 to form pREP41-Sin1. A truncated clone of detect Sty1 location. Sin1 expressing only the first 486 amino acids of Sin1 was constructed in a similar manner by PCR using the 5 oligonucleotide Sin1-N1 and Fluorescence microscopy the 3 oligonucleotide TCTTATGGATCCTTAACTAAATGTTTTAT- Indirect fluorescence microscopy was carried out on an Olympus IX70 CAAGTGG (Sin1-ΔC). The resulting 1.5 kb fragment was digested with inverted microscope with phase contrast and DIC optics and observed NdeI and BamHI and cloned into pREP41 to form pREP41-Sin1(ΔC). using a Photometrics CH350L liquid cooled CCD camera and Deltavision Plasmids were used to transformed strains bearing the leu1-32 mutation deconvolution software. Images were manipulated using PhotoShop. and leucine prototrophs selected. Stable overexpression was reached Preparation and detection of GFP fluorescence was performed essentially after at least 48 h growth in the absence of thiamine. as previously described (Toone et al., 1998). Fluorescence was observed on a Zeiss Axiophot and images were captured on standard 35 mm film. Disruption of fission yeast Sin1 sequences The plasmid pCRII-ura4 was digested with XhoI and SpeI to release a Detection of activated Sty1 protein 1.6 kb fragment that was cloned into pIRT2-Sin1 which had been The Sty1 protein was partially purified from cells expressing Sty1 fused digested with XhoI and SpeI to form pIRT2-Sin1::ura4. pIRT2-Sin1::ura4 to a HA peptide epitope and a His C-terminal tail. Briefly, pelleted was digested with SacI and SphI and transformed into a leu1-32/leu1- cells were lysed into denaturing lysis buffer [1% nonident P40 (NP40), 32 ura4-D18/ura4-D18 ade6-M216/ade6-M210 h /h diploid strain. 6 M GuHCl pH 8.0] and the Sty1 protein isolated by affinity precipitation Sporulation and tetrad dissection of stable heterozygous diploids pro- on Ni –NTA beads (Qiagen). Precipitated proteins were resolved duced ura4 haploids, demonstrating that sin1 is not an essential gene. by SDS–PAGE and transferred electrophoretically to nitrocellulose Uracil prototrophs contained a disruption of the sin1 gene as verified by membranes. Membranes were probed with either a monoclonal antibody PCR and Southern hybridization (data not shown). to the HA epitope (12CA5) or with a polyclonal antibody to the phosphorylated form of p38 (New England Biolabs). Detection was Identification and sequencing of chicken Sin1 performed using a peroxidase-conjugated anti-mouse IgGs (Amersham, Chicken Sin1 was isolated from a cDNA library constructed from stage UK) and chemiluminescence visualization (ECL, Amersham, UK) 10–12 (Hamburger and Hamilton, 1992) chicken embryo hindbrains according to the manufacturer’s instructions. using the SuperscriptII System for cDNA Synthesis and Plasmid Cloning (Gibco-BRL) (J.Christiansen and D.G.Wilkinson, in preparation). Ran- Association of Sty1 and Sin1 in vivo dom clones were then chosen and used to make antisense RNA probes Wild-type cells or cells expressing Sty1 fused to a HA peptide epitope for use in whole-mount in situ hybridizations (Xu and Wilkinson, 1998). and a His C-terminal tail were transformed with pREP41-3HA-Sin1. Sin1 was identified as being segmentally expressed in the hindbrain and Pelleted cells were lysed into lysis buffer (0.05% NP40, 50 mM NaCl, was sequenced from both the 5 and 3 ends using the M13-reverse and 50 mM NaF, 10% glycerol, 2 mM Na-orthovanadate, 10 mM M13-universal primers in conjunction with a Big Dye terminator kit and β-mercaptoethanol, 10 μg/ml aprotonin, 10 μg/ml benzamidine, 2 mM a 377 automated DNA Sequencer (Applied Biosystems). Sequences were phenylmethylsulfonyl fluoride, 10 μg/ml pepstatin A, 10 μg/ml leupeptin, analysed for putative ORFs using the MacVector 5.1 package (Oxford 50 mM Tris–HCl pH 7.4) and proteins partially purified by affinity Molecular). Nucleic acid and protein sequence similarity searches were precipitation on Ni –NTA beads (Quiagen). Precipitated proteins were performed using the gapped BLAST algorithm (Altschul et al., 1997) resolved by SDS–PAGE and transferred electrophoretically to nitrocellu- accessed via the internet at http://www.ncbi.nlm.nih.gov. lose membranes. Membranes were probed with a monoclonal antibody to the HA epitope (12CA5). Detection was performed as above. Overexpression of chicken Sin1 and chimeric Sin1 fusion proteins DNA and RNA isolation and hybridization The chicken Sin1 cDNA was amplified from pSPORT1-Sin1 (G.g.) Schizosaccharomyces pombe cells were cultured in YES medium (0.5% using by PCR using the 5 oligonucleotide TACCTACATATGGCTTT- yeast extract, 2% glucose, 50 mg/l adenine) to stationary phase. Chromo- 4219 M.G.Wilkinson et al. somal DNA isolated from a 10 ml culture was dissolved in 25 ml of Fuchs,S.Y., Xie,B., Adler,V., Fried,V.A., Davis,R.J. and Ronai,Z. (1997) TE, of which one fifth was digested and subjected to electrophoresis c-Jun NH -terminal kinases target the ubiquitination of their associated and Southern blot hybridization. To isolate RNA, S.pombe cells were transcription factors. J. Biol. Chem., 272, 32163–32168. cultured in YES to exponentially growing phase. Approximately 10 μg Fuchs,S.Y., Fried,V.A. and Ronai,Z. (1998) Stress-activated kinases of total RNA was isolated and resolved by agarose gel electrophoresis regulate protein stability. Oncogene, 17, 1483–1490. before transfer to nitrocellulose for hybridization as previously described Gaits,F., Degols,G., Shiozaki,K. and Russell,P. (1998) Phosphorylation (Shieh et al., 1997). Probes for pyp2, cdc2, ctt1, trr1 and gpd1 were as and association with the transcription factor Atf1 regulate localisation previously described (Wilkinson et al., 1996; Toone et al., 1998). of Spc1 stress-activated kinase in fission yeast. Genes Dev., 12, 1464–1473. Galcheva-Gargova,Z., De´rijard,B., Wu,I.-H. and Davis,R.J. (1994) An Acknowledgements osmosensing signal transduction pathway in mammalian cells. Science, 265, 806–808. The authors wish to express their gratitude to Dr Lee Johnston and Gille,H., Sharrocks,A.D. and Shaw,P.E. (1992) Phosphorylation of members of the Division of Yeast Genetics for helpful advice, discussions transcription factor p62TCF by MAP kinase stimulates ternary complex and critical reading of the manuscript, to Dr Nic Jones (ICRF) and formation at c-fos promoter. Nature, 358, 414–417. Dr K.Shiozaki (UC Davis) for strains and reagents, to Monica Belich Gille,H., Strahl,T. and Shaw,P.E. (1995) Activation of ternary complex (NIMR) for advice with the two-hybrid screen and to Dr Yannick Gachet factor Elk-1 by stress-activated protein kinases. Curr. Biol., 5, and Dr Jeremy Hyams (UCL) for help with immunocytochemistry. 1191–1200. DNA sequencing of chicken Sin1 was performed at the Advanced Gupta,S., Campbell,D., Derijard,B. and Davis,R.J. (1995) Transcription Biotechnology Centre, Imperial College, London. H.M. was supported factor ATF2 regulation by the JNK signal transduction pathway. by a post-doctoral fellowship from La Direccio´n General de Investigacio´n Science, 267, 389–393. Cientı´fica y Te´chnica from the Spanish Government. T.S.P. was supported Hamburger,V. and Hamilton,H.L. (1992) A series of normal stages in by a post-doctoral fellowship from the Esteban Romero-Caja Murcia the development of the chick embryo. Dev. Dyn., 195, 231–272. Foundation, Spain. This research was supported by the MRC. Han,J., Lee,J.-D., Bibbs,L. and Ulevitch,R.J. (1994) A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. References Science, 265, 808–811. Herskowitz,I. (1995) MAP kinase pathways in yeast: for mating and Alfa,C.E., Fantes,P., Hyams,J.S., Mcleod,M. and Warbrick,E. (1993) more. Cell, 80, 187–197. Experiments with Fission Yeast: a Laboratory Course Manual. Cold Hibi,M., Anning,L., Smeal,T., Minden,A. and Karin,M. (1993) Spring Harbor Laboratory Press, Cold Spring Harbour, NY. Identification of an oncoprotein- and UV-responsive protein kinase Altschul,S.F., Madden,T.L., Schaffer,A.A., Zheng,J., Zhang,Z., Miller,W. that binds and potentiates the c-Jun activation domain. Genes Dev., and Lipman,D.J. (1997) Gapped BLAST and PSI-BLAST: a new 7, 2135–2148. generation of protein database search programs. Nucleic Acids Res., Kanoh,J., Watanabe,Y., Ohsugi,M., Iino,Y. and Yamamoto,M. (1996) 25, 3389–3402. Schizosaccharomyces pombe gad7 encodes a phosphoprotein with a Barbet,N. Muriel,W.J. and Carr,A.M. (1992) Versatile shuttle vectors bZIP domain, which is required for proper G arrest and gene and genomic libraries for use with Schizosaccharomyces pombe. Gene, expression under nitrogen starvation. Genes Cells, 1, 391–408. 114, 59–66. Kato,T., Okazaki,K., Murakami,H., Stettler,S., Fantes,P. and Okayama,H. Basi,G., Schmid,E. and Maundrell,K. (1993) TATA box mutations in the (1996) Stress signal, mediated by a HOG1-like MAP kinase, controls Schizosaccharomyces pombe nmt1 promoter affect transcriptional sexual development in fission yeast. FEBS Lett., 378, 207–212. efficiency but not the transcription start point or thiamine repressibility. Kyriakis,J.M., Banerjee,P., Nikolakaki,E., Dai-T., Rubie,E.A., Gene, 123, 131–136. Ahmad,M.F., Avruch,J. and Woodgett,J.R. (1994) The stress-activated Buck,V., Russell,P. and Millar,J.B.A. (1995) Identification of a cdk- protein kinase family of c-jun kinases. Nature, 369, 156–160. activating kinase in fission yeast. EMBO J., 14, 6173–6183. Lee,J.C. et al. (1994) A protein kinase involved in the regulation of Colicelli,J., Nicolette,C., Birchmeier,C., Rodgers,L., Riggs,M. and inflammatory cytokine biosynthesis. Nature, 372, 739–746. Wigler,M. (1991) Expression of three mammalian cDNAs that interfere Livingstone,C., Patel,G. and Jones,N. (1995) ATF-2 contains a with RAS function in Saccharomyces cerevisiae. Proc. Natl Acad. phosphorylation-dependent transcriptional activation domain. EMBO Sci. USA, 88, 2913–2917. J., 14, 1785–1797. Davis,R.J. (1994) MAPKs: a new JNK expands the group. Trends Marais,R., Wynne,J. and Treisman,R (1993) The SRF accessory protein Biochem. Sci., 19, 470–473. Elk-1 contains a growth factor-regulated transcriptional activation Degols,G. and Russell,P. (1997) Discrete roles of the Spc1 kinase and the domain. Cell, 73, 381–393. Atf1 transcription factor in the UV response of Schizosaccharomyces Marshall,C.J. (1994) MAP kinase kinase kinase, MAP kinase kinase and pombe. Mol. Cell. Biol., 17, 3356–3363. MAP kinase. Curr. Opin. Genet. Dev., 4, 82–89. Degols,G., Shiozaki,K. and Russell,P. (1996) Activation and regulation Moreno,S., Klar,A. and Nurse,P. (1991) Molecular genetic analysis of of the Spc1 stress-activated protein kinase in Schizosaccharomyces fission yeast Schisosaccharomyces pombe. Methods Enzymol., 194, pombe. Mol. Cell. Biol., 16, 2870–2877. 795–823. De´rijard,B., Hibi,M., Wu,I.-H., Barrett,T., Su,B., Deng,T., Karin,M. and Millar,J.B.A., Buck,V. and Wilkinson,M.G. (1995) Pyp1 and Pyp2 Davis,R.J. (1994) JNK1: a protein kinase stimulated by UV light and PTPases dephosphorylate an osmosensing MAP kinase controlling Ha-Ras that binds and phosphorylates the c-jun activation domain. cell size at division in fission yeast. Genes Dev., 9, 2117–2130. Cell, 76, 1025–1037. Musti,A.M., Treier,M. and Bohmann,D. (1997) Reduced ubiquitin- Dickens,M., Rogers,J.S., Cavanagh,J., Raitano,A., Xia,Z., Halpern,J.R., dependent degradation of c-Jun after phosphorylation by MAP kinases. Greenberg,M.E., Sawyers,C.L. and Davis,R.J. (1997) A cytoplasmic Science, 275, 400–402. inhibitor of the JNK signal transduction pathway. Science, 277, Prentice,H.L. (1991) High efficiency transformation of Schizo- 693–696. saccharomyces pombe by electroporation. Nucleic Acids Res., 20, 621. Durfee,T., Becherer,K., Chen,P.-L., Yeh,S.-H., Yang,Y., Kilburn,A., Raingeaud,J., Gupta,S., Rogers,J.S., Dickens,M., Han,J. Ulevitch,R.J. Lee,W.-H. and Elledge,S.J. (1993) The retinoblastoma protein and Davies,R.J. (1995) Pro-inflammatory cytokines and environmental associates with the protein phosphatase type 1 catalytic subunit. Genes stress cause p38 mitogen-activated protein kinase activation by dual Dev., 7, 555–569. phosphorylation on tyrosine and threonine. J. Biol. Chem., 270, Freshney,N.W., Rawlinson,L., Guesdon,F., Jones,E., Cowley,S., Hsuan,J. 7420–7426. and Saklatvala,J. (1994) Interleukin-1 activates a novel protein kinase Rouse,J., Cohen,P., Trigon,S., Morange,M., Alonso-Llamazares,A., cascade that results in the phosphorylation of hsp27. Cell, 78, Zamanillo,D., Hunt,T. and Nebreda,A. (1994) A novel kinase cascade 1039–1049. triggered by stress and heat shock that stimulates MAPKAP kinase-2 Fromont-Racine,M., Rain,J.-C. and Legrain,P. (1997) Toward a functional and phosphorylation of the small heat shock proteins. Cell, 78, analysis of the yeast genome through exhaustive two-hybrid analysis. 1027–1037. Nature Genet., 16, 277–282. Fuchs,S.Y., Dolan,L., Davis,R.J. and Ronai,Z. (1996) Phosphorylation- Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A dependent targeting of c-Jun ubiquitination by Jun N-kinase. Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory Press, Oncogene, 13, 1531–1535. Cold Spring Harbor, NY. 4220 A novel component of eukaryotic SAPK pathway Samejima,I., Mackie,S., Warbrick,E., Weisman,R. and Fantes,P.A. (1998) The fission yeast mitotic regulator win1 encodes an MAP kinase kinase kinase that phosphorylates and activates Wis1 MAP kinase kinase in response to high osmolarity. Mol. Biol. Cell, 9, 2325–2335. Schaeffer,H.J., Catling,A.D., Eblen,S.T., Collier,L.S., Krauss,A. and Weber,M.J. (1998) MP1: a MEK binding partner that enhances enzymatic activation of the MAP kinase cascade. Science, 281, 1668–1671. Shieh,J.-C., Wilkinson,M.G., Buck,V., Morgan,B., Makino,K. and Millar,J.B.A. (1997) The Mcs4 response regulator co-ordinately controls the stress activated Wak1-Wis1-Sty1 MAP kinase pathway and fission yeast cell cycle. Genes Dev., 11, 1008–1022. Shieh,J.-C., Wilkinson,M.G. and Millar,J.B.A. (1998) The Win1 mitotic regulator is a component of the stress activated Sty1 MAP kinase pathway in fission yeast. Mol. Biol. Cell, 9, 311–322. Shiozaki,K. and Russell,P. (1995) Cell cycle control linked to extracellular environment by MAP kinase pathway in fission yeast. Nature, 378, 739–743. Shiozaki,K. and Russell,P. (1996) Conjugation, meiosis and the osmotic stress response are regulated by Spc1 kinase through Atf1 transcription factor in fission yeast. Genes Dev., 10, 2276–2288. Takeda,T., Toda,T., Kominami,K., Kohnosu,A., Yanagida,M. and Jones,N. (1995) Schizosaccharomyces pombe atf1 encodes a transcription factor required for sexual development and entry into stationary phase. EMBO J., 14, 6193–6208. Toda,T., Shimanuki,M. amd Yanagida,M. (1991) Fission yeast genes that confer resistence to staurosporine encode an AP1-like transcription factor and a protein kinase related to the mammalian ERK1/MAP2 and budding yeast FUS3 and KSS1 kinases. Genes Dev., 5, 60–73. Toone,W.M., Kuge,S., Samuels,M., Morgan,B.A., Toda,T. and Jones,N. (1998) Regulation of the fission yeast transcription factor Pap1 by oxidative stress: requirement for the nuclear export factor Crm1 (Exportin) and the stress activated MAP kinase Sty1. Genes Dev., 12, 1453–1463. Treier,M., Staszewski,L.M. and Bohmann,D. (1994) Ubiquitin-dependent c-Jun degradation in vivo is mediated by the delta domain. Cell, 78, 787–798. Treisman,R. (1996) Regulation of transcription by MAP kinase cascades. Curr. Opin. Cell Biol., 8, 205–215. van Dam,H., Wilhelm,D., Herr,I., Steffen,A., Herrlich,P. and Angel,P. (1995) ATF-2 is preferentially activated by stress-activated protein kinases to mediate c-jun induction in response to genotoxic agents. EMBO J., 14, 1798–1811. Warbrick,E. and Fantes,P. (1991) The Wis1 protein kinase is a dose- dependent regulator of mitosis in Schizosaccharomyces pombe. EMBO J., 10, 4291–4299. Waskiewicz,A.J. and Cooper,J.A. (1995) Mitogen and stress response pathways: MAP kinase cascades and phosphatase regulation in mammals and yeast. Curr. Opin. Cell Biol., 7, 798–805. Whitmarsh,A.J., Shore,P., Sharrocks,A.D. and Davis,R.J. (1995) Integration of MAP kinase signal transduction pathways at the serum response element. Science, 269, 403–407. Whitmarsh,A.J., Cavanagh,J., Tournier,C., Yasuda,J. and Davis,R.J. (1998) A mammalian scaffold complex that selectively mediates MAP kinase activation. Science, 281, 1671–1674. Wilkinson,M.G. and Millar,J.B.A. (1998) SAPKs and transcription factors do the nucleocytoplasmic tango. Genes Dev., 10, 2289–2301. Wilkinson,M.G., Samuels,M., Takeda,T., Toda,T., Toone,M.W., Shieh,J.-C., Millar,J.B.A. and Jones,N.C. (1996) The Atf1 transcription factor is a target for the Sty1 stress activated MAP kinase pathway in fission yeast. Genes Dev., 10, 2289–2301. Xu,Q. and Wilkinson,D.G. (1998) In situ hybridization of mRNA with hapten labelled probes. Wilkinson,D.G. (ed.), In situ Hybridization: A Practical Approach. 2nd edn. Oxford University Press, Oxford, UK. Zinck,R., Cahill,M.A., Kracht,M., Sachsenmaier,C., Hipskind,R.A. and Nordheim,A. (1995) Protein synthesis inhibitors reveal differential regulation of mitogen-activated protein-kinase and stress-activated protein kinase pathways that converge on Elk-1. Mol. Cell. Biol., 15, 4930–4938. Received April 26, 1999; revised June 14, 1999; accepted June 15, 1999 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

Sin1: an evolutionarily conserved component of the eukaryotic SAPK pathway

Download PDF
12 pages

Loading next page...
 
/lp/springer-journals/sin1-an-evolutionarily-conserved-component-of-the-eukaryotic-sapk-MLuBEnuKM6

References (80)

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 1999
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1093/emboj/18.15.4210
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal Vol.18 No.15 pp.4210–4221, 1999 Sin1: an evolutionarily conserved component of the eukaryotic SAPK pathway 1,2 1,3 to activation of the extracellular-signal-regulated kinases Marc G.Wilkinson , Teresa Soto Pino , 1 1 ERK1 and ERK2 in response to a variety of growth factors Sylvie Tournier , Vicky Buck , 1,4 5 and mitogens, and which are involved in the control of Humberto Martin , Jeffrey Christiansen , 5 cell proliferation and differentiation (Marshall, 1994). David G.Wilkinson and More recently, a family of MAP kinases has been identified 1,6 Jonathan B.A.Millar in metazoan cells whose members are activated by a 1 5 Division of Yeast Genetics and Division of Developmental variety of environmental stress conditions, DNA damaging Neurobiology, National Institute for Medical Research, The Ridgeway, agents, inflammatory cytokines and certain vasoactive Mill Hill, London NW7 1AA, UK neuropeptides (De´rijard et al., 1994; Freshney et al., 1994; Galcheva-Gargova et al., 1994; Han et al., 1994; Kyriakis Present address: Department of Molecular Neurobiology, SmithKline Beecham Pharmaceuticals, New Frontiers Science Park, Third Avenue, et al., 1994; Lee et al., 1994; Rouse et al., 1994). Harlow, Essex CM14 5AW, UK These stress-activated MAP kinases (SAPKs) fall into two Present address: Departmento de Genetica y Microbiologia, Facultad distinct classes based on sequence and are termed the de Biologia, Universitad de Murcia, 30071 Murcia, Spain c-Jun N-terminal kinase (JNK) and p38 kinases. Roles for Present address: Departmento de Microbiologia II, Facultad de Farmacia, Universidad Complutense de Madrid, Plaza de Ramo´n y the SAPKs have been demonstrated in the adaptive Cajal s/n, E-28040 Madrid, Spain response of cells to stress and in T-cell activation, inflam- mation and ischaemic injury (Davies, 1994; Waskiewicz Corresponding author e-mail: [email protected] and Cooper, 1995). As such the SAPKs are receiving a great deal of attention as potential targets for novel The fission yeast Sty1/Spc1 mitogen-activated protein therapeutics. (MAP) kinase is a member of the eukaryotic stress- Since activation of MAPK pathways results in changes activated MAP kinase (SAPK) family. We have identi- in gene expression, understanding how MAP kinases fied a protein, Sin1, that interacts with Sty1/Spc1 which trigger transcriptional activation is a key issue. Attention is a member of a new evolutionarily conserved gene has been focussed on the identification and characterization family. Cells lacking Sin1 display many, but not all, of of transcription factors whose activity is modulated by the phenotypes of cells lacking the Sty1/Spc1 MAP MAPK-phosphorylation. In mammalian cells, a number kinase including sterility, multiple stress sensitivity and of factors have now been identified that are phosphorylated a cell-cycle delay. Sin1 is phosphorylated after stress by the SAPKs (Treisman, 1996). Elk-1, a member of the but this is not Sty1/Spc1-dependent. Importantly, Sin1 ternary complex factor (TCF) family of erythroblastosis is not required for activation of Sty1/Spc1 but is virus E26 (ETS) domain proteins that synergizes with the required for stress-dependent transcription via its sub- serum response factor (SRF) factor to mediate activation strate, Atf1. We find that in the absence of Sin1, Sty1/ of certain immediate early genes such as the c-fos gene, Spc1 appears to translocate to the nucleus but Atf1 is has been shown to be a target of both JNK and p38 (Gille not fully phosphorylated and becomes unstable in et al., 1992, 1995; Marais et al., 1993; Whitmarsh et al., response to environmental stress. Sin1 is also required 1995; Zinck et al., 1995). The c-Jun factor is regulated for effective transcription via the AP-1 factor Pap1 but by JNK (Hibi et al., 1993; Derijard et al., 1994; Kyriakis does not prevent its nuclear translocation. Remarkably et al., 1994) but not by p38, whereas ATF2 is phosphoryl- chimaeric fusions of sin1 with chicken sin1 sequences ated and regulated by both JNK (Gupta et al., 1995; rescue loss of sin1 function. We conclude that Sin1 is Livingstone et al., 1995; van Dam et al., 1995) and p38 a novel component of the eukaryotic SAPK pathway. (Raingeaud et al., 1995). In all three cases phosphorylation Keywords: cell cycle/environmental stress/MAP kinase/ results in an increase in the activation potential of the factor Schizosaccharomyces pombe/transcription factor although the mechanisms that underlie these increases are not understood. The molecular dissection of the SAPK pathways has been greatly aided by the identification of a similar Introduction pathway in the unicellular fission yeast Schizosaccharo- myces pombe. The central elements of this pathway are The mitogen-activated protein kinase (MAPK) signalling the Sty1 MAP kinase (also known as Spc1 or Phh1), Wis1 pathways are critical for the response of cells to changes MAPKK and Wak1 (also known as Wis4 or Wik1) and in their external environment (Marshall, 1994; Herskowitz, Win1 MAPKKKs (Warbrick and Fantes, 1991; Millar 1995; Waskiewicz and Cooper, 1995; Treisman, 1996). They serve to transduce signals generated at the cell et al., 1995; Shiozaki and Russell, 1995; Kato et al., 1996; surface to the nucleus, where changes in gene expression Shieh et al., 1997, 1998; Samejima et al., 1998). Cells result. In mammalian cells multiple distinct pathways have lacking the Sty1 MAP kinase are sensitive to multiple been identified, the best characterized of which leads environmental stresses, are unable to undergo sexual 4210 © European Molecular Biology Organization A novel component of eukaryotic SAPK pathway conjugation or differentiation and are delayed in the Table I. Two-hybrid analysis of protein interaction timing of mitotic initiation. Importantly, Sty1 is not only structurally related to the mammalian SAPKs but is Bait plasmid Prey plasmid β-galactosidase (A.U.) activated by a similar range of environmental insults pAS2 pACTII 2.1  0.3 (Millar et al., 1995; Shiozaki and Russell, 1995; Degols pAS2 pACTII-Sin1 2.3  0.3 et al., 1996, Degols and Russell, 1997; Shieh et al., 1997). pAS2-Sty1 pACTII 2.1  0.5 Most notably Sty1 stimulates gene expression via the Atf1 pAS2-Sty1 pACTII-Sin1 50.6  1.3 and Pap1 transcription factors, homologues of human pAS2-Wis1 pACTII 2.4  0.1 pAS2-Wis1 pACTII-Sin1 2.5  0.3 ATF2 and c-Jun, respectively; indicating that these path- pAS2-Wak1 pACTII 1.7  0.4 ways are likely to have derived from a common ancestor pAS2-Wak1 pACTII-Sin1 2.0  0.6 (Toda et al., 1991; Takeda et al., 1995; Kanoh et al., 1996; Shiozaki and Russell, 1996; Wilkinson et al., 1996; Diploids from a cross of S.cerevisiae strains CG1945 and Y187 (Fromont-Racine et al., 1997) were co-transformed with either pAS2, Gaits et al., 1998; Toone et al., 1998; Wilkinson and pAS2-Sty1, pAS2-Wis1 or pAS2-Wak1 bait plasmids and either Millar, 1998). Nuclear translocation of activated Sty1 pACTII or pACT1-Sin1 prey plasmid and grown in the absence of allows it to bind and phosphorylate Atf1, but the precise leucine and tryptophan. Expression of LacZ was measured by mechanism by which this phosphorylation induces tran- assessing β-galactosidase activity in extracts as described in Materials scriptional activation is not known (Shiozaki et al., 1996; and methods. Measurements are expressed in arbitrary units (A.U.) as the mean of three independent determinations (SD). Wilkinson et al., 1996). Sty1 also binds to Pap1 but, in this case, the mechanism of activation appears to be distinct. In contrast to Atf1 the bulk of Pap1 protein is cytoplasmic in unstressed cells and its translocation to the Wis4 MAPKKK (Table I). Sin1 also did not interact in nucleus is controlled by Sty1 (Toone et al., 1998). The this assay with unrelated MAPKs such as Pmk1 or mechanism by which this occurs does not seem to involve unrelated clones such as Mcs2 or Mcs6, components of phosphorylation since Pap1 is not a phosphorylation target fission yeast CAK (data not shown). This suggests that of Sty1 in vitro. Nevertheless, Atf1 and Pap1 control the the Sin1 protein interacts only with the MAPK and not expression of a distinct but overlapping set of genes in other components of the Sty1 pathway. response to Sty1 activation (reviewed in Wilkinson and A genomic clone bearing the full-length sin1 gene was Millar, 1998). isolated (Figure 1A). Sequencing revealed an open reading Although the Atf1 and Pap1 transcription factors are frame (ORF) of 1953 bp, interrupted by a small intron key components of the fission yeast SAPK pathway they located close to the termination codon, which encodes a are not the only targets for Sty1. In particular, cells lacking protein with a predicted molecular weight of ~72 kDa. Sty1 are delayed in the timing of mitotic initiation, whereas Database searches indicate that Sin1 does not contain any cells lacking both Atf1 and Pap1 are not. In an effort to known structural motifs but is homologous to the gene understand how the Sty1 MAPK pathway controls cell- product encoded by a partial human cDNA, JC310 cycle progression we have sought additional SAPK targets. (Figure 1B). The JC310 clone was isolated based on its Here we describe a new Sty1-interacting protein that is a ability to suppress the temperature sensitive defect of a Val19 key component of the fission yeast SAPK pathway and RAS2 mutation when overexpressed in S.cerevisiae which is structurally and functionally conserved in all (Colicelli et al., 1991). While this work was underway a eukaryotes. full-length cDNA with 98% sequence homology to JC310 was isolated in a screen for segmentally expressed genes in the chicken hindbrain (Figure 1B; J.Christiansen and Results D. G.Wilkinson, manuscript in preparation). Two hypothet- Sin1 is a member of an evolutionarily conserved ical proteins, one from S.cerevisiae and and the other from gene family Caenorhabditis elegans, also show extensive homology To identify new effectors of the fission yeast SAPK to these sequences (H.Martin and J.Millar, data not shown). pathway, we undertook a two-hybrid screen in Saccharo- These and functional complementation studies described myces cerevisiae for S.pombe proteins which would inter- below indicate that Sin1 is a novel conserved protein. act with Sty1. Amongst the isolates we identified were partial cDNAs that corresponded to three distinct gene Sin1 interacts with Sty1 and is phosphorylated in products. These were termed Sin1 (eight isolates), Sin2 response to environmental stress (five isolates) and Sin3 (three isolates) for Sty1 (or SAPK) To determine whether Sin1 and Sty1 interact in fission yeast interacting protein. We found that Sin2 is a member of a Sin1 was N-terminally tagged with three tandem haem- novel evolutionarily conserved gene family and will be agglutinin (HA) epitopes and expressed from the thiamine described elsewhere (S.Tournier and J.B.A.Millar, unpub- repressible nmt41 promoter in fission yeast cells bearing lished data) and that Sin3 is identical to the Pyp2 MAP Sty1 C-terminally tagged with six histidines (His) kinase phosphatase, which has previously been shown to (Figure 2A). Complexes were purified on Ni –NTA interact with Sty1 (Millar et al., 1995). We have character- agarose beads and proteins visualized by Western blot. We ized Sin1 in this paper. The ability of Sin1 to interact found that Sin1 specifically co-precipitated with tagged but with other components of the Sty1 pathway and unrelated not untagged Sty1 (Figure 2A). We were also able to show proteins was tested by two-hybrid analysis. We found that that a bacterially produced glutathione S-transferase (GST)– the Sin1 induces expression of the β-galactosidase reporter Sin1 fusion protein effectively precipitates epitope-tagged gene only when co-transformed with a plasmid expressing Sty1 from cell lysates (data not shown). the Sty1 MAPK and not the Wis1 MAPKK or Wak1/ We noted that Sin1 migrates in a diffuse manner on 4211 M.G.Wilkinson et al. Fig. 1. Sin1 is a member of an evolutionarily conserved gene family. (A) Restriction map of the sin1 genomic clone. The position of the ORF (closed bar) and intron (open bar) are shown. Arrows indicate the cDNAs isolated from the two-hybrid screen. The ura4 gene (hatched bar) was introduced between the XhoI and SpeI sites to generate pSin1::ura4. (B) Alignment of the complete fission yeast Sin1 amino acid sequence (S.p. Sin1) to the predicted sequence from a partial cDNA from humans (H.s. JC310) and a full cDNA sequence from chicken (G.g. Sin1). Boxes indicate identities amongst all three proteins. Homologies were generated using a MegAlign work package based on a Jotun Hein algorithm (DNASTAR). The nucleotide sequence of the fission yeast and chicken sin1 genes will appear in the and DDBJ/EMBL/GenBank nucleotide sequence databases under the accession Nos AF155208 and AF153127, respectively. SDS–PAGE, indicating that the protein may be subject to to treatment with phosphatase in vitro, indicating that Sin1 post-translational modifications, such as phosphorylation. is hyperphosphorylated after stress (Figure 2B). Indeed In particular, Sin1 contains a number of potential serine– hyperphosphorylation of Sin1 was also rapidly induced after proline or threonine–proline motifs which may act as targets treatment of cells with 1 mM H O , mild heat shock (to 2 2 for phosphorylation, although only one of these conforms 42°C) or 5 min centrifugation, cellular stresses known to to a consensus MAP kinase site. To investigate whether Sin1 cause Sty1 activation (Figure 2C). To determine whether is a phosphoprotein in vivo, Sin1 was immunoprecipitated this phosphorylation was due to Sty1, epitope-tagged Sin1 from log phase wild-type cells before being treated in vitro was expressed in Δsty1 cells. No change in the mobility of with alkaline phosphosphatase. Treatment with phosphatase Sin1 on SDS–PAGE gels was observed in the absence of caused Sin1 to migrate as a single non-diffuse band of Sty1 before or after the cells were challenged with an high electrophoretic mobility, indicating that it is multiply- osmotic stress, indicating that an alternative kinase(s) phosphorylated in unstressed cells (Figure 2B). Following phosphorylates Sin1 (Figure 2D). In keeping with this inter- treatment of wild-type cells with 0.5 M NaCl, slower migrat- pretation, a bacterially produced, full-length GST–Sin1 ing forms of Sin1 were observed which were also sensitive fusion protein was not phosphorylated by Sty1 in vitro (data 4212 A novel component of eukaryotic SAPK pathway conditions. We reasoned that disrupting the function of new components of this pathway would effect one or more of these processes. To investigate the cellular function of Sin1 we replaced internal sin1 sequences with the ura4 gene (Figure 1A) and integrated the disrupt into a sporulating diploid strain. Tetrad dissection of asci from heterozygous diploids gave rise to four viable spores, which on germination showed a 2:2 segregation of uracil auxotrophs to uracil prototrophs (data not shown), indicat- ing that sin1 is a non-essential gene. Cells lacking Sty1, but not either of the Atf1 or Pap1 transcription factors, divide at a greater cell size than wild-type (Figure 3A; Millar et al., 1995, Shiozaki and Russell, 1995). Import- antly, Δsin1 cells were also found to be elongated at division with respect to wild-type dividing at 20.2  1.4 μm indicating that, like Sty1, Sin1 plays a role in the timing of mitotic initiation (Figure 3A). In rich medium we noted that Δsin1 cells also appear to be somewhat wider than wild-type cells, the reason for which is unknown. Sin1 is required for sexual conjugation and differentiation The Sty1 kinase and the Atf1 transcription factor, but not Pap1, are required for the onset of sexual conjugation and differentiation (Shiozaki and Russell, 1996; Wilkinson Fig. 2. Sin1 associates with Sty1 and is a stress-induced et al., 1996). Cells lacking these proteins mate with only phosphoprotein. (A) Sin1 interacts with Sty1 in vivo. Wild-type (JM 1059) or tagged Sty1(6His HA) cells (JM1521) were transformed with 5–10% efficiency of the wild-type. Homothallic strains pREP41-3HA-Sin1 and grown to log-phase in minimal medium bearing a deletion in either Sty1 or Sin1 were grown to lacking leucine at 30°C either in the absence (–) or presence ()of stationary phase for 48 h in minimal medium lacking a 10 μg/ml thiamine. Cell extracts from these cells were made following 2 nitrogen source and the number of cells that had undergone centrifugation and bead lysis. Proteins were precipitated on Ni –NTA sexual conjugation and meiosis was assessed. Cells lacking beads and the presence of the HA epitope determined by Western blot (Ni –NTA). As a control 50 μg of total cell extract was probed functional Sin1 display a complete mating defect which directly for the presence of the HA epitope (Cell extract). (B) Sin1 is could be fully restored by reintroduction of a Sin1 genomic a phosphoprotein. Wild-type (wt) (JM 1059) were transformed with clone but not control plasmid (Table II). It should be pREP41-3HA-Sin1 and grown to log-phase in minimal medium noted that this defect was more profound than in cells lacking leucine. Cultures was then either incubated in the same medium either untreated (0 min) or with 0.5 M NaCl for 10 min lacking Sty1 and that the mating defect of Δsty1 cells (10 min). Cells were harvested and the Sin1 protein could not be restored by overexpressing sin1 (Table II). immunoprecipitated from cell lysates with a monoclonal anibody to These results indicate Sin1 is also absolutely required for the HA epitope (12CA5). Immunoprecipitates were washed and then initiation of sexual differentiation. incubated at 30°C in phosphatase buffer for 20 min either in the presence () or absence (–) of 10 units alkaline phosphatase (PPase). Proteins were then separated by SDS–PAGE and probed for the Cells lacking Sin1 are sensitive to multiple presence of the HA epitope as in (A). (C) Phosphorylation of Sin1 is environmental stresses increased after stress. Wild-type cells expressing pREP41-3HA-Sin1 as The Sty1 MAP kinase pathway is required for the survival above were grown in minimal medium lacking leucine and then either of cells to multiple environmental insults. To examine the heat shocked (42°C) or incubated in the presence of an oxidative role of Sin1 in the stress response, Δsin1 cells or cells stress (1 mM H O ) or centrifuged at 4000 r.p.m. (Cent.) for the times 2 2 indicated. Cells were harvested and extracts made. Twenty micrograms lacking various components of the Sty1 MAP kinase of total cell protein was probed for the presence of Sin1 by Western pathway were grown on rich medium either at normal blot as in (A). (D) Sin1 is not phosphorylated by Sty1. Wild-type (JM temperature (30°C), high temperature (37°C) or in the 1059) or Δsty1 (JM 1160) cells transformed with pREP41-3HA-Sin1 presence or absence of an osmotic stress (1 M KCl) or and grown to log-phase in minimal medium lacking leucine before being incubated in the same medium containing 0.5 M NaCl for times oxidative stress (50 μM CdSO ). Importantly, as with cells indicated. The Sin1 protein was detected by Western blot as in (A). lacking either Sty1 or Atf1, Δsin1 cells were unable to grow under conditions of osmotic stress (Figure 3B). In not shown). These results indicate that Sin1 binds the Sty1 addition Δsin1 cells, like Δsty1 cells, were also temperature MAP kinase and is the target of one or more stress-activated sensitive, a phenotype not displayed by cells lacking either kinases in vivo. Atf1 or Pap1 or both (Figure 3B). However in contrast to Δsty1 cells, Δsin1 cells are able to proliferate in the Cells lacking Sin1 are delayed in the timing of presence of 50 μm CdSO (Figure 3B) or 1 mM t-butyl mitotic initiation hydrogen peroxide (data not shown). Thus Sin1 is required The Sty1 MAP kinase pathway is required for several for many, but not all, of the processes controlled by Sty1 functions in fission yeast including maintaining the MAP kinase, in particular those controlled by Atf1, correct timing of mitotic initiation, for onset of cellular supporting the notion that Sin1 is an authentic component differentiation and for protection of the cells under adverse of the fission yeast SAPK pathway. 4213 M.G.Wilkinson et al. Fig. 3. Cells lacking Sin1 are delayed at the G /M transition and sensitive to environmental stress. (A) Δsin1 cells are elongated at division. Wild-type (wt) (JM 1059), sty1::ura4 (Δsty1) (JM 1160) or sin1::ura4 (Δsin1) (JM 1797) cells were grown to log-phase in minimal medium and photographed using Normarski optics. Cell size at cell division was measured using a Nikon filar eyepiece drum micrometer at 1200 magnification. (B) Δsin1 cells are stress sensitive. Wild-type (wt) (JM 1059), sty1::ura4 (Δsty1) (JM 1160), sin1::ura4 (Δsin1) (JM 1797), atf1::ura4 (Δatf1) (JM 1529), pap1::ura4 (Δpap1) (TP 103–3C) or atf1::ura4 pap1::ura4 (Δatf1 Δpap1) (JM 1733) cells were grown on yeast extract and supplement (YES) at 30°C and then streaked to the same medium at 30°C (top left plate) or to YES at 37°C (top right), to the same medium containing 1 M KCl at 30°C (bottom left plate), or YES containing 50 μM CdSO (bottom right plate) and incubated for two days. Table II. Induction of sexual conjugation and differentiation others are either dependent solely on Pap1 (e.g. trr1)or on both Atf1 and Pap1 (e.g. ctt1). In the latter case, the Strain Plasmid Mating efficiency (%) requirement for Atf1 and Pap1 is dependent on the nature of the inductive stress (Toone et al., 1998; Wilkinson and wt h pIRT2 41.5 wt h pIRT2-Sin1 43.8 Millar, 1998). Since Sin1 is required for proliferation Δsty1 h pIRT2 3.8 under certain adverse conditions, we next investigated the Δsty1 h pIRT2-Sin1 3.6 role of Sin1 in rapid activation of gene expression follow- Δsin1 h pIRT2 0.0 ing the exposure of cells to multiple stresses. In response Δsin1 h pIRT2-Sin1 39.4 to either an osmotic shock (0.9 M KCl), oxidative stress Homothallic cultures of wild-type (wt) (JY878), sty1::ura4 (Δsty1) (1 mM hydrogen peroxide) or a mild heat shock (42°C) (1264) or sin1::ura4 (Δsin1) (JM820) cells were transformed with expression of pyp2 and gpd1 was virtually absent in Δsin1 either pIRT2 or pIRT2-Sin1, grown to log-phase in liquid EMM and cells, although some residual induction of gpd1 occurred then transferred to the same medium lacking a nitrogen source in response to osmotic stress (Figure 4). Loss of Sin1 did (NH Cl) for two days. Mating efficiency was assessed microscopically. not, however, effect the expression of cdc2, or other unrelated genes, implying that Sin1 does not control Sin1 is required for Atf1-dependent gene general transcription (Figure 4; data not shown). These transcription findings indicate that Sin1 is required for rapid stress- Induction of a number of genes in response to stress induced expression of genes under the control of the including glycerol-3-phosphate dehydrogenase (gpd1), the Wis1–Sty1–Atf1 pathway. Pyp2 tyrosine-specific MAP kinase phosphatase (pyp2), thioredoxin reductase (trr1) and catalase (ctt1) are entirely dependent on the Sty1 MAP kinase (Millar et al., 1995, Sin1 is not required for Sty1 activation Degols et al., 1996; Wilkinson et al., 1996; Toone et al., The previous results establish Sin1 as a component of a 1998). Some of these (including pyp2 and gpd1) are signal transduction cascade leading to stress-activated targets of the Atf1 transcription factor alone, whereas gene expression. Since Sty1 is required for this response, 4214 A novel component of eukaryotic SAPK pathway Fig. 5. Sin1 is not required for Sty1 phosphorylation. Effect of Sin1 on Sty1 activation. Log phase cultures of wild-type (wt) (JM1521) or Δsin1 (1849) cells bearing an integrated and epitope-tagged version of Sty1 growing in YES medium at 30°C were incubated in the same medium containing either 0.5 M NaCl or shifted to 42°C for the times indicated. Approximately 210 cells were harvested at each time point, lysed under denaturing conditions and the Sty1 protein precipitated using Ni –NTA agarose. Precipitates were probed by Western blot for the presence of phosphorylated MAP kinase (α-p38). Table III. Strains used in this study Strain No. Genotype Reference /source CH 428 ade6-M210 his7-366 h C.Hoffman CH 429 ade6-M216 his7-366 h C.Hoffman JM 1160 ade6-216 sty1::ura4 h Millar et al., 1995 JM 1529 his7-366 atf1::ura4 h this study TP 103– pap1::ura4 h Toone et al., 1998 3C JM 1733 his7-366 atf1::ura4 pap1::ura4 h this study JM 1797 ade6-M216 his7-366 sin1::ura4 h this study JY 878 ade6-M216 h David Hughes Fig. 4. Sin1 is required for Atf1-dependent gene transcription. JM 1264 ade6-M216 sty1::ura4 h Shieh et al., 1997 Log-phase cultures growing in YES at 30°C of either wild-type (wt) JM 1820 ade6-M210 his7-366 sin1::ura4 h this study (JM1059) or Δsin1 cells (JM1797) cells were either shifted to 42°C KS 1479 atf1 (HA6His):ura4 h Shiozaki et al., (A) or incubated in the same medium containing 0.9 M KCl (B)or 1mMH O (C) at 30°C for the times indicated. Total RNA was 2 2 JM 1852 atf1 (HA6His):ura4 sin1::ura4 this study extracted and equal quantities were separated by electrophoresis. JM 1521 ade6-M210 his7-366 sty1 (HA6His):ura4 Shieh et al., 1997 Northern blots were then sequentially probed using DNA specific to the pyp2, gpd1 and cdc2 genes. JM 1849 ade6-M210 his7-366 sty1 (HA6His):ura4 this study sin1::ura4 HM 1689 ade6-M216 his7-366 sty1 (9myc):ura4 h this study we next asked whether Sin1 is required for Sty1 activation. JM 1809 ade6-M216 his7-366 sty1 (9myc):ura4 Wild-type or Δsin1 cells bearing a His -tagged sty1 allele sin1::ura4 this study were grown to log-phase in rich medium and then chal- All strains were leu1-32 ura4-D18 unless otherwise stated. lenged to either a heat shock (42°C) or osmotic stress (0.5 M NaCl). Phosphorylation of Sty1 was monitored by Western blot using an antibody that recognizes only the immunofluorescence. In both wild-type and Δsin1 cells, phosphorylated, and by inference activated, form of Sty1 Sty1 was found to be localized throughout the cytoplasm (Gaits et al., 1998). No difference in the degree or kinetics in unstressed cells but concentrated in the nucleus (as of Sty1 phosphorylation could be observed either in the assessed by co-incidence with DAPi staining) after 10 min presence or absence of Sin1 (Figure 5). However, in this stimulation with an osmotic stress (0.5 M NaCl) and other experiments we noted that dephosphorylation (Figure 6A). However, in three independent experiments of Sty1 was delayed, probably due to the lack of induction the intensity of nuclear Sty1 staining in Δsin1 cells was of the Pyp2 MAP kinase phosphatase. Since Sin1 does found to be ~50% that of wild-type (Figure 6A). These not appear to interact with other components of the Sty1 results indicate that Sin1 is not absolutely required for pathway and is not required for Sty1 activation it is nuclear translocation of the Sty1 MAP kinase, but may unlikely to be part of the pre-activated MAPK complex. facilitate the transport process. We have previously shown that Sty1 associates with Sin1 is required for full phosphorylation of Atf1 in Atf1 in vivo and is required for its phosphorylation after the nucleus stress (Shiozaki and Russell, 1996; Wilkinson et al., The Sty1 MAP kinase is cytoplasmic in unstressed cells 1996). Although not formally demonstrated for Atf1, and translocates to the nucleus only in response to stress. phosphorylation of ATF2 by the JNK or p38 MAP kinase Transport to the nucleus requires dual phosphorylation but leads to its transcriptional activation. To analyse the not activity of the MAP kinase (Gaits et al., 1998). To role of Sin1 in Atf1-mediated transcriptional activation, assess whether Sin1 may be required for this process, a phosphorylation of Atf1 was assessed in the absence of sty1-9myc allele was generated and Sty1 was localized Sin1. For these experiments, a chromosomal version of in either a wild-type or Δsin1 background by indirect atf1 was used that expresses Atf1 tagged with His and 4215 M.G.Wilkinson et al. the HA epitope (Shiozaki and Russell, 1996). Previous results have shown that this shift is due to phosphorylation and is entirely dependent on the Sty1 MAP kinase (Shiozaki and Russell, 1996). Treatment of wild-type cells with osmotic stress induces a rapid phosphorylation of Atf1 in vivo which is retained for up to an hour, as previously observed. The level of Atf1 protein also increases at later times, probably because Atf1 stimulates its own expression (Degols and Russell, 1997). In the absence of Sin1, Atf1 undergoes a rapid stress-dependent phosphorylation, the extent of which is notably less than that observed in wild-type cells (Figure 6B). This is consistent with our observation that a proportion of Sty1 does enter the nucleus. More strikingly, the level of Atf1 protein rapidly decreases and no increase in the level of the protein is observed after prolonged incubation (Figure 6B). We presume this latter result is because Δsin1 cells do not support Atf1-dependent transcription. By indirect immunofluorescence Atf1 protein is still observed in the nucleus in the absence of Sin1 but to a some what lesser intensity (data not shown). The steady-state level and full stress-induced phosphorylation of Atf1 were restored when an episomal plasmid expressing sin1, but not empty vector, was reintroduced to Δsin1 cells (data not shown). These results suggest that Sin1 is required both for full phosphorylation and stability of Atf1 after stimulation of cells by environmental stress. This is likely to account for the requirement for Sin1 in Atf1-dependent gene transcription. Sin1 controls Pap1-dependent gene transcription but not nuclear entry To investigate the role of Sin1 in Pap1-dependent transcription the induction of the ctt1 and trr1 genes was investigated in cells lacking Sin1. In response to either heat shock or oxidative stress, induction of catalase (ctt1) and thioredoxin reductase (trr1) is dependent on the Pap1 transcription factor. As the results in Figure 7 indicate, rapid induction of ctt1 after either heat shock or oxidative stress was severely compromised in the absence of Sin1, although the message eventually accumulated to near wild-type levels after prolonged exposure (Figure 7A and B). Induction of trr1 under the same conditions was virtually abolished (Figure 7A and B). Previous results have suggested that Sty1 controls transcriptional activation of Pap1 by controlling its nuclear translocation (Toone et al., 1998). In contrast, we find that loss of Sin1 does not block the nuclear accumulation of ectopically expressed GFP–pap1 fusion protein (Figure 7C). These results indicate that Sin1 is also required for the induction Fig. 6. Effect of Sin1 on translocation of Sty1 and phosphorylation of of both Pap1-dependent gene transcription in fission yeast, Atf1. (A) Log phase cultures of wild-type (wt) (HM 1689) or Δsin1 by a mechanism that is distinct from control of Pap1 (JM 1809) cells bearing an integrated and nine myc epitope-tagged version of Sty1 growing in YES medium at 30°C (Control) were nuclear entry. incubated in the same medium containing 0.5 M NaCl for the times indicated. Cells were fixed and probed by indirect immunofluorescence Sin1 is functionally conserved for the presence of the myc epitope (Sty1-9myc) or nuclei (DAPi) as Since many of the components of the fission yeast SAPK described in Materials and methods. (B) Log phase cultures of wild- pathway are conserved in metazoans, we next tested type (wt) (KS 1479) or Δsin1 (JM 1852) cells both bearing an integrated and C-terminally tagged version of Atf1 containing His and 6 whether the structural homologues of Sin1 from either two HA epitopes growing in YES medium at 30°C were incubated in mammalian or avian origin could substitute for Sin1 in the same medium containing 0.5 M NaCl for the times indicated. fission yeast. Various full-length, truncated or fusion Approximately 210 cells were harvested at each time point, lysed proteins between fission yeast and chicken sin1 sequences under denaturing conditions and the Atf1 protein precipitated using Ni –NTA agarose. Precipitates were probed by Western blot for the were constructed and cloned behind the thiamine presence of the HA-epitope tag (α-HA). repressible nmt1 promoter. The ability of these constructs 4216 A novel component of eukaryotic SAPK pathway Fig. 7. Sin1 controls Pap1-dependent gene transcription but not its nuclear translocation. Sin1 is required for rapid Pap1-dependent transcription. Log-phase cultures growing in YES at 30°C of either wild-type (JM1059) or Δsin1 cells (JM1797) cells were incubated in the same medium containing either (A)1mMH O or (B) shifted to 42°C for the times indicated. Total RNA was extracted and equal quantities were separated by 2 2 electrophoresis. Northern blots were then sequentially probed using DNA specific to the ctt1, trr1 and cdc2 genes. (C) Sin1 is not required for Pap1 nuclear translocation. Δsin1 cells (JM1797) transformed with pREP41-GFP–pap1 (Toone et al., 1998) were grown to log-phase in minimal medium lacking thiamine and leucine. Localization of Pap1 was assessed by direct immunofluorescence as detailed in Materials and methods before (Control) and after addition of 1 mM H O for 30 min (30 min). 2 2 to suppress the temperature sensitivity of Δsin1 cells was then assessed. Whereas the full-length fission yeast gene [S.pombe Sin1(1–650)] could rescue the defect of Δsin1 cells at high temperature, a construct expressing only the first 486 amino acids [S.pombe Sin1 (1–486)] could not, indicating that the C-terminal 164 amino acids are essential for Sin1 function in vivo (Figure 8). Surprisingly, fusion of the first 486 amino acids of the S.pombe Sin1 to the C-terminal 182 amino acids of the chicken Sin1 sequence restored the ability of Δsin1 cells to grow at high temper- ature, indicating that the C-terminal domain of fission yeast and chicken sequences are functionally related (Figure 8). Notably we isolated a clone by the two-hybrid screen that expresses only the C-terminal 244 amino acids of Sin1, suggesting that this region is the presumptive binding domain for Sty1. Full-length chicken Sin1 was also able to suppress the temperature sensitivity of a Δsin1 Fig. 8. Functional conservation of Sin1. Diagrammatic representation strain, although in this case the rescue was very poor. We of full-length and chimaeric fusion proteins from S.pombe and Gallus note that the fission yeast sequence contains additional gallus sin1 sequences. Δsin1 cells (JM 1852) were transformed with amino acids between residues 419 and 490 that are not either pREP41 (Control), pREP41-Sin1(ΔC) expressing only the first 486 amino acids of fission yeast Sin1 [S.p. Sin1 (1–486)] or pREP41- represented in either human or chicken sequences, which Sin1 (S.p.–G.g.) expressing a chimaeric fusion protein between fission may be important for functional rescue. Together these yeast and chicken sequences (S.p.–G.g. Sin1). Cells were grown on data suggest that Sin1 is a member of a new class of EMM plates lacking leucine at 30°C and then streaked onto the same evolutionarily conserved signal transducer. plates at either 30 or 37°C for 2 days. 4217 M.G.Wilkinson et al. Discussion communication). It is conceivable that deregulated entry of Sty1 to the nucleus may lead to incomplete Atf1 Here we have identified Sin1 as a new component of the phosphorylation and subsequent degradation. Alternat- fission yeast stress-activated Sty1 MAP kinase pathway. ively, Sin1 may function to protect phosphorylated Atf1 This conclusion is based on the following observations. from ubiquitination. We are currently attempting to distin- First, Sin1 binds specifically to the Sty1 MAP kinase guish between these possibilities. in vivo and is phosphorylated after environmental stress. Our results indicate that Sin1 is also partly required for Secondly, cells lacking Sin1 display many of the pheno- Pap1-dependent transcription. The regulation of Pap1 is types of cells lacking Sty1 including stress sensitivity, distinct from that of Atf1, in that Pap1 is not an in vitro sterility and cell-cycle delay. Lastly, Sin1 is required for target for Sty1 MAP kinase (Toone et al., 1998). Instead the induction of a number of genes including pyp2, gpd1, translocation of cytoplasmic Pap1 to the nucleus is thought ctt1 and trr1 which are under the control of both the to be the primary mechanism by which Pap1-dependent Sty1 MAP kinase and its targets, the Atf1 and Pap1 transcription is controlled by Sty1. One caveat to this is transcription factors. that translocation of Pap1 appears to be too slow to fully Although stress-activated and Sty1-dependent gene tran- account for the rapid induction of gene expression (Toone scription is defective in the absence of Sin1, activation of et al., 1998). We find that in the absence of Sin1, Sty1 kinase, as judged by appearance of the doubly rapid induction of Pap1-dependent transcription of ctt1 is phosphorylated form of Sty1, appears to be normal. This defective, but this eventually recovers after prolonged distinguishes Sin1 from recently identified regulators of incubation as Pap1 is translocated to the nucleus. It is MAP kinases in mammalian cells such as JIP-1 or MP1, conceivable that a small nuclear pool of Pap1 is rapidly which act as scaffold proteins that support the integrity activated by Sty1 after exposure to stress and subsequently of the pre-activation MAPK complex (Dickens et al., reinforced by a Sin1-independent bulk import of Pap1 1997; Schaeffer et al., 1998; Whitmarsh et al., 1998). from the cytoplasm at later times. Regardless, the eventual Indeed Sin1 does not interact with other components of increase in ctt1 expression explains why sin1-deletes are the Sty1 MAP kinase pathway, including the Wis1 able to proliferate under conditions of prolonged exposure MAPKK and Wak1 MAPKKK. Rather, it places Sin1 to oxidative stresses such as heavy metals and hydrogen function between MAP kinase activation and stimulation peroxide. It is important to point out that cells lacking of gene transcription. Since Sty1, like many MAP kinases, Sin1, like Δsty1 cells, are both temperature sensitive and is cytoplasmic in unstimulated cells and translocates to delayed in the timing of mitotic initiation whereas cells the nucleus after activation, we considered the possibility lacking both Atf1 and Pap1 are not. This suggests that that Sin1 may be required for translocation of the doubly Sin1 controls processes in fission yeast other than those phosphorylated MAP kinase to the nucleus. Indirect regulated by Atf1 and Pap1, including control of cell- immunocytochemical analysis using an integrated epitope- cycle progression. The lack of known structural motifs in tagged Sty1 suggests that this is not the case. This the Sin1 protein at present prevents further speculation as observation is consistent with the fact that, in the absence to its function. Importantly, however, Sin1 itself is a of Sin1, Sty1 is still able to phosphorylate constitutively phosphoprotein that is hyperphosphorylated after environ- nuclear Atf1. However, neither the intensity of nuclear mental stress but not a substrate of Sty1, suggesting Sin1 accumulation nor Sty1-dependent Atf1 phosphorylation may act at a focal point between the Sty1 pathway and are as pronounced as in wild-type cells. This suggests that other stress-activated kinases. Sin1 may facilitate, but is not absolutely required for, the In conclusion, here we have presented data which transport process. It will be highly informative, in this establishes Sin1 as a component of the stress-activated regard, to identify additional proteins that bind Sin1, its Sty1/Spc1 MAP kinase pathway in fission yeast. Since requirements for association with Sty1 and its cellular the fission yeast Sty1 pathway displays many of the location before and after challenge by environmental characteristics of the JNK and p38 MAP kinase pathways stress. These experiments are now underway. in mammals, a prediction from our results is that Sin1 We observe that Atf1 is not only under-phosphorylated homologues play a central role in stress-activated gene in the absence of Sin1 but rapidly degraded. Importantly, transcription by SAPKs in other species. Future work will recent evidence from mammalian cells has implicated be aimed at testing this hypothesis. protein stability of SAPK targets as a means of controlling stress-dependent stimulation of gene transcription (Fuchs Materials and methods et al., 1998). The ability of JNK to phosphorylate the Media and general techniques c-Jun transcription factor requires its association with the Media and genetic methods for studying fission yeast have been reviewed delta domain, which is positioned between amino acids (Moreno et al., 1991). General DNA methods were performed using 30–57 in the N-terminus. Association of JNK to this standard techniques (Sambrook et al., 1989). Cell length measurements domain also controls the proteolytic degradation of c-Jun were made using log-phase cells with a Nikon filar eyepiece drum micrometer at 1200 magnification. Transformations were regularly through the 26S proteasome, although, importantly in this performed by electroporation (Prentice, 1991) using a Bio-Rad Gene case, JNK does not need to be active as a kinase (Treier TM Pulser . et al., 1994; Fuchs et al., 1996; Musti et al., 1997). This lead researchers to find that JNK also targets ATF2 for Assessment of mating efficiency Homothallic (h ) cells were grown to log-phase for two days in liquid ubiquitination by a similar process (Fuchs et al., 1997). Edinburgh minimal medium (EMM) and then transferred for various Although a number of phosphorylation sites for Sty1 have lengths of time to the same medium lacking a nitrogen source. Mating been identified on the Atf1 protein, the function of these efficiency was determined microscopically by scoring the percentage of phosphorylations is not understood (N.Jones, personal spore-containing asci or cells undergoing sexual conjugation. 4218 A novel component of eukaryotic SAPK pathway Two-hybrid screening and β-galactosidase assays CCTGGACAACCC (Sin1-GGF) incorporating an NdeI site (shown The full-length sty1 ORF was fused to the 3 end of the GAL4 DNA- italicized) which hybridized to sequences surrounding the ATG initiation binding domain by digesting pREP41-sty1(HA6His) (Millar et al., 1995) codon, whereas the 3 oligonucleotide TTAATCGGATCCTCACT- with NdeI and BamHI and cloning the fragment into the NdeI and GCTGTCCCGATTTCTT (Sin1-GGC) incorporating a BamHI site BamHI sites of pAS2ΔΔ-BC to construct pAS2ΔΔ-BC-sty1. An S.pombe (shown italicized) hybridized to sequences 3 to the TGA termination cDNA library (Durfee et al., 1993) was screened using an improved codon. The PCR product was cleaved with NdeI and BamHI and cloned mating strategy (Fromont-Racine et al., 1997). We obtained 32 clones, into pREP41 to form pREP41-Sin1(G.g.). A chimaeric fusion protein of positive for HIS3 and LacZ expression from 210 diploid colonies. the first 486 amino acids of the fission yeast Sin1 with the last 186 amino Interacting proteins were identified by automated DNA sequencing. acids of chicken Sin1 was constructed by combined PCR using the Quantification of interactions was performed by assessing β-galactosidase 5 oligonucleotides Sin1-N1 and the 3 oligonucleotide CTGGCTCT- activity in cell extracts as previously described (Buck et al., 1995). CCAAGGTACTAAATGTTTTATCAAGTGG (Sin1-CP2) and the 5 oligonucleotide CCACTTGATAAAACATTTAGTACCTTGGAG- Identification and sequencing of fission yeast Sin1 AGCCAG (Sin1-CP1) in combination with the 3 oligonucleotide Sin1- An XhoI fragment from pACT-Sin1 containing a partial sin1 cDNA was GGC. Products from each reaction were then combined and a second used to probe an S.pombe pURB1 genomic library (Barbet et al., 1992). round of amplification performed using the oligonucleotides Sin1-N1 Two positive clones with overlapping inserts were isolated and designated and Sin1-GGC. The resulting product was cleaved with NdeI and BamHI pURB1-Sin1-1 and pURB1-Sin1-2. Sequencing of the partial cDNAs and cloned into pREP41 to form pREP41-Sin1 (S.p.-G.g.). Plasmids from pACT-Sin1 and the two genomic clones revealed an ORF of were used to transformed strains bearing the leu1-32 mutation and 1953 bp, interrupted by a small intron located close to the termination leucine prototrophs selected. Stable overexpression was reached after at codon. Dideoxy sequencing was performed using a T7 sequencing kit least 48 h growth in the absence of thiamine. from Pharmacia. Immunocytochemical analysis of Sty1 location Overexpression and tagging of fission yeast Sin1 A tandem 9 myc epitope was amplified by PCR from the plasmid The plasmid pURB1-Sin1-1 was digested with SacI and SphI and the pC3280 (a gift of K.Nasmyth) using the 5 oligonucleotide GAAAAA- insert cloned into pIRT2 to form pIRT2-Sin1. The sin1 ORF was GGGCGGCCGCATGGTTCAC and the 3 oligonucleotide ATATA- amplified from the genomic clone pIRT2-Sin1 by PCR amplification. TATGCGGCCGCCTTATGTCGGCATATTCGAG bearing NotI sites The 5 oligonucleotide TTACCATGGATCATATGCAATATTCTCAT- (italicized). The resulting PCR fragment was cloned into pBSSK-Ura4- ATATACTTC (Sin1-N1) incorporating NcoI and NdeI sites (shown Sty1(6HisHA) (Shieh et al., 1998) that had been digested with NotIto italicized) hybridized to sequences surrounding the ATG initiation codon, form pBSSK-Ura4-Sty1(9myc). pBSSK-Ura4-Sty1(9myc) was linearized whereas the 3 oligonucleotide ACATGGATCCACCTATGTATTCATA- with PacI and the resulting fragment transformed into wild-type S.pombe GAA (Sin1-REPC2) incorporating a BamHI site (shown italicized) cells bearing the ura4-D18 auxotrophic marker. Stable integration of the hybridized to sequences 3 to the TGA termination codon. The PCR tagged sty1 gene at the genomic sty1 locus was confirmed by Southern product was cleaved with NdeI and BamHI and cloned into pREP41- blot analysis and PCR. Indirect immunofluorescence microscopy and 3HA to form pREP41-3HA-Sin1 which expresses a 3HA-tagged sin1 DAPi staining were performed by methanol fixation as previously gene under the control of a partially defective version of the nmt1 described (Alfa et al., 1993). A monoclonal antibody to the myc epitope thiamine repressible promoter (Basi et al., 1993). The same fragment (9E10) and a rhodamine-conjugated antimouse antibody were used to was cloned into pREP41 to form pREP41-Sin1. A truncated clone of detect Sty1 location. Sin1 expressing only the first 486 amino acids of Sin1 was constructed in a similar manner by PCR using the 5 oligonucleotide Sin1-N1 and Fluorescence microscopy the 3 oligonucleotide TCTTATGGATCCTTAACTAAATGTTTTAT- Indirect fluorescence microscopy was carried out on an Olympus IX70 CAAGTGG (Sin1-ΔC). The resulting 1.5 kb fragment was digested with inverted microscope with phase contrast and DIC optics and observed NdeI and BamHI and cloned into pREP41 to form pREP41-Sin1(ΔC). using a Photometrics CH350L liquid cooled CCD camera and Deltavision Plasmids were used to transformed strains bearing the leu1-32 mutation deconvolution software. Images were manipulated using PhotoShop. and leucine prototrophs selected. Stable overexpression was reached Preparation and detection of GFP fluorescence was performed essentially after at least 48 h growth in the absence of thiamine. as previously described (Toone et al., 1998). Fluorescence was observed on a Zeiss Axiophot and images were captured on standard 35 mm film. Disruption of fission yeast Sin1 sequences The plasmid pCRII-ura4 was digested with XhoI and SpeI to release a Detection of activated Sty1 protein 1.6 kb fragment that was cloned into pIRT2-Sin1 which had been The Sty1 protein was partially purified from cells expressing Sty1 fused digested with XhoI and SpeI to form pIRT2-Sin1::ura4. pIRT2-Sin1::ura4 to a HA peptide epitope and a His C-terminal tail. Briefly, pelleted was digested with SacI and SphI and transformed into a leu1-32/leu1- cells were lysed into denaturing lysis buffer [1% nonident P40 (NP40), 32 ura4-D18/ura4-D18 ade6-M216/ade6-M210 h /h diploid strain. 6 M GuHCl pH 8.0] and the Sty1 protein isolated by affinity precipitation Sporulation and tetrad dissection of stable heterozygous diploids pro- on Ni –NTA beads (Qiagen). Precipitated proteins were resolved duced ura4 haploids, demonstrating that sin1 is not an essential gene. by SDS–PAGE and transferred electrophoretically to nitrocellulose Uracil prototrophs contained a disruption of the sin1 gene as verified by membranes. Membranes were probed with either a monoclonal antibody PCR and Southern hybridization (data not shown). to the HA epitope (12CA5) or with a polyclonal antibody to the phosphorylated form of p38 (New England Biolabs). Detection was Identification and sequencing of chicken Sin1 performed using a peroxidase-conjugated anti-mouse IgGs (Amersham, Chicken Sin1 was isolated from a cDNA library constructed from stage UK) and chemiluminescence visualization (ECL, Amersham, UK) 10–12 (Hamburger and Hamilton, 1992) chicken embryo hindbrains according to the manufacturer’s instructions. using the SuperscriptII System for cDNA Synthesis and Plasmid Cloning (Gibco-BRL) (J.Christiansen and D.G.Wilkinson, in preparation). Ran- Association of Sty1 and Sin1 in vivo dom clones were then chosen and used to make antisense RNA probes Wild-type cells or cells expressing Sty1 fused to a HA peptide epitope for use in whole-mount in situ hybridizations (Xu and Wilkinson, 1998). and a His C-terminal tail were transformed with pREP41-3HA-Sin1. Sin1 was identified as being segmentally expressed in the hindbrain and Pelleted cells were lysed into lysis buffer (0.05% NP40, 50 mM NaCl, was sequenced from both the 5 and 3 ends using the M13-reverse and 50 mM NaF, 10% glycerol, 2 mM Na-orthovanadate, 10 mM M13-universal primers in conjunction with a Big Dye terminator kit and β-mercaptoethanol, 10 μg/ml aprotonin, 10 μg/ml benzamidine, 2 mM a 377 automated DNA Sequencer (Applied Biosystems). Sequences were phenylmethylsulfonyl fluoride, 10 μg/ml pepstatin A, 10 μg/ml leupeptin, analysed for putative ORFs using the MacVector 5.1 package (Oxford 50 mM Tris–HCl pH 7.4) and proteins partially purified by affinity Molecular). Nucleic acid and protein sequence similarity searches were precipitation on Ni –NTA beads (Quiagen). Precipitated proteins were performed using the gapped BLAST algorithm (Altschul et al., 1997) resolved by SDS–PAGE and transferred electrophoretically to nitrocellu- accessed via the internet at http://www.ncbi.nlm.nih.gov. lose membranes. Membranes were probed with a monoclonal antibody to the HA epitope (12CA5). Detection was performed as above. Overexpression of chicken Sin1 and chimeric Sin1 fusion proteins DNA and RNA isolation and hybridization The chicken Sin1 cDNA was amplified from pSPORT1-Sin1 (G.g.) Schizosaccharomyces pombe cells were cultured in YES medium (0.5% using by PCR using the 5 oligonucleotide TACCTACATATGGCTTT- yeast extract, 2% glucose, 50 mg/l adenine) to stationary phase. Chromo- 4219 M.G.Wilkinson et al. somal DNA isolated from a 10 ml culture was dissolved in 25 ml of Fuchs,S.Y., Xie,B., Adler,V., Fried,V.A., Davis,R.J. and Ronai,Z. (1997) TE, of which one fifth was digested and subjected to electrophoresis c-Jun NH -terminal kinases target the ubiquitination of their associated and Southern blot hybridization. To isolate RNA, S.pombe cells were transcription factors. J. Biol. Chem., 272, 32163–32168. cultured in YES to exponentially growing phase. Approximately 10 μg Fuchs,S.Y., Fried,V.A. and Ronai,Z. (1998) Stress-activated kinases of total RNA was isolated and resolved by agarose gel electrophoresis regulate protein stability. Oncogene, 17, 1483–1490. before transfer to nitrocellulose for hybridization as previously described Gaits,F., Degols,G., Shiozaki,K. and Russell,P. (1998) Phosphorylation (Shieh et al., 1997). Probes for pyp2, cdc2, ctt1, trr1 and gpd1 were as and association with the transcription factor Atf1 regulate localisation previously described (Wilkinson et al., 1996; Toone et al., 1998). of Spc1 stress-activated kinase in fission yeast. Genes Dev., 12, 1464–1473. Galcheva-Gargova,Z., De´rijard,B., Wu,I.-H. and Davis,R.J. (1994) An Acknowledgements osmosensing signal transduction pathway in mammalian cells. Science, 265, 806–808. The authors wish to express their gratitude to Dr Lee Johnston and Gille,H., Sharrocks,A.D. and Shaw,P.E. (1992) Phosphorylation of members of the Division of Yeast Genetics for helpful advice, discussions transcription factor p62TCF by MAP kinase stimulates ternary complex and critical reading of the manuscript, to Dr Nic Jones (ICRF) and formation at c-fos promoter. Nature, 358, 414–417. Dr K.Shiozaki (UC Davis) for strains and reagents, to Monica Belich Gille,H., Strahl,T. and Shaw,P.E. (1995) Activation of ternary complex (NIMR) for advice with the two-hybrid screen and to Dr Yannick Gachet factor Elk-1 by stress-activated protein kinases. Curr. Biol., 5, and Dr Jeremy Hyams (UCL) for help with immunocytochemistry. 1191–1200. DNA sequencing of chicken Sin1 was performed at the Advanced Gupta,S., Campbell,D., Derijard,B. and Davis,R.J. (1995) Transcription Biotechnology Centre, Imperial College, London. H.M. was supported factor ATF2 regulation by the JNK signal transduction pathway. by a post-doctoral fellowship from La Direccio´n General de Investigacio´n Science, 267, 389–393. Cientı´fica y Te´chnica from the Spanish Government. T.S.P. was supported Hamburger,V. and Hamilton,H.L. (1992) A series of normal stages in by a post-doctoral fellowship from the Esteban Romero-Caja Murcia the development of the chick embryo. Dev. Dyn., 195, 231–272. Foundation, Spain. This research was supported by the MRC. Han,J., Lee,J.-D., Bibbs,L. and Ulevitch,R.J. (1994) A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. References Science, 265, 808–811. Herskowitz,I. (1995) MAP kinase pathways in yeast: for mating and Alfa,C.E., Fantes,P., Hyams,J.S., Mcleod,M. and Warbrick,E. (1993) more. Cell, 80, 187–197. Experiments with Fission Yeast: a Laboratory Course Manual. Cold Hibi,M., Anning,L., Smeal,T., Minden,A. and Karin,M. (1993) Spring Harbor Laboratory Press, Cold Spring Harbour, NY. Identification of an oncoprotein- and UV-responsive protein kinase Altschul,S.F., Madden,T.L., Schaffer,A.A., Zheng,J., Zhang,Z., Miller,W. that binds and potentiates the c-Jun activation domain. Genes Dev., and Lipman,D.J. (1997) Gapped BLAST and PSI-BLAST: a new 7, 2135–2148. generation of protein database search programs. Nucleic Acids Res., Kanoh,J., Watanabe,Y., Ohsugi,M., Iino,Y. and Yamamoto,M. (1996) 25, 3389–3402. Schizosaccharomyces pombe gad7 encodes a phosphoprotein with a Barbet,N. Muriel,W.J. and Carr,A.M. (1992) Versatile shuttle vectors bZIP domain, which is required for proper G arrest and gene and genomic libraries for use with Schizosaccharomyces pombe. Gene, expression under nitrogen starvation. Genes Cells, 1, 391–408. 114, 59–66. Kato,T., Okazaki,K., Murakami,H., Stettler,S., Fantes,P. and Okayama,H. Basi,G., Schmid,E. and Maundrell,K. (1993) TATA box mutations in the (1996) Stress signal, mediated by a HOG1-like MAP kinase, controls Schizosaccharomyces pombe nmt1 promoter affect transcriptional sexual development in fission yeast. FEBS Lett., 378, 207–212. efficiency but not the transcription start point or thiamine repressibility. Kyriakis,J.M., Banerjee,P., Nikolakaki,E., Dai-T., Rubie,E.A., Gene, 123, 131–136. Ahmad,M.F., Avruch,J. and Woodgett,J.R. (1994) The stress-activated Buck,V., Russell,P. and Millar,J.B.A. (1995) Identification of a cdk- protein kinase family of c-jun kinases. Nature, 369, 156–160. activating kinase in fission yeast. EMBO J., 14, 6173–6183. Lee,J.C. et al. (1994) A protein kinase involved in the regulation of Colicelli,J., Nicolette,C., Birchmeier,C., Rodgers,L., Riggs,M. and inflammatory cytokine biosynthesis. Nature, 372, 739–746. Wigler,M. (1991) Expression of three mammalian cDNAs that interfere Livingstone,C., Patel,G. and Jones,N. (1995) ATF-2 contains a with RAS function in Saccharomyces cerevisiae. Proc. Natl Acad. phosphorylation-dependent transcriptional activation domain. EMBO Sci. USA, 88, 2913–2917. J., 14, 1785–1797. Davis,R.J. (1994) MAPKs: a new JNK expands the group. Trends Marais,R., Wynne,J. and Treisman,R (1993) The SRF accessory protein Biochem. Sci., 19, 470–473. Elk-1 contains a growth factor-regulated transcriptional activation Degols,G. and Russell,P. (1997) Discrete roles of the Spc1 kinase and the domain. Cell, 73, 381–393. Atf1 transcription factor in the UV response of Schizosaccharomyces Marshall,C.J. (1994) MAP kinase kinase kinase, MAP kinase kinase and pombe. Mol. Cell. Biol., 17, 3356–3363. MAP kinase. Curr. Opin. Genet. Dev., 4, 82–89. Degols,G., Shiozaki,K. and Russell,P. (1996) Activation and regulation Moreno,S., Klar,A. and Nurse,P. (1991) Molecular genetic analysis of of the Spc1 stress-activated protein kinase in Schizosaccharomyces fission yeast Schisosaccharomyces pombe. Methods Enzymol., 194, pombe. Mol. Cell. Biol., 16, 2870–2877. 795–823. De´rijard,B., Hibi,M., Wu,I.-H., Barrett,T., Su,B., Deng,T., Karin,M. and Millar,J.B.A., Buck,V. and Wilkinson,M.G. (1995) Pyp1 and Pyp2 Davis,R.J. (1994) JNK1: a protein kinase stimulated by UV light and PTPases dephosphorylate an osmosensing MAP kinase controlling Ha-Ras that binds and phosphorylates the c-jun activation domain. cell size at division in fission yeast. Genes Dev., 9, 2117–2130. Cell, 76, 1025–1037. Musti,A.M., Treier,M. and Bohmann,D. (1997) Reduced ubiquitin- Dickens,M., Rogers,J.S., Cavanagh,J., Raitano,A., Xia,Z., Halpern,J.R., dependent degradation of c-Jun after phosphorylation by MAP kinases. Greenberg,M.E., Sawyers,C.L. and Davis,R.J. (1997) A cytoplasmic Science, 275, 400–402. inhibitor of the JNK signal transduction pathway. Science, 277, Prentice,H.L. (1991) High efficiency transformation of Schizo- 693–696. saccharomyces pombe by electroporation. Nucleic Acids Res., 20, 621. Durfee,T., Becherer,K., Chen,P.-L., Yeh,S.-H., Yang,Y., Kilburn,A., Raingeaud,J., Gupta,S., Rogers,J.S., Dickens,M., Han,J. Ulevitch,R.J. Lee,W.-H. and Elledge,S.J. (1993) The retinoblastoma protein and Davies,R.J. (1995) Pro-inflammatory cytokines and environmental associates with the protein phosphatase type 1 catalytic subunit. Genes stress cause p38 mitogen-activated protein kinase activation by dual Dev., 7, 555–569. phosphorylation on tyrosine and threonine. J. Biol. Chem., 270, Freshney,N.W., Rawlinson,L., Guesdon,F., Jones,E., Cowley,S., Hsuan,J. 7420–7426. and Saklatvala,J. (1994) Interleukin-1 activates a novel protein kinase Rouse,J., Cohen,P., Trigon,S., Morange,M., Alonso-Llamazares,A., cascade that results in the phosphorylation of hsp27. Cell, 78, Zamanillo,D., Hunt,T. and Nebreda,A. (1994) A novel kinase cascade 1039–1049. triggered by stress and heat shock that stimulates MAPKAP kinase-2 Fromont-Racine,M., Rain,J.-C. and Legrain,P. (1997) Toward a functional and phosphorylation of the small heat shock proteins. Cell, 78, analysis of the yeast genome through exhaustive two-hybrid analysis. 1027–1037. Nature Genet., 16, 277–282. Fuchs,S.Y., Dolan,L., Davis,R.J. and Ronai,Z. (1996) Phosphorylation- Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A dependent targeting of c-Jun ubiquitination by Jun N-kinase. Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory Press, Oncogene, 13, 1531–1535. Cold Spring Harbor, NY. 4220 A novel component of eukaryotic SAPK pathway Samejima,I., Mackie,S., Warbrick,E., Weisman,R. and Fantes,P.A. (1998) The fission yeast mitotic regulator win1 encodes an MAP kinase kinase kinase that phosphorylates and activates Wis1 MAP kinase kinase in response to high osmolarity. Mol. Biol. Cell, 9, 2325–2335. Schaeffer,H.J., Catling,A.D., Eblen,S.T., Collier,L.S., Krauss,A. and Weber,M.J. (1998) MP1: a MEK binding partner that enhances enzymatic activation of the MAP kinase cascade. Science, 281, 1668–1671. Shieh,J.-C., Wilkinson,M.G., Buck,V., Morgan,B., Makino,K. and Millar,J.B.A. (1997) The Mcs4 response regulator co-ordinately controls the stress activated Wak1-Wis1-Sty1 MAP kinase pathway and fission yeast cell cycle. Genes Dev., 11, 1008–1022. Shieh,J.-C., Wilkinson,M.G. and Millar,J.B.A. (1998) The Win1 mitotic regulator is a component of the stress activated Sty1 MAP kinase pathway in fission yeast. Mol. Biol. Cell, 9, 311–322. Shiozaki,K. and Russell,P. (1995) Cell cycle control linked to extracellular environment by MAP kinase pathway in fission yeast. Nature, 378, 739–743. Shiozaki,K. and Russell,P. (1996) Conjugation, meiosis and the osmotic stress response are regulated by Spc1 kinase through Atf1 transcription factor in fission yeast. Genes Dev., 10, 2276–2288. Takeda,T., Toda,T., Kominami,K., Kohnosu,A., Yanagida,M. and Jones,N. (1995) Schizosaccharomyces pombe atf1 encodes a transcription factor required for sexual development and entry into stationary phase. EMBO J., 14, 6193–6208. Toda,T., Shimanuki,M. amd Yanagida,M. (1991) Fission yeast genes that confer resistence to staurosporine encode an AP1-like transcription factor and a protein kinase related to the mammalian ERK1/MAP2 and budding yeast FUS3 and KSS1 kinases. Genes Dev., 5, 60–73. Toone,W.M., Kuge,S., Samuels,M., Morgan,B.A., Toda,T. and Jones,N. (1998) Regulation of the fission yeast transcription factor Pap1 by oxidative stress: requirement for the nuclear export factor Crm1 (Exportin) and the stress activated MAP kinase Sty1. Genes Dev., 12, 1453–1463. Treier,M., Staszewski,L.M. and Bohmann,D. (1994) Ubiquitin-dependent c-Jun degradation in vivo is mediated by the delta domain. Cell, 78, 787–798. Treisman,R. (1996) Regulation of transcription by MAP kinase cascades. Curr. Opin. Cell Biol., 8, 205–215. van Dam,H., Wilhelm,D., Herr,I., Steffen,A., Herrlich,P. and Angel,P. (1995) ATF-2 is preferentially activated by stress-activated protein kinases to mediate c-jun induction in response to genotoxic agents. EMBO J., 14, 1798–1811. Warbrick,E. and Fantes,P. (1991) The Wis1 protein kinase is a dose- dependent regulator of mitosis in Schizosaccharomyces pombe. EMBO J., 10, 4291–4299. Waskiewicz,A.J. and Cooper,J.A. (1995) Mitogen and stress response pathways: MAP kinase cascades and phosphatase regulation in mammals and yeast. Curr. Opin. Cell Biol., 7, 798–805. Whitmarsh,A.J., Shore,P., Sharrocks,A.D. and Davis,R.J. (1995) Integration of MAP kinase signal transduction pathways at the serum response element. Science, 269, 403–407. Whitmarsh,A.J., Cavanagh,J., Tournier,C., Yasuda,J. and Davis,R.J. (1998) A mammalian scaffold complex that selectively mediates MAP kinase activation. Science, 281, 1671–1674. Wilkinson,M.G. and Millar,J.B.A. (1998) SAPKs and transcription factors do the nucleocytoplasmic tango. Genes Dev., 10, 2289–2301. Wilkinson,M.G., Samuels,M., Takeda,T., Toda,T., Toone,M.W., Shieh,J.-C., Millar,J.B.A. and Jones,N.C. (1996) The Atf1 transcription factor is a target for the Sty1 stress activated MAP kinase pathway in fission yeast. Genes Dev., 10, 2289–2301. Xu,Q. and Wilkinson,D.G. (1998) In situ hybridization of mRNA with hapten labelled probes. Wilkinson,D.G. (ed.), In situ Hybridization: A Practical Approach. 2nd edn. Oxford University Press, Oxford, UK. Zinck,R., Cahill,M.A., Kracht,M., Sachsenmaier,C., Hipskind,R.A. and Nordheim,A. (1995) Protein synthesis inhibitors reveal differential regulation of mitogen-activated protein-kinase and stress-activated protein kinase pathways that converge on Elk-1. Mol. Cell. Biol., 15, 4930–4938. Received April 26, 1999; revised June 14, 1999; accepted June 15, 1999

Journal

The EMBO Journal – Springer Journals

Published: Aug 2, 1999

Keywords: cell cycle; environmental stress; MAP kinase; Schizosaccharomyces pombe; transcription factor

There are no references for this article.