Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via a TGF-β– and retinoic acid–dependent mechanism

A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via... BRIEF DEFINITIVE REPORT A functionally specialized population of mucosal CD103 DCs induces Foxp3 regulatory T cells via a TGF-  – and retinoic acid – dependent mechanism 1 1 Janine L. Coombes, Karima R.R. Siddiqui, Carolina V. Arancibia- 1 2 2 2 C á rcamo, Jason Hall, Cheng-Ming Sun, Yasmine Belkaid, and Fiona Powrie Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, UK Mucosal Immunology Unit, Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health (NIH), Bethesda, MD 20892 Foxp3 regulatory T (T reg) cells play a key role in controlling immune pathological re- actions. Many develop their regulatory activity in the thymus, but there is also evidence for development of Foxp3 T reg cells from naive precursors in the periphery. Recent studies have shown that transforming growth factor (TGF)-  can promote T reg cell development in culture, but little is known about the cellular and molecular mechanisms that mediate this pathway under more physiological conditions. Here, we show that after antigen activa- tion in the intestine, naive T cells acquire expression of Foxp3. Moreover, we identify a population of CD103 mesenteric lymph node dendritic cells (DCs) that induce the devel- opment of Foxp3 T reg cells. Importantly, promotion of T reg cell responses by CD103 DCs is dependent on TGF-  and the dietary metabolite, retinoic acid (RA). These results newly identify RA as a cofactor in T reg cell generation, providing a mechanism via which functionally specialized gut-associated lymphoid tissue DCs can extend the repertoire of T reg cells focused on the intestine. Regulatory T (T reg) cells are known to play occurring population. Consequently, it is diffi - CORRESPONDENCE Fiona Powrie: an important role in the control of destructive cult to determine what proportion of peripheral fi [email protected] infl ammatory responses ( 1 ). Most frequently CD25 Foxp3 T reg cells had their regulatory studied is the naturally occurring population of function imprinted in the periphery. CD4 CD25 Foxp3 T reg cells that develops The ability to induce T reg cell populations in the thymus. These cells are important in the from the naive pool may be of particular benefi t control of a wide range of immune-mediated in the intestine. The extensive immune system pathologies, including autoimmunity, colitis, here must cope with the challenge of mount- and chronic infection. Nevertheless, T cells with ing protective immunity to occasional patho- regulatory function can also be generated in the gens while remaining tolerant to dietary antigen periphery from the naive T cell pool after, for and the commensal fl ora. It may therefore be example, the oral administration of antigen or crucial to generate T reg cells specifi c for these the targeting of peptide ligands to DCs in vivo types of antigen, in addition to those T reg cells ( 2 – 4 ). Foxp3 T cells can also be generated in selected for their high affi nity to self-antigen in the presence of TGF-  ( 5 – 10 ). the thymus. Although peripheral T cells can begin to DCs are thought to play an important role in express Foxp3 and acquire regulatory function, the generation of T reg cell responses. DCs pre- the relevance of this pathway under normal sent in the gut-associated lymphoid tissue (GALT) physiological conditions remains unclear. This is possess several functional specializations that sug- compounded by the fact that induced Foxp3 gest they may be capable of inducing regulatory- T cells look phenotypically similar to the naturally type responses ( 11, 12 ). However, a clear role for these cells in the extrathymic development of The online version of this article contains supplemental material. Foxp3 T reg cells remains to be demonstrated. Vol. 204, No. 8, August 6, 2007 1757-1764 www.jem.org/cgi/doi/ 10.1084/jem.20070590 The Journal of Experimental Medicine Here, we demonstrate that a population of CD103 DCs found in the mesenteric LNs (MLNs) of normal mice can promote the conversion of naive T cells into Foxp3 T reg cells. This occurred without any further manipulation of the DC population and was dependent on TGF-  and the vitamin A metabolite, retinoic acid (RA). These results highlight one path- way by which T reg cells may be generated in the periphery under normal conditions. RESULTS AND DISCUSSION Oral administration of OVA induces Foxp3 T cells from naive precursors Oral administration of antigen has been shown to increase T reg cell populations in a variety of experimental settings ( 3, 4, 13 ). However, whether this represents de novo induction or expansion of a preformed pool of Foxp3 T reg cells is not clear. Here, we have investigated the induction of Foxp3 ex- pression in antigen-specifi c T cells after oral administration of OVA to DO11.10 SCID mice. Placing a TCR transgene on the SCID background prevents endogenous rearrangement of TCR chains, resulting in all peripheral T cells having a single antigen specifi city. As the antigen recognized by the DO11.10 TCR is exogenous, T cells from unfed DO11.10 SCID mice Figure 1. Induction of Foxp3 T cells after oral administration are a uniformly naive population and do not express Foxp3. of antigen. DO11.10 SCID mice were given OVA or BSA in drinking DO11.10 SCID mice are therefore a useful tool to investigate water for 5 d. (A) Single cell suspensions of MLNs stained for CD4 and Foxp3 and analyzed by FACS. Numbers represent the proportion of induction of Foxp3 expression rather than expansion of a pre- Foxp3 cells among the CD4 population. (B) P ercentage of Foxp3 existing population. When drinking water was supplemented cells among the CD4 population, and total number of Foxp3 cells in with OVA, but not BSA, we observed a dramatic increase OVA- and BSA-fed mice. Data are representative of two similar inde- in MLN cellularity, including a proportionate increase in pendent experiments. the number of CD4 T cells. This was accompanied by the formation of a small population of Foxp3 T cells in the MLN ( Fig. 1 ). Populations of Foxp3 T cells were also detected in such antigen-loaded DCs may preferentially direct the induc- the spleen and colonic lamina propria (LP) of OVA-fed mice, tion or expansion of T cells with regulatory properties. In although the increase in T cell numbers was moderate in com- line with this, several previous studies have suggested that parison to the MLN (unpublished data). Foxp3 T cells were intestinal DCs may be tolerogenic ( 11, 14 ). Moreover, a recent still detectable 5 d after the removal of antigen from the study has demonstrated a role for the migration of intestinal drinking water (Fig. S1, A and B, available at http://www.jem DCs through the lymph to the MLN in the induction of oral .org/cgi/content/full/jem.20070590/DC1). tolerance ( 15 ). It therefore seemed likely that the induction Expression of Foxp3 also occurred in naive peripheral of Foxp3 expression we observed upon the feeding of OVA DO11.10 SCID CD4 T cells adoptively transferred into could be mediated by DCs present in the MLNs. We there- congenic Ly9.2 BALB/c mice (Fig. S1, C – E). This supports fore sought to investigate the role of MLN DCs in the induction the conclusion that Foxp3 T reg cells can arise from the pe- of Foxp3 T reg cells. ripheral T cell pool rather than from immature thymocytes, which may have occurred if antigen-loaded peripheral DCs CD103 DCs isolated from the MLNs promote migrated to the thymus of DO11.10 SCID mice. Further- the conversion of naive CD4 T cells into Foxp3 T cells more, this fi nding confi rms that the presence of a normal We have previously demonstrated that expression of CD103 T reg cell repertoire does not inhibit the peripheral generation on DCs is required for the CD4 CD25 T reg cell – mediated of Foxp3 T reg cells. control of experimental colitis ( 16 ). This suggested that Collectively, our results suggest that the GALT is one site CD103 DCs may be functionally specialized to drive T reg cell at which the peripheral induction of Foxp3 T reg cells can responses. CD103 is expressed by a proportion of DCs isolated occur. Although potential mediators for the peripheral in- from the MLNs and colonic LP of normal mice and is also duction of Foxp3 expression have been studied, the factors present on rat lymph DCs migrating from the intestine in the governing their formation at this particular anatomical site steady state ( Fig. 2 A ) ( 17 – 19 ). Fittingly, in CCR7 mice, remain unknown. Antigen administered by the oral route is where the migration of DCs from tissue to the LN is impaired, likely to be picked up by DCs present in the Peyer ’ s patches the number of CD103 DCs in the MLNs is greatly reduced or LP. Upon encounter with T cells, most likely in the MLNs, ( 19 ). This suggests that a proportion of the CD103 DCs present 1758 CD103 MLN DCS INDUCE FOXP3 T REG CELLS | Coombes et al. BRIEF DEFINITIVE REPORT induce expression of Foxp3, which was detectable by FACS at days 3 and 7 of culture ( Fig. 2, B and C, and not depicted). Induction of Foxp3 was dependent on the number of DCs present in culture, with a reduction in the number of CD103 DCs leading to a decrease in the proportion of T cells ex- pressing Foxp3 ( Fig. 2 B ). CD103 MLN DCs isolated from OVA-fed mice also drove expression of Foxp3 when cultured with DO11.10 SCID CD4 T cells, indicating that CD103 DCs are capable of taking up and presenting orally administered antigen (Fig. S3). However, very little CD4 T cell accumu- lation was observed in the presence of CD103 DCs or when mice were fed an irrelevant antigen. The ability of CD103 DCs to maintain a preexisting population of Foxp3 CD4 CD25 T cells in culture was also investigated. CD4 CD25 T cells were obtained from the spleens of DO11.10 BALB/c mice, and expression of Foxp3 in the TCR transgenic (KJ-1.26 ) fraction was investigated. At the beginning of culture, 75% of KJ-1.26 T cells expressed Foxp3. Over the period of culture this proportion decreased, probably as a result of outgrowth of contaminating Foxp3 T cells rather than a genuine down-regulation of Foxp3. However, the proportion of T cells expressing Foxp3 by day 7 of culture was greater in the presence of CD103 DCs ( Fig. 2 D ). This suggests that in addition to inducing Foxp3 expression in naive T cells, CD103 DCs favor the maintenance of existing Foxp3 cells over expansion of any contaminating Foxp3 population. We had previously observed that CD103 MLN DCs Figure 2. Induction of Foxp3 T cells in the presence of MLN directed the migration of T cells to the intestine without CD103 DCs. (A) Single cell suspensions of spleen, MLNs, and colonic LP inducing production of the proinfl ammatory cytokine IFN- from BALB/c mice were prepared, and the proportion of CD103 cells ( 16 ). We now demonstrate that CD103 MLN DCs are high 5 among the CD11c population was determined. (B) 0.25 – 1  10 CD103 capable both of converting naive T cells into Foxp3 T reg or CD103 MLN DCs were cultured with CFDA SE-labeled DO11.10 CD4 cells and of supporting conventional CD4 CD25 Foxp3 T cells and 0.2  g/ml OVA peptide. At day 7 of culture, T cells were stained for Foxp3 and CD4 and analyzed by FACS. The graph shows the percent- T reg cells. Collectively, these data indicate that CD103 age of Foxp3 cells among CD4 T cells in the presence of varying num- MLN DCs are capable of driving T reg cell responses focused bers of either DC subset. Data is representative of three independent on the intestine. Because expression of CD103 on DCs was experiments. (C) FACS plots showing the percentage of T cells expressing required for the CD4 CD25 T reg cell – mediated control of 5 + Foxp3 at the start of culture and after 7 d of culture with 10 CD103 or colitis, we speculate that both the transferred CD4 CD25 CD103 MLN DCs. Plots are gated on CD4 cells, and numbers represent T reg cells and the Foxp3 T reg cells generated peripherally the proportion of CD4 cells in each quadrant. (D) CD4 CD25 T cells from from naive T cells may play an important role in the prevention DO11.10 mice were isolated and cultured with 10 CD103 or CD103 MLN of intestinal pathology. DCs and 0.2  g/ml OVA peptide. Before culture, and at day 6 of culture, T cells were stained for CD4, Foxp3, and clonotypic TCR (KJ-1.26). Plots are gated on KJ-1.26 CD4 cells. Numbers represent the percentage of Foxp3 TGF-  enhances the conversion of naive T cells into Foxp3 cells among the KJ-1.26 CD4 population. Data are representative of two cells in the presence of CD103 DCs independent experiments. TGF-  1 is important in maintaining functional Foxp3 CD4 CD25 T reg cells in the periphery and can also induce in the MLNs migrate there constitutively from the intestine, Foxp3 expression in naive T cells ( 5 – 10, 20 ). Therefore, the role making them likely candidates for the generation of T reg cell of TGF-  in the induction of Foxp3 by CD103 DCs was responses. We compared the ability of CD103 and CD103 investigated. Naive T cells were again cultured with CD103 DCs isolated from the MLNs of normal BALB/c mice to or CD103 DCs. Inclusion of a blocking mAb against TGF- induce expression of Foxp3 in splenic CD4 T cells isolated completely blocked the induction of Foxp3, indicating that from DO11.10 SCID mice. Proliferation and accumulation the conversion of naive T cells into Foxp3 T reg cells by of T cells was comparable in the presence of both CD103 CD103 DCs is mediated by TGF-  ( Fig. 3 A ). A possible and CD103 DCs (Fig. S2, available at http://www.jem explanation for the functional diff erence between CD103 .org/cgi/content/full/jem.20070590/DC1). However, it was and CD103 DC subsets is that CD103 DCs produce higher striking that only the CD103 DC population was able to levels of active TGF-  than the CD103 population. Analysis JEM VOL. 204, August 6, 2007 1759 Figure 4. RA acts as a cofactor for Foxp3 induction. (A) CD103 and CD103 DCs were sorted from the MLNs of BALB/c mice. Aldh1a2 gene expression was assayed by quantitative PCR and normalized relative to expression of HPRT. Data shown are representative of two independent experiments. (B) CD4 T cells from DO11.10 SCID mice were cultured with 5  10 CD103 or CD103 MLN DCs, 0.2  g/ml OVA peptide, and 2 ng/ml rhTGF-  . Some wells were additionally supplemented with 100 nM RA. Figure 3. Induction of Foxp3 is dependent on TGF-  . (A) CD4 T cells were stained for  7 integrin, CD4, and Foxp3 and analyzed by FACS. T cells from DO11.10 SCID mice were cultured with 5  10 CD103 or Plots are gated on CD4 cells, and numbers represent the percentage of CD103 MLN DCs, 0.2  g/ml OVA peptide, and 50  g/ml anti – TGF-  or CD4 cells in each quadrant. Data are representative of two independent isotype control. At day 6 of culture, T cells were stained for CD4 and experiments. (C) Graph depicts pooled data from the experiments de- Foxp3 and analyzed by FACS. Representative plots from two independent scribed in B. Bars show the percentage of CD4 cells expressing Foxp3. experiments are gated on CD4 cells, and numbers represent the percent- (D) Graph depicts absolute numbers of Foxp3 T cells in culture under the age of CD4 cells in each quadrant. (B) CD103 and CD103 DCs were indicated conditions. sorted from the MLNs of BALB/c mice. Tgfb2 , ltbp3 , and plat gene expres- sion was assayed by quantitative PCR and normalized relative to expres- sion of HPRT. Data shown are representative of two independent experiments. (C) CD4 T cells from DO11.10 SCID mice were cultured with of naive T cells into Foxp3 T cells, so that inclusion of 1 ng/ml 10 CD103 or CD103 MLN DCs, 0.2 ug/ml OVA peptide, and the indicated TGF-  resulted in the expression of Foxp3 by  50% of T cells. concentrations of rhTGF-  . At day 6 of culture, T cells were stained for However, although inclusion of TGF-  in cultures containing CD4 and Foxp3 and analyzed by FACS. Representative plots from three CD103 DCs allowed for the generation of a minor Foxp3 similar experiments are gated on CD4 cells, and numbers represent the T cell population, the percentage of T cells expressing Foxp3 percentage of Foxp3 cells among CD4 T cells. was still considerably lower than in the presence of CD103 DCs ( Fig. 3 C ). of gene expression by freshly isolated CD103 and CD103 Although CD103 DCs express genes involved in the MLN DCs revealed several diff erences in the expression of secretion and activation of latent TGF-  , this cannot account mRNA related to TGF-  and its secretion and activation for their enhanced ability to induce Foxp3 in the presence of ( Fig. 3 B ). Specifi cally, CD103 DCs expressed higher levels exogenous TGF-  . The exogenous TGF-  used in these ex- of tgfb2 , plat (tissue plasminogen activator), and latent TGF-  periments was already in its active form, bypassing the need binding protein 3 ( ltbp3 ). LTBP3 is important for the effi cient for the production of factors involved in the conversion of secretion and appropriate localization of latent TGF-  , whereas latent into active TGF-  . Even the provision of very high tissue plasminogen activator plays a role in the activation of concentrations of active TGF-  did not enable CD103 DCs latent TGF-  ( 21 ). to induce similar levels of Foxp3 to CD103 DCs, suggesting Although suffi cient endogenous TGF-  was present in either that CD103 DCs are producing an inhibitory factor cultures containing CD103 DCs to mediate the conversion or lack an important cofactor. of  10% of naive T cells into Foxp3 T cells, we investigated the eff ect of adding varying concentrations of exogenous RA acts as a cofactor for Foxp3 induction TGF-  on the induction of Foxp3. The addition of TGF-  We and others have previously demonstrated that CD103 to cultures containing CD103 DCs enhanced the conversion DCs promote the expression of gut homing receptors on 1760 CD103 MLN DCS INDUCE FOXP3 T REG CELLS | Coombes et al. BRIEF DEFINITIVE REPORT T cells ( 16, 19 ). Expression of gut homing receptors on T cells is enhanced by the vitamin A metabolite RA ( 22 ). Accord- ingly, we now show that CD103 DCs express aldh1a2 , a retinal dehydrogenase involved in the conversion of retinal into RA ( Fig. 4 A ). As a result, we investigated whether the provision of vitamin A was an important factor in the con- version of naive T cells into Foxp3 T cells. As expected, the culture of T cells with exogenous TGF-  and CD103 DCs led to the generation of a greater proportion of Foxp3 T cells than did culture with TGF-  and CD103 DCs ( Fig. 4, B – D ). However, the addition of both TGF-  and RA to cultures led to the generation of a similar proportion and number of Foxp3 T cells in the presence of both CD103 and CD103 DCs ( Fig. 4, B-D ). Foxp3 T cells generated in this way were still detectable after 17 d in culture, regardless of whether or not exogenous TGF-  and RA continued to be provided (Fig. S4, available at http://www.jem.org/cgi/ content/full/jem.20070590/DC1). It would therefore appear that RA is a necessary cofactor for the effi cient TGF-  – mediated conversion of naive T cells into Foxp3 T reg cells. In addition, inclusion of synthetic RA receptor inhibitors (LE540 and LE135) blocked the spontaneous induction of Foxp3 seen in the presence of CD103 MLN DCs (Fig. S5). Figure 5. CD103 DCs produce proinfl ammatory cytokines. CD103 The ability of CD103 DCs to metabolize vitamin A is there- and CD103 DCs were sorted from the MLN of BALB/c mice and cultured fore likely to account for their ability to drive the spontane- overnight in the presence of anti-CD40, an isotype control, or LPS. ous conversion of naive T cells into Foxp3 T cells in the (A) Supernatants were harvested, and cytokine concentrations were analyzed by cytometric bead array. Graphs are representative of two independent absence of any exogenous factors. experiments and depict cytokine concentrations in pg/ml. (B) IL-12p40 and IL-23p19 gene expression was assayed by quantitative PCR and Converted Foxp3 T cells suppress naive T cell proliferation normalized relative to expression of HPRT. Data are representative of two in vitro independent experiments. (C) CD103 and CD103 DCs were sorted from Expression of Foxp3 can be transiently up-regulated upon T cell the MLN of BALB/c mice. Tlr2 , tlr4 , and tbx21 gene expression was assayed activation in the absence of an accompanying acquisition of by quantitative PCR and normalized relative to expression of HPRT. Data regulatory properties ( 23 ). It was therefore important to test the are representative of two independent experiments. ability of Foxp3 T cells generated in the presence of CD103 MLN DCs to suppress the proliferation of naive T cells. Be- cause live cells cannot be sorted on the basis of Foxp3 expres- However, it is crucial that protective immunity to intestinal sion in the absence of a reporter gene, we could not test the pathogens can also be mounted. To this end, we investigated the suppressive function of the Foxp3 T cells generated using the functional properties of the reciprocal CD103 DC population. experimental setup described above. Instead, GFP CD4 T cells Purifi ed CD103 and CD103 MLN DCs were cultured were isolated from Foxp3-GFP mice and activated in the pres- overnight either alone or in the presence of LPS or an agonist ence of CD103 DCs and anti-CD3 . This led to the generation anti-CD40 mAb. Cytokines in the supernatants were quanti- of a similar proportion of Foxp3 T cells as in the antigen- tated by cytometric bead array, whereas levels of cytokine specifi c system. Again, this induction of Foxp3 could be inhib- mRNA in the DCs were determined by quantitative PCR. ited by the inclusion of anti – TGF-  or RA receptor inhibitors CD103 DCs produced higher levels of TNF-  regardless of and could be enhanced by the inclusion of rhTGF-  and RA whether DCs were left unstimulated or activated with LPS or (Fig. S5). Foxp3 T cells generated in the presence of CD103 anti-CD40. However, treatment with LPS did increase the DCs and rhTGF-  were then sorted on the basis of GFP ex- levels of TNF-  present in the supernatants of CD103 DC pression and their ability to suppress the proliferation of naive (Fig. 5 A). LPS treatment also led to the enhanced production T cells compared with that of freshly isolated Foxp3 T reg cells. of IL-6 by CD103 DCs (Fig. 5 A). Furthermore, CD103 Foxp3 T cells generated in this way were able to suppress the DCs produce substantially higher levels of IL-23p19 mRNA proliferation of naive T cells, indicating that they represent a true than CD103 DCs after stimulation through CD40. Only a regulatory population (Fig. S5). comparatively moderate increase in the expression of IL-12p40 was observed (Fig. 5 B). Consistent with their increased pro- CD103 DCs produce proinfl ammatory cytokines duction of TNF-  and IL-6 in response to LPS stimulation, We have demonstrated a clear role for MLN CD103 DCs in CD103 DCs also expressed slightly higher levels of Toll-like the induction of Foxp3 and regulatory function in naive T cells. receptor (TLR)4 mRNA than CD103 DCs. Further evidence JEM VOL. 204, August 6, 2007 1761 for in vitro stimulation of T cells was clone 145-2C11 (BD Biosciences). for the more proinfl ammatory phenotype of CD103 DCs Anti – mouse CD4 (L3T4), anti – mouse  7 integrin (M293), and anti – mouse included the enhanced expression of tlr2 and tbx21 , which 4  7 (DATK32; all from BD Biosciences); anti – mouse Foxp3 (FJK-16S; encodes Tbet (Fig. 5 C). eBioscience); and biotinylated or FITC-labeled anti-clonotypic TCR (KJ-1.26) The data presented here raise the question of why the were used for analysis of T cell populations. functional properties of CD103 and CD103 DCs diff er so dramatically. It is likely that the CD103 DC subset has arrived Adoptive transfer and oral feeding of antigen. CD4 T cells were isolated from splenic single cell suspensions from DO11.10-SCID mice by in the MLNs from the intestine and, consequently, its journey labeling with magnetic anti-CD4 beads (Miltenyi Biotec) and separating the through the immunosuppressive intestinal environment may cell populations using LS MACS columns according to the manufacturer ’ s have left an impact on its function. We hypothesize that the instructions. 2.5  10 cells were injected i.v. into Ly9.2 BALB/c recipients. interaction between CD103 on DCs and E-cadherin on After 24 h, drinking water was supplemented with 20 mg/ml Grade VI OVA epithelial cells may tether the DCs close to the intestinal epi- (Sigma-Aldrich) as described previously ( 13 ). Antigen was administered to thelium. This would allow them to be conditioned, perhaps by intact DO11.10 SCID mice in the same way. At the time points indicated in the relevant fi gure legends, organs were harvested and the presence of epithelial cell – derived factors, to go on to drive regulatory- Foxp3 T cells was determined by FACS. type responses in the draining LNs. An example of this is the conditioning of DCs by thymic stromal lymphopoietin high Preparation and culture of CD11c subsets. MLNs from BALB/c produced by intestinal epithelial cells ( 24 ). A key feature of gut mice were cut into small fragments and incubated in RPMI with 10% FCS, conditioning in our studies is the capacity of CD103 DCs to 15 mM Hepes, and 1 mg/ml collagenase type VIII (Sigma-Aldrich) for produce or activate TGF-  and to provide RA, both essential 40 min at 37 ° C in a shaking incubator. After adding EDTA for an addi- cofactors for the emergence of Foxp3 T cells. In this way, tional 5 min, the solution was fi ltered through a nylon mesh and washed in HBSS with 0.1% BSA. Cell suspensions were incubated with an anti-FcR gut-derived DCs respond to environmental cues to promote antibody (clone 24G2; eBioscience), followed by anti-CD11c MACS beads noninfl ammatory immune-suppressive responses that may con- (Miltenyi Biotec). CD11c cells were positively selected on an LS MACS tribute to intestinal homeostasis. On the other hand, CD103 column according to the manufacturer ’ s instructions (Miltenyi Biotec). DCs may have arrived in the LNs through the blood and Cells were labeled with anti-CD3e, anti-CD103, anti-CD11c, and 7-AAD therefore escaped gut conditioning. This would leave them and sorted on a MoFlo sorter (DakoCytomation) to 98% purity. For anal- ysis of cytokine production, DC subsets were cultured overnight in DMEM poised to respond to infl ammatory stimuli through the pro- supplemented with 10% FCS, 2 mM L-glutamine, and 100 U of penicillin duction of proinfl ammatory cytokines. and streptomycin. 1 ug/ml LPS (Sigma-Aldrich) or 10 ug/ml anti – mouse Our results demonstrate the presence of two functionally CD40 was added to some wells. Supernatants were analyzed for cytokines using distinct DC subsets present in the MLNs of normal mice. a Cytometric Bead Array mouse infl ammation kit according to the manu- CD103 DCs are poised to deal with pathogens through the facturer ’ s instructions (BD Biosciences). Cells were prepared for quantitative production of proinfl ammatory cytokines, whereas CD103 PCR analysis as described below. DCs induce Foxp3 T reg cells, suggesting a mechanism by which tolerance to harmless non – self-antigen may be main- Preparation of T cell populations. CD4 T cells were isolated from splenic single cell suspensions from DO11.10 SCID mice by labeling with tained. The ability to induce or expand populations of T reg magnetic anti-CD4 beads (Miltenyi Biotec) and separating the cell popula- cells in culture increases the likelihood that they could be used tions using LS MACS columns according to the manufacturer ’ s instructions. therapeutically, for example, in the treatment of infl ammatory The positively selected CD4 T cells were labeled with 10  M CFDA SE bowel disease. Identifi cation of the key factors involved in the using a Vybrant CFDA SE Cell Tracer kit (Invitrogen). CD4 CD25 T cells induction of T reg cells by CD103 DCs suggests ways in which were isolated from the spleens of DO11.10 BALB/c mice. Single cell sus- pensions were depleted of CD8 , MHC class II , Mac-1 , and B220 cells this process can be made more effi cient. In this regard, the by negative selection using sheep anti – rat-coated Dynabeads (Dynal) as de- fi nding that RA enhances the TGF-  – mediated induction of scribed previously ( 26 ). The resulting CD4-enriched cells were stained with Foxp3 may have important therapeutic implications. biotinylated anti – mouse CD25, followed by Straptavidin-coated MACS beads and sorted by AutoMACS (Miltenyi Biotec). MATERIALS AND METHODS Mice. BALB/c, DO11.10 BALB/c, and DO11.10 SCID TCR transgenic 5 T cell diff erentiation assay. 2  10 T cells were cultured together with mice were maintained in microisolator cages in a specifi c pathogen-free animal 4 5 high 2.5  10 – 10 of the sorted CD11c subsets and 0.2  g/ml OVA peptide facility at the University of Oxford. Experiments were performed according in complete RPMI (10% FCS, 2 mM L-glutamine, 0.05 mM 2-mercapto- to the UK Animals (Scientifi c Procedures) Act of 1986. Foxp3 eGFP re- ethanol, and 100 U of penicillin and streptomycin) for 4 d. Cultures were GFP porter mice (Foxp3 ) were originally obtained from M. Oukka (Harvard supplemented with fresh medium containing 100 U/ml recombinant human Medical School, Boston, MA) ( 25 ) and were maintained in the NIH ’ s animal 5 IL-2 (PeproTech) and incubated for an additional 2 – 3 d. Alternatively, 10 facilities under specifi c pathogen-free conditions.   4 CD4 eGFP T cells were cultured with 10 purifi ed CD103 or CD103 MLN DCs and 1  g/ml of soluble anti-CD3 for 5 d. 5 ng/ml of recombi- Antibodies. The following antibodies were used for cell purifi cation: anti – nant human IL-2 was added to cultures every other day beginning on day 2 mouse CD8 (clone YTS169), MHC class II (TIB120), Mac-1 (M1/70), as described previously ( 25 ). On day 5, cells were stained with PE-Cy7 – and B220 (RA3-6B2; all purifi ed from hybridoma supernatant by affi nity conjugated anti-CD4 (RM4-5), and Foxp3 cells were detected by eGFP chromatography); and biotinylated anti – mouse CD25 (7D4), anti – mouse expression. Recombinant human TGF-  1 (R & D Systems), anti – mouse CD11c (clone HL3), anti – mouse CD103 (M290), and anti – mouse CD3e TGF-  1/2, all-trans RA (Sigma-Aldrich), or the RA receptor inhibitors, (145-2C11; all from BD Biosciences). For use in in vitro cultures, anti – mouse LE540 (Wako Chemicals USA) and LE135 (Tocris Bioscience), were added TGF-  1/2 (1D11.16.8) and anti – mouse CD40 (FGK45) were purifi ed from to culture wells in some cases. Concentrations are indicated in the relevant hybridoma supernatant by affi nity chromatography. Anti – mouse CD3 used fi gure legends. 1762 CD103 MLN DCS INDUCE FOXP3 T REG CELLS | Coombes et al. BRIEF DEFINITIVE REPORT Suppression assay. The ability of Foxp3 T cells generated in the presence 4 . Thorstenson , K.M. , and A. Khoruts . 2001 . Generation of anergic CD25 of CD103 DCs to suppress T cell proliferation was determined as described CD4 T cells with immunoregulatory potential in vivo following induction of peripheral tolerance with intravenous or oral antigen. previously ( 27 ). In brief, sorted CD4 GFP T reg cells were cultured with 5 4   5 J. Immunol. 167 : 188 – 195 . 10 freshly isolated CD4 GFP T cells, 10 antigen-presenting cells, and 5 . Chen , W. , W. Jin , N. Hardegen , K.J. Lei , L. Li , N. Marinos , G. McGrady , 0.5  g/ml anti-CD3 (145-2C11; BD Biosciences). Antigen-presenting cells and S.M. Wahl . 2003 . Conversion of peripheral CD4 CD25  naive were prepared by depleting splenocytes of CD90 cells by isolation kit and T cells to CD4 CD25 regulatory T cells by TGF-  induction of tran- autoMACs (Miltenyi Biotec), followed by irradiation. Cultures were incu- scription factor Foxp3. J. Exp. Med. 198 : 1875 – 1886 . bated for 72 h, with the inclusion of 1  Ci/well [ H]TdR (MP Biomedicals) 6 . Cobbold , S.P. , R. Castejon , E. Adams , D. Zelenika , L. Graca , S. for the fi nal 8 h. Humm , and H. Waldmann . 2004 . Induction of foxP3+ regulatory T cells in the periphery of T cell receptor transgenic mice tolerized to Quantitation of gene expression using real-time PCR. Total RNA was transplants. J. Immunol. 172 : 6003 – 6010 . purifi ed from sorted cells using RNAeasy kits (QIAGEN). cDNA synthesis 7 . Fantini , M.C. , C. Becker , G. Monteleone , F. Pallone , P.R. Galle , and was performed using Superscript III reverse transcriptase and Oligo dT primers M.F. Neurath . 2004 . Cutting edge: TGF-beta induces a regulatory phe- (both from Invitrogen). Quantitative PCR reactions were performed either notype in CD4+CD25  T cells through Foxp3 induction and down- using quantitect Primer Assays with SYBR green PCR mastermix (QIAGEN) regulation of Smad7. J. Immunol. 172 : 5149 – 5153 . 8 . Fu , S. , N. Zhang , A.C. Yopp , D. Chen , M. Mao , H. Zhang , Y. Ding , or the following reagents: IL-23 p19 primer AGCGGGACATATGAATC- and J.S. Bromberg . 2004 . TGF-beta induces Foxp3 T-regulatory cells TACTAAGAGA, GTCCTAGTAGGGAGGTGTGAAGTTG, and FAM/ from CD4 CD25- precursors. Am. J. Transplant. 4 : 1614 – 1627 . TAMRA-labeled probe CCAGTTCTGCTTGCAAAGGATCCGC; IL-12 9 . Rao , P.E. , A.L. Petrone , and P.D. Ponath . 2005 . Diff erentiation and p40 primers GACCATCACTGTCAAAGAGTTTCTAGAT, AGGAAA- expansion of T cells with regulatory function from human peripheral GTCTTGTTTTTGAAATTTTTTAA, and FAM/TAMRA-labeled probe lymphocytes by stimulation in the presence of TGF- { beta } . J. Immunol. CCACTCACATCTGCTGCTCCACAAGAAG; HPRT primers GACCG- 174 : 1446 – 1455 . GTCCCGTCATGC and TCATAACCTGGTTCATCATCGC; and VIC/ 10 . Wan , Y.Y. , and R.A. Flavell . 2005 . Identifying Foxp3-expressing sup- TAMRA-labeled probe ACCCGCAGTCCCAGCGTCGTC. pressor T cells with a bicistronic reporter. Proc. Natl. Acad. Sci. USA . cDNA samples were assayed in triplicate using a Chromo4 detection 102 : 5126 – 5131 . system (MJ Research), and gene expression levels for each individual sample 11 . Chirdo , F.G. , O.R. Millington , H. Beacock-Sharp , and A.M. Mowat . were normalized to HPRT. Mean relative gene expression was determined 2005 . Immunomodulatory dendritic cells in intestinal lamina propria. C(t) and the diff erences were calculated using the 2 method ( 28 ). Eur. J. Immunol. 35 : 1831 – 1840 . 12 . Johansson , C. , and B.L. Kelsall . 2005 . Phenotype and function of intes- Statistics. An unpaired student ’ s t test was performed in Prism (Graphpad) tinal dendritic cells. Semin. Immunol. 17 : 284 – 294 . in all cases. Where appropriate, mean SD is represented on graphs. 13 . Zhang , X. , L. Izikson , L. Liu , and H.L. Weiner . 2001 . Activation of CD25()CD4() regulatory T cells by oral antigen administration. J. Immunol. 167 : 4245 – 4253 . Online supplemental material. Fig. S1 shows the generation of Foxp3 14 . Bilsborough , J. , T.C. George , A. Norment , and J.L. Viney . 2003 . T cells in the GALT. Foxp3 T cells are maintained in the MLN of DO11.10 Mucosal CD8alpha DC, with a plasmacytoid phenotype, induce dif- SCID mice after the removal of antigen and can be generated after the transfer ferentiation and support function of T cells with regulatory properties. of DO11.10 SCID T cells to normal mice. Fig. S2 shows the accumulation Immunology . 108 : 481 – 492 . and proliferation of CD4 T cells in the presence of CD103 and CD103 15 . Worbs , T. , U. Bode , S. Yan , M.W. Hoff mann , G. Hintzen , G. DCs. Fig. S3 shows that CD103 DCs can acquire and present orally admin- Bernhardt , R. Forster , and O. Pabst . 2006 . Oral tolerance originates in istered antigen. Fig. S4 shows that Foxp3 T cells continue to accumulate in the intestinal immune system and relies on antigen carriage by dendritic culture without the continued provision of TGF-  and RA. Fig. S5 shows that cells. J. Exp. Med. 203 : 519 – 527 . induction of Foxp3 by CD103 DCs is inhibited by RA receptor inhibitors, 16 . Annacker , O. , J.L. Coombes , V. Malmstrom , H.H. Uhlig , T. Bourne , and that Foxp3 T cells generated in vitro can suppress T cell proliferation. B. Johansson-Lindbom , W.W. Agace , C.M. Parker , and F. Powrie . The online supplemental material can be found at http://www.jem.org/cgi/ 2005 . Essential role for CD103 in the T cell – mediated regulation of content/full/jem.20070590/DC1. experimental colitis. J. Exp. Med. 202 : 1051 – 1061 . 17 . Kilshaw , P.J. 1993 . Expression of the mucosal T cell integrin alpha M290 beta 7 by a major subpopulation of dendritic cells in mice. Eur. J. We would like to thank Nigel Rust for cell sorting and the staff of our animal Immunol. 23 : 3365 – 3368 . facility for care of the mice. 18 . Brenan , M. , and M. Puklavec . 1992 . The MRC OX-62 antigen: a use- This study was funded by the Wellcome Trust and the European Union (Euro- ful marker in the purifi cation of rat veiled cells with the biochemical Thymaide FP6 Integrated Project; LSHB-CT-2003-503410), with J.L. Coombes and properties of an integrin. J. Exp. Med. 175 : 1457 – 1465 . K.R.R. Siddiqui in receipt of Medical Research Council studentships. 19 . Johansson-Lindbom , B. , M. Svensson , O. Pabst , C. Palmqvist , G. The authors have no confl icting fi nancial interests. Marquez , R. Forster , and W.W. Agace . 2005 . Functional specialization of gut CD103 dendritic cells in the regulation of tissue-selective T cell Submitted: 23 March 2007 homing. J. Exp. Med. 202 : 1063 – 1073 . Accepted: 25 June 2007 20 . Marie , J.C. , J.J. Letterio , M. Gavin , and A.Y. Rudensky . 2005 . TGF- 1 maintains suppressor function and Foxp3 expression in CD4 CD25 regulatory T cells. J. Exp. Med. 201 : 1061 – 1067 . REFERENCES 1 . Coombes , J.L. , N.J. Robinson , K.J. Maloy , H.H. Uhlig , and F. Powrie . 21 . Annes , J.P. , J.S. Munger , and D.B. Rifkin . 2003 . Making sense of latent TGFbeta activation. J. Cell Sci. 116 : 217 – 224 . 2005 . Regulatory T cells and intestinal homeostasis. Immunol. Rev. 204 : 184 – 194 . 22 . Iwata , M. , A. Hirakiyama , Y. Eshima , H. Kagechika , C. Kato , and S.Y. Song . 2004 . Retinoic acid imprints gut-homing specifi city on T cells. 2 . Kretschmer , K. , I. Apostolou , D. Hawiger , K. Khazaie , M.C. Nussenzweig , and H. von Boehmer . 2005 . Inducing and expanding regulatory T cell Immunity . 21 : 527 – 538 . 23 . Gavin , M.A. , T.R. Torgerson , E. Houston , P. DeRoos , W.Y. Ho , A. populations by foreign antigen. Nat. Immunol. 6 : 1219 – 1227 . 3 . Sun , J.B. , S. Raghavan , A. Sjoling , S. Lundin , and J. Holmgren . 2006 . Stray-Pedersen , E.L. Ocheltree , P.D. Greenberg , H.D. Ochs , and A.Y. Rudensky . 2006 . Single-cell analysis of normal and FOXP3-mutant hu- Oral tolerance induction with antigen conjugated to cholera toxin B subunit generates both Foxp3CD25 and Foxp3  CD25  CD4 man T cells: FOXP3 expression without regulatory T cell development. Proc. Natl. Acad. Sci. USA . 103 : 6659 – 6664 . regulatory T cells. J. Immunol. 177 : 7634 – 7644 . JEM VOL. 204, August 6, 2007 1763 24 . Rimoldi , M. , M. Chieppa , V. Salucci , F. Avogadri , A. Sonzogni , G.M. 26 . Powrie , F. , M.W. Leach , S. Mauze , L.B. Caddle , and R.L. Coff man . 1993 . Sampietro , A. Nespoli , G. Viale , P. Allavena , and M. Rescigno . 2005 . Phenotypically distinct subsets of CD4 T cells induce or protect from chronic Intestinal immune homeostasis is regulated by the crosstalk between epi- intestinal infl ammation in C. B-17 scid mice. Int. Immunol. 5 : 1461 – 1471 . thelial cells and dendritic cells. Nat. Immunol. 6 : 507 – 514 . 27 . Thornton , A.M. , and E.M. Shevach . 1998 . CD4 CD25 immuno- 25 . Bettelli , E. , Y. Carrier , W. Gao , T. Korn , T.B. Strom , M. Oukka , H.L. regulatory T cells suppress polyclonal T cell activation in vitro by inhibiting Weiner , and V.K. Kuchroo . 2006 . Reciprocal developmental pathways interleukin 2 production. J. Exp. Med. 188 : 287 – 296 . for the generation of pathogenic eff ector TH17 and regulatory T cells. 28 . Pfaffl , M.W. 2001 . A new mathematical model for relative quantifi ca- Nature . 441 : 235 – 238 . tion in real-time RT-PCR. Nucleic Acids Res. 29 : e45 . 1764 CD103 MLN DCS INDUCE FOXP3 T REG CELLS | Coombes et al. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The Journal of Experimental Medicine Pubmed Central

A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via a TGF-β– and retinoic acid–dependent mechanism

Coombes, Janine L.; Siddiqui, Karima R.R.; Arancibia-Cárcamo, Carolina V.; Hall, Jason; Sun, Cheng-Ming; Belkaid, Yasmine; Powrie, Fiona
The Journal of Experimental Medicine , Volume 204 (8) – Aug 6, 2007
Download PDF
8 pages

Loading next page...
 
/lp/pubmed-central/a-functionally-specialized-population-of-mucosal-cd103-dcs-induces-MRulB92p03

References (34)

Publisher
Pubmed Central
Copyright
Copyright © 2007, The Rockefeller University Press
ISSN
0022-1007
eISSN
1540-9538
DOI
10.1084/jem.20070590
Publisher site
See Article on Publisher Site

Abstract

BRIEF DEFINITIVE REPORT A functionally specialized population of mucosal CD103 DCs induces Foxp3 regulatory T cells via a TGF-  – and retinoic acid – dependent mechanism 1 1 Janine L. Coombes, Karima R.R. Siddiqui, Carolina V. Arancibia- 1 2 2 2 C á rcamo, Jason Hall, Cheng-Ming Sun, Yasmine Belkaid, and Fiona Powrie Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, UK Mucosal Immunology Unit, Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health (NIH), Bethesda, MD 20892 Foxp3 regulatory T (T reg) cells play a key role in controlling immune pathological re- actions. Many develop their regulatory activity in the thymus, but there is also evidence for development of Foxp3 T reg cells from naive precursors in the periphery. Recent studies have shown that transforming growth factor (TGF)-  can promote T reg cell development in culture, but little is known about the cellular and molecular mechanisms that mediate this pathway under more physiological conditions. Here, we show that after antigen activa- tion in the intestine, naive T cells acquire expression of Foxp3. Moreover, we identify a population of CD103 mesenteric lymph node dendritic cells (DCs) that induce the devel- opment of Foxp3 T reg cells. Importantly, promotion of T reg cell responses by CD103 DCs is dependent on TGF-  and the dietary metabolite, retinoic acid (RA). These results newly identify RA as a cofactor in T reg cell generation, providing a mechanism via which functionally specialized gut-associated lymphoid tissue DCs can extend the repertoire of T reg cells focused on the intestine. Regulatory T (T reg) cells are known to play occurring population. Consequently, it is diffi - CORRESPONDENCE Fiona Powrie: an important role in the control of destructive cult to determine what proportion of peripheral fi [email protected] infl ammatory responses ( 1 ). Most frequently CD25 Foxp3 T reg cells had their regulatory studied is the naturally occurring population of function imprinted in the periphery. CD4 CD25 Foxp3 T reg cells that develops The ability to induce T reg cell populations in the thymus. These cells are important in the from the naive pool may be of particular benefi t control of a wide range of immune-mediated in the intestine. The extensive immune system pathologies, including autoimmunity, colitis, here must cope with the challenge of mount- and chronic infection. Nevertheless, T cells with ing protective immunity to occasional patho- regulatory function can also be generated in the gens while remaining tolerant to dietary antigen periphery from the naive T cell pool after, for and the commensal fl ora. It may therefore be example, the oral administration of antigen or crucial to generate T reg cells specifi c for these the targeting of peptide ligands to DCs in vivo types of antigen, in addition to those T reg cells ( 2 – 4 ). Foxp3 T cells can also be generated in selected for their high affi nity to self-antigen in the presence of TGF-  ( 5 – 10 ). the thymus. Although peripheral T cells can begin to DCs are thought to play an important role in express Foxp3 and acquire regulatory function, the generation of T reg cell responses. DCs pre- the relevance of this pathway under normal sent in the gut-associated lymphoid tissue (GALT) physiological conditions remains unclear. This is possess several functional specializations that sug- compounded by the fact that induced Foxp3 gest they may be capable of inducing regulatory- T cells look phenotypically similar to the naturally type responses ( 11, 12 ). However, a clear role for these cells in the extrathymic development of The online version of this article contains supplemental material. Foxp3 T reg cells remains to be demonstrated. Vol. 204, No. 8, August 6, 2007 1757-1764 www.jem.org/cgi/doi/ 10.1084/jem.20070590 The Journal of Experimental Medicine Here, we demonstrate that a population of CD103 DCs found in the mesenteric LNs (MLNs) of normal mice can promote the conversion of naive T cells into Foxp3 T reg cells. This occurred without any further manipulation of the DC population and was dependent on TGF-  and the vitamin A metabolite, retinoic acid (RA). These results highlight one path- way by which T reg cells may be generated in the periphery under normal conditions. RESULTS AND DISCUSSION Oral administration of OVA induces Foxp3 T cells from naive precursors Oral administration of antigen has been shown to increase T reg cell populations in a variety of experimental settings ( 3, 4, 13 ). However, whether this represents de novo induction or expansion of a preformed pool of Foxp3 T reg cells is not clear. Here, we have investigated the induction of Foxp3 ex- pression in antigen-specifi c T cells after oral administration of OVA to DO11.10 SCID mice. Placing a TCR transgene on the SCID background prevents endogenous rearrangement of TCR chains, resulting in all peripheral T cells having a single antigen specifi city. As the antigen recognized by the DO11.10 TCR is exogenous, T cells from unfed DO11.10 SCID mice Figure 1. Induction of Foxp3 T cells after oral administration are a uniformly naive population and do not express Foxp3. of antigen. DO11.10 SCID mice were given OVA or BSA in drinking DO11.10 SCID mice are therefore a useful tool to investigate water for 5 d. (A) Single cell suspensions of MLNs stained for CD4 and Foxp3 and analyzed by FACS. Numbers represent the proportion of induction of Foxp3 expression rather than expansion of a pre- Foxp3 cells among the CD4 population. (B) P ercentage of Foxp3 existing population. When drinking water was supplemented cells among the CD4 population, and total number of Foxp3 cells in with OVA, but not BSA, we observed a dramatic increase OVA- and BSA-fed mice. Data are representative of two similar inde- in MLN cellularity, including a proportionate increase in pendent experiments. the number of CD4 T cells. This was accompanied by the formation of a small population of Foxp3 T cells in the MLN ( Fig. 1 ). Populations of Foxp3 T cells were also detected in such antigen-loaded DCs may preferentially direct the induc- the spleen and colonic lamina propria (LP) of OVA-fed mice, tion or expansion of T cells with regulatory properties. In although the increase in T cell numbers was moderate in com- line with this, several previous studies have suggested that parison to the MLN (unpublished data). Foxp3 T cells were intestinal DCs may be tolerogenic ( 11, 14 ). Moreover, a recent still detectable 5 d after the removal of antigen from the study has demonstrated a role for the migration of intestinal drinking water (Fig. S1, A and B, available at http://www.jem DCs through the lymph to the MLN in the induction of oral .org/cgi/content/full/jem.20070590/DC1). tolerance ( 15 ). It therefore seemed likely that the induction Expression of Foxp3 also occurred in naive peripheral of Foxp3 expression we observed upon the feeding of OVA DO11.10 SCID CD4 T cells adoptively transferred into could be mediated by DCs present in the MLNs. We there- congenic Ly9.2 BALB/c mice (Fig. S1, C – E). This supports fore sought to investigate the role of MLN DCs in the induction the conclusion that Foxp3 T reg cells can arise from the pe- of Foxp3 T reg cells. ripheral T cell pool rather than from immature thymocytes, which may have occurred if antigen-loaded peripheral DCs CD103 DCs isolated from the MLNs promote migrated to the thymus of DO11.10 SCID mice. Further- the conversion of naive CD4 T cells into Foxp3 T cells more, this fi nding confi rms that the presence of a normal We have previously demonstrated that expression of CD103 T reg cell repertoire does not inhibit the peripheral generation on DCs is required for the CD4 CD25 T reg cell – mediated of Foxp3 T reg cells. control of experimental colitis ( 16 ). This suggested that Collectively, our results suggest that the GALT is one site CD103 DCs may be functionally specialized to drive T reg cell at which the peripheral induction of Foxp3 T reg cells can responses. CD103 is expressed by a proportion of DCs isolated occur. Although potential mediators for the peripheral in- from the MLNs and colonic LP of normal mice and is also duction of Foxp3 expression have been studied, the factors present on rat lymph DCs migrating from the intestine in the governing their formation at this particular anatomical site steady state ( Fig. 2 A ) ( 17 – 19 ). Fittingly, in CCR7 mice, remain unknown. Antigen administered by the oral route is where the migration of DCs from tissue to the LN is impaired, likely to be picked up by DCs present in the Peyer ’ s patches the number of CD103 DCs in the MLNs is greatly reduced or LP. Upon encounter with T cells, most likely in the MLNs, ( 19 ). This suggests that a proportion of the CD103 DCs present 1758 CD103 MLN DCS INDUCE FOXP3 T REG CELLS | Coombes et al. BRIEF DEFINITIVE REPORT induce expression of Foxp3, which was detectable by FACS at days 3 and 7 of culture ( Fig. 2, B and C, and not depicted). Induction of Foxp3 was dependent on the number of DCs present in culture, with a reduction in the number of CD103 DCs leading to a decrease in the proportion of T cells ex- pressing Foxp3 ( Fig. 2 B ). CD103 MLN DCs isolated from OVA-fed mice also drove expression of Foxp3 when cultured with DO11.10 SCID CD4 T cells, indicating that CD103 DCs are capable of taking up and presenting orally administered antigen (Fig. S3). However, very little CD4 T cell accumu- lation was observed in the presence of CD103 DCs or when mice were fed an irrelevant antigen. The ability of CD103 DCs to maintain a preexisting population of Foxp3 CD4 CD25 T cells in culture was also investigated. CD4 CD25 T cells were obtained from the spleens of DO11.10 BALB/c mice, and expression of Foxp3 in the TCR transgenic (KJ-1.26 ) fraction was investigated. At the beginning of culture, 75% of KJ-1.26 T cells expressed Foxp3. Over the period of culture this proportion decreased, probably as a result of outgrowth of contaminating Foxp3 T cells rather than a genuine down-regulation of Foxp3. However, the proportion of T cells expressing Foxp3 by day 7 of culture was greater in the presence of CD103 DCs ( Fig. 2 D ). This suggests that in addition to inducing Foxp3 expression in naive T cells, CD103 DCs favor the maintenance of existing Foxp3 cells over expansion of any contaminating Foxp3 population. We had previously observed that CD103 MLN DCs Figure 2. Induction of Foxp3 T cells in the presence of MLN directed the migration of T cells to the intestine without CD103 DCs. (A) Single cell suspensions of spleen, MLNs, and colonic LP inducing production of the proinfl ammatory cytokine IFN- from BALB/c mice were prepared, and the proportion of CD103 cells ( 16 ). We now demonstrate that CD103 MLN DCs are high 5 among the CD11c population was determined. (B) 0.25 – 1  10 CD103 capable both of converting naive T cells into Foxp3 T reg or CD103 MLN DCs were cultured with CFDA SE-labeled DO11.10 CD4 cells and of supporting conventional CD4 CD25 Foxp3 T cells and 0.2  g/ml OVA peptide. At day 7 of culture, T cells were stained for Foxp3 and CD4 and analyzed by FACS. The graph shows the percent- T reg cells. Collectively, these data indicate that CD103 age of Foxp3 cells among CD4 T cells in the presence of varying num- MLN DCs are capable of driving T reg cell responses focused bers of either DC subset. Data is representative of three independent on the intestine. Because expression of CD103 on DCs was experiments. (C) FACS plots showing the percentage of T cells expressing required for the CD4 CD25 T reg cell – mediated control of 5 + Foxp3 at the start of culture and after 7 d of culture with 10 CD103 or colitis, we speculate that both the transferred CD4 CD25 CD103 MLN DCs. Plots are gated on CD4 cells, and numbers represent T reg cells and the Foxp3 T reg cells generated peripherally the proportion of CD4 cells in each quadrant. (D) CD4 CD25 T cells from from naive T cells may play an important role in the prevention DO11.10 mice were isolated and cultured with 10 CD103 or CD103 MLN of intestinal pathology. DCs and 0.2  g/ml OVA peptide. Before culture, and at day 6 of culture, T cells were stained for CD4, Foxp3, and clonotypic TCR (KJ-1.26). Plots are gated on KJ-1.26 CD4 cells. Numbers represent the percentage of Foxp3 TGF-  enhances the conversion of naive T cells into Foxp3 cells among the KJ-1.26 CD4 population. Data are representative of two cells in the presence of CD103 DCs independent experiments. TGF-  1 is important in maintaining functional Foxp3 CD4 CD25 T reg cells in the periphery and can also induce in the MLNs migrate there constitutively from the intestine, Foxp3 expression in naive T cells ( 5 – 10, 20 ). Therefore, the role making them likely candidates for the generation of T reg cell of TGF-  in the induction of Foxp3 by CD103 DCs was responses. We compared the ability of CD103 and CD103 investigated. Naive T cells were again cultured with CD103 DCs isolated from the MLNs of normal BALB/c mice to or CD103 DCs. Inclusion of a blocking mAb against TGF- induce expression of Foxp3 in splenic CD4 T cells isolated completely blocked the induction of Foxp3, indicating that from DO11.10 SCID mice. Proliferation and accumulation the conversion of naive T cells into Foxp3 T reg cells by of T cells was comparable in the presence of both CD103 CD103 DCs is mediated by TGF-  ( Fig. 3 A ). A possible and CD103 DCs (Fig. S2, available at http://www.jem explanation for the functional diff erence between CD103 .org/cgi/content/full/jem.20070590/DC1). However, it was and CD103 DC subsets is that CD103 DCs produce higher striking that only the CD103 DC population was able to levels of active TGF-  than the CD103 population. Analysis JEM VOL. 204, August 6, 2007 1759 Figure 4. RA acts as a cofactor for Foxp3 induction. (A) CD103 and CD103 DCs were sorted from the MLNs of BALB/c mice. Aldh1a2 gene expression was assayed by quantitative PCR and normalized relative to expression of HPRT. Data shown are representative of two independent experiments. (B) CD4 T cells from DO11.10 SCID mice were cultured with 5  10 CD103 or CD103 MLN DCs, 0.2  g/ml OVA peptide, and 2 ng/ml rhTGF-  . Some wells were additionally supplemented with 100 nM RA. Figure 3. Induction of Foxp3 is dependent on TGF-  . (A) CD4 T cells were stained for  7 integrin, CD4, and Foxp3 and analyzed by FACS. T cells from DO11.10 SCID mice were cultured with 5  10 CD103 or Plots are gated on CD4 cells, and numbers represent the percentage of CD103 MLN DCs, 0.2  g/ml OVA peptide, and 50  g/ml anti – TGF-  or CD4 cells in each quadrant. Data are representative of two independent isotype control. At day 6 of culture, T cells were stained for CD4 and experiments. (C) Graph depicts pooled data from the experiments de- Foxp3 and analyzed by FACS. Representative plots from two independent scribed in B. Bars show the percentage of CD4 cells expressing Foxp3. experiments are gated on CD4 cells, and numbers represent the percent- (D) Graph depicts absolute numbers of Foxp3 T cells in culture under the age of CD4 cells in each quadrant. (B) CD103 and CD103 DCs were indicated conditions. sorted from the MLNs of BALB/c mice. Tgfb2 , ltbp3 , and plat gene expres- sion was assayed by quantitative PCR and normalized relative to expres- sion of HPRT. Data shown are representative of two independent experiments. (C) CD4 T cells from DO11.10 SCID mice were cultured with of naive T cells into Foxp3 T cells, so that inclusion of 1 ng/ml 10 CD103 or CD103 MLN DCs, 0.2 ug/ml OVA peptide, and the indicated TGF-  resulted in the expression of Foxp3 by  50% of T cells. concentrations of rhTGF-  . At day 6 of culture, T cells were stained for However, although inclusion of TGF-  in cultures containing CD4 and Foxp3 and analyzed by FACS. Representative plots from three CD103 DCs allowed for the generation of a minor Foxp3 similar experiments are gated on CD4 cells, and numbers represent the T cell population, the percentage of T cells expressing Foxp3 percentage of Foxp3 cells among CD4 T cells. was still considerably lower than in the presence of CD103 DCs ( Fig. 3 C ). of gene expression by freshly isolated CD103 and CD103 Although CD103 DCs express genes involved in the MLN DCs revealed several diff erences in the expression of secretion and activation of latent TGF-  , this cannot account mRNA related to TGF-  and its secretion and activation for their enhanced ability to induce Foxp3 in the presence of ( Fig. 3 B ). Specifi cally, CD103 DCs expressed higher levels exogenous TGF-  . The exogenous TGF-  used in these ex- of tgfb2 , plat (tissue plasminogen activator), and latent TGF-  periments was already in its active form, bypassing the need binding protein 3 ( ltbp3 ). LTBP3 is important for the effi cient for the production of factors involved in the conversion of secretion and appropriate localization of latent TGF-  , whereas latent into active TGF-  . Even the provision of very high tissue plasminogen activator plays a role in the activation of concentrations of active TGF-  did not enable CD103 DCs latent TGF-  ( 21 ). to induce similar levels of Foxp3 to CD103 DCs, suggesting Although suffi cient endogenous TGF-  was present in either that CD103 DCs are producing an inhibitory factor cultures containing CD103 DCs to mediate the conversion or lack an important cofactor. of  10% of naive T cells into Foxp3 T cells, we investigated the eff ect of adding varying concentrations of exogenous RA acts as a cofactor for Foxp3 induction TGF-  on the induction of Foxp3. The addition of TGF-  We and others have previously demonstrated that CD103 to cultures containing CD103 DCs enhanced the conversion DCs promote the expression of gut homing receptors on 1760 CD103 MLN DCS INDUCE FOXP3 T REG CELLS | Coombes et al. BRIEF DEFINITIVE REPORT T cells ( 16, 19 ). Expression of gut homing receptors on T cells is enhanced by the vitamin A metabolite RA ( 22 ). Accord- ingly, we now show that CD103 DCs express aldh1a2 , a retinal dehydrogenase involved in the conversion of retinal into RA ( Fig. 4 A ). As a result, we investigated whether the provision of vitamin A was an important factor in the con- version of naive T cells into Foxp3 T cells. As expected, the culture of T cells with exogenous TGF-  and CD103 DCs led to the generation of a greater proportion of Foxp3 T cells than did culture with TGF-  and CD103 DCs ( Fig. 4, B – D ). However, the addition of both TGF-  and RA to cultures led to the generation of a similar proportion and number of Foxp3 T cells in the presence of both CD103 and CD103 DCs ( Fig. 4, B-D ). Foxp3 T cells generated in this way were still detectable after 17 d in culture, regardless of whether or not exogenous TGF-  and RA continued to be provided (Fig. S4, available at http://www.jem.org/cgi/ content/full/jem.20070590/DC1). It would therefore appear that RA is a necessary cofactor for the effi cient TGF-  – mediated conversion of naive T cells into Foxp3 T reg cells. In addition, inclusion of synthetic RA receptor inhibitors (LE540 and LE135) blocked the spontaneous induction of Foxp3 seen in the presence of CD103 MLN DCs (Fig. S5). Figure 5. CD103 DCs produce proinfl ammatory cytokines. CD103 The ability of CD103 DCs to metabolize vitamin A is there- and CD103 DCs were sorted from the MLN of BALB/c mice and cultured fore likely to account for their ability to drive the spontane- overnight in the presence of anti-CD40, an isotype control, or LPS. ous conversion of naive T cells into Foxp3 T cells in the (A) Supernatants were harvested, and cytokine concentrations were analyzed by cytometric bead array. Graphs are representative of two independent absence of any exogenous factors. experiments and depict cytokine concentrations in pg/ml. (B) IL-12p40 and IL-23p19 gene expression was assayed by quantitative PCR and Converted Foxp3 T cells suppress naive T cell proliferation normalized relative to expression of HPRT. Data are representative of two in vitro independent experiments. (C) CD103 and CD103 DCs were sorted from Expression of Foxp3 can be transiently up-regulated upon T cell the MLN of BALB/c mice. Tlr2 , tlr4 , and tbx21 gene expression was assayed activation in the absence of an accompanying acquisition of by quantitative PCR and normalized relative to expression of HPRT. Data regulatory properties ( 23 ). It was therefore important to test the are representative of two independent experiments. ability of Foxp3 T cells generated in the presence of CD103 MLN DCs to suppress the proliferation of naive T cells. Be- cause live cells cannot be sorted on the basis of Foxp3 expres- However, it is crucial that protective immunity to intestinal sion in the absence of a reporter gene, we could not test the pathogens can also be mounted. To this end, we investigated the suppressive function of the Foxp3 T cells generated using the functional properties of the reciprocal CD103 DC population. experimental setup described above. Instead, GFP CD4 T cells Purifi ed CD103 and CD103 MLN DCs were cultured were isolated from Foxp3-GFP mice and activated in the pres- overnight either alone or in the presence of LPS or an agonist ence of CD103 DCs and anti-CD3 . This led to the generation anti-CD40 mAb. Cytokines in the supernatants were quanti- of a similar proportion of Foxp3 T cells as in the antigen- tated by cytometric bead array, whereas levels of cytokine specifi c system. Again, this induction of Foxp3 could be inhib- mRNA in the DCs were determined by quantitative PCR. ited by the inclusion of anti – TGF-  or RA receptor inhibitors CD103 DCs produced higher levels of TNF-  regardless of and could be enhanced by the inclusion of rhTGF-  and RA whether DCs were left unstimulated or activated with LPS or (Fig. S5). Foxp3 T cells generated in the presence of CD103 anti-CD40. However, treatment with LPS did increase the DCs and rhTGF-  were then sorted on the basis of GFP ex- levels of TNF-  present in the supernatants of CD103 DC pression and their ability to suppress the proliferation of naive (Fig. 5 A). LPS treatment also led to the enhanced production T cells compared with that of freshly isolated Foxp3 T reg cells. of IL-6 by CD103 DCs (Fig. 5 A). Furthermore, CD103 Foxp3 T cells generated in this way were able to suppress the DCs produce substantially higher levels of IL-23p19 mRNA proliferation of naive T cells, indicating that they represent a true than CD103 DCs after stimulation through CD40. Only a regulatory population (Fig. S5). comparatively moderate increase in the expression of IL-12p40 was observed (Fig. 5 B). Consistent with their increased pro- CD103 DCs produce proinfl ammatory cytokines duction of TNF-  and IL-6 in response to LPS stimulation, We have demonstrated a clear role for MLN CD103 DCs in CD103 DCs also expressed slightly higher levels of Toll-like the induction of Foxp3 and regulatory function in naive T cells. receptor (TLR)4 mRNA than CD103 DCs. Further evidence JEM VOL. 204, August 6, 2007 1761 for in vitro stimulation of T cells was clone 145-2C11 (BD Biosciences). for the more proinfl ammatory phenotype of CD103 DCs Anti – mouse CD4 (L3T4), anti – mouse  7 integrin (M293), and anti – mouse included the enhanced expression of tlr2 and tbx21 , which 4  7 (DATK32; all from BD Biosciences); anti – mouse Foxp3 (FJK-16S; encodes Tbet (Fig. 5 C). eBioscience); and biotinylated or FITC-labeled anti-clonotypic TCR (KJ-1.26) The data presented here raise the question of why the were used for analysis of T cell populations. functional properties of CD103 and CD103 DCs diff er so dramatically. It is likely that the CD103 DC subset has arrived Adoptive transfer and oral feeding of antigen. CD4 T cells were isolated from splenic single cell suspensions from DO11.10-SCID mice by in the MLNs from the intestine and, consequently, its journey labeling with magnetic anti-CD4 beads (Miltenyi Biotec) and separating the through the immunosuppressive intestinal environment may cell populations using LS MACS columns according to the manufacturer ’ s have left an impact on its function. We hypothesize that the instructions. 2.5  10 cells were injected i.v. into Ly9.2 BALB/c recipients. interaction between CD103 on DCs and E-cadherin on After 24 h, drinking water was supplemented with 20 mg/ml Grade VI OVA epithelial cells may tether the DCs close to the intestinal epi- (Sigma-Aldrich) as described previously ( 13 ). Antigen was administered to thelium. This would allow them to be conditioned, perhaps by intact DO11.10 SCID mice in the same way. At the time points indicated in the relevant fi gure legends, organs were harvested and the presence of epithelial cell – derived factors, to go on to drive regulatory- Foxp3 T cells was determined by FACS. type responses in the draining LNs. An example of this is the conditioning of DCs by thymic stromal lymphopoietin high Preparation and culture of CD11c subsets. MLNs from BALB/c produced by intestinal epithelial cells ( 24 ). A key feature of gut mice were cut into small fragments and incubated in RPMI with 10% FCS, conditioning in our studies is the capacity of CD103 DCs to 15 mM Hepes, and 1 mg/ml collagenase type VIII (Sigma-Aldrich) for produce or activate TGF-  and to provide RA, both essential 40 min at 37 ° C in a shaking incubator. After adding EDTA for an addi- cofactors for the emergence of Foxp3 T cells. In this way, tional 5 min, the solution was fi ltered through a nylon mesh and washed in HBSS with 0.1% BSA. Cell suspensions were incubated with an anti-FcR gut-derived DCs respond to environmental cues to promote antibody (clone 24G2; eBioscience), followed by anti-CD11c MACS beads noninfl ammatory immune-suppressive responses that may con- (Miltenyi Biotec). CD11c cells were positively selected on an LS MACS tribute to intestinal homeostasis. On the other hand, CD103 column according to the manufacturer ’ s instructions (Miltenyi Biotec). DCs may have arrived in the LNs through the blood and Cells were labeled with anti-CD3e, anti-CD103, anti-CD11c, and 7-AAD therefore escaped gut conditioning. This would leave them and sorted on a MoFlo sorter (DakoCytomation) to 98% purity. For anal- ysis of cytokine production, DC subsets were cultured overnight in DMEM poised to respond to infl ammatory stimuli through the pro- supplemented with 10% FCS, 2 mM L-glutamine, and 100 U of penicillin duction of proinfl ammatory cytokines. and streptomycin. 1 ug/ml LPS (Sigma-Aldrich) or 10 ug/ml anti – mouse Our results demonstrate the presence of two functionally CD40 was added to some wells. Supernatants were analyzed for cytokines using distinct DC subsets present in the MLNs of normal mice. a Cytometric Bead Array mouse infl ammation kit according to the manu- CD103 DCs are poised to deal with pathogens through the facturer ’ s instructions (BD Biosciences). Cells were prepared for quantitative production of proinfl ammatory cytokines, whereas CD103 PCR analysis as described below. DCs induce Foxp3 T reg cells, suggesting a mechanism by which tolerance to harmless non – self-antigen may be main- Preparation of T cell populations. CD4 T cells were isolated from splenic single cell suspensions from DO11.10 SCID mice by labeling with tained. The ability to induce or expand populations of T reg magnetic anti-CD4 beads (Miltenyi Biotec) and separating the cell popula- cells in culture increases the likelihood that they could be used tions using LS MACS columns according to the manufacturer ’ s instructions. therapeutically, for example, in the treatment of infl ammatory The positively selected CD4 T cells were labeled with 10  M CFDA SE bowel disease. Identifi cation of the key factors involved in the using a Vybrant CFDA SE Cell Tracer kit (Invitrogen). CD4 CD25 T cells induction of T reg cells by CD103 DCs suggests ways in which were isolated from the spleens of DO11.10 BALB/c mice. Single cell sus- pensions were depleted of CD8 , MHC class II , Mac-1 , and B220 cells this process can be made more effi cient. In this regard, the by negative selection using sheep anti – rat-coated Dynabeads (Dynal) as de- fi nding that RA enhances the TGF-  – mediated induction of scribed previously ( 26 ). The resulting CD4-enriched cells were stained with Foxp3 may have important therapeutic implications. biotinylated anti – mouse CD25, followed by Straptavidin-coated MACS beads and sorted by AutoMACS (Miltenyi Biotec). MATERIALS AND METHODS Mice. BALB/c, DO11.10 BALB/c, and DO11.10 SCID TCR transgenic 5 T cell diff erentiation assay. 2  10 T cells were cultured together with mice were maintained in microisolator cages in a specifi c pathogen-free animal 4 5 high 2.5  10 – 10 of the sorted CD11c subsets and 0.2  g/ml OVA peptide facility at the University of Oxford. Experiments were performed according in complete RPMI (10% FCS, 2 mM L-glutamine, 0.05 mM 2-mercapto- to the UK Animals (Scientifi c Procedures) Act of 1986. Foxp3 eGFP re- ethanol, and 100 U of penicillin and streptomycin) for 4 d. Cultures were GFP porter mice (Foxp3 ) were originally obtained from M. Oukka (Harvard supplemented with fresh medium containing 100 U/ml recombinant human Medical School, Boston, MA) ( 25 ) and were maintained in the NIH ’ s animal 5 IL-2 (PeproTech) and incubated for an additional 2 – 3 d. Alternatively, 10 facilities under specifi c pathogen-free conditions.   4 CD4 eGFP T cells were cultured with 10 purifi ed CD103 or CD103 MLN DCs and 1  g/ml of soluble anti-CD3 for 5 d. 5 ng/ml of recombi- Antibodies. The following antibodies were used for cell purifi cation: anti – nant human IL-2 was added to cultures every other day beginning on day 2 mouse CD8 (clone YTS169), MHC class II (TIB120), Mac-1 (M1/70), as described previously ( 25 ). On day 5, cells were stained with PE-Cy7 – and B220 (RA3-6B2; all purifi ed from hybridoma supernatant by affi nity conjugated anti-CD4 (RM4-5), and Foxp3 cells were detected by eGFP chromatography); and biotinylated anti – mouse CD25 (7D4), anti – mouse expression. Recombinant human TGF-  1 (R & D Systems), anti – mouse CD11c (clone HL3), anti – mouse CD103 (M290), and anti – mouse CD3e TGF-  1/2, all-trans RA (Sigma-Aldrich), or the RA receptor inhibitors, (145-2C11; all from BD Biosciences). For use in in vitro cultures, anti – mouse LE540 (Wako Chemicals USA) and LE135 (Tocris Bioscience), were added TGF-  1/2 (1D11.16.8) and anti – mouse CD40 (FGK45) were purifi ed from to culture wells in some cases. Concentrations are indicated in the relevant hybridoma supernatant by affi nity chromatography. Anti – mouse CD3 used fi gure legends. 1762 CD103 MLN DCS INDUCE FOXP3 T REG CELLS | Coombes et al. BRIEF DEFINITIVE REPORT Suppression assay. The ability of Foxp3 T cells generated in the presence 4 . Thorstenson , K.M. , and A. Khoruts . 2001 . Generation of anergic CD25 of CD103 DCs to suppress T cell proliferation was determined as described CD4 T cells with immunoregulatory potential in vivo following induction of peripheral tolerance with intravenous or oral antigen. previously ( 27 ). In brief, sorted CD4 GFP T reg cells were cultured with 5 4   5 J. Immunol. 167 : 188 – 195 . 10 freshly isolated CD4 GFP T cells, 10 antigen-presenting cells, and 5 . Chen , W. , W. Jin , N. Hardegen , K.J. Lei , L. Li , N. Marinos , G. McGrady , 0.5  g/ml anti-CD3 (145-2C11; BD Biosciences). Antigen-presenting cells and S.M. Wahl . 2003 . Conversion of peripheral CD4 CD25  naive were prepared by depleting splenocytes of CD90 cells by isolation kit and T cells to CD4 CD25 regulatory T cells by TGF-  induction of tran- autoMACs (Miltenyi Biotec), followed by irradiation. Cultures were incu- scription factor Foxp3. J. Exp. Med. 198 : 1875 – 1886 . bated for 72 h, with the inclusion of 1  Ci/well [ H]TdR (MP Biomedicals) 6 . Cobbold , S.P. , R. Castejon , E. Adams , D. Zelenika , L. Graca , S. for the fi nal 8 h. Humm , and H. Waldmann . 2004 . Induction of foxP3+ regulatory T cells in the periphery of T cell receptor transgenic mice tolerized to Quantitation of gene expression using real-time PCR. Total RNA was transplants. J. Immunol. 172 : 6003 – 6010 . purifi ed from sorted cells using RNAeasy kits (QIAGEN). cDNA synthesis 7 . Fantini , M.C. , C. Becker , G. Monteleone , F. Pallone , P.R. Galle , and was performed using Superscript III reverse transcriptase and Oligo dT primers M.F. Neurath . 2004 . Cutting edge: TGF-beta induces a regulatory phe- (both from Invitrogen). Quantitative PCR reactions were performed either notype in CD4+CD25  T cells through Foxp3 induction and down- using quantitect Primer Assays with SYBR green PCR mastermix (QIAGEN) regulation of Smad7. J. Immunol. 172 : 5149 – 5153 . 8 . Fu , S. , N. Zhang , A.C. Yopp , D. Chen , M. Mao , H. Zhang , Y. Ding , or the following reagents: IL-23 p19 primer AGCGGGACATATGAATC- and J.S. Bromberg . 2004 . TGF-beta induces Foxp3 T-regulatory cells TACTAAGAGA, GTCCTAGTAGGGAGGTGTGAAGTTG, and FAM/ from CD4 CD25- precursors. Am. J. Transplant. 4 : 1614 – 1627 . TAMRA-labeled probe CCAGTTCTGCTTGCAAAGGATCCGC; IL-12 9 . Rao , P.E. , A.L. Petrone , and P.D. Ponath . 2005 . Diff erentiation and p40 primers GACCATCACTGTCAAAGAGTTTCTAGAT, AGGAAA- expansion of T cells with regulatory function from human peripheral GTCTTGTTTTTGAAATTTTTTAA, and FAM/TAMRA-labeled probe lymphocytes by stimulation in the presence of TGF- { beta } . J. Immunol. CCACTCACATCTGCTGCTCCACAAGAAG; HPRT primers GACCG- 174 : 1446 – 1455 . GTCCCGTCATGC and TCATAACCTGGTTCATCATCGC; and VIC/ 10 . Wan , Y.Y. , and R.A. Flavell . 2005 . Identifying Foxp3-expressing sup- TAMRA-labeled probe ACCCGCAGTCCCAGCGTCGTC. pressor T cells with a bicistronic reporter. Proc. Natl. Acad. Sci. USA . cDNA samples were assayed in triplicate using a Chromo4 detection 102 : 5126 – 5131 . system (MJ Research), and gene expression levels for each individual sample 11 . Chirdo , F.G. , O.R. Millington , H. Beacock-Sharp , and A.M. Mowat . were normalized to HPRT. Mean relative gene expression was determined 2005 . Immunomodulatory dendritic cells in intestinal lamina propria. C(t) and the diff erences were calculated using the 2 method ( 28 ). Eur. J. Immunol. 35 : 1831 – 1840 . 12 . Johansson , C. , and B.L. Kelsall . 2005 . Phenotype and function of intes- Statistics. An unpaired student ’ s t test was performed in Prism (Graphpad) tinal dendritic cells. Semin. Immunol. 17 : 284 – 294 . in all cases. Where appropriate, mean SD is represented on graphs. 13 . Zhang , X. , L. Izikson , L. Liu , and H.L. Weiner . 2001 . Activation of CD25()CD4() regulatory T cells by oral antigen administration. J. Immunol. 167 : 4245 – 4253 . Online supplemental material. Fig. S1 shows the generation of Foxp3 14 . Bilsborough , J. , T.C. George , A. Norment , and J.L. Viney . 2003 . T cells in the GALT. Foxp3 T cells are maintained in the MLN of DO11.10 Mucosal CD8alpha DC, with a plasmacytoid phenotype, induce dif- SCID mice after the removal of antigen and can be generated after the transfer ferentiation and support function of T cells with regulatory properties. of DO11.10 SCID T cells to normal mice. Fig. S2 shows the accumulation Immunology . 108 : 481 – 492 . and proliferation of CD4 T cells in the presence of CD103 and CD103 15 . Worbs , T. , U. Bode , S. Yan , M.W. Hoff mann , G. Hintzen , G. DCs. Fig. S3 shows that CD103 DCs can acquire and present orally admin- Bernhardt , R. Forster , and O. Pabst . 2006 . Oral tolerance originates in istered antigen. Fig. S4 shows that Foxp3 T cells continue to accumulate in the intestinal immune system and relies on antigen carriage by dendritic culture without the continued provision of TGF-  and RA. Fig. S5 shows that cells. J. Exp. Med. 203 : 519 – 527 . induction of Foxp3 by CD103 DCs is inhibited by RA receptor inhibitors, 16 . Annacker , O. , J.L. Coombes , V. Malmstrom , H.H. Uhlig , T. Bourne , and that Foxp3 T cells generated in vitro can suppress T cell proliferation. B. Johansson-Lindbom , W.W. Agace , C.M. Parker , and F. Powrie . The online supplemental material can be found at http://www.jem.org/cgi/ 2005 . Essential role for CD103 in the T cell – mediated regulation of content/full/jem.20070590/DC1. experimental colitis. J. Exp. Med. 202 : 1051 – 1061 . 17 . Kilshaw , P.J. 1993 . Expression of the mucosal T cell integrin alpha M290 beta 7 by a major subpopulation of dendritic cells in mice. Eur. J. We would like to thank Nigel Rust for cell sorting and the staff of our animal Immunol. 23 : 3365 – 3368 . facility for care of the mice. 18 . Brenan , M. , and M. Puklavec . 1992 . The MRC OX-62 antigen: a use- This study was funded by the Wellcome Trust and the European Union (Euro- ful marker in the purifi cation of rat veiled cells with the biochemical Thymaide FP6 Integrated Project; LSHB-CT-2003-503410), with J.L. Coombes and properties of an integrin. J. Exp. Med. 175 : 1457 – 1465 . K.R.R. Siddiqui in receipt of Medical Research Council studentships. 19 . Johansson-Lindbom , B. , M. Svensson , O. Pabst , C. Palmqvist , G. The authors have no confl icting fi nancial interests. Marquez , R. Forster , and W.W. Agace . 2005 . Functional specialization of gut CD103 dendritic cells in the regulation of tissue-selective T cell Submitted: 23 March 2007 homing. J. Exp. Med. 202 : 1063 – 1073 . Accepted: 25 June 2007 20 . Marie , J.C. , J.J. Letterio , M. Gavin , and A.Y. Rudensky . 2005 . TGF- 1 maintains suppressor function and Foxp3 expression in CD4 CD25 regulatory T cells. J. Exp. Med. 201 : 1061 – 1067 . REFERENCES 1 . Coombes , J.L. , N.J. Robinson , K.J. Maloy , H.H. Uhlig , and F. Powrie . 21 . Annes , J.P. , J.S. Munger , and D.B. Rifkin . 2003 . Making sense of latent TGFbeta activation. J. Cell Sci. 116 : 217 – 224 . 2005 . Regulatory T cells and intestinal homeostasis. Immunol. Rev. 204 : 184 – 194 . 22 . Iwata , M. , A. Hirakiyama , Y. Eshima , H. Kagechika , C. Kato , and S.Y. Song . 2004 . Retinoic acid imprints gut-homing specifi city on T cells. 2 . Kretschmer , K. , I. Apostolou , D. Hawiger , K. Khazaie , M.C. Nussenzweig , and H. von Boehmer . 2005 . Inducing and expanding regulatory T cell Immunity . 21 : 527 – 538 . 23 . Gavin , M.A. , T.R. Torgerson , E. Houston , P. DeRoos , W.Y. Ho , A. populations by foreign antigen. Nat. Immunol. 6 : 1219 – 1227 . 3 . Sun , J.B. , S. Raghavan , A. Sjoling , S. Lundin , and J. Holmgren . 2006 . Stray-Pedersen , E.L. Ocheltree , P.D. Greenberg , H.D. Ochs , and A.Y. Rudensky . 2006 . Single-cell analysis of normal and FOXP3-mutant hu- Oral tolerance induction with antigen conjugated to cholera toxin B subunit generates both Foxp3CD25 and Foxp3  CD25  CD4 man T cells: FOXP3 expression without regulatory T cell development. Proc. Natl. Acad. Sci. USA . 103 : 6659 – 6664 . regulatory T cells. J. Immunol. 177 : 7634 – 7644 . JEM VOL. 204, August 6, 2007 1763 24 . Rimoldi , M. , M. Chieppa , V. Salucci , F. Avogadri , A. Sonzogni , G.M. 26 . Powrie , F. , M.W. Leach , S. Mauze , L.B. Caddle , and R.L. Coff man . 1993 . Sampietro , A. Nespoli , G. Viale , P. Allavena , and M. Rescigno . 2005 . Phenotypically distinct subsets of CD4 T cells induce or protect from chronic Intestinal immune homeostasis is regulated by the crosstalk between epi- intestinal infl ammation in C. B-17 scid mice. Int. Immunol. 5 : 1461 – 1471 . thelial cells and dendritic cells. Nat. Immunol. 6 : 507 – 514 . 27 . Thornton , A.M. , and E.M. Shevach . 1998 . CD4 CD25 immuno- 25 . Bettelli , E. , Y. Carrier , W. Gao , T. Korn , T.B. Strom , M. Oukka , H.L. regulatory T cells suppress polyclonal T cell activation in vitro by inhibiting Weiner , and V.K. Kuchroo . 2006 . Reciprocal developmental pathways interleukin 2 production. J. Exp. Med. 188 : 287 – 296 . for the generation of pathogenic eff ector TH17 and regulatory T cells. 28 . Pfaffl , M.W. 2001 . A new mathematical model for relative quantifi ca- Nature . 441 : 235 – 238 . tion in real-time RT-PCR. Nucleic Acids Res. 29 : e45 . 1764 CD103 MLN DCS INDUCE FOXP3 T REG CELLS | Coombes et al.

Journal

The Journal of Experimental Medicine – Pubmed Central

Published: Aug 6, 2007

There are no references for this article.