Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Pro-inflammatory Cytokine Tumor Necrosis Factor-α Induces Bone Morphogenetic Protein-2 in Chondrocytes via mRNA Stabilization and Transcriptional Up-regulation *

Pro-inflammatory Cytokine Tumor Necrosis Factor-α Induces Bone Morphogenetic Protein-2 in... THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 37, pp. 27229 –27241, September 15, 2006 © 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Pro-inflammatory Cytokine Tumor Necrosis Factor- Induces Bone Morphogenetic Protein-2 in Chondrocytes via mRNA Stabilization and Transcriptional Up-regulation Received for publication, April 10, 2006, and in revised form, June 12, 2006 Published, JBC Papers in Press, July 11, 2006, DOI 10.1074/jbc.M603385200 ‡1 ‡ ‡ ‡ § ‡ ‡ Naoshi Fukui , Yasuko Ikeda , Toshiyuki Ohnuki , Atsuhiko Hikita , Sakae Tanaka , Shoji Yamane , Ryuji Suzuki , ¶ ‡ Linda J. Sandell , and Takahiro Ochi From the Department of Pathomechanisms, Clinical Research Center, National Hospital Organization Sagamihara Hospital, Sagamihara, Kanagawa 228-8522, Japan, the Department of Orthopaedic Surgery, Faculty of Medicine, the University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan, and the Department of Orthopaedic Surgery, Washington University School of Medicine, St. Louis, Missouri 63110 In articular chondrocytes, the inflammatory cytokine tumor their ability to induce ectopic bone formation (1). Molecular necrosis factor- (TNF-) induces the expression of bone morpho- cloning of the BMPs later revealed that the proteins belong to genetic protein-2 (BMP-2), a growth factor known to be involved in the transforming growth factor- superfamily (2). The evolu- the induction of cartilage and bone. A study was performed to clar- tionary conservation of BMPs is remarkable. For example, the ify the mechanism(s) underlying the induction of BMP-2 in chon- amino acid sequence of Drosophila protein decapentaplegic drogenic ATDC5 cells and primary cultured adult human articular (dpp)is 75% identical to human BMP-2 and is functionally chondrocytes. In ATDC5 cells, the endogenous BMP-2 expression interchangeable with recombinant human protein as to its abil- was consistently low throughout the process of chondrogenic dif- ity to ectopically induce bone formation in rodents (3). ferentiation, and TNF- induced BMP-2 expression only after the BMPs are critical in embryonal development and postnatal cells acquired the chondrogenic phenotype. The results of nuclear growth. Among them, BMP-2 plays a vital role in fetal develop- run-off assay and cycloheximide treatment consistently indicated ment. Mice lacking functional BMP-2 gene die during early that ATDC5 cells acquire the capacity to synthesize BMP-2 mRNA embryogenesis due to malformation of the proamniotic canal in the nuclei during the differentiation process. In an attempt to and a defect in cardiac development (4). Subsequent studies explain the discrepancy between the active nuclear mRNA synthe- have shown that the growth factor is involved in various aspects sis and the observed low expression level in differentiated ATDC5 of development such as skin and hair formation, neural cell cells, the stability of BMP-2 mRNA was evaluated, and the cells differentiation, and cartilage and bone formation (5). The role were found to regulate the expression of BMP-2 at the post-tran- of BMP-2 in skeletal development is particularly crucial. At the scriptional level. Human chondrocytes were confirmed to have a early stage of embryogenesis, BMP-2 is expressed in specific similar post-transcriptional regulation. The result of 3-rapid areas of limb buds to form prechondrogenic condensations, amplification of cDNA end revealed that both human and mouse and it later promotes cellular differentiation into chondrocytes BMP-2 mRNAs contain multiple pentameric AUUUA motifs in a (6). conserved manner in the 3-untranslated regions, and transient Besides its roles in developmental and growth processes, transfection experiments demonstrated that TNF- increases the BMP-2 is also expressed in postnatal animals and is often asso- stability of BMP-2 mRNA through the pentameric motifs. Further ciated with various pathologies. The growth factor is expressed experiments revealed that TNF- modulates mRNA stability via in the process of bone healing where it regulates cellular differ- p38 signal transduction pathway, whereas the cytokine also aug- entiation, proliferation, and matrix production (7, 8). Various mented the expression of BMP-2 through transcriptional up-regu- tumors have been found to express BMP-2. Indeed, this protein lation via the transcriptional factor NF-B. is known to exert diverse effects on tumor cells, ranging from the facilitation of tumor growth to the induction of cellular apoptosis (9–11). We and other investigators have found that Bone morphogenetic proteins (BMPs) are a group of BMP-2 is expressed at high levels in arthritic joints by both secreted signaling proteins that were originally identified by chondrocytes and synovial cells, possibly promoting chondro- cyte anabolism and osteophyte formation (12–16). Because of its potent biological actions, the expression of * This work was supported in part by Grants-in-aid from the Japan Society for the Promotion of Science (Grant 15390467), the Ministry of Education, Cul- BMP-2 must be strictly regulated in vivo. In fact, BMP-2 is ture, Sports, Science and Technology of Japan (Grant 16659416), the Mitsui expressed in a highly tissue- and stage-specific pattern during Life Social Welfare Foundation, the Nakatomi Foundation. The costs of embryogenesis (17, 18), and either enhancement or inhibition publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement”in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. To whom correspondence should be addressed. Tel.: 81-42-742-8311; Fax: nuclear factor-B; IB, inhibitor of B; PDTC, pyrrolidine dithiocarbam- 81-42-742-7990; E-mail: [email protected]. ate; MAP, mitogen-activated protein; MKK, mitogen-activated protein The abbreviations used are: BMP, bone morphogenetic protein; UTR, kinase kinase; CHX, cycloheximide; ActD, actinomycin D; ERK, extracellular untranslated region; TNF, tumor necrosis factor; GAPDH, glyceroaldehyde- signal-regulated kinase; JNK, c-Jun N-terminal kinase; RNAi, RNA interfer- 3-phsophate dehydrogenase; ARE, AU-rich element; nt, nucleotide; NF-B, ence; siRNA, small interfering RNA. SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27229 This is an Open Access article under the CC BY license. Induction Mechanisms of BMP-2 by TNF- in Chondrocytes of its activity is know to cause a significant disturbance in skel- media containing 10% fetal bovine serum, penicillin, strepto- etal formation (19, 20). However, although the function of mycin, and 25 g/ml ascorbic acid (Sigma). For cartilage BMP-2 has been extensively studied, less is known about the explants, full thickness articular cartilage was aseptically mechanisms that regulate production of the growth factor. To obtained from metacarpophalangeal joints of adult bovine ani- date, several studies have shown that the expression of the gene mals and punched out into discs 3 mm in diameter. The is regulated at the transcriptional level. Retinoic acid induces explants were cultured in DMEM (Invitrogen) containing 10% BMP-2 expression through transcriptional activation in osteo- fetal bovine serum, penicillin, streptomycin, and 25 g/ml blastic cells, possibly via retinoic acid receptor  (21–23). ascorbic acid. NF-B has been shown to regulate the transcriptional activity For the inhibitors used in the study, cycloheximide, actino- of BMP-2 in growth plate chondrocytes during endochondral mycin D, pyrrolidine dithiocarbamate, ionomycin, and wort- bone development (24). The transcriptional activity might be mannin were purchased from Sigma, U0126 and SP600125 enhanced by estrogen (25) and, interestingly, by BMP-2 itself were from Biomol (Plymouth Meeting, PA), and SB202190, (26). Thus, transcriptional regulation is considered to play an SB202474, SB203580, PD98059, and GF109203X were important role in expression of the protein. obtained from Calbiochem. Recombinant mouse and human On the other hand, BMP-2 expression could also be regu- TNF- were purchased from Chemicon International lated at the post-transcriptional level. Computer analyses have (Temecula, CA); recombinant mouse noggin was from R&D revealed that the proximal part of the 3-untranslated region Systems (Minneapolis, MN). (3-UTR) of BMP-2 gene is highly conserved across a wide Real-time Quantitative PCR Analysis—Total RNA was range of species (21, 27). That fact suggests the involvement of extracted from the cells using the RNeasy kit (Qiagen, Valencia, post-transcriptional regulation for the expression of BMP-2, CA) with DNaseI (Qiagen) treatment, and 1 g of total RNA because 3-UTRs of mRNA often contain sequences to regulate was employed to synthesize cDNA using avian myeloblastosis post-transcriptional events (28, 29). In fact, a recent report has virus reverse transcriptase (Roche Diagnostics). The cDNA was shown that degradation of the gene transcripts could be regu- then used for real-time quantitative PCR on a LightCycler lated by the region (27). However, details of the regulatory (Roche Diagnostics). For mouse BMP-2 and glyceraldehyde-3- mechanism are not yet known, and the biological significance phosphate dehydrogenase (GAPDH) genes, respective pairs of of transcriptional and post-transcriptional regulation has yet to gene-specific hybridization probes labeled with fluorescein be established. (Flu) and LightCycler-Red640 (LC640) dyes, respectively, were We and others recently reported that the pro-inflammatory used to monitor the amount of PCR product. The primer cytokines interleukin-1 and TNF- induce BMP-2 expression sequences were 5-TGCACCAAGATGAACACAG-3 and 5- in adult articular chondrocytes and a chondrosarcoma cell line GCTGTTTGTGTTTGGCTTG-3 for BMP-2, and 5-TGAA- (12, 30). Similar BMP-2 induction by those cytokines is also CGGGAAGCTCACTGG-3 and 5-TCCACCACCCTGTTG- observed in synovial cells (14, 31) and could be a widespread CTGTA-3 for GAPDH. The probe sequences were 5-TCGT- event in arthritic joints. In this study, the mechanism of BMP-2 TTGTGGAGCGGATGTCCTTTT/Flu/-3 and 5-/LC640/C- induction by TNF- was studied in chondrogenic ATDC5 cells ATCATGTCCAAAAGTCACTAGCAATGGC-3 for BMP-2, and primary cultured adult human articular chondrocytes. Our and 5-CTGAGGACCAGGTTGTCTCCTGCGA/Flu/-3 and results indicated that both transcriptional and post-transcrip- 5-/LC640/TTCAACAGCAACTCCCACTCTTCCACC-3 tional regulation are involved in the induction of BMP-2. for GAPDH (Nihon Gene Research Laboratory, Sendai, Japan). PCR of human BMP-2, RelA, Ib, and GAPDH genes was EXPERIMENTAL PROCEDURES performed using the LightCycler FastStart DNA Master SYBR Cell Culture—ATDC5 cells were obtained from the RIKEN Green I (Roche Diagnostics), and the amount of PCR product cell bank (Tsukuba, Japan) and cultured in a 1:1 mixture of was monitored by the intensity of fluorescence from the dye Dulbecco’s modified Eagle’s medium and Ham’s F-12 medium bound to the product. The primer sequences were 5-CCCCG- (DMEM/F-12, Invitrogen) containing 5% fetal bovine serum GGGTATCACGCCTTT-3 and 5-GCGACACCCACAACC- (fetal bovine serum, Invitrogen), 50 units/ml penicillin, 50 CTCCA-3 for BMP-2, 5-CAGAGTTACCTACCAGGGCT- g/ml streptomycin, 10 g/ml human transferrin (Roche ATTC-3 and 5-TCTGACTCTGTGTCATAGCTCTCC-3 Molecular Biochemicals, Indianapolis, IN), and 3  10 M for RelA, 5-ACGAGCTTGTAGGAAAGGACTG-3 and 5- sodium selenite (Sigma) (32). To induce chondrogenic differ- GCTGCTCTTCTATAGGAACTTGGA-3 for IB, and 5- entiation, bovine insulin (Sigma) was added to the media at a CAGGGACTCCCCAGCAGT-3 and 5-GGCATTGCCCTC- concentration of 10 g/ml. Human chondrocytes were AACGACCA-3 for GAPDH. obtained from 29 osteoarthritic knee joints in 28 patients at the The PCR protocol was the same for all genes, i.e. 95 °C for 10 time of joint replacement surgery. The material collection was min to activate Taq polymerase, then 40 cycles of 95 °C for 10 s, performed under the approval of institutional review boards, 60 °C for 15 s, and 72 °C for 6 s. When SYBR green dye was used and informed consent in writing was obtained from all patients. to monitor PCR, melting curves were routinely recorded to ver- Articular chondrocytes were liberated from cartilage tissue by ify the singularity of the PCR product. In each sample, the level sequential enzymic digestion of 0.5% Pronase (Calbiochem) of cDNA was normalized by the expression of GAPDH. and 0.025% collagenase P (Roche Diagnostics, Basel, Switzer- Nuclear Run-off Assay—ATDC5 cells were seeded to 225- 2 3 2 land) (33). Isolated cells were plated onto 6- or 12-well plates at cm flasks at a density of 2  10 /cm and incubated under the 5 2 a density of 2  10 cells/cm and cultured in DMEM/F-12 aforementioned conditions. Soon after reaching confluency or 27230 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes following 15 days of culture in the insulin-containing media, cloned into the KpnI and EcoRI sites of pcDNA3.1/Zeo(). the cells were incubated for another 48 h in the presence or cDNA for the entire 3-UTR of mouse BMP-2 was generated absence of 20 ng/ml of recombinant mouse TNF-. The cells by PCR and subcloned into pCR2.1 vector. Using the vector were then harvested, lysed in 4 ml of the Nonidet P-40 buffer as a template, specific regions of the 3-UTR were amplified (10 mM Tris, pH 7.4, 10 mM NaCl, 3 mM MgCl , and 0.5% Non- by PCR and ligated into pcDNA3.1/Zeo() between the idet P-40). The nuclei thus obtained were resuspended in glyc- EcoRI and XbaI sites. Thus, either the entire or a specific erol storage buffer (40% glycerol, 50 mM Tris, pH 8.3, 5 mM region of mouse BMP-2 3-UTR was placed between the MgCl , and 0.1 mM EDTA) and immediately stored in liquid luciferase gene and the BGH polyadenylation site of the vec- nitrogen until use. tor. All constructs were analyzed by restriction mapping and RNA transcripts were labeled by incubation of the nuclei in a DNA sequencing. reaction buffer (5 mM Tris, pH 8.0, 2.5 mM MgCl , 150 mM KCl, Transient Transfection Assays—Transient transfection 0.5 mM ATP, 0.5 mM CTP, 0.5 mM GTP, and 1 mM dithiothre- experiments were performed in differentiated ATDC5 cells itol) containing 100 Ci of [- P]UTP (10 mCi/ml, GE Health- using each of the prepared luciferase vectors and a phRL-TK care, Piscataway, NJ) for 30 min at 30 °C. Nuclei from 1–3 10 vector (Promega). The cells were plated on 12-well plates, and cells were used for each transcript reaction. The reaction mix- differentiation was induced as previously described. DNA ture was treated with DNase I and proteinase K, and RNA was transfection was carried out using the SuperFect transfection isolated by phenol-chloroform extraction and ethanol precipi- reagent (Qiagen). For each well, 0.5 g of the luciferase vector tation. pCR2.1 vectors (Invitrogen) containing cDNAs for the and 1.5 g of phRL-TK vector were mixed with 4 l of Super- entire mouse BMP-2 3-UTR, partial mouse GAPDH, and full- Fect reagent and 75 l of DMEM/F-12 medium, and the mix- length mouse -actin were prepared respectively, together with ture was incubated for 10 min at room temperature. The rea- an empty vector. Five micrograms of each plasmid was linear- gent mixture was combined with 400 l of the complete culture ized by HindIII digestion, denatured with 0.2 M NaOH, blotted medium, which was transferred to the washed cell monolayer in onto nylon membranes (Hybond-N, GE Healthcare), and each well. After incubation for 14–18 h, the medium contain- immobilized by UV-cross-linking. The membrane was pre-hy- ing transfection reagent was replaced with the complete bridized with ULTRAhyb (Ambion, Austin, TX), and hybrid- medium. For some experiments, recombinant mouse TNF- ization was then allowed to proceed at 42 °C for 14–16 h. The was added to the medium at a concentration of 10 ng/ml. The membranes were washed twice in 2 SSC at 65 °C, treated with transfected cells were cultured for 48 h and then lysed in 100 l RNase A, and washed again in 2  SSC at 37 °C. The analysis of reporter lysis buffer (Promega). Luciferase activity was was performed by phosphorimaging using a Typhoon 9410 (GE assayed on a luminometer (JNR AB-2100, Atto, Tokyo, Japan) Healthcare) with ImageQuaNT software (GE Healthcare). using a Dual-Glo luciferase assay system (Promega). All trans- 3-Rapid Amplification of cDNA Ends—The 3-end of mouse fection experiments were repeated at least three times in BMP-2 gene was determined using a GeneRacer kit (Invitro- duplicate. gen) following the manufacturer’s protocol. In brief, total RNA Preparation of Adenovirus Vector and Gene Transduction— was extracted from bone tissues of C57BL/6 mice, and cDNA The recombinant adenovirus vector carrying constitutively was synthesized using an oligo(dT)-adapter primer provided by active MAP kinase kinase 6 (MKK6) gene under the control of the kit. The first PCR was performed using 1 g of the synthe- chicken -actin promoter and cytomegalovirus IE enhancer sized cDNA as a template with mGSP1 (5-AGAAAACGTCT- was generated by the DNA-terminal protein complex method CGCCACCCTCC-3) and 3 primer for the adaptor. The PCR (34). The adenovirus carrying -galactosidase was obtained product containing the 3-end of human BMP-2 mRNA was from BD Biosciences (San Jose, CA). Titers of the adenovirus obtained by using a nested PCR using the first PCR product as a were determined by an Adeno-X Rapid Titer kit (BD Bio- template, and mGSP2 (5-TACATTTGCCTGACACGCA- sciences) following the manufacturer’s protocol. The titer was GCA-3) and the 3-nested primer provided by the kit as prim- represented by the multiplicity of infection. ers. The PCR product was subcloned into pCR2.1 vector and To infect the adenovirus vectors in cultured human chon- subjected to DNA sequencing. The 3-rapid amplification of drocytes, the culture media in each well of 6- or 12-well plates cDNA ends of human BMP-2 mRNA was performed in the was replaced by 1.0 or 0.5 ml of serum-free DMEM/F-12 same manner, using total RNA from primary cultured chon- medium containing the adenoviruses at the indicated multi- drocytes to generate cDNA, and an external primer hGSP1 plicity of infection. The cells were incubated for 2 h under nor- (5-TGGCACGTCCGGGTTACCATGTTCATTA-3) and an mal culture conditions, after which 5 times the volume of the internal primer hGSP2 (5-TGAAGCCCTTACAGGCCAAA- complete medium was added to each well. GGACCACA-3) for the first and nested PCR, respectively. Western Blotting—Approximately 1  10 cells were lysed in DNA sequences were determined by using the Long-Read 0.5 ml of radioimmune precipitation assay buffer containing Tower System (GE Healthcare). Three clones were sequenced proteinase inhibitors (0.5 ml of 50 mM Tris-HCl, pH 7.4, 150 for each gene. mM NaCl, 1% (v/v) Triton X-100, 1% (w/v) sodium deoxy- Plasmid Constructions—Luciferase reporter expression con- cholate, 0.1% (w/v) SDS, and a mixture of proteinase inhibitors structs harboring mouse BMP-2 3-UTR at the 3-end of the (Complete Mini, Roche Diagnostics)) for 10 min on ice with luciferase coding region were prepared in pcDNA3.1/Zeo() occasional mixing. The lysate was clarified by centrifugation at expression vector (Invitrogen). The luciferase cDNA was 12,000  g for 20 min at 4 °C. Twenty micrograms of protein generated from pGL3-Basic vector (Promega) by PCR and was subjected to SDS-PAGE with 8–16% polyacrylamide sepa- SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27231 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes rating gel in the reducing condition and electronically trans- tation kit (Invitrogen), and the radioactivity was normalized by ferred onto a nitrocellulose membrane (Bio-Rad). After block- the amount of DNA. Immunohistochemistry—Immunohistochemistry of carti- ing, the membrane was incubated with either anti-p38 MAP lage explants was performed following a previously described kinase or anti-phopho-p38 MAP kinase (Thr-180/Thy-182) method (12) with some modifications. In brief, 6-m-thick antibody (Cell Signaling Technology, Beverly, MA) and then cryosections were prepared from the explants, fixed in acetone, with the secondary antibody conjugated with peroxidase (Santa and digested with 1.0% hyaluronidase (Sigma) for antigen Cruz Biotechnology, Santa Cruz, CA). Immunoreactive protein retrieval. To detect the presence of BMP-2, anti-human BMP-2 was finally visualized using a SuperSignal West Pico chemilu- goat polyclonal antisera (Santa Cruz Biotechnology) were used minescent substrate (Pierce). at the concentration of 1:100, which was visualized with the RNAi Experiments—The expression of p65 subunit of NF-B avidine-linked peroxidase system (goat ABC staining system, or RelA and IB was suppressed by RNAi in primary cultured Santa Cruz Biotechnology) coupled with 3-amino-9-ethylcar- human chondrocytes. All siRNAs were purchased from Qiagen, bazole substrate (DakoCytomation, Carpinteria, CA). The sec- and two siRNAs with distinctive sequences were used for each tions were observed under a light microscope without nuclei gene. The sense strand sequences of the RNA duplexes were as staining, to facilitate direct comparison of the staining intensi- follows: RelA#1, 5-GGACAUAUGAGACCUUCAAdTdT-3; ties among the sections. RelA#2, 5-GAUUGAGGAGAAACGUAAAdTdT-3;IB#1, Statistical Analyses—For statistical analyses, data were com- 5-GGGUGUACUUAUAUCCACATdT-3;IB#2, 5-GGG- pared using one-way factorial analysis of variance, and when CCAGCUGACACUAGAAdTdT-3; and control siRNA, necessary, Fisher’s PLSD was used as a post-hoc test. Statistical 5-UUCUCCGAACGUGUCACGUdTdT-3. significance was set at p  0.05. The siRNAs were delivered into human chondrocytes by electroporation following cell isolation from cartilage matrix. RESULTS Electroporation was performed using a Nucleofector device TNF- and Cycloheximide Induced BMP-2 Expression in Dif- and a Human Chondrocyte Nucleofector kit (Amaxa, Cologne, ferentiated, Not Undifferentiated, ATDC5 Cells—As a prelimi- Germany) following the manufacturer’s instructions. In brief, nary experiment, the time course of chondrogenic differentia- 1  10 cells were suspended in 100 l of the electroporation tion of ATDC5 cells was determined by evaluating the buffer provided by the kit, along with 1.5 lof68 M stock expression of type II procollagen and aggrecan as well as type X solution of siRNA. Thus, the final concentration of siRNA in procollagen from Day 0 until Day 25, every 5 days after addition the buffer was 100 nM. The buffer was then transferred to a of insulin to the media. Under our experimental conditions, the supplied cuvette, and electroporation was performed using the expression of type II procollagen and aggrecan began to protocol recommended by the manufacturer. After electropo- increase at Day 10 and rose continuously up to Day 25 (data not ration, the cells were immediately transferred onto each well of shown). Meanwhile, the expression level of type X procollagen 12-well plates and cultured in DMEM/F-12 containing 20% was very low from Day 0 to Day 15 and then was up-regulated at fetal bovine serum. Next day, the media were replaced to the Day 20 and beyond (data not shown), indicating the occur- aforementioned regular culture media for human chondro- rence of a hypertrophic change in the cells. Based on these cytes. The viability of cells was 60% with the procedure. observations, the induction of BMP-2 by TNF- in ATDC5 Incorporation of [ S]Sulfate into Cartilage Explants—For cells was investigated between Days 0 and 15 in the following this experiment, 20–40 cartilage explants were prepared from experiments. normal bovine articular cartilage and equally divided into 4 Without TNF- stimulation, the expression level of BMP-2 groups. The first group was cultured in the aforementioned was consistently low in ATDC5 cells from Day 0 to Day 15 (Fig. culture medium for 6 days, while changing the medium every 2 1, A–D). The response to TNF- varied according to the stage days. The second group was first cultured in the same medium of chondrogenic differentiation. At Days 0 and 5 when the cells for 4 days, and then for 2 days in a medium containing recom- were still undifferentiated, TNF- did not induce the expres- binant mouse noggin (1 g/ml). The third and fourth groups sion of BMP-2. With the onset of chondrogenic differentiation, were initially cultured in a medium containing 2.5 ng/ml a weak induction was observed at Day 10 (Fig. 1C), and it recombinant human TNF- for 4 days. The third group was became obvious at Day 15 as the differentiation progressed (Fig. then cultured in the regular culture medium for 2 days, whereas 1D). In Day-15 cells, the induction was dose-dependent, and its the fourth group was cultured in a medium containing 1 g/ml maximum was observed with 100 ng/ml TNF-. The cells cul- recombinant noggin. For all four groups, newly synthesized sul- tured for 15 days without insulin showed a weaker response to fated proteoglycan was radiolabeled for the last8hof culture TNF-, presumably due to the lack of chondrogenic differenti- with 10 Ci/ml [ S]sulfate (GE Healthcare). The explants were ation (Fig. 1E). then recovered, extensively rinsed with ice-cold phosphate- Next, the effect of a protein synthesis inhibitor, cyclohexi- buffered saline, and subjected to papain digestion. The diges- mide (CHX), was studied at different stages of differentiation tion was performed using 50 g/ml papain (Sigma) in 500 lof (Fig. 1F). In Day-0 cells, the expression of BMP-2 was not digestion buffer (0.2 M sodium acetate, pH 6.0) at 60 °C over- affected by CHX. In Day-10 cells, CHX induced a moderate night. The digest was then centrifuged, and 20 l of supernatant expression of BMP-2, and in Day-15 cells the induction was was used to measure the radioactivity. DNA content was also obvious. In various genes, CHX is known to induce mRNA determined using a PicoGreen double-stranded DNA quanti- expression by disrupting the linkage between mRNA transla- 27232 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes was evaluated using an RNA synthe- sis inhibitor, actinomycin D (ActD). The result of this experiment revealed that the degradation rate of BMP-2 mRNA was indeed reduced by TNF- (Fig. 2C). In the presence of TNF-, the half-life of BMP-2 mRNA was extended from 137 to 257 min, an increase of88%. Thus, the involvement of a post-transcrip- tional mechanism in the induction of BMP-2 by TNF- was indicated. TNF- Induces BMP-2 in Human Articular Chondrocytes by Increas- ing mRNA Stability—In the next experiment, the involvement of post-transcriptional mechanism(s) in the induction of BMP-2 was examined in primary cultured adult human articular chondrocytes. FIGURE 1. Induction of BMP-2 in ATDC5 cells by TNF- and cycloheximide. A–E, effect of TNF- on BMP-2 expression was evaluated on ATDC5 cells at various stages of chondrogenic differentiation. Before (A) and after Before examining that hypothesis, culture for 5 (B), 10 (C), or 15 days (D) in insulin-containing media, ATDC5 cells were treated with graded doses the induction of BMP-2 in human of TNF- for 48 h, and expression of BMP-2 mRNA was evaluated. In parallel, cells maintained for 15 days in insulin-free media were treated with TNF-, and expression of BMP-2 was evaluated (E). F, ATDC5 cells cultured chondrocytes was evaluated under in insulin-containing media for 0, 10, or 15 days were treated with 2.5 g/ml CHX for 24 h, and BMP-2 mRNA our experimental conditions. The expression was evaluated. For these experiments, expression of BMP-2 mRNA was evaluated by real-time PCR endogenous expression level of together with GAPDH expression; results are shown in relative ratios against GAPDH. Data are mean  S.D. of three to five experiments. BMP-2 in human chondrocytes was considerably higher than that in dif- tion and mRNA degradation (35). Therefore, our result sug- ferentiated ATDC5 cells, and, in accordance with our previous gested the possibility that BMP-2 mRNA might have been syn- observation (12), TNF- up-regulated BMP-2 expression 10- thesized at a certain level in differentiated ATDC5 cells, even fold (Fig. 3A). The induction was dose-dependent, and similar though the observed expression level was very low. to that in ATDC5 cells, the maximum induction was observed BMP-2 Expression Is Regulated at Both Transcriptional and at 100 ng/ml. Post-transcriptional Levels in ATDC5 Cells—To determine the The experiment with CHX was repeated with human chon- transcriptional activity of BMP-2 gene, a nuclear run-off assay drocytes, and a strong induction of BMP-2 was again observed, was performed on differentiated and undifferentiated ATDC5 suggesting the presence of a similar post-transcriptional regu- cells with or without TNF- stimulation (Fig. 2, A and B). The lation in human cells (Fig. 3B). The effect of CHX was observed result revealed that the expression of BMP-2 was suppressed at at and above a concentration of 2.5 g/ml, and 10 g/ml CHX the transcriptional level in undifferentiated cells but that the seemed sufficient to obtain the maximum induction. gene transcripts were being synthesized at a substantial level in Next, the stability of BMP-2 mRNA in human chondrocytes the nuclei of differentiated cells. In the differentiated ATDC5 was evaluated in the presence or absence of TNF- (Fig. 3C). cells, TNF- treatment enhanced mRNA synthesis, whereas Some cells were treated with TNF- for 48 h, and the mRNA the cytokine had virtually no effect on it in undifferentiated stability was then evaluated in the presence of TNF-. The cells. results showed that TNF- also stabilizes BMP-2 mRNA in Thus, results of the CHX treatment and nuclear run-off assay human articular chondrocytes. The mRNA half-life was both indicated that, in ATDC5 cells, BMP-2 mRNA is synthe- extended 2.6 times from 72 to 185 min by TNF-. Interest- sized at a certain level in the nuclei of cells once they acquired ingly, an extended TNF- treatment for 48 h resulted in further the chondrogenic phenotype. However, the observed level of mRNA stabilization, and the half-life was prolonged to 278 min, BMP-2 expression was very low in the differentiated ATDC5 which was 390% of that in the untreated cells. cells as long as they were not treated with TNF- (Fig. 1, A–D). Human and Mouse BMP-2 mRNA Contain AU-rich Ele- The apparent contradiction between the results strongly sug- ments in 3-UTRs—To determine the 3-UTR sequence, gested the involvement of a post-transcriptional mechanism in 3-rapid amplification of cDNA ends was performed on human the regulation of BMP-2 expression. and mouse BMP-2 mRNA. The results revealed that the To examine this hypothesis, we evaluated the stability of 3-UTR of human BMP-2 had a length of 3736 nt, whereas that BMP-2 mRNA in differentiated ATDC5 cells in the presence or of mouse 3-UTR was 1170 nt (Fig. 4). Mouse 3-UTR shows an absence of TNF-. Because the basal expression level of BMP-2 82% sequence identity with human 3-UTR. Although both was too low to evaluate the degradation rate, the cells were 3-UTRs are longer than the average lengths of the respective initially treated with TNF- for 48 h to induce certain levels of species (29), they are both encoded by the third or the last exon BMP-2 expression, after which the degradation rate of mRNA of the gene together with the last part of the translated region. SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27233 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes FIGURE 3. Involvement of post-transcriptional regulation in expression of BMP-2 in human chondrocytes. A, human articular chondrocytes were maintained by monolayer culture and treated with graded concentrations of TNF-. Induction of BMP-2 was evaluated 48 h later. B, chondrocytes were treated with graded doses of CHX for 24 h, and BMP-2 expression was evalu- ated. C, decay of BMP-2 mRNA was evaluated in presence (filled circles)or absence (open circles) of TNF-, using ActD (1 M). Decay of mRNA was also evaluated in cells treated with TNF- for 48 h prior to addition of ActD and in the continuous presence of the cytokine (filled squares). For these experi- ments, expression of BMP-2 was evaluated by real-time PCR together with GAPDH expression. In A and B, results are shown as ratios against GAPDH. In C, RNA ratios at respective time points were normalized by the ratio at begin- ning of the evaluation (i.e. time 0) in each experiment to facilitate direct com- parison. Data are mean  S.D. of three to five experiments. region, and mouse has 8 in the proximal third of the region (Fig. 4). The alignment of the 8 motifs in the mouse gene is well FIGURE 2. Synthesis of BMP-2 mRNA in nuclei, and stability of mRNA in conserved in the human gene, suggesting their functional cytoplasm in the presence or absence of TNF-. A, nuclear run-offs from differentiated and undifferentiated ATDC5 cells. Immediately after reaching significance. confluency (Day 0) or after culture in insulin-containing media for 15 days Induction of BMP-2 by TNF- Is Mediated by the AU-rich (Day 15), ATDC5 cells were treated with or without 20 ng/ml TNF- for 48 h, Element in 3-UTR—The functional significance of the ARE in and nuclei were obtained. RNA synthesis was allowed to proceed in nuclei in the presence of [- P]UTP, and amounts of synthesized BMP-2 gene tran- BMP-2 3-UTR was investigated by generating luciferase scripts were evaluated by slot blot analysis together with those for GAPDH, reporter constructs harboring either the entire or various parts -actin, and pCR2.1 vector without insert (for background). The experiment was repeated twice with consistent results. B, signal ratios between BMP-2 of mouse BMP-2 3-UTR at the 3-end of the luciferase coding 3-UTR and -actin were quantified after subtracting background. C, ATDC5 region (Fig. 5A). cells were maintained in insulin-containing media for 15 days, and stimulated To analyze the function of the region, that 3-UTR was with 100 ng/ml TNF- for 48 h to induce BMP-2 expression. Degradation of BMP-2 mRNA was then evaluated by addition of ActD (1 M), with (open cir- divided into four parts according to the distribution of pentam- cles) or without (filled circles) withdrawal of TNF- from media. At each time eric AUUUA motifs. The first part, designated part A, involves point, remaining amounts of BMP-2 mRNA were evaluated by real-time PCR together with GAPDH mRNA; results are shown in relative ratios against the first 189 nt with two pentamers. The next 137 nt containing GAPDH. Data are mean  S.D. of three experiments. four pentamers was designated part B. Part C contained the following 114 nt with two pentamers, and the remaining 730 nt For various genes, the stability of mRNA is regulated by cis- without motifs was designated part D. These parts were acting elements in 3-UTR (28, 29). Among them, the adeno- inserted, alone or in combination, after the stop codon of the sine/uridine-rich element (ARE) is a well characterized luciferase coding region. sequence that has the function of modulating mRNA degrada- The constructs were transiently transfected to the differen- tion in response to various extracellular stimuli. The element tiated ATDC5 cells, and the luciferase activity was measured often contains repeats of pentameric AUUUA motifs. The (Fig. 5B). The results revealed that the addition of the entire result of sequencing revealed that both human and mouse 3-UTR reduced luciferase activity by 75%. When parts A, B, BMP-2 3-UTRs contain multiple copies of the pentameric or D were inserted alone, a significant reduction was observed motif. Human 3-UTR contains 22 motifs throughout the only with part B, whereas the reduction with parts A or D was 27234 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes not apparent. The reduction of luciferase activity with part B was augmented by the addition of part A or parts C and D, and the strongest FIGURE 4. Distribution of AUUUA motifs in human and mouse BMP-2 3-UTRs. Relative lengths and distri- reduction was observed when parts butions of AUUUA motifs (filled ellipses) in human and mouse BMP-2 3-UTRs are shown. A through C were inserted together. Interestingly, the addition of the reversed 3-UTR sequence also suppressed luciferase activity, although the effect was less obvious than that of the regular orientation. For some constructs, luciferase activity was also evaluated in the presence of TNF- (Fig. 5C). For the two constructs that strongly reduced luciferase activity in the previous experiment, the suppressed activity was partly recovered by TNF-, whereas the cytokine did not affect luciferase activity with the insert containing no AUUUA motifs. Thus, our results suggest the possibility that the expression of BMP-2 could have been suppressed in the chondrocytes by the ARE in 3-UTR and that the induction of BMP-2 by TNF- could have been the result of a release from the ARE-mediated suppression. p38 Signaling Pathway Is Involved in Stabilization of BMP-2 mRNA by TNF- in Human Chondrocytes—Next, experiments were performed to determine the signal transduction path- way(s) involved in the stabilization of BMP-2 mRNA by TNF-. It is known that TNF- stabilizes mRNA of various genes through the signal pathway involving p38 MAP kinase (36). For some other genes, the stability of mRNA is regulated by signal pathways involving extracellular signal-regulated kinase-1/2 (ERK-1/2) (37, 38), c-Jun N-terminal kinase (JNK) (39, 40), pro- tein kinase C (38, 41), or phosphatidylinositol 3-kinase (42). mRNA turnover can be regulated by the intracellular calcium concentration (43). Thus, seven specific inhibitors for these sig- nals were examined to determine whether they inhibited the induction of BMP-2 by TNF- (Fig. 6A). Among them, SB203580, an inhibitor for p38 pathway, was found to strongly suppress the BMP-2 induction; it also suppressed the expres- sion of BMP-2 in untreated chondrocytes by 50%, suggesting that p38 signaling could be important in maintaining the endogenous expression of the protein. On the other hand, wortmannin and ionomycin, which inhibit phosphatidylinosi- tol 3-kinase activity and cause calcium ion influx, respectively, induced the expression of BMP-2 in chondrocytes, although the induction by TNF- was not enhanced but rather sup- pressed by these inhibitors. The inhibitors for ERK-1/2, JNK, or protein kinase C showed no significant effect on either the endogenous expression or induction levels, indicating that these pathways might not be involved in the regulation of FIGURE 5. Chimeric constructs used for transient transfection experi- ments and their luciferase activity. A, chimeric constructs used for tran- BMP-2 expression in chondrocytes. sient transfection experiments. Constructs have all or a part of mouse Because SB203580 showed significant suppression of BMP-2 3-UTR (open bars)atthe3-end of luciferase coding sequence (Luc), followed by SV40 polyadenylation signal (SV40 poly(A)). The chi- BMP-2 expression, the dose response to the inhibitor was meric region was under the control of SV40 promoter and enhancer. Solid evaluated in the untreated and TNF--stimulated chondro- ellipses indicate locations of pentameric AUUUA motifs, and numbers at cytes together with the effect of SB202190, another specific the top denote positions of nucleotide in 3-UTR. B, luciferase activity of constructs. ATDC5 cells maintained for 15 days in insulin-containing inhibitor for the p38 pathway (Fig. 6B). The result showed media were transiently transfected with one of the above constructs, and that the endogenous expression and induction of BMP-2 was luciferase activity was measured 48 h later. C, effect of TNF- on luciferase inhibited by SB203580 in a similar dose-dependent manner. activity. For some constructs, luciferase activity was measured after treat- ing cells with 10 ng/ml TNF- for 48 h following transfection. Luciferase The endogenous expression and induction were both assays were repeated three to six times, and activity of Firefly luciferase reduced by 25% with 1 M SB203580, and the inhibitory was normalized by that of Renilla luciferase. Data are expressed as a per- centage of control (mean  S.D.). effects were almost maximal at the concentration of 5 M. SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27235 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes The expression of BMP-2 was inhibited by SB202190 to an untreated cells (Fig. 6C). Even without TNF- stimulation, the extent similar to SB203580 in both untreated and TNF- inhibition of the p38 pathway resulted in the facilitation of stimulated chondrocytes, confirming the significance of p38 mRNA degradation in chondrocytes; the half-life of BMP-2 signaling in the maintenance of endogenous expression and mRNA declined from 70 to 42 min, a reduction of 40%. The induction of the protein by TNF-. decrease in mRNA stability was considered to account for the We then evaluated the effect of SB203580 on the stability of suppression of endogenous BMP-2 expression by the inhibitor. BMP-2 mRNA in the TNF--treated chondrocytes and Furthermore, although the mRNA stability was significantly 27236 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes increased in the TNF--treated cells, the inhibitor reduced the stability below the level of that in untreated cells, completely abrogating the cytokine’s effect. The mRNA half-life was 282 min in the TNF--treated cells, which was reduced to 53 min by the addition of SB203580. The significance of p38 MAP kinase in the regulation of BMP-2 expression was confirmed by use of the adenovirus carrying constitutively active MKK6, a kinase that directly phosphorylates p38 MAP kinase. Infection with the adeno- virus induced the expression of BMP-2 mRNA along with the phosphorylation of p38 (Fig. 6, D and E), but that induction was completely inhibited by SB203580, together with p38 phosphorylation. Thus, the results of these experiments showed that BMP-2 expression in primary cultured adult human chondrocytes is regulated by a post-transcriptional mechanism predominantly modulated by the p38 signal pathway. Coordination of NF-B and p38 Signal Pathway in BMP-2 Induction by TNF-—Since it has been reported that the expression of BMP-2 is transcriptionally regulated by NF-Bin epiphyseal chondrocytes (24), experiments were performed to determine the role of NF-B in the induction of BMP-2 by TNF-. In the first experiment, nuclear translocation of NF-B was inhibited by pyrrolidine dithiocarbamate (PDTC), and the levels of endogenous expression and induc- tion by TNF- were evaluated (Fig. 7A). Unlike SB203580, PDTC did not change the endogenous level of BMP-2 expression in human chondrocytes, suggesting that the tran- scriptional factor may not be responsible for the mainte- FIGURE 7. Involvement of NF-B in induction of BMP-2. A, effect of PDTC on endogenous expression and induction of BMP-2 by TNF- was evaluated in nance of BMP-2 expression in adult human articular chon- primary cultured human articular chondrocytes. In presence or absence of drocytes. This finding differed from a previously reported TNF-, PDTC was given to chondrocytes at various concentrations. For some result with epiphyseal chondrocytes showing that the inhi- cells, SB203580 (20 M) was given together with PDTC. Forty-eight hours later, expression of BMP-2 was evaluated by real-time PCR and represented bition of NF-B strongly reduced the expression of BMP-2 in by ratios against GAPDH. , p  0.05 against untreated cells, and **, p  0.01 the growth plates (24). On the other hand, the inhibitor sup- against cells treated with TNF- alone. B, stability of BMP-2 mRNA was evalu- ated using ActD (1 M) in chondrocytes treated with TNF- for 48 h with (filled pressed the induction of BMP-2 by TNF- by 50%. The diamonds) or without (filled circles) PDTC (100 M). At each time point, expres- suppressive effect seemed to reach a plateau at a concentra- sion of BMP-2 was determined by real-time PCR together with GAPDH, and tion of 100 M, because no further suppression was observed their RNA ratio was obtained. To facilitate direct comparison, ratios at respec- tive time points were normalized by the ratio at beginning of the evaluation with a higher concentration of PDTC. In contrast, when (i.e. Time 0) under each experimental condition. For these experiments, TNF- SB203580 was used together with PDTC, the induction was was used at a concentration of 100 ng/ml. Data are shown by mean  S.D. or completely abrogated, and the expression of BMP-2 declined mean  S.D. of three to five experiments. below the level of endogenous expression. Although PDTC partly suppressed BMP-2 induction, the inhibitor did not induction was suppressed not through a change in post-tran- change the stability of BMP-2 mRNA in TNF--treated scriptional regulation, but rather through the decrease in chondrocytes (Fig. 7B), suggesting the possibility that the transcriptional activity. FIGURE 6. Involvement of p38 MAP kinase in the induction of BMP-2 by TNF-. A, human articular chondrocytes were maintained by monolayer culture, and seven specific inhibitors of signal transduction pathways were examined at indicated concentrations to determine whether they exerted significant effects on endogenous expression and induction of BMP-2 by TNF-. Effects on endogenous expression were evaluated 48 h after addition of inhibitors. To assess effects on induction, inhibitors were given 30 min prior to addition of TNF- to media, and induction levels were determined 48 h later. Expression of BMP-2 was # ## represented by ratios against GAPDH. , p  0.05; , p  0.01 against control cells; *, p  0.05; **, p  0.01 against control cells treated with TNF- alone. B, chondrocytes were cultured with graded doses of SB203580 in the presence (solid bars) or absence (open bars) of TNF- stimulation, and the expression of BMP-2 was evaluated 48 h later. In parallel, the effect of SB202190 on the expression of BMP-2 was evaluated together with that of SB202474, a negative control # ## for the p38 inhibitors (bars in shaded areas). Expression of BMP-2 was represented by ratios against GAPDH. , p 0.05, and , p 0.01 against untreated cells; **, p 0.01 against cells treated with TNF- alone. C, chondrocytes were cultured for 48 h in the presence (open squares) or absence (open circles) of SB203580, and the stability of BMP-2 mRNA was evaluated using ActD (1 M). Evaluation was also performed on cells treated with TNF- for 48 h with (filled squares)or without (filled circles) SB203580. To facilitate direct comparison, RNA ratios at respective time points were normalized by the ratio at beginning of the evaluation (i.e. Time 0) under each experimental condition. D and E, chondrocytes were infected with the adenovirus carrying constitutively active MKK6 at indicated titers, and 72 h later, the amount of phosphorylated p38 and expression of BMP-2 mRNA were evaluated together with those of total p38 protein and GAPDH, respectively. SB203580 was given to some cells together with the adenovirus. In E, BMP-2 expression was represented by ratios against GAPDH. **, p  0.01 against untreated cells. For these experiments, expression of BMP-2 and GAPDH was quantitatively evaluated by real-time PCR. TNF- was used at the concentration of 100 ng/ml, and media containing inhibitors were replaced every 24 h to preclude possible degradation of the inhibitors. Data are shown by mean  S.D. or mean  S.D. of three or four experiments. SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27237 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes IB expression caused a 2-fold increase of endogenous BMP-2 expression (Fig. 8D). The response to TNF- was preserved in those cells, although the magnitude of BMP-2 induction was not aug- mented by the suppression of IB. Noggin Showed Stronger Inhibi- tory Effects on Chondrocyte Anabo- lism after TNF- Treatment—To evaluate the biological significance of BMP-2 induced by TNF-, carti- lage explants were cultured in the presence or absence of the cytokine, and the inhibitory effect of noggin on the synthetic activity of chondro- cytes in those explants was investi- gated. In this experiment, the con- centration of TNF- was set at a relatively low level based on our pre- vious experience (12). First, the induction of BMP-2 by TNF- was confirmed by immunostaining. Compared with the untreated con- trols (Fig. 9A), staining for BMP-2 was much stronger in the TNF-- treated explants (Fig. 9B). In those explants, the staining was observed both inside and around the chon- drocytes, which was consistent with FIGURE 8. Influence of reduced RelA and IB expression on the induction of BMP-2 by TNF-. A and B, our previous observation with siRNAs for RelA (A) and IB (B) were delivered into primary cultured human chondrocytes by electroporation, human cartilage explants (12). Next, and the expression levels of respective genes were monitored every 2 days until Day 6 by real-time PCR. For each gene, two siRNAs with respective target sequences were used (filled squares and triangles), and the results the synthesis of sulfated proteogly- are shown by ratios against GAPDH together with that of the control cells given a control siRNA (open circles). can in the explants was evaluated by C and D, the cells to which the siRNAs for RelA (C) and IB (D) were delivered were treated with 20 or 100 ng/ml the incorporation of [ S]sulfate. In of TNF- for 48 h, and the induction of BMP-2 was evaluated by real-time PCR. Considering the time course of gene suppression, the cells were treated with TNF- from Day 2 to Day 4. Open bars represent the result of the control explants without TNF- control cells, and light and dark shaded bars show the results of respective siRNAs used for the gene. The results treatment, the incorporation of are shown by ratios against GAPDH. *, p  0.05 and **, p  0.01 against control cells in respective treatment groups. Data are mean  S.D. or mean  S.D. of three to five experiments. [ S]sulfate into the explants was not significantly influenced by the Induction of BMP-2 by TNF- Was Significantly Modulated addition of noggin to the culture media (Fig. 9C). On the other by the Suppression of RelA and IB Expression—The involve- hand, noggin showed a strong inhibitory effect on the explants ment of NF-B in the induction of BMP-2 was further con- treated with TNF-. Although the low dose of cytokine did not firmed by RNAi experiments. In primary cultured human artic- cause significant suppression of the synthetic activity in the ular chondrocytes, the expression of RelA and IB was explants, noggin reduced the incorporation of [ S]sulfate by effectively reduced by RNAi. The result of real-time PCR dem- 50%. Thus, in the TNF--treated explants, BMP-2 induced by onstrated that the expression of RelA gene was suppressed from TNF- was considered to play a significant anabolic role on the Day 2 to Day 6 after the delivery of siRNAs into the cells (Fig. synthetic activity of chondrocytes, likely counteracting the sup- 8A). The strongest inhibition was observed at Day 4 for both pressive effects of TNF-. siRNAs used for the gene, when the expression levels were DISCUSSION reduced to 22 and 37%, respectively, of that of the control. For IB, the suppression was strongest at Day 2 and Day 4 for In the current work, the presence of a complex regulation for respective siRNAs, when the expression was 25 and 44% of the BMP-2 expression was initially suggested in ATDC5 cells by the control (Fig. 8B). Next, the induction of BMP-2 by TNF- was experiment using CHX. The expression of BMP-2 was induced evaluated in the cells given the siRNAs. The introduction of by CHX in differentiated but not undifferentiated ATDC5 cells, siRNA by electroporation considerably reduced the induction whereas the basal level of BMP-2 expression was consistently of BMP-2 by TNF- (Fig. 8, C and D). Nonetheless, it was low throughout the differentiation process. Because CHX is noticed that the gene silencing of RelA significantly inhibited known to induce gene expression through the inhibition of the induction of BMP-2 (Fig. 8C). Meanwhile, the reduction of RNA degradation (35), that observation suggested the possibil- 27238 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes that human chondrocytes most likely have a similar regulatory system for the control of BMP-2 expression. In eukaryotic cells, the level of gene expression is strictly regulated at both transcriptional and post-transcriptional lev- els. Modulation of the mRNA decay rate is a strategy widely used by cells to adjust the intensity of expression (44). The decay of mRNA is often mediated by the specific cis-acting sequences in 3-UTR, represented by an AU-rich element or ARE (29, 45). The ARE often contains multiple copies of pen- tameric AUUUA motifs. Such motifs have been found in many unstable and inducible genes such as cytokines and oncogenes, where the elements control the degeneration of mRNA in response to a variety of intra- and extracellular signals, enabling a rapid adjustment of RNA levels (46). In the present study, the result of 3-rapid amplification of cDNA ends revealed that both human and mouse BMP-2 mRNA contain multiple AUUUA motifs in the 3-UTRs. Mouse 3-UTR contains 8 motifs within a proximal 320-nt AU-rich stretch, and their alignment is highly conserved in the human gene. In various genes whose expression is regulated at the post-transcriptional level, the nucleotide sequences of AREs are often evolutionarily conserved (47–50). The result of this study indicated that BMP-2 could be one such gene. Because BMP-2 protein is FIGURE 9. Expression of BMP-2 and effect of noggin on sulfate incorpora- highly conserved during the evolutionary process, it is reason- tion in cartilage explants with and without TNF- treatment. A and B, cartilage explants were cultured in the presence or absence of TNF- (2.5 able to assume that the regulatory mechanism is conserved as ng/ml) for 4 days, and the expression of BMP-2 was detected by immuno- well. In fact, a sequence comparison has revealed that a 265- staining. Representative photomicrographs of the control explants without nucleotide region in the BMP-2 3-UTR is 73% conserved over TNF- treatment (A) and those treated with TNF- (B) are shown. Magnifica- tion, 200. C, the explants with and without TNF- treatment were further a span of 450 million years of evolution from fish to mammals cultured for 2 days in the presence or absence of recombinant mouse noggin (27). Interestingly, with all its functional and sequential similar- (1 g/ml), and the synthetic activity of chondrocytes was evaluated by the ity to BMP-2, the BMP-4 gene lacks an equivalent conserved incorporation of [ S]sulfate into the explants. The experiments were repeated four times using cartilage from two animals. Open bars represent region in the 3-UTR. The possible absence of post-transcrip- the results of the explants without TNF- treatment, and solid bars represent tional regulation may account for the difference in the for those with TNF- treatment. The results are shown as cpm normalized by DNA contents. Data are mean  S.D. expression patterns between the two BMPs during embryo- genesis (5, 17, 18). Although AREs regulate the decay of mRNA in many genes, ity that BMP-2 mRNA was synthesized at a certain level in the presence of ARE in 3-UTR does not necessarily indicate differentiated cells, even without TNF- stimulation. Accord- that the element is actually functional (45). Furthermore, the ingly, the results of nuclear run-off experiments revealed that significance of AREs may vary depending on the cell types (51) differentiated ATDC5 cells were in fact synthesizing BMP-2 or states of cellular differentiation (21, 27, 45, 52), possibly due mRNA at the nuclei, whereas such synthesis was barely detect- to the change in trans-acting regulators (45). Thus, the function able in undifferentiated cells. The discrepancy between the of ARE needs to be evaluated within the biological context in active mRNA synthesis in the nuclei and the low level of expres- which the gene is expressed. In this study, we therefore exam- sion observed in differentiated cells can be explained by the ined the function of BMP-2 3-UTR in differentiated ATDC5 involvement of post-transcriptional control in the regulation of cells, in which the addition of 3-UTR to the luciferase gene did BMP-2 expression. On the other hand, the results of nuclear indeed reduce the enzyme activity. That reduction was related run-off experiments also revealed that the transcriptional activ- to the number of inserted AUUUA motifs, rather than to the ity of BMP-2 mRNA was increased by TNF-. Taking all these specific sequence in the region. Thus, out of eight pentameric results into account, the regulation of BMP-2 in ATDC5 cells motifs, the first or last two pentamers alone did not change the may be understood as follows. In undifferentiated cells, expres- luciferase activity significantly, whereas the middle four within sion is suppressed at the transcriptional level. The cells acquire 86 bases suppressed it by over 40%. The addition of two motifs, the ability to synthesize BMP-2 mRNA with the progression of either proximal or distal, was enough to obtain suppression chondrogenic differentiation, but the overall expression is still equal to the entire 3-UTR. suppressed by a post-transcriptional regulatory mechanism AREs are often divided into three classes, with the ARE of that facilitates mRNA degradation. TNF- induces the expres- BMP-2 falling into class II, in which the region is characterized sion of BMP-2 in differentiated cells through the transcrip- by multiple copies of clustered AUUUA motifs (53, 54). The tional up-regulation and stabilization of mRNA. The regulatory other members of this class are mostly cytokines and enzymes mechanisms were then investigated in primary cultured human such as interleukin-3 (40), TNF- (55), and cyclooxygenese-2 chondrocytes, and the results of those experiments indicated (51, 56, 57). In these genes, the effect of mRNA stabilization by SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27239 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes the pentameric sequence has often been related to the number inflammatory cytokines (12). Because the protein has potent of motifs in the AREs (40, 57). Our current observations are in anabolic actions on chondrocytes (62, 63), it is possible that the good agreement with those previous results. induced BMP-2 counteracts the progression of the disease by It is worth noting that a few previous studies reported con- enhancing the chondrocyte metabolism. In fact, the result of tradictory results on whether or not the addition of 3-UTR this study indicated a possibility that BMP-2, after induction by increased the stability of BMP-2 mRNA (21, 27). Considering TNF-, could compensate the reduced chondrocyte metabo- that AREs primarily destabilize rather than stabilize mRNA (29, lism caused by the cytokine (Fig. 9). The notion is also sup- 36, 44, 45), it is possible that the previous observations might ported by a recent observation that mice lacking a BMP recep- not reflect the actual function of the 3-UTR in vivo. Because an tor in cartilage tended to develop premature osteoarthritis (64). embryonic carcinoma cell line was used in those studies, the Thus, for pathologies that involve BMP-2 expression, its con- inconsistency might stem from differences in the cell types trol could be a key to regulating the disease process. The results and/or stages of cellular differentiation. Because the reduced of this study will provide useful clues in developing new strate- luciferase activity by the addition of 3-UTR was significantly gies to treat various diseases involving chondrocytes. recovered by TNF-, we think the current result reasonably REFERENCES reflects the biological function of the region. 1. Urist, M. R. (1965) Science 150, 893–899 Based on the results of our current study, it seems very likely 2. Wozney, J. M., Rosen, V., Celeste, A. J., Mitsock, L. M., Whitters, M. J., that the p38 signal pathway mediates the stabilization of BMP-2 Kriz, R. W., Hewick, R. M., and Wang, E. A. (1988) Science 242, mRNA by TNF-. In genes containing AREs, the stability of 1528–1534 3. Sampath, T. K., Rashka, K. F., Doctor, J. S., Tucker, R. F., and Hoffmann, mRNA is regulated by proteins that bind to the region or ARE- F. M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6004–6008 binding proteins. The function of such proteins is often modu- 4. Zhang, H., and Bradley, A. (1996) Development 122, 2977–2986 lated by the p38 signal pathway. For example, the ARE-binding 5. Hogan, B. L. (1996) Genes Dev. 10, 1580–1594 proteins HuR, AUF1, and tristetraprolin are all known to stabi- 6. Pizette, S., and Niswander, L. (2000) Dev. Biol. 219, 237–249 lize or destabilize mRNA in response to p38 signaling (42, 7. Bostrom, M. P., Lane, J. M., Berberian, W. S., Missri, A. A., Tomin, E., 58–60). Although the protein that binds to BMP-2 ARE has not Weiland, A., Doty, S. B., Glaser, D., and Rosen, V. M. (1995) J. Orthop. Res. 13, 357–367 been determined, it is likely that mRNA stability is regulated by 8. Si, X., Jin, Y., Yang, L., Tipoe, G. L., and White, F. H. (1997) Eur. J. Oral. Sci. one such protein. AREs regulated by the p38 pathway have a 105, 325–330 common feature in that they contain several closely adjacent 9. Hallahan, A. R., Pritchard, J. I., Chandraratna, R. A. S., Ellenbogen, R. G., AUUUA motifs (36). That feature is indeed shared with the Geyer, J. R., Overland, R. P., Strand, A. D., Topcott, S. J., and Olson, J. M. BMP-2 gene. (2003) Nat. Med. 9, 1033–1038 10. Kleeff, J., Maruyama, H., Ishiwata, T., Sawhney, H., Friess, H., Buchler, Besides the post-transcriptional regulation, the modulation M. W., and Korc, M. (1999) Gastroenterology 116, 1202–1216 of transcriptional activity seemed to play another important 11. Langenfeld, E. M., Calvano, S. E., Abou-Nukta, F., Lowry, S. F., Amenta, P., role in the induction of BMP-2 by TNF-. In differentiated and Langenfeld, J. (2003) Carcinogenesis 24, 1445–1454 ATDC5 cells, TNF- increased the transcriptional rate of 12. Fukui, N., Zhu, Y., Maloney, W. J., Clohisy, J., and Sandell, L. J. (2003) BMP-2, whereas in human cells, the induction of BMP-2 was J. Bone Joint Surg. Am. 85A, Suppl. 3, 59–66 partly suppressed by an NF-B inhibitor without changing the 13. van Lent, P. L., Blom, A. B., van der Kraan, P., Holthuysen, A. E., Vitters, E., van Rooijen, N., Smeets, R. L., Nabbe, K. C., and van den Berg, W. B. (2004) stability of mRNA. The involvement of NF-B in the induction Arthritis Rheum. 50, 103–111 of BMP-2 was further suggested by the result of RNAi experi- 14. Lories, R. J., Derese, I., Ceuppens, J. L., and Luyten, F. P. (2003) Arthritis ment. In the present study, the reduction of RelA expression by Rheum. 48, 2807–2818 RNAi strongly suppressed the induction of BMP-2 by TNF-. 15. Nakase, T., Miyaji, T., Tomita, T., Kaneko, M., Kuriyama, K., Myoui, A., In the meantime, because neither addition of PDTC nor sup- Sugamoto, K., Ochi, T., and Yoshikawa, H. (2003) Osteoarthritis Cartilage pression of RelA changed the level of endogenous BMP-2 11, 278–284 16. Zoricic, S., Maric, I., Bobinac, D., and Vukicevic, S. (2003) J. Anat. 202, expression, it is assumed that the transcriptional factor may not 269–277 play a significant role in the maintenance of BMP-2 in the 17. Lyons, K. M., Pelton, R. W., and Hogan, B. L. (1989) Genes Dev. 3, untreated chondrocytes. This speculation is consistent with the 1657–1668 result that the suppression of IB by RNAi caused significant 18. Lyons, K. M., Pelton, R. W., and Hogan, B. L. (1990) Development 109, elevation of endogenous BMP-2 expression. The evidence that 833–844 the expression of BMP-2 is transcriptionally regulated by 19. Macias, D., Gan˜an, Y., Sampath, T. K., Piedra, M. E., Ros, M. A., and Hurle, J. M. (1997) Development 124, 1109–1117 NF-B has been shown in a previous study in the growth plate 20. Zhang, D., Ferguson, C. M., O’Keefe, R. J., Puzas, J. E., Roiser, R. N., and chondrocytes (24), and our current results indicated that the Reynolds, P. R. (2002) J. Bone Miner. Res. 17, 293–300 transcriptional regulation could be involved in the induction of 21. Abrams, K. L., Xu, J., Nativelle-Serpentini, C., Dabirshahsahebi, S., and BMP-2 by TNF- in articular chondrocytes, together with the Rogers, M. B. (2004) J. Biol. Chem. 279, 15916–15928 mRNA stabilization mechanism. 22. Boylan, J. F., Lufkin, T., Achkar, C. C., Taneja, R., Chambon, P., and Gudas, L. J. (1995) Mol. Cell. Biol. 15, 843–851 The induction of BMP-2 in chondrocytes could be a critical 23. Helvering, L. M., Sharp, R. L., Ou, X., and Geiser, A. G. (2000) Gene (Amst.) factor in several pathologies, e.g. osteoarthritis. In osteoarthritis 256, 123–138 joints, the anabolic activity of the chondrocytes is highly up- 24. Feng, J. Q., Xing, L., Zhang, J.-H., Zhao, M., Horn, D., Chan, J., Boyce, B. F., regulated, which likely retards disease progression (61). In Harris, S. E., Mundy, G. R., and Chen, D. (2003) J. Biol. Chem. 278, osteoarthritis cartilage, the expression of BMP-2 is significantly 29130–29135 increased (12, 15), possibly through the induction by the pro- 25. Zhou, S., Turgeman, G., Harris, S. E., Leitman, D. C., Komm, B. S., Bodine, 27240 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes P. V. N., and Gazit, D. (2003) Mol. Endocrinol. 17, 56–66 45. Bevilacqua, A., Ceriani, M. C., Capaccioli, S., and Nicolin, A. (2003) J. Cell. 26. Ghosh-Choudhury, N., Choudhury, C. G., Harris, M. A., Wozney, J., Physiol. 195, 356–372 Mundy, G. R., Abboud, S. L., and Harris, S. E. (2001) Biochem. Biophys. Res. 46. Saklatvala, J., Dean, J., and Clark, A. (2003) Biochem. Soc. Symp. 70, 95–106 Commun. 286, 101–108 47. Asson-Batres, M. A., Spurgeon, S. L., Diaz, J., DeLoughery, T. G., and 27. Fritz, D. T., Liu, D., Xu, J., Jiang, S., and Rogers, M. B. (2004) J. Biol. Chem. Bagby, H. C., Jr. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1318–1322 279, 48950–48958 48. Dorssers, L., Burger, H., Bot, F., Delwel, R., Geurts van Kessel, A. H., 28. St Johnston, D. (1995) Cell 81, 161–170 Lowenberg, B., and Wagemaker, G. (1987) Gene (Amst.) 55, 115–124 29. Mignone, F., Gissi, C., Liuni, S., and Pesole, G. (2002) Genome Biology 49. Schiavone, N., Rosini, P., Quattrone, A., Donnini, M., Lapucci, A., Citti, L., http://genomebiology.com/2002/3/3/reviews/0004 Bevilacqua, A., Nicolin, A., and Capaccioli, S. (2000) FASEB J. 14, 174–184 30. Shi, J., Schmitt-Talbot, E., DiMattia, D. A., and Dullea, R. G. (2004) In- 50. Vasudevan, S., and Peltz, S. W. (2001) Mol. Cell 7, 1191–1200 flamm. Res. 53, 377–389 51. Cox, S. J., and Morrison, A. R. (2001) J. Biol. Chem. 276, 23179–23185 31. Fowler, M. J., Jr., Neff, M. S., Borghaei, R. C., Pease, E. A., Mochan, E., and 52. Bashirullah, A., Cooperstock, R. L., and Lipshitz, H. D. (2001) Proc. Natl. Thornton, R. D. (1998) Biochem. Biophys. Res. Commun. 248, 450–453 Acad. Sci. U. S. A. 98, 7025–7028 32. Atsumi, T., Miwa, Y., Kimata, K., and Ikawa, Y. (1990) Cell Differ. Dev. 30, 53. Chen, C. Y., Xu, N., and Shyu, A. B. (1995) Mol. Cell. Biol. 15, 5777–5788 109–116 54. Peng, S. S., Chen, Y., and Shyu, A. B. (1996) Mol. Cell. Biol. 16, 1490–1499 33. Kuettner, K. E., Pauli, B. U., Gall, G., Memoli, V. A., and Schenk, R. K. 55. Brook, M., Sully, G., Clark, A. R., and Saklatvala, J. (2000) FEBS Lett. 483, (1982) J. Cell Biol. 93, 743–750 57–61 34. Seto, H., Kamekura, S., Miura, T., Yamamoto, A., Chikuda, H., Ogata, T., 56. Dean, J. L., Brook, M., Clark, A. R., and Saklatvala, J. (1999) J. Biol. Chem. Hiraoka, H., Oda, H., Nakamura, K., Kurosawa, H., Chung, U.-I., Kawagu- 274, 264–269 chi, H., and Tanaka, S. (2004) J. Clin. Invest. 113, 718–726 57. Dixon, D. A., Kaplan, C. D., McIntyre, T. M., Zimmerman, G. A., and 35. Beelman, C. A., and Parker, R. (1994) J. Biol. Chem. 269, 9687–9692 Prescott, S. M. (2000) J. Biol. Chem. 275, 11750–11757 36. Dean, J. L. E., Sully, G., Clark, A. R., and Saklatvala, J. (2004) Cell. Signal. 16, 58. Carballo, E., Chao, H., Lai, W. S., Kennington, E. A., Campbell, D., and 1113–1121 Blackshear, P. J. (2001) J. Biol. Chem. 276, 42580–42587 37. Esnault, S., and Malter, J. S. (2002) Blood 99, 4048–4052 59. Dean, J. L., Wait, R., Mahtani, K. R., Sully, G., Clark, A. R., and Saklatvala, 38. Shaw, G., and Kamen, R. (1986) Cell 46, 659–667 J. (2001) Mol. Cell. Biol. 21, 721–730 39. Chen, C. Y., Gherzi, R., Andersen, J. S., Gaietta, G., Jurchott, K., Royer, 60. Wilson, G. M., Lu, J., Sutphen, K., Sun, Y., Huynh, Y., and Brewer, G. H. D., Mann, M., and Karin, M. (2000) Genes Dev. 14, 1236–1248 (2003) J. Biol. Chem. 278, 33029–33038 40. Ming, X. F., Kaiser, M., and Moroni, C. (1998) EMBO J. 17, 6039–6048 61. Sandell, L. J., and Aigner, T. (2001) Arthritis Res. 3, 107–113 41. Short, S., Tian, D., Short, M. L., and Jungmann, R. A. (2000) J. Biol. Chem. 62. Grunder, T., Gaissmaier, C., Fritz, J., Stoop, R., Hortschansky, P., Mollen- 275, 12963–12969 hauer, J., and Aicher, W. K. (2004) Osteoarthritis Cartilage 12, 559–567 42. Ming, X. F., Stoecklin, G., Lu, M., Looser, R., and Moroni, C. (2001) Mol. 63. Stewart, M. C., Saunders, K. M., Burton-Wurster, N., and Macleod, J. N. Cell. Biol. 21, 5778–5789 (2000) J. Bone Miner. Res. 15, 166–174 43. Stoecklin, G., Hahn, S., and Moroni, C. (1994) J. Biol. Chem. 269, 64. Rountree, R. B., Schoor, M., Chen, H., Marks, M. E., Harley, V., Mishina, 28591–28597 Y., and Kingley, D. M. (2004) PLoS Biol. 2, e335 http://www.plosbiology. 44. Wilusz, C. J., Wormington, M., and Peltz, S. W. (2001) Nat. Rev. Mol. Cell. Biol. 2, 237–246 org. doi:10.1371/journal.pbio.0020355 SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27241 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry American Society for Biochemistry and Molecular Biology

Pro-inflammatory Cytokine Tumor Necrosis Factor-α Induces Bone Morphogenetic Protein-2 in Chondrocytes via mRNA Stabilization and Transcriptional Up-regulation *

Download PDF
13 pages

Loading next page...
 
/lp/american-society-for-biochemistry-and-molecular-biology/pro-inflammatory-cytokine-tumor-necrosis-factor-induces-bone-RHeAjUFJUg

References (62)

Publisher
American Society for Biochemistry and Molecular Biology
Copyright
Copyright © 2006 Elsevier Inc.
ISSN
0021-9258
eISSN
1083-351X
DOI
10.1074/jbc.m603385200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 37, pp. 27229 –27241, September 15, 2006 © 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Pro-inflammatory Cytokine Tumor Necrosis Factor- Induces Bone Morphogenetic Protein-2 in Chondrocytes via mRNA Stabilization and Transcriptional Up-regulation Received for publication, April 10, 2006, and in revised form, June 12, 2006 Published, JBC Papers in Press, July 11, 2006, DOI 10.1074/jbc.M603385200 ‡1 ‡ ‡ ‡ § ‡ ‡ Naoshi Fukui , Yasuko Ikeda , Toshiyuki Ohnuki , Atsuhiko Hikita , Sakae Tanaka , Shoji Yamane , Ryuji Suzuki , ¶ ‡ Linda J. Sandell , and Takahiro Ochi From the Department of Pathomechanisms, Clinical Research Center, National Hospital Organization Sagamihara Hospital, Sagamihara, Kanagawa 228-8522, Japan, the Department of Orthopaedic Surgery, Faculty of Medicine, the University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan, and the Department of Orthopaedic Surgery, Washington University School of Medicine, St. Louis, Missouri 63110 In articular chondrocytes, the inflammatory cytokine tumor their ability to induce ectopic bone formation (1). Molecular necrosis factor- (TNF-) induces the expression of bone morpho- cloning of the BMPs later revealed that the proteins belong to genetic protein-2 (BMP-2), a growth factor known to be involved in the transforming growth factor- superfamily (2). The evolu- the induction of cartilage and bone. A study was performed to clar- tionary conservation of BMPs is remarkable. For example, the ify the mechanism(s) underlying the induction of BMP-2 in chon- amino acid sequence of Drosophila protein decapentaplegic drogenic ATDC5 cells and primary cultured adult human articular (dpp)is 75% identical to human BMP-2 and is functionally chondrocytes. In ATDC5 cells, the endogenous BMP-2 expression interchangeable with recombinant human protein as to its abil- was consistently low throughout the process of chondrogenic dif- ity to ectopically induce bone formation in rodents (3). ferentiation, and TNF- induced BMP-2 expression only after the BMPs are critical in embryonal development and postnatal cells acquired the chondrogenic phenotype. The results of nuclear growth. Among them, BMP-2 plays a vital role in fetal develop- run-off assay and cycloheximide treatment consistently indicated ment. Mice lacking functional BMP-2 gene die during early that ATDC5 cells acquire the capacity to synthesize BMP-2 mRNA embryogenesis due to malformation of the proamniotic canal in the nuclei during the differentiation process. In an attempt to and a defect in cardiac development (4). Subsequent studies explain the discrepancy between the active nuclear mRNA synthe- have shown that the growth factor is involved in various aspects sis and the observed low expression level in differentiated ATDC5 of development such as skin and hair formation, neural cell cells, the stability of BMP-2 mRNA was evaluated, and the cells differentiation, and cartilage and bone formation (5). The role were found to regulate the expression of BMP-2 at the post-tran- of BMP-2 in skeletal development is particularly crucial. At the scriptional level. Human chondrocytes were confirmed to have a early stage of embryogenesis, BMP-2 is expressed in specific similar post-transcriptional regulation. The result of 3-rapid areas of limb buds to form prechondrogenic condensations, amplification of cDNA end revealed that both human and mouse and it later promotes cellular differentiation into chondrocytes BMP-2 mRNAs contain multiple pentameric AUUUA motifs in a (6). conserved manner in the 3-untranslated regions, and transient Besides its roles in developmental and growth processes, transfection experiments demonstrated that TNF- increases the BMP-2 is also expressed in postnatal animals and is often asso- stability of BMP-2 mRNA through the pentameric motifs. Further ciated with various pathologies. The growth factor is expressed experiments revealed that TNF- modulates mRNA stability via in the process of bone healing where it regulates cellular differ- p38 signal transduction pathway, whereas the cytokine also aug- entiation, proliferation, and matrix production (7, 8). Various mented the expression of BMP-2 through transcriptional up-regu- tumors have been found to express BMP-2. Indeed, this protein lation via the transcriptional factor NF-B. is known to exert diverse effects on tumor cells, ranging from the facilitation of tumor growth to the induction of cellular apoptosis (9–11). We and other investigators have found that Bone morphogenetic proteins (BMPs) are a group of BMP-2 is expressed at high levels in arthritic joints by both secreted signaling proteins that were originally identified by chondrocytes and synovial cells, possibly promoting chondro- cyte anabolism and osteophyte formation (12–16). Because of its potent biological actions, the expression of * This work was supported in part by Grants-in-aid from the Japan Society for the Promotion of Science (Grant 15390467), the Ministry of Education, Cul- BMP-2 must be strictly regulated in vivo. In fact, BMP-2 is ture, Sports, Science and Technology of Japan (Grant 16659416), the Mitsui expressed in a highly tissue- and stage-specific pattern during Life Social Welfare Foundation, the Nakatomi Foundation. The costs of embryogenesis (17, 18), and either enhancement or inhibition publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement”in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. To whom correspondence should be addressed. Tel.: 81-42-742-8311; Fax: nuclear factor-B; IB, inhibitor of B; PDTC, pyrrolidine dithiocarbam- 81-42-742-7990; E-mail: [email protected]. ate; MAP, mitogen-activated protein; MKK, mitogen-activated protein The abbreviations used are: BMP, bone morphogenetic protein; UTR, kinase kinase; CHX, cycloheximide; ActD, actinomycin D; ERK, extracellular untranslated region; TNF, tumor necrosis factor; GAPDH, glyceroaldehyde- signal-regulated kinase; JNK, c-Jun N-terminal kinase; RNAi, RNA interfer- 3-phsophate dehydrogenase; ARE, AU-rich element; nt, nucleotide; NF-B, ence; siRNA, small interfering RNA. SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27229 This is an Open Access article under the CC BY license. Induction Mechanisms of BMP-2 by TNF- in Chondrocytes of its activity is know to cause a significant disturbance in skel- media containing 10% fetal bovine serum, penicillin, strepto- etal formation (19, 20). However, although the function of mycin, and 25 g/ml ascorbic acid (Sigma). For cartilage BMP-2 has been extensively studied, less is known about the explants, full thickness articular cartilage was aseptically mechanisms that regulate production of the growth factor. To obtained from metacarpophalangeal joints of adult bovine ani- date, several studies have shown that the expression of the gene mals and punched out into discs 3 mm in diameter. The is regulated at the transcriptional level. Retinoic acid induces explants were cultured in DMEM (Invitrogen) containing 10% BMP-2 expression through transcriptional activation in osteo- fetal bovine serum, penicillin, streptomycin, and 25 g/ml blastic cells, possibly via retinoic acid receptor  (21–23). ascorbic acid. NF-B has been shown to regulate the transcriptional activity For the inhibitors used in the study, cycloheximide, actino- of BMP-2 in growth plate chondrocytes during endochondral mycin D, pyrrolidine dithiocarbamate, ionomycin, and wort- bone development (24). The transcriptional activity might be mannin were purchased from Sigma, U0126 and SP600125 enhanced by estrogen (25) and, interestingly, by BMP-2 itself were from Biomol (Plymouth Meeting, PA), and SB202190, (26). Thus, transcriptional regulation is considered to play an SB202474, SB203580, PD98059, and GF109203X were important role in expression of the protein. obtained from Calbiochem. Recombinant mouse and human On the other hand, BMP-2 expression could also be regu- TNF- were purchased from Chemicon International lated at the post-transcriptional level. Computer analyses have (Temecula, CA); recombinant mouse noggin was from R&D revealed that the proximal part of the 3-untranslated region Systems (Minneapolis, MN). (3-UTR) of BMP-2 gene is highly conserved across a wide Real-time Quantitative PCR Analysis—Total RNA was range of species (21, 27). That fact suggests the involvement of extracted from the cells using the RNeasy kit (Qiagen, Valencia, post-transcriptional regulation for the expression of BMP-2, CA) with DNaseI (Qiagen) treatment, and 1 g of total RNA because 3-UTRs of mRNA often contain sequences to regulate was employed to synthesize cDNA using avian myeloblastosis post-transcriptional events (28, 29). In fact, a recent report has virus reverse transcriptase (Roche Diagnostics). The cDNA was shown that degradation of the gene transcripts could be regu- then used for real-time quantitative PCR on a LightCycler lated by the region (27). However, details of the regulatory (Roche Diagnostics). For mouse BMP-2 and glyceraldehyde-3- mechanism are not yet known, and the biological significance phosphate dehydrogenase (GAPDH) genes, respective pairs of of transcriptional and post-transcriptional regulation has yet to gene-specific hybridization probes labeled with fluorescein be established. (Flu) and LightCycler-Red640 (LC640) dyes, respectively, were We and others recently reported that the pro-inflammatory used to monitor the amount of PCR product. The primer cytokines interleukin-1 and TNF- induce BMP-2 expression sequences were 5-TGCACCAAGATGAACACAG-3 and 5- in adult articular chondrocytes and a chondrosarcoma cell line GCTGTTTGTGTTTGGCTTG-3 for BMP-2, and 5-TGAA- (12, 30). Similar BMP-2 induction by those cytokines is also CGGGAAGCTCACTGG-3 and 5-TCCACCACCCTGTTG- observed in synovial cells (14, 31) and could be a widespread CTGTA-3 for GAPDH. The probe sequences were 5-TCGT- event in arthritic joints. In this study, the mechanism of BMP-2 TTGTGGAGCGGATGTCCTTTT/Flu/-3 and 5-/LC640/C- induction by TNF- was studied in chondrogenic ATDC5 cells ATCATGTCCAAAAGTCACTAGCAATGGC-3 for BMP-2, and primary cultured adult human articular chondrocytes. Our and 5-CTGAGGACCAGGTTGTCTCCTGCGA/Flu/-3 and results indicated that both transcriptional and post-transcrip- 5-/LC640/TTCAACAGCAACTCCCACTCTTCCACC-3 tional regulation are involved in the induction of BMP-2. for GAPDH (Nihon Gene Research Laboratory, Sendai, Japan). PCR of human BMP-2, RelA, Ib, and GAPDH genes was EXPERIMENTAL PROCEDURES performed using the LightCycler FastStart DNA Master SYBR Cell Culture—ATDC5 cells were obtained from the RIKEN Green I (Roche Diagnostics), and the amount of PCR product cell bank (Tsukuba, Japan) and cultured in a 1:1 mixture of was monitored by the intensity of fluorescence from the dye Dulbecco’s modified Eagle’s medium and Ham’s F-12 medium bound to the product. The primer sequences were 5-CCCCG- (DMEM/F-12, Invitrogen) containing 5% fetal bovine serum GGGTATCACGCCTTT-3 and 5-GCGACACCCACAACC- (fetal bovine serum, Invitrogen), 50 units/ml penicillin, 50 CTCCA-3 for BMP-2, 5-CAGAGTTACCTACCAGGGCT- g/ml streptomycin, 10 g/ml human transferrin (Roche ATTC-3 and 5-TCTGACTCTGTGTCATAGCTCTCC-3 Molecular Biochemicals, Indianapolis, IN), and 3  10 M for RelA, 5-ACGAGCTTGTAGGAAAGGACTG-3 and 5- sodium selenite (Sigma) (32). To induce chondrogenic differ- GCTGCTCTTCTATAGGAACTTGGA-3 for IB, and 5- entiation, bovine insulin (Sigma) was added to the media at a CAGGGACTCCCCAGCAGT-3 and 5-GGCATTGCCCTC- concentration of 10 g/ml. Human chondrocytes were AACGACCA-3 for GAPDH. obtained from 29 osteoarthritic knee joints in 28 patients at the The PCR protocol was the same for all genes, i.e. 95 °C for 10 time of joint replacement surgery. The material collection was min to activate Taq polymerase, then 40 cycles of 95 °C for 10 s, performed under the approval of institutional review boards, 60 °C for 15 s, and 72 °C for 6 s. When SYBR green dye was used and informed consent in writing was obtained from all patients. to monitor PCR, melting curves were routinely recorded to ver- Articular chondrocytes were liberated from cartilage tissue by ify the singularity of the PCR product. In each sample, the level sequential enzymic digestion of 0.5% Pronase (Calbiochem) of cDNA was normalized by the expression of GAPDH. and 0.025% collagenase P (Roche Diagnostics, Basel, Switzer- Nuclear Run-off Assay—ATDC5 cells were seeded to 225- 2 3 2 land) (33). Isolated cells were plated onto 6- or 12-well plates at cm flasks at a density of 2  10 /cm and incubated under the 5 2 a density of 2  10 cells/cm and cultured in DMEM/F-12 aforementioned conditions. Soon after reaching confluency or 27230 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes following 15 days of culture in the insulin-containing media, cloned into the KpnI and EcoRI sites of pcDNA3.1/Zeo(). the cells were incubated for another 48 h in the presence or cDNA for the entire 3-UTR of mouse BMP-2 was generated absence of 20 ng/ml of recombinant mouse TNF-. The cells by PCR and subcloned into pCR2.1 vector. Using the vector were then harvested, lysed in 4 ml of the Nonidet P-40 buffer as a template, specific regions of the 3-UTR were amplified (10 mM Tris, pH 7.4, 10 mM NaCl, 3 mM MgCl , and 0.5% Non- by PCR and ligated into pcDNA3.1/Zeo() between the idet P-40). The nuclei thus obtained were resuspended in glyc- EcoRI and XbaI sites. Thus, either the entire or a specific erol storage buffer (40% glycerol, 50 mM Tris, pH 8.3, 5 mM region of mouse BMP-2 3-UTR was placed between the MgCl , and 0.1 mM EDTA) and immediately stored in liquid luciferase gene and the BGH polyadenylation site of the vec- nitrogen until use. tor. All constructs were analyzed by restriction mapping and RNA transcripts were labeled by incubation of the nuclei in a DNA sequencing. reaction buffer (5 mM Tris, pH 8.0, 2.5 mM MgCl , 150 mM KCl, Transient Transfection Assays—Transient transfection 0.5 mM ATP, 0.5 mM CTP, 0.5 mM GTP, and 1 mM dithiothre- experiments were performed in differentiated ATDC5 cells itol) containing 100 Ci of [- P]UTP (10 mCi/ml, GE Health- using each of the prepared luciferase vectors and a phRL-TK care, Piscataway, NJ) for 30 min at 30 °C. Nuclei from 1–3 10 vector (Promega). The cells were plated on 12-well plates, and cells were used for each transcript reaction. The reaction mix- differentiation was induced as previously described. DNA ture was treated with DNase I and proteinase K, and RNA was transfection was carried out using the SuperFect transfection isolated by phenol-chloroform extraction and ethanol precipi- reagent (Qiagen). For each well, 0.5 g of the luciferase vector tation. pCR2.1 vectors (Invitrogen) containing cDNAs for the and 1.5 g of phRL-TK vector were mixed with 4 l of Super- entire mouse BMP-2 3-UTR, partial mouse GAPDH, and full- Fect reagent and 75 l of DMEM/F-12 medium, and the mix- length mouse -actin were prepared respectively, together with ture was incubated for 10 min at room temperature. The rea- an empty vector. Five micrograms of each plasmid was linear- gent mixture was combined with 400 l of the complete culture ized by HindIII digestion, denatured with 0.2 M NaOH, blotted medium, which was transferred to the washed cell monolayer in onto nylon membranes (Hybond-N, GE Healthcare), and each well. After incubation for 14–18 h, the medium contain- immobilized by UV-cross-linking. The membrane was pre-hy- ing transfection reagent was replaced with the complete bridized with ULTRAhyb (Ambion, Austin, TX), and hybrid- medium. For some experiments, recombinant mouse TNF- ization was then allowed to proceed at 42 °C for 14–16 h. The was added to the medium at a concentration of 10 ng/ml. The membranes were washed twice in 2 SSC at 65 °C, treated with transfected cells were cultured for 48 h and then lysed in 100 l RNase A, and washed again in 2  SSC at 37 °C. The analysis of reporter lysis buffer (Promega). Luciferase activity was was performed by phosphorimaging using a Typhoon 9410 (GE assayed on a luminometer (JNR AB-2100, Atto, Tokyo, Japan) Healthcare) with ImageQuaNT software (GE Healthcare). using a Dual-Glo luciferase assay system (Promega). All trans- 3-Rapid Amplification of cDNA Ends—The 3-end of mouse fection experiments were repeated at least three times in BMP-2 gene was determined using a GeneRacer kit (Invitro- duplicate. gen) following the manufacturer’s protocol. In brief, total RNA Preparation of Adenovirus Vector and Gene Transduction— was extracted from bone tissues of C57BL/6 mice, and cDNA The recombinant adenovirus vector carrying constitutively was synthesized using an oligo(dT)-adapter primer provided by active MAP kinase kinase 6 (MKK6) gene under the control of the kit. The first PCR was performed using 1 g of the synthe- chicken -actin promoter and cytomegalovirus IE enhancer sized cDNA as a template with mGSP1 (5-AGAAAACGTCT- was generated by the DNA-terminal protein complex method CGCCACCCTCC-3) and 3 primer for the adaptor. The PCR (34). The adenovirus carrying -galactosidase was obtained product containing the 3-end of human BMP-2 mRNA was from BD Biosciences (San Jose, CA). Titers of the adenovirus obtained by using a nested PCR using the first PCR product as a were determined by an Adeno-X Rapid Titer kit (BD Bio- template, and mGSP2 (5-TACATTTGCCTGACACGCA- sciences) following the manufacturer’s protocol. The titer was GCA-3) and the 3-nested primer provided by the kit as prim- represented by the multiplicity of infection. ers. The PCR product was subcloned into pCR2.1 vector and To infect the adenovirus vectors in cultured human chon- subjected to DNA sequencing. The 3-rapid amplification of drocytes, the culture media in each well of 6- or 12-well plates cDNA ends of human BMP-2 mRNA was performed in the was replaced by 1.0 or 0.5 ml of serum-free DMEM/F-12 same manner, using total RNA from primary cultured chon- medium containing the adenoviruses at the indicated multi- drocytes to generate cDNA, and an external primer hGSP1 plicity of infection. The cells were incubated for 2 h under nor- (5-TGGCACGTCCGGGTTACCATGTTCATTA-3) and an mal culture conditions, after which 5 times the volume of the internal primer hGSP2 (5-TGAAGCCCTTACAGGCCAAA- complete medium was added to each well. GGACCACA-3) for the first and nested PCR, respectively. Western Blotting—Approximately 1  10 cells were lysed in DNA sequences were determined by using the Long-Read 0.5 ml of radioimmune precipitation assay buffer containing Tower System (GE Healthcare). Three clones were sequenced proteinase inhibitors (0.5 ml of 50 mM Tris-HCl, pH 7.4, 150 for each gene. mM NaCl, 1% (v/v) Triton X-100, 1% (w/v) sodium deoxy- Plasmid Constructions—Luciferase reporter expression con- cholate, 0.1% (w/v) SDS, and a mixture of proteinase inhibitors structs harboring mouse BMP-2 3-UTR at the 3-end of the (Complete Mini, Roche Diagnostics)) for 10 min on ice with luciferase coding region were prepared in pcDNA3.1/Zeo() occasional mixing. The lysate was clarified by centrifugation at expression vector (Invitrogen). The luciferase cDNA was 12,000  g for 20 min at 4 °C. Twenty micrograms of protein generated from pGL3-Basic vector (Promega) by PCR and was subjected to SDS-PAGE with 8–16% polyacrylamide sepa- SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27231 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes rating gel in the reducing condition and electronically trans- tation kit (Invitrogen), and the radioactivity was normalized by ferred onto a nitrocellulose membrane (Bio-Rad). After block- the amount of DNA. Immunohistochemistry—Immunohistochemistry of carti- ing, the membrane was incubated with either anti-p38 MAP lage explants was performed following a previously described kinase or anti-phopho-p38 MAP kinase (Thr-180/Thy-182) method (12) with some modifications. In brief, 6-m-thick antibody (Cell Signaling Technology, Beverly, MA) and then cryosections were prepared from the explants, fixed in acetone, with the secondary antibody conjugated with peroxidase (Santa and digested with 1.0% hyaluronidase (Sigma) for antigen Cruz Biotechnology, Santa Cruz, CA). Immunoreactive protein retrieval. To detect the presence of BMP-2, anti-human BMP-2 was finally visualized using a SuperSignal West Pico chemilu- goat polyclonal antisera (Santa Cruz Biotechnology) were used minescent substrate (Pierce). at the concentration of 1:100, which was visualized with the RNAi Experiments—The expression of p65 subunit of NF-B avidine-linked peroxidase system (goat ABC staining system, or RelA and IB was suppressed by RNAi in primary cultured Santa Cruz Biotechnology) coupled with 3-amino-9-ethylcar- human chondrocytes. All siRNAs were purchased from Qiagen, bazole substrate (DakoCytomation, Carpinteria, CA). The sec- and two siRNAs with distinctive sequences were used for each tions were observed under a light microscope without nuclei gene. The sense strand sequences of the RNA duplexes were as staining, to facilitate direct comparison of the staining intensi- follows: RelA#1, 5-GGACAUAUGAGACCUUCAAdTdT-3; ties among the sections. RelA#2, 5-GAUUGAGGAGAAACGUAAAdTdT-3;IB#1, Statistical Analyses—For statistical analyses, data were com- 5-GGGUGUACUUAUAUCCACATdT-3;IB#2, 5-GGG- pared using one-way factorial analysis of variance, and when CCAGCUGACACUAGAAdTdT-3; and control siRNA, necessary, Fisher’s PLSD was used as a post-hoc test. Statistical 5-UUCUCCGAACGUGUCACGUdTdT-3. significance was set at p  0.05. The siRNAs were delivered into human chondrocytes by electroporation following cell isolation from cartilage matrix. RESULTS Electroporation was performed using a Nucleofector device TNF- and Cycloheximide Induced BMP-2 Expression in Dif- and a Human Chondrocyte Nucleofector kit (Amaxa, Cologne, ferentiated, Not Undifferentiated, ATDC5 Cells—As a prelimi- Germany) following the manufacturer’s instructions. In brief, nary experiment, the time course of chondrogenic differentia- 1  10 cells were suspended in 100 l of the electroporation tion of ATDC5 cells was determined by evaluating the buffer provided by the kit, along with 1.5 lof68 M stock expression of type II procollagen and aggrecan as well as type X solution of siRNA. Thus, the final concentration of siRNA in procollagen from Day 0 until Day 25, every 5 days after addition the buffer was 100 nM. The buffer was then transferred to a of insulin to the media. Under our experimental conditions, the supplied cuvette, and electroporation was performed using the expression of type II procollagen and aggrecan began to protocol recommended by the manufacturer. After electropo- increase at Day 10 and rose continuously up to Day 25 (data not ration, the cells were immediately transferred onto each well of shown). Meanwhile, the expression level of type X procollagen 12-well plates and cultured in DMEM/F-12 containing 20% was very low from Day 0 to Day 15 and then was up-regulated at fetal bovine serum. Next day, the media were replaced to the Day 20 and beyond (data not shown), indicating the occur- aforementioned regular culture media for human chondro- rence of a hypertrophic change in the cells. Based on these cytes. The viability of cells was 60% with the procedure. observations, the induction of BMP-2 by TNF- in ATDC5 Incorporation of [ S]Sulfate into Cartilage Explants—For cells was investigated between Days 0 and 15 in the following this experiment, 20–40 cartilage explants were prepared from experiments. normal bovine articular cartilage and equally divided into 4 Without TNF- stimulation, the expression level of BMP-2 groups. The first group was cultured in the aforementioned was consistently low in ATDC5 cells from Day 0 to Day 15 (Fig. culture medium for 6 days, while changing the medium every 2 1, A–D). The response to TNF- varied according to the stage days. The second group was first cultured in the same medium of chondrogenic differentiation. At Days 0 and 5 when the cells for 4 days, and then for 2 days in a medium containing recom- were still undifferentiated, TNF- did not induce the expres- binant mouse noggin (1 g/ml). The third and fourth groups sion of BMP-2. With the onset of chondrogenic differentiation, were initially cultured in a medium containing 2.5 ng/ml a weak induction was observed at Day 10 (Fig. 1C), and it recombinant human TNF- for 4 days. The third group was became obvious at Day 15 as the differentiation progressed (Fig. then cultured in the regular culture medium for 2 days, whereas 1D). In Day-15 cells, the induction was dose-dependent, and its the fourth group was cultured in a medium containing 1 g/ml maximum was observed with 100 ng/ml TNF-. The cells cul- recombinant noggin. For all four groups, newly synthesized sul- tured for 15 days without insulin showed a weaker response to fated proteoglycan was radiolabeled for the last8hof culture TNF-, presumably due to the lack of chondrogenic differenti- with 10 Ci/ml [ S]sulfate (GE Healthcare). The explants were ation (Fig. 1E). then recovered, extensively rinsed with ice-cold phosphate- Next, the effect of a protein synthesis inhibitor, cyclohexi- buffered saline, and subjected to papain digestion. The diges- mide (CHX), was studied at different stages of differentiation tion was performed using 50 g/ml papain (Sigma) in 500 lof (Fig. 1F). In Day-0 cells, the expression of BMP-2 was not digestion buffer (0.2 M sodium acetate, pH 6.0) at 60 °C over- affected by CHX. In Day-10 cells, CHX induced a moderate night. The digest was then centrifuged, and 20 l of supernatant expression of BMP-2, and in Day-15 cells the induction was was used to measure the radioactivity. DNA content was also obvious. In various genes, CHX is known to induce mRNA determined using a PicoGreen double-stranded DNA quanti- expression by disrupting the linkage between mRNA transla- 27232 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes was evaluated using an RNA synthe- sis inhibitor, actinomycin D (ActD). The result of this experiment revealed that the degradation rate of BMP-2 mRNA was indeed reduced by TNF- (Fig. 2C). In the presence of TNF-, the half-life of BMP-2 mRNA was extended from 137 to 257 min, an increase of88%. Thus, the involvement of a post-transcrip- tional mechanism in the induction of BMP-2 by TNF- was indicated. TNF- Induces BMP-2 in Human Articular Chondrocytes by Increas- ing mRNA Stability—In the next experiment, the involvement of post-transcriptional mechanism(s) in the induction of BMP-2 was examined in primary cultured adult human articular chondrocytes. FIGURE 1. Induction of BMP-2 in ATDC5 cells by TNF- and cycloheximide. A–E, effect of TNF- on BMP-2 expression was evaluated on ATDC5 cells at various stages of chondrogenic differentiation. Before (A) and after Before examining that hypothesis, culture for 5 (B), 10 (C), or 15 days (D) in insulin-containing media, ATDC5 cells were treated with graded doses the induction of BMP-2 in human of TNF- for 48 h, and expression of BMP-2 mRNA was evaluated. In parallel, cells maintained for 15 days in insulin-free media were treated with TNF-, and expression of BMP-2 was evaluated (E). F, ATDC5 cells cultured chondrocytes was evaluated under in insulin-containing media for 0, 10, or 15 days were treated with 2.5 g/ml CHX for 24 h, and BMP-2 mRNA our experimental conditions. The expression was evaluated. For these experiments, expression of BMP-2 mRNA was evaluated by real-time PCR endogenous expression level of together with GAPDH expression; results are shown in relative ratios against GAPDH. Data are mean  S.D. of three to five experiments. BMP-2 in human chondrocytes was considerably higher than that in dif- tion and mRNA degradation (35). Therefore, our result sug- ferentiated ATDC5 cells, and, in accordance with our previous gested the possibility that BMP-2 mRNA might have been syn- observation (12), TNF- up-regulated BMP-2 expression 10- thesized at a certain level in differentiated ATDC5 cells, even fold (Fig. 3A). The induction was dose-dependent, and similar though the observed expression level was very low. to that in ATDC5 cells, the maximum induction was observed BMP-2 Expression Is Regulated at Both Transcriptional and at 100 ng/ml. Post-transcriptional Levels in ATDC5 Cells—To determine the The experiment with CHX was repeated with human chon- transcriptional activity of BMP-2 gene, a nuclear run-off assay drocytes, and a strong induction of BMP-2 was again observed, was performed on differentiated and undifferentiated ATDC5 suggesting the presence of a similar post-transcriptional regu- cells with or without TNF- stimulation (Fig. 2, A and B). The lation in human cells (Fig. 3B). The effect of CHX was observed result revealed that the expression of BMP-2 was suppressed at at and above a concentration of 2.5 g/ml, and 10 g/ml CHX the transcriptional level in undifferentiated cells but that the seemed sufficient to obtain the maximum induction. gene transcripts were being synthesized at a substantial level in Next, the stability of BMP-2 mRNA in human chondrocytes the nuclei of differentiated cells. In the differentiated ATDC5 was evaluated in the presence or absence of TNF- (Fig. 3C). cells, TNF- treatment enhanced mRNA synthesis, whereas Some cells were treated with TNF- for 48 h, and the mRNA the cytokine had virtually no effect on it in undifferentiated stability was then evaluated in the presence of TNF-. The cells. results showed that TNF- also stabilizes BMP-2 mRNA in Thus, results of the CHX treatment and nuclear run-off assay human articular chondrocytes. The mRNA half-life was both indicated that, in ATDC5 cells, BMP-2 mRNA is synthe- extended 2.6 times from 72 to 185 min by TNF-. Interest- sized at a certain level in the nuclei of cells once they acquired ingly, an extended TNF- treatment for 48 h resulted in further the chondrogenic phenotype. However, the observed level of mRNA stabilization, and the half-life was prolonged to 278 min, BMP-2 expression was very low in the differentiated ATDC5 which was 390% of that in the untreated cells. cells as long as they were not treated with TNF- (Fig. 1, A–D). Human and Mouse BMP-2 mRNA Contain AU-rich Ele- The apparent contradiction between the results strongly sug- ments in 3-UTRs—To determine the 3-UTR sequence, gested the involvement of a post-transcriptional mechanism in 3-rapid amplification of cDNA ends was performed on human the regulation of BMP-2 expression. and mouse BMP-2 mRNA. The results revealed that the To examine this hypothesis, we evaluated the stability of 3-UTR of human BMP-2 had a length of 3736 nt, whereas that BMP-2 mRNA in differentiated ATDC5 cells in the presence or of mouse 3-UTR was 1170 nt (Fig. 4). Mouse 3-UTR shows an absence of TNF-. Because the basal expression level of BMP-2 82% sequence identity with human 3-UTR. Although both was too low to evaluate the degradation rate, the cells were 3-UTRs are longer than the average lengths of the respective initially treated with TNF- for 48 h to induce certain levels of species (29), they are both encoded by the third or the last exon BMP-2 expression, after which the degradation rate of mRNA of the gene together with the last part of the translated region. SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27233 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes FIGURE 3. Involvement of post-transcriptional regulation in expression of BMP-2 in human chondrocytes. A, human articular chondrocytes were maintained by monolayer culture and treated with graded concentrations of TNF-. Induction of BMP-2 was evaluated 48 h later. B, chondrocytes were treated with graded doses of CHX for 24 h, and BMP-2 expression was evalu- ated. C, decay of BMP-2 mRNA was evaluated in presence (filled circles)or absence (open circles) of TNF-, using ActD (1 M). Decay of mRNA was also evaluated in cells treated with TNF- for 48 h prior to addition of ActD and in the continuous presence of the cytokine (filled squares). For these experi- ments, expression of BMP-2 was evaluated by real-time PCR together with GAPDH expression. In A and B, results are shown as ratios against GAPDH. In C, RNA ratios at respective time points were normalized by the ratio at begin- ning of the evaluation (i.e. time 0) in each experiment to facilitate direct com- parison. Data are mean  S.D. of three to five experiments. region, and mouse has 8 in the proximal third of the region (Fig. 4). The alignment of the 8 motifs in the mouse gene is well FIGURE 2. Synthesis of BMP-2 mRNA in nuclei, and stability of mRNA in conserved in the human gene, suggesting their functional cytoplasm in the presence or absence of TNF-. A, nuclear run-offs from differentiated and undifferentiated ATDC5 cells. Immediately after reaching significance. confluency (Day 0) or after culture in insulin-containing media for 15 days Induction of BMP-2 by TNF- Is Mediated by the AU-rich (Day 15), ATDC5 cells were treated with or without 20 ng/ml TNF- for 48 h, Element in 3-UTR—The functional significance of the ARE in and nuclei were obtained. RNA synthesis was allowed to proceed in nuclei in the presence of [- P]UTP, and amounts of synthesized BMP-2 gene tran- BMP-2 3-UTR was investigated by generating luciferase scripts were evaluated by slot blot analysis together with those for GAPDH, reporter constructs harboring either the entire or various parts -actin, and pCR2.1 vector without insert (for background). The experiment was repeated twice with consistent results. B, signal ratios between BMP-2 of mouse BMP-2 3-UTR at the 3-end of the luciferase coding 3-UTR and -actin were quantified after subtracting background. C, ATDC5 region (Fig. 5A). cells were maintained in insulin-containing media for 15 days, and stimulated To analyze the function of the region, that 3-UTR was with 100 ng/ml TNF- for 48 h to induce BMP-2 expression. Degradation of BMP-2 mRNA was then evaluated by addition of ActD (1 M), with (open cir- divided into four parts according to the distribution of pentam- cles) or without (filled circles) withdrawal of TNF- from media. At each time eric AUUUA motifs. The first part, designated part A, involves point, remaining amounts of BMP-2 mRNA were evaluated by real-time PCR together with GAPDH mRNA; results are shown in relative ratios against the first 189 nt with two pentamers. The next 137 nt containing GAPDH. Data are mean  S.D. of three experiments. four pentamers was designated part B. Part C contained the following 114 nt with two pentamers, and the remaining 730 nt For various genes, the stability of mRNA is regulated by cis- without motifs was designated part D. These parts were acting elements in 3-UTR (28, 29). Among them, the adeno- inserted, alone or in combination, after the stop codon of the sine/uridine-rich element (ARE) is a well characterized luciferase coding region. sequence that has the function of modulating mRNA degrada- The constructs were transiently transfected to the differen- tion in response to various extracellular stimuli. The element tiated ATDC5 cells, and the luciferase activity was measured often contains repeats of pentameric AUUUA motifs. The (Fig. 5B). The results revealed that the addition of the entire result of sequencing revealed that both human and mouse 3-UTR reduced luciferase activity by 75%. When parts A, B, BMP-2 3-UTRs contain multiple copies of the pentameric or D were inserted alone, a significant reduction was observed motif. Human 3-UTR contains 22 motifs throughout the only with part B, whereas the reduction with parts A or D was 27234 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes not apparent. The reduction of luciferase activity with part B was augmented by the addition of part A or parts C and D, and the strongest FIGURE 4. Distribution of AUUUA motifs in human and mouse BMP-2 3-UTRs. Relative lengths and distri- reduction was observed when parts butions of AUUUA motifs (filled ellipses) in human and mouse BMP-2 3-UTRs are shown. A through C were inserted together. Interestingly, the addition of the reversed 3-UTR sequence also suppressed luciferase activity, although the effect was less obvious than that of the regular orientation. For some constructs, luciferase activity was also evaluated in the presence of TNF- (Fig. 5C). For the two constructs that strongly reduced luciferase activity in the previous experiment, the suppressed activity was partly recovered by TNF-, whereas the cytokine did not affect luciferase activity with the insert containing no AUUUA motifs. Thus, our results suggest the possibility that the expression of BMP-2 could have been suppressed in the chondrocytes by the ARE in 3-UTR and that the induction of BMP-2 by TNF- could have been the result of a release from the ARE-mediated suppression. p38 Signaling Pathway Is Involved in Stabilization of BMP-2 mRNA by TNF- in Human Chondrocytes—Next, experiments were performed to determine the signal transduction path- way(s) involved in the stabilization of BMP-2 mRNA by TNF-. It is known that TNF- stabilizes mRNA of various genes through the signal pathway involving p38 MAP kinase (36). For some other genes, the stability of mRNA is regulated by signal pathways involving extracellular signal-regulated kinase-1/2 (ERK-1/2) (37, 38), c-Jun N-terminal kinase (JNK) (39, 40), pro- tein kinase C (38, 41), or phosphatidylinositol 3-kinase (42). mRNA turnover can be regulated by the intracellular calcium concentration (43). Thus, seven specific inhibitors for these sig- nals were examined to determine whether they inhibited the induction of BMP-2 by TNF- (Fig. 6A). Among them, SB203580, an inhibitor for p38 pathway, was found to strongly suppress the BMP-2 induction; it also suppressed the expres- sion of BMP-2 in untreated chondrocytes by 50%, suggesting that p38 signaling could be important in maintaining the endogenous expression of the protein. On the other hand, wortmannin and ionomycin, which inhibit phosphatidylinosi- tol 3-kinase activity and cause calcium ion influx, respectively, induced the expression of BMP-2 in chondrocytes, although the induction by TNF- was not enhanced but rather sup- pressed by these inhibitors. The inhibitors for ERK-1/2, JNK, or protein kinase C showed no significant effect on either the endogenous expression or induction levels, indicating that these pathways might not be involved in the regulation of FIGURE 5. Chimeric constructs used for transient transfection experi- ments and their luciferase activity. A, chimeric constructs used for tran- BMP-2 expression in chondrocytes. sient transfection experiments. Constructs have all or a part of mouse Because SB203580 showed significant suppression of BMP-2 3-UTR (open bars)atthe3-end of luciferase coding sequence (Luc), followed by SV40 polyadenylation signal (SV40 poly(A)). The chi- BMP-2 expression, the dose response to the inhibitor was meric region was under the control of SV40 promoter and enhancer. Solid evaluated in the untreated and TNF--stimulated chondro- ellipses indicate locations of pentameric AUUUA motifs, and numbers at cytes together with the effect of SB202190, another specific the top denote positions of nucleotide in 3-UTR. B, luciferase activity of constructs. ATDC5 cells maintained for 15 days in insulin-containing inhibitor for the p38 pathway (Fig. 6B). The result showed media were transiently transfected with one of the above constructs, and that the endogenous expression and induction of BMP-2 was luciferase activity was measured 48 h later. C, effect of TNF- on luciferase inhibited by SB203580 in a similar dose-dependent manner. activity. For some constructs, luciferase activity was measured after treat- ing cells with 10 ng/ml TNF- for 48 h following transfection. Luciferase The endogenous expression and induction were both assays were repeated three to six times, and activity of Firefly luciferase reduced by 25% with 1 M SB203580, and the inhibitory was normalized by that of Renilla luciferase. Data are expressed as a per- centage of control (mean  S.D.). effects were almost maximal at the concentration of 5 M. SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27235 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes The expression of BMP-2 was inhibited by SB202190 to an untreated cells (Fig. 6C). Even without TNF- stimulation, the extent similar to SB203580 in both untreated and TNF- inhibition of the p38 pathway resulted in the facilitation of stimulated chondrocytes, confirming the significance of p38 mRNA degradation in chondrocytes; the half-life of BMP-2 signaling in the maintenance of endogenous expression and mRNA declined from 70 to 42 min, a reduction of 40%. The induction of the protein by TNF-. decrease in mRNA stability was considered to account for the We then evaluated the effect of SB203580 on the stability of suppression of endogenous BMP-2 expression by the inhibitor. BMP-2 mRNA in the TNF--treated chondrocytes and Furthermore, although the mRNA stability was significantly 27236 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes increased in the TNF--treated cells, the inhibitor reduced the stability below the level of that in untreated cells, completely abrogating the cytokine’s effect. The mRNA half-life was 282 min in the TNF--treated cells, which was reduced to 53 min by the addition of SB203580. The significance of p38 MAP kinase in the regulation of BMP-2 expression was confirmed by use of the adenovirus carrying constitutively active MKK6, a kinase that directly phosphorylates p38 MAP kinase. Infection with the adeno- virus induced the expression of BMP-2 mRNA along with the phosphorylation of p38 (Fig. 6, D and E), but that induction was completely inhibited by SB203580, together with p38 phosphorylation. Thus, the results of these experiments showed that BMP-2 expression in primary cultured adult human chondrocytes is regulated by a post-transcriptional mechanism predominantly modulated by the p38 signal pathway. Coordination of NF-B and p38 Signal Pathway in BMP-2 Induction by TNF-—Since it has been reported that the expression of BMP-2 is transcriptionally regulated by NF-Bin epiphyseal chondrocytes (24), experiments were performed to determine the role of NF-B in the induction of BMP-2 by TNF-. In the first experiment, nuclear translocation of NF-B was inhibited by pyrrolidine dithiocarbamate (PDTC), and the levels of endogenous expression and induc- tion by TNF- were evaluated (Fig. 7A). Unlike SB203580, PDTC did not change the endogenous level of BMP-2 expression in human chondrocytes, suggesting that the tran- scriptional factor may not be responsible for the mainte- FIGURE 7. Involvement of NF-B in induction of BMP-2. A, effect of PDTC on endogenous expression and induction of BMP-2 by TNF- was evaluated in nance of BMP-2 expression in adult human articular chon- primary cultured human articular chondrocytes. In presence or absence of drocytes. This finding differed from a previously reported TNF-, PDTC was given to chondrocytes at various concentrations. For some result with epiphyseal chondrocytes showing that the inhi- cells, SB203580 (20 M) was given together with PDTC. Forty-eight hours later, expression of BMP-2 was evaluated by real-time PCR and represented bition of NF-B strongly reduced the expression of BMP-2 in by ratios against GAPDH. , p  0.05 against untreated cells, and **, p  0.01 the growth plates (24). On the other hand, the inhibitor sup- against cells treated with TNF- alone. B, stability of BMP-2 mRNA was evalu- ated using ActD (1 M) in chondrocytes treated with TNF- for 48 h with (filled pressed the induction of BMP-2 by TNF- by 50%. The diamonds) or without (filled circles) PDTC (100 M). At each time point, expres- suppressive effect seemed to reach a plateau at a concentra- sion of BMP-2 was determined by real-time PCR together with GAPDH, and tion of 100 M, because no further suppression was observed their RNA ratio was obtained. To facilitate direct comparison, ratios at respec- tive time points were normalized by the ratio at beginning of the evaluation with a higher concentration of PDTC. In contrast, when (i.e. Time 0) under each experimental condition. For these experiments, TNF- SB203580 was used together with PDTC, the induction was was used at a concentration of 100 ng/ml. Data are shown by mean  S.D. or completely abrogated, and the expression of BMP-2 declined mean  S.D. of three to five experiments. below the level of endogenous expression. Although PDTC partly suppressed BMP-2 induction, the inhibitor did not induction was suppressed not through a change in post-tran- change the stability of BMP-2 mRNA in TNF--treated scriptional regulation, but rather through the decrease in chondrocytes (Fig. 7B), suggesting the possibility that the transcriptional activity. FIGURE 6. Involvement of p38 MAP kinase in the induction of BMP-2 by TNF-. A, human articular chondrocytes were maintained by monolayer culture, and seven specific inhibitors of signal transduction pathways were examined at indicated concentrations to determine whether they exerted significant effects on endogenous expression and induction of BMP-2 by TNF-. Effects on endogenous expression were evaluated 48 h after addition of inhibitors. To assess effects on induction, inhibitors were given 30 min prior to addition of TNF- to media, and induction levels were determined 48 h later. Expression of BMP-2 was # ## represented by ratios against GAPDH. , p  0.05; , p  0.01 against control cells; *, p  0.05; **, p  0.01 against control cells treated with TNF- alone. B, chondrocytes were cultured with graded doses of SB203580 in the presence (solid bars) or absence (open bars) of TNF- stimulation, and the expression of BMP-2 was evaluated 48 h later. In parallel, the effect of SB202190 on the expression of BMP-2 was evaluated together with that of SB202474, a negative control # ## for the p38 inhibitors (bars in shaded areas). Expression of BMP-2 was represented by ratios against GAPDH. , p 0.05, and , p 0.01 against untreated cells; **, p 0.01 against cells treated with TNF- alone. C, chondrocytes were cultured for 48 h in the presence (open squares) or absence (open circles) of SB203580, and the stability of BMP-2 mRNA was evaluated using ActD (1 M). Evaluation was also performed on cells treated with TNF- for 48 h with (filled squares)or without (filled circles) SB203580. To facilitate direct comparison, RNA ratios at respective time points were normalized by the ratio at beginning of the evaluation (i.e. Time 0) under each experimental condition. D and E, chondrocytes were infected with the adenovirus carrying constitutively active MKK6 at indicated titers, and 72 h later, the amount of phosphorylated p38 and expression of BMP-2 mRNA were evaluated together with those of total p38 protein and GAPDH, respectively. SB203580 was given to some cells together with the adenovirus. In E, BMP-2 expression was represented by ratios against GAPDH. **, p  0.01 against untreated cells. For these experiments, expression of BMP-2 and GAPDH was quantitatively evaluated by real-time PCR. TNF- was used at the concentration of 100 ng/ml, and media containing inhibitors were replaced every 24 h to preclude possible degradation of the inhibitors. Data are shown by mean  S.D. or mean  S.D. of three or four experiments. SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27237 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes IB expression caused a 2-fold increase of endogenous BMP-2 expression (Fig. 8D). The response to TNF- was preserved in those cells, although the magnitude of BMP-2 induction was not aug- mented by the suppression of IB. Noggin Showed Stronger Inhibi- tory Effects on Chondrocyte Anabo- lism after TNF- Treatment—To evaluate the biological significance of BMP-2 induced by TNF-, carti- lage explants were cultured in the presence or absence of the cytokine, and the inhibitory effect of noggin on the synthetic activity of chondro- cytes in those explants was investi- gated. In this experiment, the con- centration of TNF- was set at a relatively low level based on our pre- vious experience (12). First, the induction of BMP-2 by TNF- was confirmed by immunostaining. Compared with the untreated con- trols (Fig. 9A), staining for BMP-2 was much stronger in the TNF-- treated explants (Fig. 9B). In those explants, the staining was observed both inside and around the chon- drocytes, which was consistent with FIGURE 8. Influence of reduced RelA and IB expression on the induction of BMP-2 by TNF-. A and B, our previous observation with siRNAs for RelA (A) and IB (B) were delivered into primary cultured human chondrocytes by electroporation, human cartilage explants (12). Next, and the expression levels of respective genes were monitored every 2 days until Day 6 by real-time PCR. For each gene, two siRNAs with respective target sequences were used (filled squares and triangles), and the results the synthesis of sulfated proteogly- are shown by ratios against GAPDH together with that of the control cells given a control siRNA (open circles). can in the explants was evaluated by C and D, the cells to which the siRNAs for RelA (C) and IB (D) were delivered were treated with 20 or 100 ng/ml the incorporation of [ S]sulfate. In of TNF- for 48 h, and the induction of BMP-2 was evaluated by real-time PCR. Considering the time course of gene suppression, the cells were treated with TNF- from Day 2 to Day 4. Open bars represent the result of the control explants without TNF- control cells, and light and dark shaded bars show the results of respective siRNAs used for the gene. The results treatment, the incorporation of are shown by ratios against GAPDH. *, p  0.05 and **, p  0.01 against control cells in respective treatment groups. Data are mean  S.D. or mean  S.D. of three to five experiments. [ S]sulfate into the explants was not significantly influenced by the Induction of BMP-2 by TNF- Was Significantly Modulated addition of noggin to the culture media (Fig. 9C). On the other by the Suppression of RelA and IB Expression—The involve- hand, noggin showed a strong inhibitory effect on the explants ment of NF-B in the induction of BMP-2 was further con- treated with TNF-. Although the low dose of cytokine did not firmed by RNAi experiments. In primary cultured human artic- cause significant suppression of the synthetic activity in the ular chondrocytes, the expression of RelA and IB was explants, noggin reduced the incorporation of [ S]sulfate by effectively reduced by RNAi. The result of real-time PCR dem- 50%. Thus, in the TNF--treated explants, BMP-2 induced by onstrated that the expression of RelA gene was suppressed from TNF- was considered to play a significant anabolic role on the Day 2 to Day 6 after the delivery of siRNAs into the cells (Fig. synthetic activity of chondrocytes, likely counteracting the sup- 8A). The strongest inhibition was observed at Day 4 for both pressive effects of TNF-. siRNAs used for the gene, when the expression levels were DISCUSSION reduced to 22 and 37%, respectively, of that of the control. For IB, the suppression was strongest at Day 2 and Day 4 for In the current work, the presence of a complex regulation for respective siRNAs, when the expression was 25 and 44% of the BMP-2 expression was initially suggested in ATDC5 cells by the control (Fig. 8B). Next, the induction of BMP-2 by TNF- was experiment using CHX. The expression of BMP-2 was induced evaluated in the cells given the siRNAs. The introduction of by CHX in differentiated but not undifferentiated ATDC5 cells, siRNA by electroporation considerably reduced the induction whereas the basal level of BMP-2 expression was consistently of BMP-2 by TNF- (Fig. 8, C and D). Nonetheless, it was low throughout the differentiation process. Because CHX is noticed that the gene silencing of RelA significantly inhibited known to induce gene expression through the inhibition of the induction of BMP-2 (Fig. 8C). Meanwhile, the reduction of RNA degradation (35), that observation suggested the possibil- 27238 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes that human chondrocytes most likely have a similar regulatory system for the control of BMP-2 expression. In eukaryotic cells, the level of gene expression is strictly regulated at both transcriptional and post-transcriptional lev- els. Modulation of the mRNA decay rate is a strategy widely used by cells to adjust the intensity of expression (44). The decay of mRNA is often mediated by the specific cis-acting sequences in 3-UTR, represented by an AU-rich element or ARE (29, 45). The ARE often contains multiple copies of pen- tameric AUUUA motifs. Such motifs have been found in many unstable and inducible genes such as cytokines and oncogenes, where the elements control the degeneration of mRNA in response to a variety of intra- and extracellular signals, enabling a rapid adjustment of RNA levels (46). In the present study, the result of 3-rapid amplification of cDNA ends revealed that both human and mouse BMP-2 mRNA contain multiple AUUUA motifs in the 3-UTRs. Mouse 3-UTR contains 8 motifs within a proximal 320-nt AU-rich stretch, and their alignment is highly conserved in the human gene. In various genes whose expression is regulated at the post-transcriptional level, the nucleotide sequences of AREs are often evolutionarily conserved (47–50). The result of this study indicated that BMP-2 could be one such gene. Because BMP-2 protein is FIGURE 9. Expression of BMP-2 and effect of noggin on sulfate incorpora- highly conserved during the evolutionary process, it is reason- tion in cartilage explants with and without TNF- treatment. A and B, cartilage explants were cultured in the presence or absence of TNF- (2.5 able to assume that the regulatory mechanism is conserved as ng/ml) for 4 days, and the expression of BMP-2 was detected by immuno- well. In fact, a sequence comparison has revealed that a 265- staining. Representative photomicrographs of the control explants without nucleotide region in the BMP-2 3-UTR is 73% conserved over TNF- treatment (A) and those treated with TNF- (B) are shown. Magnifica- tion, 200. C, the explants with and without TNF- treatment were further a span of 450 million years of evolution from fish to mammals cultured for 2 days in the presence or absence of recombinant mouse noggin (27). Interestingly, with all its functional and sequential similar- (1 g/ml), and the synthetic activity of chondrocytes was evaluated by the ity to BMP-2, the BMP-4 gene lacks an equivalent conserved incorporation of [ S]sulfate into the explants. The experiments were repeated four times using cartilage from two animals. Open bars represent region in the 3-UTR. The possible absence of post-transcrip- the results of the explants without TNF- treatment, and solid bars represent tional regulation may account for the difference in the for those with TNF- treatment. The results are shown as cpm normalized by DNA contents. Data are mean  S.D. expression patterns between the two BMPs during embryo- genesis (5, 17, 18). Although AREs regulate the decay of mRNA in many genes, ity that BMP-2 mRNA was synthesized at a certain level in the presence of ARE in 3-UTR does not necessarily indicate differentiated cells, even without TNF- stimulation. Accord- that the element is actually functional (45). Furthermore, the ingly, the results of nuclear run-off experiments revealed that significance of AREs may vary depending on the cell types (51) differentiated ATDC5 cells were in fact synthesizing BMP-2 or states of cellular differentiation (21, 27, 45, 52), possibly due mRNA at the nuclei, whereas such synthesis was barely detect- to the change in trans-acting regulators (45). Thus, the function able in undifferentiated cells. The discrepancy between the of ARE needs to be evaluated within the biological context in active mRNA synthesis in the nuclei and the low level of expres- which the gene is expressed. In this study, we therefore exam- sion observed in differentiated cells can be explained by the ined the function of BMP-2 3-UTR in differentiated ATDC5 involvement of post-transcriptional control in the regulation of cells, in which the addition of 3-UTR to the luciferase gene did BMP-2 expression. On the other hand, the results of nuclear indeed reduce the enzyme activity. That reduction was related run-off experiments also revealed that the transcriptional activ- to the number of inserted AUUUA motifs, rather than to the ity of BMP-2 mRNA was increased by TNF-. Taking all these specific sequence in the region. Thus, out of eight pentameric results into account, the regulation of BMP-2 in ATDC5 cells motifs, the first or last two pentamers alone did not change the may be understood as follows. In undifferentiated cells, expres- luciferase activity significantly, whereas the middle four within sion is suppressed at the transcriptional level. The cells acquire 86 bases suppressed it by over 40%. The addition of two motifs, the ability to synthesize BMP-2 mRNA with the progression of either proximal or distal, was enough to obtain suppression chondrogenic differentiation, but the overall expression is still equal to the entire 3-UTR. suppressed by a post-transcriptional regulatory mechanism AREs are often divided into three classes, with the ARE of that facilitates mRNA degradation. TNF- induces the expres- BMP-2 falling into class II, in which the region is characterized sion of BMP-2 in differentiated cells through the transcrip- by multiple copies of clustered AUUUA motifs (53, 54). The tional up-regulation and stabilization of mRNA. The regulatory other members of this class are mostly cytokines and enzymes mechanisms were then investigated in primary cultured human such as interleukin-3 (40), TNF- (55), and cyclooxygenese-2 chondrocytes, and the results of those experiments indicated (51, 56, 57). In these genes, the effect of mRNA stabilization by SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27239 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes the pentameric sequence has often been related to the number inflammatory cytokines (12). Because the protein has potent of motifs in the AREs (40, 57). Our current observations are in anabolic actions on chondrocytes (62, 63), it is possible that the good agreement with those previous results. induced BMP-2 counteracts the progression of the disease by It is worth noting that a few previous studies reported con- enhancing the chondrocyte metabolism. In fact, the result of tradictory results on whether or not the addition of 3-UTR this study indicated a possibility that BMP-2, after induction by increased the stability of BMP-2 mRNA (21, 27). Considering TNF-, could compensate the reduced chondrocyte metabo- that AREs primarily destabilize rather than stabilize mRNA (29, lism caused by the cytokine (Fig. 9). The notion is also sup- 36, 44, 45), it is possible that the previous observations might ported by a recent observation that mice lacking a BMP recep- not reflect the actual function of the 3-UTR in vivo. Because an tor in cartilage tended to develop premature osteoarthritis (64). embryonic carcinoma cell line was used in those studies, the Thus, for pathologies that involve BMP-2 expression, its con- inconsistency might stem from differences in the cell types trol could be a key to regulating the disease process. The results and/or stages of cellular differentiation. Because the reduced of this study will provide useful clues in developing new strate- luciferase activity by the addition of 3-UTR was significantly gies to treat various diseases involving chondrocytes. recovered by TNF-, we think the current result reasonably REFERENCES reflects the biological function of the region. 1. Urist, M. R. (1965) Science 150, 893–899 Based on the results of our current study, it seems very likely 2. Wozney, J. M., Rosen, V., Celeste, A. J., Mitsock, L. M., Whitters, M. J., that the p38 signal pathway mediates the stabilization of BMP-2 Kriz, R. W., Hewick, R. M., and Wang, E. A. (1988) Science 242, mRNA by TNF-. In genes containing AREs, the stability of 1528–1534 3. Sampath, T. K., Rashka, K. F., Doctor, J. S., Tucker, R. F., and Hoffmann, mRNA is regulated by proteins that bind to the region or ARE- F. M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6004–6008 binding proteins. The function of such proteins is often modu- 4. Zhang, H., and Bradley, A. (1996) Development 122, 2977–2986 lated by the p38 signal pathway. For example, the ARE-binding 5. Hogan, B. L. (1996) Genes Dev. 10, 1580–1594 proteins HuR, AUF1, and tristetraprolin are all known to stabi- 6. Pizette, S., and Niswander, L. (2000) Dev. Biol. 219, 237–249 lize or destabilize mRNA in response to p38 signaling (42, 7. Bostrom, M. P., Lane, J. M., Berberian, W. S., Missri, A. A., Tomin, E., 58–60). Although the protein that binds to BMP-2 ARE has not Weiland, A., Doty, S. B., Glaser, D., and Rosen, V. M. (1995) J. Orthop. Res. 13, 357–367 been determined, it is likely that mRNA stability is regulated by 8. Si, X., Jin, Y., Yang, L., Tipoe, G. L., and White, F. H. (1997) Eur. J. Oral. Sci. one such protein. AREs regulated by the p38 pathway have a 105, 325–330 common feature in that they contain several closely adjacent 9. Hallahan, A. R., Pritchard, J. I., Chandraratna, R. A. S., Ellenbogen, R. G., AUUUA motifs (36). That feature is indeed shared with the Geyer, J. R., Overland, R. P., Strand, A. D., Topcott, S. J., and Olson, J. M. BMP-2 gene. (2003) Nat. Med. 9, 1033–1038 10. Kleeff, J., Maruyama, H., Ishiwata, T., Sawhney, H., Friess, H., Buchler, Besides the post-transcriptional regulation, the modulation M. W., and Korc, M. (1999) Gastroenterology 116, 1202–1216 of transcriptional activity seemed to play another important 11. Langenfeld, E. M., Calvano, S. E., Abou-Nukta, F., Lowry, S. F., Amenta, P., role in the induction of BMP-2 by TNF-. In differentiated and Langenfeld, J. (2003) Carcinogenesis 24, 1445–1454 ATDC5 cells, TNF- increased the transcriptional rate of 12. Fukui, N., Zhu, Y., Maloney, W. J., Clohisy, J., and Sandell, L. J. (2003) BMP-2, whereas in human cells, the induction of BMP-2 was J. Bone Joint Surg. Am. 85A, Suppl. 3, 59–66 partly suppressed by an NF-B inhibitor without changing the 13. van Lent, P. L., Blom, A. B., van der Kraan, P., Holthuysen, A. E., Vitters, E., van Rooijen, N., Smeets, R. L., Nabbe, K. C., and van den Berg, W. B. (2004) stability of mRNA. The involvement of NF-B in the induction Arthritis Rheum. 50, 103–111 of BMP-2 was further suggested by the result of RNAi experi- 14. Lories, R. J., Derese, I., Ceuppens, J. L., and Luyten, F. P. (2003) Arthritis ment. In the present study, the reduction of RelA expression by Rheum. 48, 2807–2818 RNAi strongly suppressed the induction of BMP-2 by TNF-. 15. Nakase, T., Miyaji, T., Tomita, T., Kaneko, M., Kuriyama, K., Myoui, A., In the meantime, because neither addition of PDTC nor sup- Sugamoto, K., Ochi, T., and Yoshikawa, H. (2003) Osteoarthritis Cartilage pression of RelA changed the level of endogenous BMP-2 11, 278–284 16. Zoricic, S., Maric, I., Bobinac, D., and Vukicevic, S. (2003) J. Anat. 202, expression, it is assumed that the transcriptional factor may not 269–277 play a significant role in the maintenance of BMP-2 in the 17. Lyons, K. M., Pelton, R. W., and Hogan, B. L. (1989) Genes Dev. 3, untreated chondrocytes. This speculation is consistent with the 1657–1668 result that the suppression of IB by RNAi caused significant 18. Lyons, K. M., Pelton, R. W., and Hogan, B. L. (1990) Development 109, elevation of endogenous BMP-2 expression. The evidence that 833–844 the expression of BMP-2 is transcriptionally regulated by 19. Macias, D., Gan˜an, Y., Sampath, T. K., Piedra, M. E., Ros, M. A., and Hurle, J. M. (1997) Development 124, 1109–1117 NF-B has been shown in a previous study in the growth plate 20. Zhang, D., Ferguson, C. M., O’Keefe, R. J., Puzas, J. E., Roiser, R. N., and chondrocytes (24), and our current results indicated that the Reynolds, P. R. (2002) J. Bone Miner. Res. 17, 293–300 transcriptional regulation could be involved in the induction of 21. Abrams, K. L., Xu, J., Nativelle-Serpentini, C., Dabirshahsahebi, S., and BMP-2 by TNF- in articular chondrocytes, together with the Rogers, M. B. (2004) J. Biol. Chem. 279, 15916–15928 mRNA stabilization mechanism. 22. Boylan, J. F., Lufkin, T., Achkar, C. C., Taneja, R., Chambon, P., and Gudas, L. J. (1995) Mol. Cell. Biol. 15, 843–851 The induction of BMP-2 in chondrocytes could be a critical 23. Helvering, L. M., Sharp, R. L., Ou, X., and Geiser, A. G. (2000) Gene (Amst.) factor in several pathologies, e.g. osteoarthritis. In osteoarthritis 256, 123–138 joints, the anabolic activity of the chondrocytes is highly up- 24. Feng, J. Q., Xing, L., Zhang, J.-H., Zhao, M., Horn, D., Chan, J., Boyce, B. F., regulated, which likely retards disease progression (61). In Harris, S. E., Mundy, G. R., and Chen, D. (2003) J. Biol. Chem. 278, osteoarthritis cartilage, the expression of BMP-2 is significantly 29130–29135 increased (12, 15), possibly through the induction by the pro- 25. Zhou, S., Turgeman, G., Harris, S. E., Leitman, D. C., Komm, B. S., Bodine, 27240 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 37 •SEPTEMBER 15, 2006 Induction Mechanisms of BMP-2 by TNF- in Chondrocytes P. V. N., and Gazit, D. (2003) Mol. Endocrinol. 17, 56–66 45. Bevilacqua, A., Ceriani, M. C., Capaccioli, S., and Nicolin, A. (2003) J. Cell. 26. Ghosh-Choudhury, N., Choudhury, C. G., Harris, M. A., Wozney, J., Physiol. 195, 356–372 Mundy, G. R., Abboud, S. L., and Harris, S. E. (2001) Biochem. Biophys. Res. 46. Saklatvala, J., Dean, J., and Clark, A. (2003) Biochem. Soc. Symp. 70, 95–106 Commun. 286, 101–108 47. Asson-Batres, M. A., Spurgeon, S. L., Diaz, J., DeLoughery, T. G., and 27. Fritz, D. T., Liu, D., Xu, J., Jiang, S., and Rogers, M. B. (2004) J. Biol. Chem. Bagby, H. C., Jr. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1318–1322 279, 48950–48958 48. Dorssers, L., Burger, H., Bot, F., Delwel, R., Geurts van Kessel, A. H., 28. St Johnston, D. (1995) Cell 81, 161–170 Lowenberg, B., and Wagemaker, G. (1987) Gene (Amst.) 55, 115–124 29. Mignone, F., Gissi, C., Liuni, S., and Pesole, G. (2002) Genome Biology 49. Schiavone, N., Rosini, P., Quattrone, A., Donnini, M., Lapucci, A., Citti, L., http://genomebiology.com/2002/3/3/reviews/0004 Bevilacqua, A., Nicolin, A., and Capaccioli, S. (2000) FASEB J. 14, 174–184 30. Shi, J., Schmitt-Talbot, E., DiMattia, D. A., and Dullea, R. G. (2004) In- 50. Vasudevan, S., and Peltz, S. W. (2001) Mol. Cell 7, 1191–1200 flamm. Res. 53, 377–389 51. Cox, S. J., and Morrison, A. R. (2001) J. Biol. Chem. 276, 23179–23185 31. Fowler, M. J., Jr., Neff, M. S., Borghaei, R. C., Pease, E. A., Mochan, E., and 52. Bashirullah, A., Cooperstock, R. L., and Lipshitz, H. D. (2001) Proc. Natl. Thornton, R. D. (1998) Biochem. Biophys. Res. Commun. 248, 450–453 Acad. Sci. U. S. A. 98, 7025–7028 32. Atsumi, T., Miwa, Y., Kimata, K., and Ikawa, Y. (1990) Cell Differ. Dev. 30, 53. Chen, C. Y., Xu, N., and Shyu, A. B. (1995) Mol. Cell. Biol. 15, 5777–5788 109–116 54. Peng, S. S., Chen, Y., and Shyu, A. B. (1996) Mol. Cell. Biol. 16, 1490–1499 33. Kuettner, K. E., Pauli, B. U., Gall, G., Memoli, V. A., and Schenk, R. K. 55. Brook, M., Sully, G., Clark, A. R., and Saklatvala, J. (2000) FEBS Lett. 483, (1982) J. Cell Biol. 93, 743–750 57–61 34. Seto, H., Kamekura, S., Miura, T., Yamamoto, A., Chikuda, H., Ogata, T., 56. Dean, J. L., Brook, M., Clark, A. R., and Saklatvala, J. (1999) J. Biol. Chem. Hiraoka, H., Oda, H., Nakamura, K., Kurosawa, H., Chung, U.-I., Kawagu- 274, 264–269 chi, H., and Tanaka, S. (2004) J. Clin. Invest. 113, 718–726 57. Dixon, D. A., Kaplan, C. D., McIntyre, T. M., Zimmerman, G. A., and 35. Beelman, C. A., and Parker, R. (1994) J. Biol. Chem. 269, 9687–9692 Prescott, S. M. (2000) J. Biol. Chem. 275, 11750–11757 36. Dean, J. L. E., Sully, G., Clark, A. R., and Saklatvala, J. (2004) Cell. Signal. 16, 58. Carballo, E., Chao, H., Lai, W. S., Kennington, E. A., Campbell, D., and 1113–1121 Blackshear, P. J. (2001) J. Biol. Chem. 276, 42580–42587 37. Esnault, S., and Malter, J. S. (2002) Blood 99, 4048–4052 59. Dean, J. L., Wait, R., Mahtani, K. R., Sully, G., Clark, A. R., and Saklatvala, 38. Shaw, G., and Kamen, R. (1986) Cell 46, 659–667 J. (2001) Mol. Cell. Biol. 21, 721–730 39. Chen, C. Y., Gherzi, R., Andersen, J. S., Gaietta, G., Jurchott, K., Royer, 60. Wilson, G. M., Lu, J., Sutphen, K., Sun, Y., Huynh, Y., and Brewer, G. H. D., Mann, M., and Karin, M. (2000) Genes Dev. 14, 1236–1248 (2003) J. Biol. Chem. 278, 33029–33038 40. Ming, X. F., Kaiser, M., and Moroni, C. (1998) EMBO J. 17, 6039–6048 61. Sandell, L. J., and Aigner, T. (2001) Arthritis Res. 3, 107–113 41. Short, S., Tian, D., Short, M. L., and Jungmann, R. A. (2000) J. Biol. Chem. 62. Grunder, T., Gaissmaier, C., Fritz, J., Stoop, R., Hortschansky, P., Mollen- 275, 12963–12969 hauer, J., and Aicher, W. K. (2004) Osteoarthritis Cartilage 12, 559–567 42. Ming, X. F., Stoecklin, G., Lu, M., Looser, R., and Moroni, C. (2001) Mol. 63. Stewart, M. C., Saunders, K. M., Burton-Wurster, N., and Macleod, J. N. Cell. Biol. 21, 5778–5789 (2000) J. Bone Miner. Res. 15, 166–174 43. Stoecklin, G., Hahn, S., and Moroni, C. (1994) J. Biol. Chem. 269, 64. Rountree, R. B., Schoor, M., Chen, H., Marks, M. E., Harley, V., Mishina, 28591–28597 Y., and Kingley, D. M. (2004) PLoS Biol. 2, e335 http://www.plosbiology. 44. Wilusz, C. J., Wormington, M., and Peltz, S. W. (2001) Nat. Rev. Mol. Cell. Biol. 2, 237–246 org. doi:10.1371/journal.pbio.0020355 SEPTEMBER 15, 2006• VOLUME 281 • NUMBER 37 JOURNAL OF BIOLOGICAL CHEMISTRY 27241

Journal

Journal of Biological Chemistry – American Society for Biochemistry and Molecular Biology

Published: Sep 15, 2006

There are no references for this article.