Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

EMT Program is Dispensable for Metastasis but Induces Chemoresistance in Pancreatic Cancer

EMT Program is Dispensable for Metastasis but Induces Chemoresistance in Pancreatic Cancer Author Manuscript Author Manuscript Author Manuscript Author Manuscript HHS Public Access Author manuscript Nature. Author manuscript; available in PMC 2016 May 18. Published in final edited form as: Nature. 2015 November 26; 527(7579): 525–530. doi:10.1038/nature16064. EMT Program is Dispensable for Metastasis but Induces Chemoresistance in Pancreatic Cancer #1 #1 1 1 1 Xiaofeng Zheng , Julienne L. Carstens , Jiha Kim , Matthew Scheible , Judith Kaye , 1 2 1 1,3,4 Hikaru Sugimoto , Chia-Chin Wu , Valerie S. LeBleu , and Raghu Kalluri Department of Cancer Biology, Metastasis Research Center, University of Texas MD Anderson Cancer Center, Houston, Texas Department of Genomic Medicine, University of Texas MD Anderson Cancer Center, Houston, Texas Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas Department of Bioengineering, Rice University, Houston, Texas. These authors contributed equally to this work. Diagnosis of pancreatic ductal adenocarcinoma (PDAC) is associated with dismal prognosis despite current therapies; therefore new treatment strategies are urgently required. Numerous studies have suggested that epithelial to mesenchymal transition (EMT) contributes to early- 1 4 stage dissemination of cancer cells and is pivotal for invasion and metastasis of PDAC . EMT program is associated with phenotypic conversion of epithelial cells into mesenchymal-like cells in cell culture conditions, albeit such defined mesenchymal conversion (with spindle shaped morphology) of epithelial cells is rare with quasi- 5 6 mesenchymal phenotypes occasionally observed in the tumor (partial EMT) . Most studies exploring the functional role of EMT in tumors have depended on cell culture induced loss- of-function and gain-of-function experiments involving EMT inducing transcription factors 2 3 7 10 , , - such as Twist, Snail and Zeb1 . Therefore, the functional contribution of EMT 4 6 program for invasion and metastasis remains unclear and genetically engineered mouse models (GEMMs) to specifically address a causal connection are lacking. Here we functionally probed the role of EMT program in PDAC by generating PDAC GEMMs with deletion of Snail or Twist, two key transcription factors responsible for EMT. EMT suppression in the primary tumor did not alter the emergence of invasive PDAC, systemic Users may view, print, copy, and download text and data-mine the content in such documents, for the purposes of academic research, subject always to the full Conditions of use:http://www.nature.com/authors/editorial_policies/license.html#terms Address for Correspondence: Raghu Kalluri, MD, PhD, ; Email: [email protected] AUTHOR CONTRIBUTIONS R.K. conceptually designed the strategy for this study, participated in discussions, provided intellectual input, supervised experimental discussion and helped write the manuscript. V.S.L. helped design experimental strategy, provided intellectual input, supervised the studies, performed immunohistochemistry and culture experiments, generated the figures and wrote the manuscript. X.Z. performed experiments to generate the GEMMs and helped characterize the mouse phenotype, performed culture experiments, collected the tissue for analysis and contributed to the manuscript writing. J.L.C. characterized the mouse phenotype, analyzed the data related to the GEMMs, collected data, generated the figures and helped with manuscript writing and editing. H.S. performed experiments with mice and injected cancer cells and helped collect tissue, J.Kim., M.S., J.Kaye., and C.-C.W. performed experiments and collected data. The data was analyzed by J.L.C, V.S.L., X.Z., J.Kim, and C.-C.W. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 2 dissemination and metastasis. Suppression of EMT led to an increase in cancer cell proliferation with enhanced expression of nucleoside transporters in tumors, contributing to enhanced sensitivity to gemcitabine treatment and increased overall survival of mice. Collectively, our study suggests that Snail or Twist induced EMT program is not rate- limiting for invasion and metastasis but highlights the importance of combining EMT inhibition with chemotherapy for the treatment of pancreatic cancer. L/L L/L G12D R172H/+ We crossed Twist1 or Snai1 mice with Pdx1-Cre; LSL-Kras ; P53 (KPC) G12D R172H/+ L/L cKO to generate the Pdx1-Cre; LSL-Kras ; P53 ; Twist1 (KPC; Twist ) and the G12D R172H/+ L/L cKO Pdx1-Cre; LSL-Kras ; P53 ; Snai1 (KPC; Snail ) mice, respectively. The resultant progeny were born in an expected Mendelian ratio, without overt phenotypic findings other than the anticipated emergence of spontaneous pancreatic cancer (Extended Figure 1A). Genetic deletion of Snai1 or Twist1 did not significantly delay pancreatic tumorigenesis, alter tumor histopathology features or local invasion (Figure 1A-C and cKO cKO Extended Table 1). KPC; Twist and KPC; Snail mice displayed similar tumor burden compared to KPC control mice (Extended Figure 1B), and insignificant difference in overall survival (Figure 1D). Loss of Twist1 or Snai1 expression in the pancreas epithelium was confirmed by in situ hybridization coupled with CK8 epithelial immunolabeling (Figure 1E and Extended Figure 1C) as well as immunolabeling for Twist and Snail (Extended Figure 1D). Suppression of EMT program was significantly noted (Figure 1F-G, Extended Figure 1E). Lineage tracing (Figure 1F) and immunolabeling of the primary tumor (Figure 1G) showed a significant decrease in the frequency of epithelial cells with expression of the mesenchymal marker αSMA (EMT cells) and a decrease in expression of EMT inducing transcription factor, Zeb1 (Figure 1H). Global gene expression profiling of tumors revealed a decrease in expression of EMT associated genes (including cKO cKO Snai1 and Twist1) in KPC; Snail and KPC; Twist mice compared to KPC control (Extended Figure 1F). Loss of Snail and Twist enhanced E-cadherin expression and suppressed Zeb2 and Sox4 expression in cancer cells (Extended Figure 2A-C). Snai2 (Slug) expression was restricted to early PanIN lesion in all the experimental groups with no cKO observed expression in advanced tumors and was significantly reduced in KPC; Snail cKO and KPC;Twist mice compared to KPC control mice (Extended Figure 2D). While desmoplasia, including extracellular matrix (ECM) and myofibroblasts content (Figure 1I and Extended Figure 2E-F), tumor vessel density (Extended Figure 2G), intratumoral hypoxia (Extended Figure 2H), CD3 T-cell infiltration (Extended Figure 2I), and cancer cell apoptosis was unaffected with Twist/Snail deletion in KPC tumors (Figure 2A), the proliferation of cancer cells in mice with suppressed EMT program was significantly increased (Figure 2B), as shown previously in mouse models of breast 11 13 - + cancers . Immunostaining experiments further revealed that EMT cancer cells are largely Ki67 (Extended Figure 3A). Altogether, the data suggests that EMT program driven by Twist/Snail transcription factors is dispensable for initiation and progression of primary pancreatic cancer. Next, we investigated whether suppression of EMT program impacts invasion and + cKO metastasis. The number of YFP CTCs from lineage traced KPC and KPC; Twist was found unchanged (Figure 2C and Extended Figure 3B), and expression of cancer cell Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 3 G12D cKO cKO specific Kras mRNA in the blood from KPC, KPC; Twist and KPC; Snail was unaffected (Figure 2D), suggesting that suppression of EMT program in pancreatic tumors does not impact the rate of systemic dissemination of cancer cells. Extensive histopathological analyses, coupled with CK19 or YFP immunostaining of distant metastatic target organs, namely the liver, lung and spleen, indicated a similar frequency of metastasis in EMT suppressed tumors when compared to control tumors (Figure 2E, Extended Figure 3C, Extended Table 1, and Extended Table 2). The metastases were negative for Twist and Snail, and only a few KPC metastatic cells expressed αSMA or Zeb1 (Extended Figure 3D- F), while being positive for E-cadherin and Ki-67 (Extended Figure 3G-H). The cKO proliferation rate of cancer cells in the metastases was similar in KPC, KPC; Snail and cKO KPC; Twist mice (Extended Figure 3H). Collectively, the results indicated that the genetic deletion of Twist1 or Snai1 in PDAC GEMMs did not reduce metastatic disease. To evaluate whether cancer cells from the pancreas with and without EMT program differentially benefited from impaired proliferation to form secondary tumors, we isolated cKO cKO cancer cells from KPC, KPC; Twist and KPC; Snail mice to assay their organ colonization potential. Twist1 was significantly reduced and Snai1 expression was undetectable in cancer cells isolated from Twist and Snail deleted tumors, respectively (Figure 2F). Short-term potential to form tumor spheres (associated with putative cancer cKO cKO stem phenotype) appeared similar in Twist and Snail KPC cells when compared to 3 8 14 16 , , - control KPC cells (Figure 2G) . Lung colonization frequency following the i.v. injection of KPC cancer cells (Twist or Snail deleted) were similar to the control KPC cancer cells (Figure 2H). These results suggest that a favored epithelial phenotype of cancer cells (via suppression of EMT program) did not impact the capacity to form tumor spheres or their ability for organ colonization . Cancer cell EMT program is associated with gemcitabine drug resistance in PDAC patients 1 2 8 9 18 23 , , , , - and in the orthotopic mouse models of PDAC . Moreover, enhanced frequency of 24 25 + , EMT cancer cells in pancreatic tumors is associated with poor survival . To determine whether EMT program suppression enhances PDAC sensitivity to gemcitabine chemotherapy, we tested the gemcitabine sensitivity of cancer cells with suppressed EMT program in KPC mice. Equilibrative nucleoside transporter ENT1 and concentrating nucleoside transporter CNT3 were significantly upregulated in cancer cells lacking Snail and cKO Twist, while ENT2 expression was unchanged (Figure 3A-C). KPC, KPC; Snail and cKO KPC; Twist mice were treated with gemcitabine and tumor burden was monitored by cKO MRI (Extended Table 3). Tumor progression was suppressed in KPC; Snail and KPC; cKO cKO Twist mice when compared to treated KPC control mice (Figure 3D). KPC; Snail cKO and KPC; Twist mice treated with gemcitabine showed improved histopathology and increased survival (Figure 3E-G). cKO cKO Cancer cells isolated from the tumors of KPC; Snail and KPC; Twist mice showed epithelial morphology (Extended Figure 4A) and reduced expression of mesenchymal genes compared to KPC cancer cell lines (Extended Figure 4B), however, in tissue culture conditions (2D culture on plastic), equilibrative nucleoside transporters (ENT1/ENT2/ ENT3) showed similar expression pattern and expression of concentrating nucleoside transporters (CNT1/CNT3) was not detected (Extended Figure 4B). Increased proliferation Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 4 cKO cKO of KPC; Snail and KPC; Twist cancer cells compared to KPC control cells (Extended Figure 4C) likely accounted for the increased sensitivity to gemcitabine and erlotinib in this setting (Extended Figure 4D). L/L G12D Next, we crossed the Snai1 to the PDAC GEMM, Ptf1a (P48)-Cre; LSL-Kras ; L/L G12D L/L L/L Tgfbr2 (KTC) to generate Ptf1a (P48)-Cre; LSL-Kras ; Tgfbr2 ; Snai1 (KTC; cKO Snail ). The KTC model offers a reliable and penetrant disease progression rate with a cKO consistent timeline of death due to PDAC. Similar to the KPC; Snail mice, KTC; cKO Snail deletion exhibited suppression of EMT program but did not impact primary tumor histopathology, lifespan, local invasion, desmoplasia and frequency of apoptosis (Figure 4F, cKO Extended Figure 5A-E, and Extended Figure 6A). KTC; Snail mice presented with significantly reduced Zeb1 expression in cancer cells but enhanced proliferation and concentrating nucleoside transporter 3 (CNT3) expression (Extended Figure 5E). ENT2 cKO and ENT1 expression were unchanged in KTC; Snail mice compared to KTC mice cKO (Extended Figure 5E and Extended Figure 6A). KTC; Snail mice demonstrated enhanced response to gemcitabine therapy, with significant normal parenchymal area and cKO reduced tumor tissue (Figure 4A-C). Gemcitabine therapy in KTC; Snail reduced tumor burden (Figure 4D) and significantly improved overall survival (Figure 4E) of mice when compared to gemcitabine treated control KTC mice. Gemcitabine therapy specifically increased cancer cell apoptosis and removed enhanced proliferation observed in EMT program suppressed tumors (Figure 4G and Extended Figure 5E), without impacting the desmoplastic reaction (Extended Figure 6B). Overall, these results suggested an enhanced sensitivity of EMT cancer cells to gemcitabine. Both the equilibrative nucleoside transporter 2 (ENT2) and the concentrating nucleoside transporter 3 (CNT3) were upregulated in EMT suppressed tumors (Figure 4G). These data support a possible mechanistic connection between EMT program and resistance to chemotherapy in PDAC. Collectively, our studies provide a comprehensive functional analysis of EMT program in PDAC progression and metastasis. Absence of either Twist1 or Snai1 did not alter cancer progression or the capacity for local invasion or metastasis to lung and liver in PDAC GEMMs. Metastasis occurs despite a significant loss of EMT program with either the deletion of Snail or Twist, and in both settings, Zeb1, Sox4, Slug and Zeb2 are also significantly suppressed. Nevertheless, it is likely that other EMT inducing factors may compensate for the loss of Snail or Twist to induce invasion and metastasis. While PDX-1 is expressed during the development of the pancreas (in early pancreatic buds: all three major lineages of the pancreas-ductal, acinar and beta-islets), its expression is largely repressed in 26 27 the adult exocrine pancreas . Therefore, deletion of Snail or Twist occurs at the embryonic stage and mice are born normal and exhibit normal pancreas histology prior to the onset of cancer. The GEMMs with Snail or Twist deletion develop PanIN lesions at the same frequency as the control mice. One could argue that suppression of EMT program starting from the inception of cancer could have launched compensatory mechanisms to overcome EMT program-dependent invasion and metastasis. However, such compensation is not observed with respect to chemo-resistance and previous studies have demonstrated that EMT program and cancer cell dissemination are observed even before PDAC lesions are detected in KPC mice . Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 5 Our study demonstrates that EMT program results in suppression of cancer cell proliferation, and suppression of drug transporter and concentrating proteins, therefore, inadvertently protecting EMT cells from anti-proliferative drugs such as gemcitabine. The correlation of decreased survival of pancreatic cancer patients with an increased EMT program is likely due to their impaired capacity to respond to gemcitabine, which is a 28 29 standard of care for most patients . Such diminished response to Gemcitabine will likely reflect on such patients also exhibiting higher metastatic disease. Collectively, our study offers the opportunity to evaluate the potential of targeting EMT program to enhance efficacy of Gemcitabine and targeted therapies . Methods Mice G12D Characterization of disease progression and genotyping for the Pdx1-Cre; LSL-Kras ; R172H/+ G12D L/L P53 (herein referred to as KPC) and Ptf1a (P48)-Cre; LSL-Kras ; Tgfbr2 31 33 (herein referred to as KTC) mice were previously described . These mice were bred to L/L cKO L/L cKO Snai1 (herein referred to as Snail ), Twist1 (herein referred to as Twist ), and cKO R26-LSL-EYFP . Snail mice were kindly provided by S.J. Weiss, University of cKO Michigan, Ann Arbor. Twist mice were kindly provided by R. R. Behringer (UT MDACC, Houston, TX) via the Mutant Mouse Regional Resource Center (MMRRC) cKO cKO repository. The resulting progeny were referred to as KPC, KPC; Snail , KPC; Twist , cKO KTC, and KTC; Snail mice and were maintained on a mixed genetic background. Both males and females were used indiscriminately. Mice were given Gemcitabine (G-4177, LC Laboratories) via intraperitoneal injection (i.p.) every other day at 50 mg/kg of body weight. Hypoxyprobe was injected in a subset of mice i.p. at 60 mg/kg of body weight 30 minutes cKO prior to euthanasia. For in vivo colonization assay, one million KPC, KPC; Twist and cKO KPC; Snail tumor cells in 100 μL of PBS were injected intravenously via the retro- orbital venous sinus. Four to eleven mice were injected per cell line. All mice were euthanized at 15 days post-injection. All mice were housed under standard housing conditions at MD Anderson Cancer Center (MDACC) animal facilities, and all animal procedures were reviewed and approved by the MDACC Institutional Animal Care and Use Committee. Tumor growth met the standard of a diameter less than or equal to 1.5 cm. Investigators were not blinded for group allocation but were blinded for the assessment of the phenotypic outcome assessed by histological analyses. No randomization method or statistical sample size estimation was used. Histology and histopathology Histology, histopathological scoring, Masson's Trichrome staining (MTS), and Picrosirius 19 33 Red were previously described . Formalin-fixed tissues were embedded in paraffin and sectioned at 5 μm thickness. MTS was performed using Gomori's Trichome Stain Kit (38016SS2, Leica Biosystems). Picrosirius red staining for collagen was performed using 0.1% picrosirius red (Direct Red80; Sigma) and counterstained with Weigert's hematoxylin. Sections were also stained with hematoxylin and eosin (H&E). Histopathological measurements were assessed by scoring H&E stained tumors for relative percentages of each histopathological phenotype: normal (non-neoplastic), PanIN, well-differentiated Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 6 PDAC, moderately-differentiated PDAC, poorly-differentiated PDAC, sarcomatoid carcinoma, or necrosis. When tumor histology was missing or of poor quality, the mice were excluded from all analyses and this was determined blinded from genotype information. A histological invasion score of the tumor cells into the surrounding stroma was scored on a scale of 0 to 2, with 0 indicating no invasion and 2 indicating high invasion, where invasion is defined as tumor cell dissemination throughout the stroma away from clearly defined epithelial “nests”. Microscopic metastases were observed in H&E stained tissue sections of the liver, lung and spleen. Positivity (one or more lesions in a tissue) was confirmed using CK19 and YFP immunohistochemistry. This data has been presented as a contingency table (Figure 2E) and represented as the number of positive tissues out of the number of tissues scored. The “Any” metastasis score is the number of mice positive for a secondary lesion found anywhere throughout the body out of the total number of mice scored. Immunohistochemistry and Immunofluorescence Tissues were fixed in 10% formalin overnight, dehydrated, and embedded in paraffin and 5 μm thick sections were then processed for analyses. Immunohistochemical analysis was performed as described . Heat mediated antigen retrieval in 1 mM EDTA + 0.05% Tween20 (pH 8.0) for one hour (pressure cooker) was performed for Snail and Twist, 10 mM citrate buffer, pH 6.0 was performed for one hour (microwave) for Ki67 or 10 minutes for all other antibodies. Primary antibodies are as follows: αSMA (M0851, DAKO, 1:400 or ab5694, Abcam, 1:400), cleaved caspase-3 (9661, Cell Signaling, 1:200), CD3 (A0452, DAKO, 1:200), CD31 (Dia310M, DiaNova, 1:10), CK8 (TROMA-1, Developmental Studies Hybridoma Bank, 1:50), CK19 (ab52625, Abcam, 1:100), CNT3 (HPA023311, Sigma- Aldrich, 1:400), ENT1 (LS-B3385, LifeSpan Bio., 1:100), E-cadherin (3195S, Cell Signaling, 1:400), ENT2 (ab48595, Abcam, 1:200), Ki67 (RM-9106, Thermo Scientific, 1:400), SLUG (9585, Cell Signaling, 1:200), SNAIL (ab180714, Abcam, 1:100), SOX4 (ab86809, Abcam, 1:200), TWIST (ab50581, Abcam, 1:100), YFP (ab13970, Abcam, 1:1000), ZEB1 (NBP1-05987, Novus, 1:500), and ZEB2 (NBP1-82991, Novus, 1:100). Sections for pimonidazole adduct (HPI Inc., 1:50) or αSMA immunohistochemistry staining were blocked with M.O.M kit (Vector Laboratories, West Grove, PA) and developed by DAB according to the manufacturer's recommendations. Alternatively, for immunofluorescence, sections were dual-labeled using secondary antibodies conjugated to Alexa fluor-488 or -594 or tyramide signal amplification (TSA, PerkinElmer) conjugated to FITC. Lineage traced (YFP positive) EMT analysis was performed on 8 μm thick O.C.T. medium (TissueTek) embedded frozen sections. Sections were stained for αSMA (ab5694, Abcam, 1:400) followed by Alexa fluor-680 conjugated secondary antibody. Bright field imagery was obtained on a Leica DM1000 light microscope or the Perkin Elmer 3DHistotech Slide Scanner. Fluorescence imagery was obtained on a Zeiss Axio Imager.M2 or the Perkin Elmer Vectra Multispectral imaging platform. The images were quantified for percent positive area using NIH ImageJ analysis software (αSMA, Pimonidazole, SLUG, and CD31), percent positive cells using InForm analysis software (Ki-67 and CD3), or scored for intensity either positive or negative (CK19, YFP, ZEB1, ZEB2, SOX4, and Cleaved Caspase-3) or on a scale of 1-3 (E-cadherin) or 1-4 (ENT1, ENT2 and CNT3). Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 7 In situ hybridization In situ hybridization (ISH) was performed on frozen tumor sections as previously described . In brief, 10 μm-thick sections were hybridized with antisense probes to Twist1 and Snai1 overnight at 65°C. After hybridization, sections were washed and incubated with AP-conjugated sheep anti-DIG antibody (1:2000; Roche) for 90 min at room temperature. After three washes, sections were incubated in BM Purple (Roche) until positive staining was seen. Digoxigenin labeled in situ riboprobes were generated by in vitro transcription method (Promega and Roche) using a PCR template. The following primers were used to generate the template PCR product. Twist1; forward (5’- CGGCCAGGTACATCGACTTC-3’) and reverse (5’- TAATACGACTCACTATAGGGAGATTTAAAAGTGTGCCCCACGC-3’) Snai1: forward (5’-CAACCGTGCTTTTGCTGAC-3’) and reverse (5’- TAATACGACTCACTATAGGGAGACCTTTAAAATGTAAACATCTTTCTCC-3’) Gene Expression Profiling cKO cKO Total RNA was isolated from tumors of KPC control, KPC; Twist and KPC; Snail mice (n = 3 in each group) by TRIzol (15596026, Life Technologies) and submitted to the Microarray Core Facility at MD Anderson Cancer Center. Gene expression analysis was performed using Mouse Ref6 Gene Expression Bead Chip (Illumina). The Limma package from R Bioconductor was used for quantile normalization of expression arrays and to analyze differentially expressed genes between cKO and control sample groups (p ≤ 0.05 and fold change ≥ 1.2). Gene expression microarray data was deposited in GEO (Accession number GSE66981). Genes up-regulated in cells acquiring an EMT program were expected cKO cKO to be down-regulated in the Twist and Snail tumors compared to control tumors. CTC assays cKO Blood (200 μL) was collected from KPC;LSL-YFP and KPC; Twist ;LSL-YFP (ROSA- LSL-YFP lineage tracing of cancer cells) mice and incubated with 10 ml of ACK lysis buffer (A1049201, Gibco) at room temperature to lyse red blood cells. Cell pellets were resuspended in 2% FBS containing PBS and analyzed for the number of YFP cells by flow cytometry (BD LSRFortessa X-20 Cell Analyzer). The data was expressed as the percent YFP cells from gated cells, with 100,000 cells analyzed at the time of acquisition. Whole G12D blood cell pellets were also assayed for the expression of Kras transcripts, using quantitative real-time PCR analyses (described below). Primary pancreatic adenocarcinoma cell culture and analyses Derivation of primary PDAC cell lines were performed as previously described . Fresh tumors were minced with sterile razor blades, digested with dispase II (17105041, Gibco, 4 mg/ml)/collagenase IV (17104019, Gibco, 4 mg/ml)/RPMI for 1 h at 37°C, filtered by a 70 μm cell strainer, resuspended in RPMI/20%FBS and then seeded on collagen I coated plates (087747, Fisher Scientific). Cells were maintained in RPMI medium with 20% FBS and 1% penicillin, streptomycin and amphotericin B (PSA) antibiotic mixture. Cancer cells were further purified by FACS based on YFP or E-Cadherin expression (anti-E-cadherin antibody, 50-3249-82, eBioscience, 1:100). The sorted cells, using BD FACSAria™ II sorter (South Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 8 Campus Flow Cytometry Core Lab of MD Anderson Cancer Center) were subsequently expanded in vitro. All studies were performed on cells cultivated less than 30 passages. As these are primary cell lines no further authentication methods were applicable and no mycoplasma tests were performed. MTT and drug sensitivity assays MTT assay was performed to detect cell proliferation and viability by using Thiazolyl Blue Tetrazolium Bromide (MTT, M2128, Sigma) following the manufacturer's recommendations with an incubation of two hours at 37°C. For the drug treatment studies, a cell line derived cKO cKO from each of the KPC, KPC; Snail and KPC; Twist mice was treated with 20 μM Gemcitabine (G-4177, LC Laboratories) or 100 μM erlotinib (5083S, NEB) for 48 hours. The relative cell viability was detected using MTT assay with a cell line derived from each cKO cKO of the KPC, KPC; Snail and KPC; Twist mice. N value is defined as biological replicates of a single cell line. Control conditions included 1% DMSO vehicle for erlotinib. The relative absorbance was normalized and control (time 0 hour or vehicle treated) arbitrarily set to 1 or 100% for absorbance or drug survival, respectively. Quantitative real-time PCR analyses (qPCR) RNA was extracted from whole blood cell pellets following ACK lysis using the PicoPure Extraction kit as directed (KIT0214, Arcturus), or from cultured primary pancreatic adenocarcinoma cells using TRIzol (15596026, Life Technologies). cDNA was synthetized using TaqMan Reverse Transcription Reagents (N8080234, Applied Biosystems) or High Capacity cDNA Reverse Transcription Kit (4368814, Applied Biosystems). Primers for G12D G12D Kras recombination are: Kras forward (5’ ACTTGTGGTGGTTGGAGCAGC 3’), G12D Kras reverse (5’ TAGGGTCATACTCATCCACAA 3’). 1/ΔCt values are presented to G12D show Kras expression in indicated experimental groups, statistical analyses were assayed on ΔCt. Primer sequences for EMT related genes are listed in Supplemental Table 1, GAPDH was used as an internal control. The data is presented as the relative fold change and statistical analyses were assayed on ΔCt. Tumor sphere assay Tumor sphere assays were performed as previously described . Two million cultured primary tumor cells were plated in a low-adherence 100mm dish (FB0875713, Fisherbrand) with 1% fetal bovine serum, Dulbecco's modified Eagle's medium, and penicillin/ streptomycin/amphotericin. Cells were incubated for seven days and formed spheres were counted at 100x magnification. Three, two and three cell lines were analyzed for KPC cKO cKO control, KPC; Twist and KPC; Snail group, respectively, five field of views per cell line were quantified. MRI Analyses MRI imaging was performed using a 7T small animal MR system as previously described . To measure tumor volume, suspected regions were drawn blinded on each slice based on normalized intensities. The volume was calculated by the addition of delineated regions of interest in mm × 1 mm slice distance. None of the mice had a tumor burden that exceeded Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 9 1.5 cm in diameter, in accordance with institutional regulations. All mice with measurable tumors were enrolled in the study (see Extended Table 3). Mice were imaged twice, once at the beginning of the enrollment (Day 0), and a second time 20 days (Day 19) afterwards. Surviving animals were euthanized at end point (Day 21) for histological characterization. Statistical analyses Statistical analyses were performed on the mean values of biological replicates in each group using unpaired two-tailed or one-tailed t-tests (qPCR only), one-way ANOVA with Tukey's multiple comparisons test using GraphPad Prism, as stipulated in the figure legends. χ analyses, using SPSS statistical software, were performed comparing control to cKO groups for metastatic or colonization frequency across multiple histological parameters in all mice and mice ≥ 120 days of age. Fisher's Exact P value was used to determine significance. Results are outlined in Extended Table 2. Kaplan-Meier plots were drawn for survival analysis and the log rank Mantel-Cox test was used to evaluate statistical differences, using GraphPad Prism. Data met the assumptions of each statistical test, where variance was not equal (determined by an F-test) Welch's correction for unequal variances was applied. Error bars represent s.e.m. when multiple visual fields were averaged to produce a single value for each animal which was then averaged again to represent the mean bar for the group in each graph. P < 0.05 was considered statistically significant. Extended Data Extended Figure 1. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 10 A Representative H&E images of small intestine (SmInt), kidney, and heart (scale, 100μm). B Pancreatic mass of (n = 29, 13, and n = 28 mice; s.d.; one-way ANOVA). C Merge of Twist1 or Snai1 in situ hybridization (black) followed by CK8 (red) immunolabeling in cKO cKO tumors from KPC and KPC; Twist or KPC; Snail mice, respectively. White arrows highlight positive cells in the stroma while yellow arrows highlight negative epithelium cKO (scale, 50 μm). D Twist or Snail immunostaining in KPC and KPC; Twist or KPC; cKO Snail tumors, respectively. Black arrows highlight positive cells in the stroma while red arrows highlight negative epithelium (scale, 20 μm). E Channel separations of the representative images of αSMA immunolabeling in YFP lineage traced tumors found in Figure 1F (scale, 50 μm). F EMT gene expression signature analysis in KPC, KPC; cKO cKO Twist and KPC; Snail cohorts (n = 3 mice). Red arrows indicate reduced Twist1 and cKO cKO Snai1 expression in KPC; Twist and KPC; Snail cohorts, respectively. Extended Figure 2. A E-Cadherin immunolabeling and quantification of primary KPC (n = 5 mice), KPC; cKO cKO Twist (n = 5 mice) and KPC; Snail (n = 4 mice) (scale, 100 μm). B Zeb2 cKO immunolabeling and quantification of primary KPC (n = 6 mice), KPC; Twist (n = 5 cKO mice) and KPC; Snail (n = 7 mice) (scale, 50 μm; inset scale, 20 μm). C Sox4 cKO immunolabeling and quantification of primary KPC (n = 7 mice), KPC; Twist (n = 6 cKO mice) and KPC; Snail (n = 8 mice) (scale, 50 μm; inset scale, 20 μm). D Slug cKO immunolabeling and quantification of primary KPC (n = 4 mice), KPC; Twist (n = 4 cKO mice) and KPC; Snail (n = 4 mice) tumors (scale, 50 μm; inset scale, 20 μm). E Sirius cKO Red staining and quantification of primary KPC (n = 21 mice), KPC;Twist (n = 8 mice) cKO and KPC;Snail (n = 11 mice) (scale, 200 μm; s.d.) F αSMA immunolabeling and Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 11 cKO cKO quantification of primary KPC (n = 5 mice), KPC;Twist (n = 5 mice) and KPC;Snail (n = 5 mice) (scale, 100 μm). G CD31 immunolabeling and quantification of primary KPC cKO cKO (n = 4 mice), KPC;Twist (n = 4 mice) and KPC;Snail (n = 3 mice) (scale, 200 μm, inset scale, 100 μm). H Pimonidazole staining and quantification of primary KPC (n = 4 cKO cKO mice), KPC; Twist (n = 4 mice) and KPC; Snail (n = 4 mice) (scale, 100 μm). I CD3 cKO immunolabeling and quantification of primary KPC (n = 5 mice), KPC;Twist (n = 5 cKO mice) and KPC;Snail (n = 5 mice) (scale, 100 μm; inset scale, 25 μm). Unless otherwise indicated error bars represent s.e.m, and significance determined by One-way ANOVA. *P < 0.05, ** P <0.01, *** P <0.001. ns, not significant. Extended Figure 3. A Immunolabeling of primary tumors (n = 3 mice) for αSMA (red), CK8 (green), Ki-67 (white) and DAPI (blue); yellow arrows point to EMT cells (scale, 20 μm). B Representative dot plots of circulating YFP cells. C Images of serial sections of KPC; LSL- YFP lung and liver metastasis stained for H&E or immunolabeled for CK19 or YFP. Yellow dashed box represents magnified areas in panel below (scale, 200 μm; magnification scale, 100 μm). D KPC metastatic tumors stained for Twist and Snail (n = 3 mice; scale, 50 μm; inset scale, 20 μm). E Zeb1 immunolabeling and quantification of metastatic KPC (n = 4 cKO cKO mice), KPC; Twist (n = 3 mice) and KPC; Snail (n = 4 mice) (scale, 50 μm; inset scale, 20 μm). F αSMA immunolabeling and quantification of metastatic KPC (n = 3 mice), cKO cKO KPC; Twist (n = 3 mice) and KPC; Snail (n = 3 mice) (scale, 50 μm; inset scale, 20 μm). G E-Cadherin staining on serial sections of αSMA immunolabeling and quantification cKO cKO of metastatic KPC (n = 4 mice), KPC; Twist (n = 3 mice) and KPC; Snail (n = 4 mice) (scale, 50 μm; inset scale, 20 μm).H Ki-67 immunolabeling and quantification of Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 12 cKO cKO metastatic KPC (n = 7 mice), KPC; Twist (n = 3 mice) and KPC; Snail (n = 3 mice) (scale, 50 μm). Unless otherwise indicated error bars represent s.e.m, percentages indicated represent percent decrease from control, and significance determined by One-way ANOVA. * P <0.05, ** P <0.01, *** P <0.001. ns, not significant. Extended Figure 4. cKO cKO A Brightfield micrograph of cultured primary KPC, KPC; Twist and KPC; Snail cells (scale, 50 μm). B EMT and gemcitabine transport related gene expression shown by qPCR cKO cKO analysis in KPC (n = 3-4 cell lines), KPC; Twist (n = 5 cell lines) and KPC; Snail (n = 5-6 cell lines) (s.d., one-tailed t-test, * P < 0.05, numbers list non-significant P values. nd: not detected, ns: not significant). C MTT assay showing cell proliferation in KPC, KPC; cKO cKO Twist and KPC; Snail cells (n = 8, 8, and 8 biological replicates of a cell line for each cKO genotype). D Relative cell viability (MTT assay) in cultured KPC, KPC; Twist and KPC; cKO Snail cells treated with gemcitabine or erlotinib (n = 8, 8, and 8 biological replicates of a cell line for each genotype). Unless otherwise indicated error bars represent s.e.m, significance was determined by one-way ANOVA. ** P <0.01, *** P <0.001, **** P <0.0001. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 13 Extended Figure 5. A Representative H&E images (scale, 100 μm). B Relative percentage of each histological cKO tissue phenotype of KTC (n = 8 mice) and KTC; Snail (n = 6 mice) primary tumors cKO (s.d.). C Primary tumor invasiveness in KTC (n = 8 mice) and KTC; Snail (n = 6 mice) cKO (s.d.). D Pancreatic mass in KTC (n = 5 mice) and KTC; Snail (n = 6 mice) (s.d.). E cKO Immunolabeling and quantification of primary KTC (n = 5 mice), KTC; Snail (n = 4 mice) for αSMA (red), CK8 (green) and DAPI (blue); white arrows indicate double positive cells (scale, 20 μm), Zeb1 (scale, 50 μm; inset scale. 20μm), cleaved caspase-3 (scale, 50 μm; n = 4 and 4 mice), Ki-67 (scale, 100 μm), ENT2 (scale, 100 μm) and CNT3 (scale, 100 μm). Unless otherwise indicated error bars represent s.e.m, and significance determined by two-tailed t-test. * P <0.05, *** P <0.001. ns, not significant. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 14 Extended Figure 6. cKO A-B Staining and quantification of (A) KTC (n = 5 or 6 mice), KTC; Snail (n = 4 or 5 cKO mice) (B) KTC + GEM (n = 4 or 5 mice), KTC; Snail + GEM (n = 5 mice) for Masson's Trichrome Stain (MTS) (scale, 200 μm), Sirius Red staining (scale, 200 μm), and ENT1 (scale, 100 μm). Error bars represent s.d. (MTS and Sirius Red) or s.e.m. (ENT1), and significance determined by two-tailed t-test. ns, not significant. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 15 Nature. Author manuscript; available in PMC 2016 May 18. Extended Table 1 cKO cKO Pathological spectrum of disease and metastasis in KPC, KPC; Twist and KPC; Snail cohorts. Pathological Spectrum within cohorts ID AGE PDA Differentiation Histology 1 Histology 2 Liver Lung Spleen Any Moribund KPC (104) 1 158 Y W S G Y Y N Y Y 2 165 Y W G N N N N Y 3 148 Y P S G N N - N Y 4 135 Y M S G Y N Y Y Y 5 95 Y M G N Y N Y N 6 42 Y M G N N N N Y 7 55 Y P G S Y N N Y Y 8 91 Y M G N N N N N 9 87 Y W G N N N N N 10 63 Y P G Y Y Y Y N 11 108 Y P S G Y N N Y FD 12 110 Y W G N N N N N 13 104 Y W G Y N N Y Y 14 54 Y W S G N N N N Y 15 108 Y P S G N Y N Y Y 16 42 Y P S G N N N N Y 17 68 Y W G N N N N N 18 107 Y P G N N N N N 19 87 Y P G N N N N N 20 48 Y P G S N N N N Y 21 109 Y P G S Y Y N Y FD 22 81 Y P G Y Y N Y Y 23 151 Y W G N Y N Y Y 24 47 Y M G S N Y N Y Y 25 143 Y P G S N Y N Y Y 26 122 Y W G Y N N Y N Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 16 Nature. Author manuscript; available in PMC 2016 May 18. Pathological Spectrum within cohorts ID AGE PDA Differentiation Histology 1 Histology 2 Liver Lung Spleen Any Moribund 27 115 Y P G Y Y N Y N 28 76 Y W G N Y N Y N 29 122 Y M S G Y N N Y Y 30 97 Y P G N N N N N 31 107 Y W G N N N N N Totals (Median) 31/31 11/31 11/31 2/30 17/31 % 100.0% 35.5% 35.5% 6.7% 54.8% cKO Twist (111) 1 148 Y W G S Y N N Y N 2 151 Y P S G Y Y Y Y N 3 140 Y P G Y Y N Y Y 4 53 Y P G S N N N N Y 5 43 Y P G N N N N Y 6 117 Y P G S N N N N N 7 90 Y P S G Y N N Y Y 8 52 Y P G S N N N N Y 9 104 Y P G N N N N N 10 218 Y P G S N N Y Y Y 11 153 Y P G N Y N Y Y 12 45 Y P G S N N N N Y 13 77 Y P G S Y N N Y Y 14 126 Y P G S Y Y N Y Y Totals (Median) 14/14 6/14 4/14 2/14 8/14 % 100.0% 42.9% 28.6% 14.3% 57.1% cKO Snail (103) 1 144 Y W G N Y N Y N 2 51 Y P G S N N N N Y Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 17 Nature. Author manuscript; available in PMC 2016 May 18. Pathological Spectrum within cohorts ID AGE PDA Differentiation Histology 1 Histology 2 Liver Lung Spleen Any Moribund 3 105 Y P G S N Y N Y Y 4 111 Y P G N N N N N 5 106 Y P G S Y N Y Y Y 6 129 Y P G N N N N N 7 102 Y P G S N Y - Y N 8 98 Y P G S Y N Y Y N 9 47 Y P G S N N N N Y 10 54 Y W G Y Y N Y FD 11 59 Y M G Y N N Y N 12 103 Y P G Y N N Y N 13 60 Y P S G Y N Y Y Y 14 77 Y P G Y N N Y Y 15 57 Y M S G Y N N Y FD 16 130 Y P G Y Y N Y FD 17 76 Y P G S N N N N FD 18 111 Y P G N Y N Y Y 19 100 Y P G S Y N Y Y FD 20 104 Y P G S Y N N Y Y 21 124 Y M G N N N N FD 22 88 Y P G S N N N N Y 23 192 Y W G Y Y N Y Y 24 122 Y P G N N N N Y 25 60 Y W G S N N N N Y 26 112 Y W G N Y N Y N 27 48 Y P G S N N N N Y 28 48 Y P G S N N N N Y 29 124 Y P G S Y Y Y Y N 30 215 Y W G N N N N N Totals (Median) 30/30 13/30 9/30 5/29 18/30 % 100.0% 43.3% 30.0% 17.2% 60.0% Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 18 Extended Table 2 Results of χ analysis reporting Fisher's Exact P value. χ2 Analysis Group Perameter Fisher's Exact P value Differentiation All Ages cKO Control vs. Twist Early Tumor progression 0.458 cKO Control vs. Snail 0.106 cKO Control vs. Twist Late Tumor progression 0.458 cKO Control vs. Snail 0.106 cKO Control vs. Twist Sarcomatoid 0.108 cKO Control vs. Snail 0.446 Differentiation ≥120 days cKO Control vs. Twist Early Tumor progression 0.580 Nature. Author manuscript; available in PMC 2016 May 18. Key: (Y) yes. (N) no, (W) well, (M) moderate, (P) poor, (G) glandular, (S) sarcomatoid, (FD) found dead, (-) no tissue Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 19 χ2 Analysis Group Perameter Fisher's Exact P value cKO Control vs. Snail 0.569 cKO Control vs. Twist Late Tumor progression 0.580 cKO Control vs. Snail 0.569 cKO Control vs. Twist Sarcomatoid 1.000 cKO Control vs. Snail 0.119 Metastasis All Ages cKO Control vs. Twist Liver Metastasis 0.744 cKO Control vs. Snail 0.358 cKO Control vs. Twist Lung Metastasis 0.743 cKO Control vs. Snail 0.786 cKO Control vs. Twist Spleen Invasion 0.581 cKO Control vs. Snail 0.254 cKO Control vs. Twist Any Metastasis 1.000 cKO Control vs. Snail 0.797 Metastasis ≥120 days cKO Control vs. Twist Liver Metastasis 0.627 Control vs. SnailcKO 1.000 cKO Control vs. Twist Lung Metastasis 0.592 Control vs. SnailcKO 1.000 cKO Control vs. Twist Spleen Invasion 0.559 Control vs. SnailcKO 1.000 cKO Control vs. Twist Any Metastasis 0.473 Control vs. SnailcKO 0.608 Extended Table 3 cKO cKO Pathological spectrum of disease and metastasis in KPC, KPC; Twist and KPC; Snail cohorts treated with Gemcitabine KPC Gemcitabine cohorts 3 3 ID Start Age (Days) Start Volume (mm ) End Volume (mm ) Survival (Days) KPC + GEM (89) (13) 1 148 1610.351 D 7 2 72 29.736 D 13 3 72 439.795 902.759 21 Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 20 KPC Gemcitabine cohorts 3 3 ID Start Age (Days) Start Volume (mm ) End Volume (mm ) Survival (Days) 4 80 44.14 D 14 5 100 536.304 592.31 21 6 89 166.968 D 2 7 94 52.734 D 7 6 122 90.211 D 14 9 164 217.919 D 8 10 143 212.817 D 18 11 84 323.829 897.217 21 12 58 76.734 D 4 13 58 116.186 D 8 Mean (Median) 301.4 797.4 Stdev 406.9 145.1 cKO Twist + GEM (79) (21) 1 117 243.0 644.2 21 2 75 47.2 180.0 21 3 75 45.4 460.9 21 4 78 54.6 47.5 21 5 46 53.7 66.5 21 6 96 63.1 D 13 7 90 23.9 D 13 8 79 101.0 D 14 9 52 28.5 D 14 10 52 49.4 98.706 21 11 104 43.4 127.0 21 12 104 53.5 12.1 21 13 68 56.7 D 15 14 122 650.1 164.1 21 15 104 181.8 78.6 21 Mean (Median) 113.0 187.9 Stdev 154.8 193.0 cKO Snail + GEM (96) (21) 1 188 255.2 D 12 2 181 854.7 D 4 3 127 32.0 59.6 21 4 127 58.7 107.4 21 5 142 109.8 D 14 6 54 33.6 57.2 21 7 89 17.0 D 13 Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 21 KPC Gemcitabine cohorts 3 3 ID Start Age (Days) Start Volume (mm ) End Volume (mm ) Survival (Days) 8 78 54.9 39.6 21 9 78 3.1 D 15 10 104 209.7 134.3 21 11 96 220.0 280.2 21 12 96 24.1 46.2 21 13 119 711.0 D 18 14 126 655.6 805.4 21 15 119 168.6 D 18 16 82 453.8 517.4 21 17 82 56.7 74.1 21 18 90 40.0 D 16 19 67 80.5 D 10 20 66 49.5 226.2 21 Mean (Median) 204.4 213.4 Stdev 250.7 231.7 Key: (D) died Supplementary Material Refer to Web version on PubMed Central for supplementary material. Acknowledgements We wish to thank Donna Lundy, Sujuan Yang, Zhenna Xiao, Rafael Deliz-Aguirre, Toru Miyake, and Sara Lovisa for technical support and Karen M. Ramirez and Ryan Jewell in the South Campus Flow Cytometry Core Lab of MD Anderson Cancer Center for FACS sorting and analysis (Grant, NCI# P30CA16672). As well as Edward Chang for scanning slides of histopathological specimens. This study was primarily supported by the Cancer Prevention and Research Institute of Texas and the Metastasis Research Center at the MD Anderson Cancer Center. The research in R.K. laboratory is also supported by the NIH grants P30CA016672, CA125550, CA155370, CA151925 and CA163191. The research in V.S.L. laboratory is supported by the NIH/NCI CCSG New Faculty Award P30CA016672 and UT MDACC Khalifa Bin Zayed Al Nahya Foundation. References 1. Hotz B, et al. Epithelial to mesenchymal transition: expression of the regulators snail, slug, and twist in pancreatic cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007; 13:4769–4776. doi:10.1158/1078-0432.CCR-06-2926. [PubMed: 17699854] 2. Arumugam T, et al. Epithelial to mesenchymal transition contributes to drug resistance in pancreatic cancer. Cancer research. 2009; 69:5820–5828. doi:10.1158/0008-5472.CAN-08-2819. [PubMed: 19584296] 3. Taube JH, et al. Core epithelial-to-mesenchymal transition interactome gene- expression signature is associated with claudin-low and metaplastic breast cancer subtypes. Proceedings of the National Academy of Sciences of the United States of America. 2010; 107:15449–15454. doi:10.1073/pnas. 1004900107. [PubMed: 20713713] 4. Rhim AD, et al. EMT and dissemination precede pancreatic tumor formation. Cell. 2012; 148:349– 361. doi:10.1016/j.cell.2011.11.025. [PubMed: 22265420] Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 22 5. Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 2009; 119:1420–1428. doi:10.1172/jci39104. [PubMed: 19487818] 6. McDonald OG, Maitra A, Hruban RH. Human correlates of provocative questions in pancreatic pathology. Advances in anatomic pathology. 2012; 19:351–362. doi:10.1097/PAP. 0b013e318273f998. [PubMed: 23060061] 7. Guaita S, et al. Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. The Journal of biological chemistry. 2002; 277:39209– 39216. doi:10.1074/jbc.M206400200. [PubMed: 12161443] 8. Wellner U, et al. The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness- inhibiting microRNAs. Nature cell biology. 2009; 11:1487–1495. doi:10.1038/ncb1998. [PubMed: 19935649] 9. Zhang K, et al. Knockdown of snail sensitizes pancreatic cancer cells to chemotherapeutic agents and irradiation. International journal of molecular sciences. 2010; 11:4891–4892. doi:10.3390/ ijms11124891. [PubMed: 21614180] 10. Tsai JH, Donaher JL, Murphy DA, Chau S, Yang J. Spatiotemporal regulation of epithelial- mesenchymal transition is essential for squamous cell carcinoma metastasis. Cancer cell. 2012; 22:725–736. doi:10.1016/j.ccr.2012.09.022. [PubMed: 23201165] 11. Stockinger A, Eger A, Wolf J, Beug H, Foisner R. E-cadherin regulates cell growth by modulating proliferation-dependent beta-catenin transcriptional activity. The Journal of cell biology. 2001; 154:1185–1196. doi:10.1083/jcb.200104036. [PubMed: 11564756] 12. Muraoka-Cook RS, Dumont N, Arteaga CL. Dual role of transforming growth factor beta in mammary tumorigenesis and metastatic progression. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005; 11:937s–943s. [PubMed: 15701890] 13. Hugo HJ, et al. Direct repression of MYB by ZEB1 suppresses proliferation and epithelial gene expression during epithelial-to-mesenchymal transition of breast cancer cells. Breast cancer research : BCR. 2013; 15:R113. doi:10.1186/bcr3580. [PubMed: 24283570] 14. Mani SA, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 2008; 133:704–715. doi:10.1016/j.cell.2008.03.027. [PubMed: 18485877] 15. Liu H, et al. Cancer stem cells from human breast tumors are involved in spontaneous metastases in orthotopic mouse models. Proceedings of the National Academy of Sciences of the United States of America. 2010; 107:18115–18120. doi:10.1073/pnas.1006732107. [PubMed: 20921380] 16. Wang Z, et al. Activated K-Ras and INK4a/Arf deficiency promote aggressiveness of pancreatic cancer by induction of EMT consistent with cancer stem cell phenotype. Journal of cellular physiology. 2013; 228:556–562. doi:10.1002/jcp.24162. [PubMed: 22806240] 17. Yang J, et al. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell. 2004; 117:927–939. doi:10.1016/j.cell.2004.06.006. [PubMed: 15210113] 18. Vega S, et al. Snail blocks the cell cycle and confers resistance to cell death. Genes & development. 2004; 18:1131–1143. doi:10.1101/gad.294104. [PubMed: 15155580] 19. Shah AN, et al. Development and characterization of gemcitabine-resistant pancreatic tumor cells. Annals of surgical oncology. 2007; 14:3629–3637. doi:10.1245/s10434-007-9583-5. [PubMed: 17909916] 20. Yin T, et al. Expression of snail in pancreatic cancer promotes metastasis and chemoresistance. The Journal of surgical research. 2007; 141:196–203. doi:10.1016/j.jss.2006.09.027. [PubMed: 17583745] 21. Wang Z, et al. Acquisition of epithelial-mesenchymal transition phenotype of gemcitabine-resistant pancreatic cancer cells is linked with activation of the notch signaling pathway. Cancer research. 2009; 69:2400–2407. doi:10.1158/0008-5472.CAN-08-4312. [PubMed: 19276344] 22. Alagesan B, et al. Combined MEK and PI3K inhibition in a mouse model of pancreatic cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015; 21:396–404. doi:10.1158/1078-0432.ccr-14-1591. [PubMed: 25348516] 23. Cursons J, et al. Stimulus-dependent differences in signalling regulate epithelial mesenchymal plasticity and change the effects of drugs in breast cancer cell lines. Cell communication and signaling : CCS. 2015; 13:26. doi:10.1186/s12964-015-0106-x. [PubMed: 25975820] Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 23 24. Javle MM, et al. Epithelial-mesenchymal transition (EMT) and activated extracellular signal- regulated kinase (p-Erk) in surgically resected pancreatic cancer. Annals of surgical oncology. 2007; 14:3527–3533. doi:10.1245/s10434-007-9540-3. [PubMed: 17879119] 25. Masugi Y, et al. Solitary cell infiltration is a novel indicator of poor prognosis and epithelial- mesenchymal transition in pancreatic cancer. Human pathology. 2010; 41:1061–1068. doi: 10.1016/j.humpath.2010.01.016. [PubMed: 20413143] 26. Park JY, et al. Pdx1 expression in pancreatic precursor lesions and neoplasms. Applied immunohistochemistry & molecular morphology : AIMM / official publication of the Society for Applied Immunohistochemistry. 2011; 19:444–449. doi:10.1097/PAI.0b013e318206d958. [PubMed: 21297446] 27. Offield MF, et al. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development. 1996; 122:983–995. [PubMed: 8631275] 28. Hidalgo M. Pancreatic cancer. The New England journal of medicine. 2010; 362:1605–1617. doi: 10.1056/NEJMra0901557. [PubMed: 20427809] 29. Kleger A, Perkhofer L, Seufferlein T. Smarter drugs emerging in pancreatic cancer therapy. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2014; 25:1260–1270. doi:10.1093/annonc/mdu013. [PubMed: 24631947] 30. Gore AJ, Deitz SL, Palam LR, Craven KE, Korc M. Pancreatic cancer-associated retinoblastoma 1 dysfunction enables TGF-beta to promote proliferation. The Journal of clinical investigation. 2014; 124:338–352. doi:10.1172/jci71526. [PubMed: 24334458] 31. Hingorani SR, et al. Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer cell. 2005; 7:469–483. doi:10.1016/j.ccr.2005.04.023. [PubMed: 15894267] 32. Ijichi H, et al. Aggressive pancreatic ductal adenocarcinoma in mice caused by pancreas-specific blockade of transforming growth factor-beta signaling in cooperation with active Kras expression. Genes & development. 2006; 20:3147–3160. doi:10.1101/gad.1475506. [PubMed: 17114585] 33. Ozdemir BC, et al. Depletion of carcinoma-associated fibroblasts and fibrosis induces immunosuppression and accelerates pancreas cancer with reduced survival. Cancer cell. 2014; 25:719–734. doi:10.1016/j.ccr.2014.04.005. [PubMed: 24856586] 34. Keskin D, et al. Targeting Vascular Pericytes in Hypoxic Tumors Increases Lung Metastasis via Angiopoietin-2. Cell reports. 2015; 10:1066–1081. doi:10.1016/j.celrep.2015.01.035. [PubMed: 25704811] 35. Smyth, GK. Limma: linear models for microarray data. In Bioinformatics and Computational Biology Solutions using R and Bioconductor. Gentleman, R.; Carey, V.; Dudoit, S.; Irizarry, R.; Huber, W., editors. Springer; New York: 2005. 36. Ying H, et al. Oncogenic Kras maintains pancreatic tumors through regulation of anabolic glucose metabolism. Cell. 2012; 149:656–670. doi:10.1016/j.cell.2012.01.058. [PubMed: 22541435] 37. Melo SA, et al. Glypican-1 identifies cancer exosomes and detects early pancreatic cancer. Nature. 2015; 523:177–182. doi:10.1038/nature14581. [PubMed: 26106858] Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 24 Figure 1. EMT inhibition does not alter primary tumor progression A Representative H&E stained primary tumors (scale; 100μm). B Relative percentages of each primary tumor histological tissue phenotype (n = 31, 14, and 30 mice; s.d.). C Local invasiveness (n = 31, 14, and 30 mice; s.d.). D Overall survival (n = 29, 12, and 33 mice). E Twist1 or Snai1 in situ hybridization (black) with CK8 (red) immunolabeling in primary + + + + tumors (n = 3 mice for all groups) relative percentage of Twist1 CK8 or Snai1 CK8 double positive cells (scale, 50μm; two-tailed t-test). F αSMA immunolabeling in YFP lineage traced tumors (n = 3 and 3 mice; scale, 50μm; two-tailed t-test). G αSMA (red), Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 25 CK8 (green) and DAPI (blue); white arrows indicate double positive cells (n = 4 mice for all groups; scale, 20μm). H Zeb1 (n = 5, 6, and 6 mice; scale, 50 μm; inset scale, 20 μm). I Masson's Trichrome Stain (MTS) (n = 8, 7, and 7 mice; scale, 200 μm; s.d.). Unless otherwise indicated error bars represent s.e.m, percentages represent percent change from control and significance determined by oneway ANOVA. *P < 0.05, ** P <0.01, *** P <0.001, **** P <0.0001. ns, not significant. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 26 Figure 2. EMT inhibition does not alter invasion and metastasis Primary tumor immunolabeling for (A) Cleaved caspase-3 (n = 6 mice for all groups; scale, 50μm) and (B) Ki-67 (n = 7, 7, and 9 mice; scale, 100 μm). C Percentage of YFP G12D circulating tumor cells (CTC) (n = 8 and 8 mice; two-tailed t-test; s.d.). D Kras expression in whole blood cell pellets (n = 5, 3, and 5 mice; s.d.). E H&E and CK19 immunolabeling of metastatic liver nodules. Metastatic tumor (T) nodules outlined by a dotted line (scale, 100μm). Table representing the number of positive tissues out of total tissues examined (χ analysis). F Expression analysis of Twist1 and Snai1 in cultured Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 27 primary tumor cell lines (n = 4 and 5 or 4 and 6 individual cell lines; one-tailed t-test of ΔCt; s.d.). G Brightfield or YFP images and quantification of sphere number in cultured tumor cell lines (n = 3, 2, and 3 individual cell lines; scale, 50μm). H H&E images (scale, 100μm) of colonized lungs from i.v. injected cultured primary tumor cell lines KPC (n = 5 and 5 cKO mice for each cell line) and KPC; Twist (n = 11 and 4 mice for each cell line) and KPC; cKO Snail (n = 4, 5, and 5 mice for each cell line). Table representing the number of colonized tissues out of total tissues examined (χ analysis). Unless otherwise indicated error bars represent s.e.m and significance determined by one-way ANOVA. * P <0.05, ** P <0.01, **** P <0.0001. ns, not significant. nd, not detected. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 28 Figure 3. EMT inhibition sensitizes tumors to gemcitabine in KPC GEMM Primary tumor immunolabeling for (A) ENT1, (B) ENT2, and (C) CNT3 (n = 6, 5, and 4 mice; scale, 100 μm; s.e.m., two-tailed t-test). D MRI tumor volumes of KPC + GEM (n = cKO 13 mice, 10 died before Day 19), KPC; Twist + GEM (n = 15 mice, 6 died before Day cKO 19) and KPC; Snail + GEM (n = 20 mice, 9 died before Day 19) (one-way ANOVA comparing mean tumor volumes on Day 0 and Day 19, respectively). E Survival on gemcitabine treatment to end point (Day 21). F H&E stained primary tumors (scale, Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 29 100μm). G Relative percentages of each histological tissue phenotype of end point mice (n = 3, 9, and 11 mice; s.d.; two-tailed t-test). * P <0.05, ** P <0.01. ns, not significant. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 30 Figure 4. EMT inhibition sensitizes tumors to gemcitabine in KTC GEMM Primary tumor (A) H&E (scale, 100 μm) and (B) relative percentage of each histological tissue phenotype (n = 5 and 7 mice; s.d.) C Local invasiveness (n = 5 and 7 mice; s.d.). D Pancreatic mass (n = 3 and 4 mice; s.d.). E Overall survival of KTC + GEM (n = 8 mice) cKO and KTC; Snail + GEM (n = 4 mice). F Overall survival of KTC (n = 6 mice) and KTC; cKO Snail (n = 3 mice). G αSMA (red), CK8 (green) and DAPI (blue); white arrows indicate double positive cells (n = 4 mice; scale, 20 μm), Zeb1 (n = 4 and 5 mice; scale, 50 μm; inset scale, 20μm), cleaved caspase-3 (n = 4 and 5 mice; scale, 50 μm), Ki-67 (n = 4 and 5 mice; Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 31 scale, 100 μm), ENT2 (n = 5 mice; scale, 100 μm), and CNT3 (n = 5 mice; scale, 100 μm). Unless otherwise indicated error bars represent s.e.m and significance determined by two- tailed t-test. * P <0.05, ** P <0.01, *** P <0.001. ns, not significant. Nature. Author manuscript; available in PMC 2016 May 18. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nature Pubmed Central

EMT Program is Dispensable for Metastasis but Induces Chemoresistance in Pancreatic Cancer

Download PDF
31 pages

Loading next page...
 
/lp/pubmed-central/emt-program-is-dispensable-for-metastasis-but-induces-chemoresistance-UB0R03sSNt

References (49)

ISSN
0028-0836
eISSN
1476-4687
DOI
10.1038/nature16064
Publisher site
See Article on Publisher Site

Abstract

Author Manuscript Author Manuscript Author Manuscript Author Manuscript HHS Public Access Author manuscript Nature. Author manuscript; available in PMC 2016 May 18. Published in final edited form as: Nature. 2015 November 26; 527(7579): 525–530. doi:10.1038/nature16064. EMT Program is Dispensable for Metastasis but Induces Chemoresistance in Pancreatic Cancer #1 #1 1 1 1 Xiaofeng Zheng , Julienne L. Carstens , Jiha Kim , Matthew Scheible , Judith Kaye , 1 2 1 1,3,4 Hikaru Sugimoto , Chia-Chin Wu , Valerie S. LeBleu , and Raghu Kalluri Department of Cancer Biology, Metastasis Research Center, University of Texas MD Anderson Cancer Center, Houston, Texas Department of Genomic Medicine, University of Texas MD Anderson Cancer Center, Houston, Texas Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas Department of Bioengineering, Rice University, Houston, Texas. These authors contributed equally to this work. Diagnosis of pancreatic ductal adenocarcinoma (PDAC) is associated with dismal prognosis despite current therapies; therefore new treatment strategies are urgently required. Numerous studies have suggested that epithelial to mesenchymal transition (EMT) contributes to early- 1 4 stage dissemination of cancer cells and is pivotal for invasion and metastasis of PDAC . EMT program is associated with phenotypic conversion of epithelial cells into mesenchymal-like cells in cell culture conditions, albeit such defined mesenchymal conversion (with spindle shaped morphology) of epithelial cells is rare with quasi- 5 6 mesenchymal phenotypes occasionally observed in the tumor (partial EMT) . Most studies exploring the functional role of EMT in tumors have depended on cell culture induced loss- of-function and gain-of-function experiments involving EMT inducing transcription factors 2 3 7 10 , , - such as Twist, Snail and Zeb1 . Therefore, the functional contribution of EMT 4 6 program for invasion and metastasis remains unclear and genetically engineered mouse models (GEMMs) to specifically address a causal connection are lacking. Here we functionally probed the role of EMT program in PDAC by generating PDAC GEMMs with deletion of Snail or Twist, two key transcription factors responsible for EMT. EMT suppression in the primary tumor did not alter the emergence of invasive PDAC, systemic Users may view, print, copy, and download text and data-mine the content in such documents, for the purposes of academic research, subject always to the full Conditions of use:http://www.nature.com/authors/editorial_policies/license.html#terms Address for Correspondence: Raghu Kalluri, MD, PhD, ; Email: [email protected] AUTHOR CONTRIBUTIONS R.K. conceptually designed the strategy for this study, participated in discussions, provided intellectual input, supervised experimental discussion and helped write the manuscript. V.S.L. helped design experimental strategy, provided intellectual input, supervised the studies, performed immunohistochemistry and culture experiments, generated the figures and wrote the manuscript. X.Z. performed experiments to generate the GEMMs and helped characterize the mouse phenotype, performed culture experiments, collected the tissue for analysis and contributed to the manuscript writing. J.L.C. characterized the mouse phenotype, analyzed the data related to the GEMMs, collected data, generated the figures and helped with manuscript writing and editing. H.S. performed experiments with mice and injected cancer cells and helped collect tissue, J.Kim., M.S., J.Kaye., and C.-C.W. performed experiments and collected data. The data was analyzed by J.L.C, V.S.L., X.Z., J.Kim, and C.-C.W. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 2 dissemination and metastasis. Suppression of EMT led to an increase in cancer cell proliferation with enhanced expression of nucleoside transporters in tumors, contributing to enhanced sensitivity to gemcitabine treatment and increased overall survival of mice. Collectively, our study suggests that Snail or Twist induced EMT program is not rate- limiting for invasion and metastasis but highlights the importance of combining EMT inhibition with chemotherapy for the treatment of pancreatic cancer. L/L L/L G12D R172H/+ We crossed Twist1 or Snai1 mice with Pdx1-Cre; LSL-Kras ; P53 (KPC) G12D R172H/+ L/L cKO to generate the Pdx1-Cre; LSL-Kras ; P53 ; Twist1 (KPC; Twist ) and the G12D R172H/+ L/L cKO Pdx1-Cre; LSL-Kras ; P53 ; Snai1 (KPC; Snail ) mice, respectively. The resultant progeny were born in an expected Mendelian ratio, without overt phenotypic findings other than the anticipated emergence of spontaneous pancreatic cancer (Extended Figure 1A). Genetic deletion of Snai1 or Twist1 did not significantly delay pancreatic tumorigenesis, alter tumor histopathology features or local invasion (Figure 1A-C and cKO cKO Extended Table 1). KPC; Twist and KPC; Snail mice displayed similar tumor burden compared to KPC control mice (Extended Figure 1B), and insignificant difference in overall survival (Figure 1D). Loss of Twist1 or Snai1 expression in the pancreas epithelium was confirmed by in situ hybridization coupled with CK8 epithelial immunolabeling (Figure 1E and Extended Figure 1C) as well as immunolabeling for Twist and Snail (Extended Figure 1D). Suppression of EMT program was significantly noted (Figure 1F-G, Extended Figure 1E). Lineage tracing (Figure 1F) and immunolabeling of the primary tumor (Figure 1G) showed a significant decrease in the frequency of epithelial cells with expression of the mesenchymal marker αSMA (EMT cells) and a decrease in expression of EMT inducing transcription factor, Zeb1 (Figure 1H). Global gene expression profiling of tumors revealed a decrease in expression of EMT associated genes (including cKO cKO Snai1 and Twist1) in KPC; Snail and KPC; Twist mice compared to KPC control (Extended Figure 1F). Loss of Snail and Twist enhanced E-cadherin expression and suppressed Zeb2 and Sox4 expression in cancer cells (Extended Figure 2A-C). Snai2 (Slug) expression was restricted to early PanIN lesion in all the experimental groups with no cKO observed expression in advanced tumors and was significantly reduced in KPC; Snail cKO and KPC;Twist mice compared to KPC control mice (Extended Figure 2D). While desmoplasia, including extracellular matrix (ECM) and myofibroblasts content (Figure 1I and Extended Figure 2E-F), tumor vessel density (Extended Figure 2G), intratumoral hypoxia (Extended Figure 2H), CD3 T-cell infiltration (Extended Figure 2I), and cancer cell apoptosis was unaffected with Twist/Snail deletion in KPC tumors (Figure 2A), the proliferation of cancer cells in mice with suppressed EMT program was significantly increased (Figure 2B), as shown previously in mouse models of breast 11 13 - + cancers . Immunostaining experiments further revealed that EMT cancer cells are largely Ki67 (Extended Figure 3A). Altogether, the data suggests that EMT program driven by Twist/Snail transcription factors is dispensable for initiation and progression of primary pancreatic cancer. Next, we investigated whether suppression of EMT program impacts invasion and + cKO metastasis. The number of YFP CTCs from lineage traced KPC and KPC; Twist was found unchanged (Figure 2C and Extended Figure 3B), and expression of cancer cell Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 3 G12D cKO cKO specific Kras mRNA in the blood from KPC, KPC; Twist and KPC; Snail was unaffected (Figure 2D), suggesting that suppression of EMT program in pancreatic tumors does not impact the rate of systemic dissemination of cancer cells. Extensive histopathological analyses, coupled with CK19 or YFP immunostaining of distant metastatic target organs, namely the liver, lung and spleen, indicated a similar frequency of metastasis in EMT suppressed tumors when compared to control tumors (Figure 2E, Extended Figure 3C, Extended Table 1, and Extended Table 2). The metastases were negative for Twist and Snail, and only a few KPC metastatic cells expressed αSMA or Zeb1 (Extended Figure 3D- F), while being positive for E-cadherin and Ki-67 (Extended Figure 3G-H). The cKO proliferation rate of cancer cells in the metastases was similar in KPC, KPC; Snail and cKO KPC; Twist mice (Extended Figure 3H). Collectively, the results indicated that the genetic deletion of Twist1 or Snai1 in PDAC GEMMs did not reduce metastatic disease. To evaluate whether cancer cells from the pancreas with and without EMT program differentially benefited from impaired proliferation to form secondary tumors, we isolated cKO cKO cancer cells from KPC, KPC; Twist and KPC; Snail mice to assay their organ colonization potential. Twist1 was significantly reduced and Snai1 expression was undetectable in cancer cells isolated from Twist and Snail deleted tumors, respectively (Figure 2F). Short-term potential to form tumor spheres (associated with putative cancer cKO cKO stem phenotype) appeared similar in Twist and Snail KPC cells when compared to 3 8 14 16 , , - control KPC cells (Figure 2G) . Lung colonization frequency following the i.v. injection of KPC cancer cells (Twist or Snail deleted) were similar to the control KPC cancer cells (Figure 2H). These results suggest that a favored epithelial phenotype of cancer cells (via suppression of EMT program) did not impact the capacity to form tumor spheres or their ability for organ colonization . Cancer cell EMT program is associated with gemcitabine drug resistance in PDAC patients 1 2 8 9 18 23 , , , , - and in the orthotopic mouse models of PDAC . Moreover, enhanced frequency of 24 25 + , EMT cancer cells in pancreatic tumors is associated with poor survival . To determine whether EMT program suppression enhances PDAC sensitivity to gemcitabine chemotherapy, we tested the gemcitabine sensitivity of cancer cells with suppressed EMT program in KPC mice. Equilibrative nucleoside transporter ENT1 and concentrating nucleoside transporter CNT3 were significantly upregulated in cancer cells lacking Snail and cKO Twist, while ENT2 expression was unchanged (Figure 3A-C). KPC, KPC; Snail and cKO KPC; Twist mice were treated with gemcitabine and tumor burden was monitored by cKO MRI (Extended Table 3). Tumor progression was suppressed in KPC; Snail and KPC; cKO cKO Twist mice when compared to treated KPC control mice (Figure 3D). KPC; Snail cKO and KPC; Twist mice treated with gemcitabine showed improved histopathology and increased survival (Figure 3E-G). cKO cKO Cancer cells isolated from the tumors of KPC; Snail and KPC; Twist mice showed epithelial morphology (Extended Figure 4A) and reduced expression of mesenchymal genes compared to KPC cancer cell lines (Extended Figure 4B), however, in tissue culture conditions (2D culture on plastic), equilibrative nucleoside transporters (ENT1/ENT2/ ENT3) showed similar expression pattern and expression of concentrating nucleoside transporters (CNT1/CNT3) was not detected (Extended Figure 4B). Increased proliferation Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 4 cKO cKO of KPC; Snail and KPC; Twist cancer cells compared to KPC control cells (Extended Figure 4C) likely accounted for the increased sensitivity to gemcitabine and erlotinib in this setting (Extended Figure 4D). L/L G12D Next, we crossed the Snai1 to the PDAC GEMM, Ptf1a (P48)-Cre; LSL-Kras ; L/L G12D L/L L/L Tgfbr2 (KTC) to generate Ptf1a (P48)-Cre; LSL-Kras ; Tgfbr2 ; Snai1 (KTC; cKO Snail ). The KTC model offers a reliable and penetrant disease progression rate with a cKO consistent timeline of death due to PDAC. Similar to the KPC; Snail mice, KTC; cKO Snail deletion exhibited suppression of EMT program but did not impact primary tumor histopathology, lifespan, local invasion, desmoplasia and frequency of apoptosis (Figure 4F, cKO Extended Figure 5A-E, and Extended Figure 6A). KTC; Snail mice presented with significantly reduced Zeb1 expression in cancer cells but enhanced proliferation and concentrating nucleoside transporter 3 (CNT3) expression (Extended Figure 5E). ENT2 cKO and ENT1 expression were unchanged in KTC; Snail mice compared to KTC mice cKO (Extended Figure 5E and Extended Figure 6A). KTC; Snail mice demonstrated enhanced response to gemcitabine therapy, with significant normal parenchymal area and cKO reduced tumor tissue (Figure 4A-C). Gemcitabine therapy in KTC; Snail reduced tumor burden (Figure 4D) and significantly improved overall survival (Figure 4E) of mice when compared to gemcitabine treated control KTC mice. Gemcitabine therapy specifically increased cancer cell apoptosis and removed enhanced proliferation observed in EMT program suppressed tumors (Figure 4G and Extended Figure 5E), without impacting the desmoplastic reaction (Extended Figure 6B). Overall, these results suggested an enhanced sensitivity of EMT cancer cells to gemcitabine. Both the equilibrative nucleoside transporter 2 (ENT2) and the concentrating nucleoside transporter 3 (CNT3) were upregulated in EMT suppressed tumors (Figure 4G). These data support a possible mechanistic connection between EMT program and resistance to chemotherapy in PDAC. Collectively, our studies provide a comprehensive functional analysis of EMT program in PDAC progression and metastasis. Absence of either Twist1 or Snai1 did not alter cancer progression or the capacity for local invasion or metastasis to lung and liver in PDAC GEMMs. Metastasis occurs despite a significant loss of EMT program with either the deletion of Snail or Twist, and in both settings, Zeb1, Sox4, Slug and Zeb2 are also significantly suppressed. Nevertheless, it is likely that other EMT inducing factors may compensate for the loss of Snail or Twist to induce invasion and metastasis. While PDX-1 is expressed during the development of the pancreas (in early pancreatic buds: all three major lineages of the pancreas-ductal, acinar and beta-islets), its expression is largely repressed in 26 27 the adult exocrine pancreas . Therefore, deletion of Snail or Twist occurs at the embryonic stage and mice are born normal and exhibit normal pancreas histology prior to the onset of cancer. The GEMMs with Snail or Twist deletion develop PanIN lesions at the same frequency as the control mice. One could argue that suppression of EMT program starting from the inception of cancer could have launched compensatory mechanisms to overcome EMT program-dependent invasion and metastasis. However, such compensation is not observed with respect to chemo-resistance and previous studies have demonstrated that EMT program and cancer cell dissemination are observed even before PDAC lesions are detected in KPC mice . Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 5 Our study demonstrates that EMT program results in suppression of cancer cell proliferation, and suppression of drug transporter and concentrating proteins, therefore, inadvertently protecting EMT cells from anti-proliferative drugs such as gemcitabine. The correlation of decreased survival of pancreatic cancer patients with an increased EMT program is likely due to their impaired capacity to respond to gemcitabine, which is a 28 29 standard of care for most patients . Such diminished response to Gemcitabine will likely reflect on such patients also exhibiting higher metastatic disease. Collectively, our study offers the opportunity to evaluate the potential of targeting EMT program to enhance efficacy of Gemcitabine and targeted therapies . Methods Mice G12D Characterization of disease progression and genotyping for the Pdx1-Cre; LSL-Kras ; R172H/+ G12D L/L P53 (herein referred to as KPC) and Ptf1a (P48)-Cre; LSL-Kras ; Tgfbr2 31 33 (herein referred to as KTC) mice were previously described . These mice were bred to L/L cKO L/L cKO Snai1 (herein referred to as Snail ), Twist1 (herein referred to as Twist ), and cKO R26-LSL-EYFP . Snail mice were kindly provided by S.J. Weiss, University of cKO Michigan, Ann Arbor. Twist mice were kindly provided by R. R. Behringer (UT MDACC, Houston, TX) via the Mutant Mouse Regional Resource Center (MMRRC) cKO cKO repository. The resulting progeny were referred to as KPC, KPC; Snail , KPC; Twist , cKO KTC, and KTC; Snail mice and were maintained on a mixed genetic background. Both males and females were used indiscriminately. Mice were given Gemcitabine (G-4177, LC Laboratories) via intraperitoneal injection (i.p.) every other day at 50 mg/kg of body weight. Hypoxyprobe was injected in a subset of mice i.p. at 60 mg/kg of body weight 30 minutes cKO prior to euthanasia. For in vivo colonization assay, one million KPC, KPC; Twist and cKO KPC; Snail tumor cells in 100 μL of PBS were injected intravenously via the retro- orbital venous sinus. Four to eleven mice were injected per cell line. All mice were euthanized at 15 days post-injection. All mice were housed under standard housing conditions at MD Anderson Cancer Center (MDACC) animal facilities, and all animal procedures were reviewed and approved by the MDACC Institutional Animal Care and Use Committee. Tumor growth met the standard of a diameter less than or equal to 1.5 cm. Investigators were not blinded for group allocation but were blinded for the assessment of the phenotypic outcome assessed by histological analyses. No randomization method or statistical sample size estimation was used. Histology and histopathology Histology, histopathological scoring, Masson's Trichrome staining (MTS), and Picrosirius 19 33 Red were previously described . Formalin-fixed tissues were embedded in paraffin and sectioned at 5 μm thickness. MTS was performed using Gomori's Trichome Stain Kit (38016SS2, Leica Biosystems). Picrosirius red staining for collagen was performed using 0.1% picrosirius red (Direct Red80; Sigma) and counterstained with Weigert's hematoxylin. Sections were also stained with hematoxylin and eosin (H&E). Histopathological measurements were assessed by scoring H&E stained tumors for relative percentages of each histopathological phenotype: normal (non-neoplastic), PanIN, well-differentiated Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 6 PDAC, moderately-differentiated PDAC, poorly-differentiated PDAC, sarcomatoid carcinoma, or necrosis. When tumor histology was missing or of poor quality, the mice were excluded from all analyses and this was determined blinded from genotype information. A histological invasion score of the tumor cells into the surrounding stroma was scored on a scale of 0 to 2, with 0 indicating no invasion and 2 indicating high invasion, where invasion is defined as tumor cell dissemination throughout the stroma away from clearly defined epithelial “nests”. Microscopic metastases were observed in H&E stained tissue sections of the liver, lung and spleen. Positivity (one or more lesions in a tissue) was confirmed using CK19 and YFP immunohistochemistry. This data has been presented as a contingency table (Figure 2E) and represented as the number of positive tissues out of the number of tissues scored. The “Any” metastasis score is the number of mice positive for a secondary lesion found anywhere throughout the body out of the total number of mice scored. Immunohistochemistry and Immunofluorescence Tissues were fixed in 10% formalin overnight, dehydrated, and embedded in paraffin and 5 μm thick sections were then processed for analyses. Immunohistochemical analysis was performed as described . Heat mediated antigen retrieval in 1 mM EDTA + 0.05% Tween20 (pH 8.0) for one hour (pressure cooker) was performed for Snail and Twist, 10 mM citrate buffer, pH 6.0 was performed for one hour (microwave) for Ki67 or 10 minutes for all other antibodies. Primary antibodies are as follows: αSMA (M0851, DAKO, 1:400 or ab5694, Abcam, 1:400), cleaved caspase-3 (9661, Cell Signaling, 1:200), CD3 (A0452, DAKO, 1:200), CD31 (Dia310M, DiaNova, 1:10), CK8 (TROMA-1, Developmental Studies Hybridoma Bank, 1:50), CK19 (ab52625, Abcam, 1:100), CNT3 (HPA023311, Sigma- Aldrich, 1:400), ENT1 (LS-B3385, LifeSpan Bio., 1:100), E-cadherin (3195S, Cell Signaling, 1:400), ENT2 (ab48595, Abcam, 1:200), Ki67 (RM-9106, Thermo Scientific, 1:400), SLUG (9585, Cell Signaling, 1:200), SNAIL (ab180714, Abcam, 1:100), SOX4 (ab86809, Abcam, 1:200), TWIST (ab50581, Abcam, 1:100), YFP (ab13970, Abcam, 1:1000), ZEB1 (NBP1-05987, Novus, 1:500), and ZEB2 (NBP1-82991, Novus, 1:100). Sections for pimonidazole adduct (HPI Inc., 1:50) or αSMA immunohistochemistry staining were blocked with M.O.M kit (Vector Laboratories, West Grove, PA) and developed by DAB according to the manufacturer's recommendations. Alternatively, for immunofluorescence, sections were dual-labeled using secondary antibodies conjugated to Alexa fluor-488 or -594 or tyramide signal amplification (TSA, PerkinElmer) conjugated to FITC. Lineage traced (YFP positive) EMT analysis was performed on 8 μm thick O.C.T. medium (TissueTek) embedded frozen sections. Sections were stained for αSMA (ab5694, Abcam, 1:400) followed by Alexa fluor-680 conjugated secondary antibody. Bright field imagery was obtained on a Leica DM1000 light microscope or the Perkin Elmer 3DHistotech Slide Scanner. Fluorescence imagery was obtained on a Zeiss Axio Imager.M2 or the Perkin Elmer Vectra Multispectral imaging platform. The images were quantified for percent positive area using NIH ImageJ analysis software (αSMA, Pimonidazole, SLUG, and CD31), percent positive cells using InForm analysis software (Ki-67 and CD3), or scored for intensity either positive or negative (CK19, YFP, ZEB1, ZEB2, SOX4, and Cleaved Caspase-3) or on a scale of 1-3 (E-cadherin) or 1-4 (ENT1, ENT2 and CNT3). Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 7 In situ hybridization In situ hybridization (ISH) was performed on frozen tumor sections as previously described . In brief, 10 μm-thick sections were hybridized with antisense probes to Twist1 and Snai1 overnight at 65°C. After hybridization, sections were washed and incubated with AP-conjugated sheep anti-DIG antibody (1:2000; Roche) for 90 min at room temperature. After three washes, sections were incubated in BM Purple (Roche) until positive staining was seen. Digoxigenin labeled in situ riboprobes were generated by in vitro transcription method (Promega and Roche) using a PCR template. The following primers were used to generate the template PCR product. Twist1; forward (5’- CGGCCAGGTACATCGACTTC-3’) and reverse (5’- TAATACGACTCACTATAGGGAGATTTAAAAGTGTGCCCCACGC-3’) Snai1: forward (5’-CAACCGTGCTTTTGCTGAC-3’) and reverse (5’- TAATACGACTCACTATAGGGAGACCTTTAAAATGTAAACATCTTTCTCC-3’) Gene Expression Profiling cKO cKO Total RNA was isolated from tumors of KPC control, KPC; Twist and KPC; Snail mice (n = 3 in each group) by TRIzol (15596026, Life Technologies) and submitted to the Microarray Core Facility at MD Anderson Cancer Center. Gene expression analysis was performed using Mouse Ref6 Gene Expression Bead Chip (Illumina). The Limma package from R Bioconductor was used for quantile normalization of expression arrays and to analyze differentially expressed genes between cKO and control sample groups (p ≤ 0.05 and fold change ≥ 1.2). Gene expression microarray data was deposited in GEO (Accession number GSE66981). Genes up-regulated in cells acquiring an EMT program were expected cKO cKO to be down-regulated in the Twist and Snail tumors compared to control tumors. CTC assays cKO Blood (200 μL) was collected from KPC;LSL-YFP and KPC; Twist ;LSL-YFP (ROSA- LSL-YFP lineage tracing of cancer cells) mice and incubated with 10 ml of ACK lysis buffer (A1049201, Gibco) at room temperature to lyse red blood cells. Cell pellets were resuspended in 2% FBS containing PBS and analyzed for the number of YFP cells by flow cytometry (BD LSRFortessa X-20 Cell Analyzer). The data was expressed as the percent YFP cells from gated cells, with 100,000 cells analyzed at the time of acquisition. Whole G12D blood cell pellets were also assayed for the expression of Kras transcripts, using quantitative real-time PCR analyses (described below). Primary pancreatic adenocarcinoma cell culture and analyses Derivation of primary PDAC cell lines were performed as previously described . Fresh tumors were minced with sterile razor blades, digested with dispase II (17105041, Gibco, 4 mg/ml)/collagenase IV (17104019, Gibco, 4 mg/ml)/RPMI for 1 h at 37°C, filtered by a 70 μm cell strainer, resuspended in RPMI/20%FBS and then seeded on collagen I coated plates (087747, Fisher Scientific). Cells were maintained in RPMI medium with 20% FBS and 1% penicillin, streptomycin and amphotericin B (PSA) antibiotic mixture. Cancer cells were further purified by FACS based on YFP or E-Cadherin expression (anti-E-cadherin antibody, 50-3249-82, eBioscience, 1:100). The sorted cells, using BD FACSAria™ II sorter (South Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 8 Campus Flow Cytometry Core Lab of MD Anderson Cancer Center) were subsequently expanded in vitro. All studies were performed on cells cultivated less than 30 passages. As these are primary cell lines no further authentication methods were applicable and no mycoplasma tests were performed. MTT and drug sensitivity assays MTT assay was performed to detect cell proliferation and viability by using Thiazolyl Blue Tetrazolium Bromide (MTT, M2128, Sigma) following the manufacturer's recommendations with an incubation of two hours at 37°C. For the drug treatment studies, a cell line derived cKO cKO from each of the KPC, KPC; Snail and KPC; Twist mice was treated with 20 μM Gemcitabine (G-4177, LC Laboratories) or 100 μM erlotinib (5083S, NEB) for 48 hours. The relative cell viability was detected using MTT assay with a cell line derived from each cKO cKO of the KPC, KPC; Snail and KPC; Twist mice. N value is defined as biological replicates of a single cell line. Control conditions included 1% DMSO vehicle for erlotinib. The relative absorbance was normalized and control (time 0 hour or vehicle treated) arbitrarily set to 1 or 100% for absorbance or drug survival, respectively. Quantitative real-time PCR analyses (qPCR) RNA was extracted from whole blood cell pellets following ACK lysis using the PicoPure Extraction kit as directed (KIT0214, Arcturus), or from cultured primary pancreatic adenocarcinoma cells using TRIzol (15596026, Life Technologies). cDNA was synthetized using TaqMan Reverse Transcription Reagents (N8080234, Applied Biosystems) or High Capacity cDNA Reverse Transcription Kit (4368814, Applied Biosystems). Primers for G12D G12D Kras recombination are: Kras forward (5’ ACTTGTGGTGGTTGGAGCAGC 3’), G12D Kras reverse (5’ TAGGGTCATACTCATCCACAA 3’). 1/ΔCt values are presented to G12D show Kras expression in indicated experimental groups, statistical analyses were assayed on ΔCt. Primer sequences for EMT related genes are listed in Supplemental Table 1, GAPDH was used as an internal control. The data is presented as the relative fold change and statistical analyses were assayed on ΔCt. Tumor sphere assay Tumor sphere assays were performed as previously described . Two million cultured primary tumor cells were plated in a low-adherence 100mm dish (FB0875713, Fisherbrand) with 1% fetal bovine serum, Dulbecco's modified Eagle's medium, and penicillin/ streptomycin/amphotericin. Cells were incubated for seven days and formed spheres were counted at 100x magnification. Three, two and three cell lines were analyzed for KPC cKO cKO control, KPC; Twist and KPC; Snail group, respectively, five field of views per cell line were quantified. MRI Analyses MRI imaging was performed using a 7T small animal MR system as previously described . To measure tumor volume, suspected regions were drawn blinded on each slice based on normalized intensities. The volume was calculated by the addition of delineated regions of interest in mm × 1 mm slice distance. None of the mice had a tumor burden that exceeded Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 9 1.5 cm in diameter, in accordance with institutional regulations. All mice with measurable tumors were enrolled in the study (see Extended Table 3). Mice were imaged twice, once at the beginning of the enrollment (Day 0), and a second time 20 days (Day 19) afterwards. Surviving animals were euthanized at end point (Day 21) for histological characterization. Statistical analyses Statistical analyses were performed on the mean values of biological replicates in each group using unpaired two-tailed or one-tailed t-tests (qPCR only), one-way ANOVA with Tukey's multiple comparisons test using GraphPad Prism, as stipulated in the figure legends. χ analyses, using SPSS statistical software, were performed comparing control to cKO groups for metastatic or colonization frequency across multiple histological parameters in all mice and mice ≥ 120 days of age. Fisher's Exact P value was used to determine significance. Results are outlined in Extended Table 2. Kaplan-Meier plots were drawn for survival analysis and the log rank Mantel-Cox test was used to evaluate statistical differences, using GraphPad Prism. Data met the assumptions of each statistical test, where variance was not equal (determined by an F-test) Welch's correction for unequal variances was applied. Error bars represent s.e.m. when multiple visual fields were averaged to produce a single value for each animal which was then averaged again to represent the mean bar for the group in each graph. P < 0.05 was considered statistically significant. Extended Data Extended Figure 1. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 10 A Representative H&E images of small intestine (SmInt), kidney, and heart (scale, 100μm). B Pancreatic mass of (n = 29, 13, and n = 28 mice; s.d.; one-way ANOVA). C Merge of Twist1 or Snai1 in situ hybridization (black) followed by CK8 (red) immunolabeling in cKO cKO tumors from KPC and KPC; Twist or KPC; Snail mice, respectively. White arrows highlight positive cells in the stroma while yellow arrows highlight negative epithelium cKO (scale, 50 μm). D Twist or Snail immunostaining in KPC and KPC; Twist or KPC; cKO Snail tumors, respectively. Black arrows highlight positive cells in the stroma while red arrows highlight negative epithelium (scale, 20 μm). E Channel separations of the representative images of αSMA immunolabeling in YFP lineage traced tumors found in Figure 1F (scale, 50 μm). F EMT gene expression signature analysis in KPC, KPC; cKO cKO Twist and KPC; Snail cohorts (n = 3 mice). Red arrows indicate reduced Twist1 and cKO cKO Snai1 expression in KPC; Twist and KPC; Snail cohorts, respectively. Extended Figure 2. A E-Cadherin immunolabeling and quantification of primary KPC (n = 5 mice), KPC; cKO cKO Twist (n = 5 mice) and KPC; Snail (n = 4 mice) (scale, 100 μm). B Zeb2 cKO immunolabeling and quantification of primary KPC (n = 6 mice), KPC; Twist (n = 5 cKO mice) and KPC; Snail (n = 7 mice) (scale, 50 μm; inset scale, 20 μm). C Sox4 cKO immunolabeling and quantification of primary KPC (n = 7 mice), KPC; Twist (n = 6 cKO mice) and KPC; Snail (n = 8 mice) (scale, 50 μm; inset scale, 20 μm). D Slug cKO immunolabeling and quantification of primary KPC (n = 4 mice), KPC; Twist (n = 4 cKO mice) and KPC; Snail (n = 4 mice) tumors (scale, 50 μm; inset scale, 20 μm). E Sirius cKO Red staining and quantification of primary KPC (n = 21 mice), KPC;Twist (n = 8 mice) cKO and KPC;Snail (n = 11 mice) (scale, 200 μm; s.d.) F αSMA immunolabeling and Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 11 cKO cKO quantification of primary KPC (n = 5 mice), KPC;Twist (n = 5 mice) and KPC;Snail (n = 5 mice) (scale, 100 μm). G CD31 immunolabeling and quantification of primary KPC cKO cKO (n = 4 mice), KPC;Twist (n = 4 mice) and KPC;Snail (n = 3 mice) (scale, 200 μm, inset scale, 100 μm). H Pimonidazole staining and quantification of primary KPC (n = 4 cKO cKO mice), KPC; Twist (n = 4 mice) and KPC; Snail (n = 4 mice) (scale, 100 μm). I CD3 cKO immunolabeling and quantification of primary KPC (n = 5 mice), KPC;Twist (n = 5 cKO mice) and KPC;Snail (n = 5 mice) (scale, 100 μm; inset scale, 25 μm). Unless otherwise indicated error bars represent s.e.m, and significance determined by One-way ANOVA. *P < 0.05, ** P <0.01, *** P <0.001. ns, not significant. Extended Figure 3. A Immunolabeling of primary tumors (n = 3 mice) for αSMA (red), CK8 (green), Ki-67 (white) and DAPI (blue); yellow arrows point to EMT cells (scale, 20 μm). B Representative dot plots of circulating YFP cells. C Images of serial sections of KPC; LSL- YFP lung and liver metastasis stained for H&E or immunolabeled for CK19 or YFP. Yellow dashed box represents magnified areas in panel below (scale, 200 μm; magnification scale, 100 μm). D KPC metastatic tumors stained for Twist and Snail (n = 3 mice; scale, 50 μm; inset scale, 20 μm). E Zeb1 immunolabeling and quantification of metastatic KPC (n = 4 cKO cKO mice), KPC; Twist (n = 3 mice) and KPC; Snail (n = 4 mice) (scale, 50 μm; inset scale, 20 μm). F αSMA immunolabeling and quantification of metastatic KPC (n = 3 mice), cKO cKO KPC; Twist (n = 3 mice) and KPC; Snail (n = 3 mice) (scale, 50 μm; inset scale, 20 μm). G E-Cadherin staining on serial sections of αSMA immunolabeling and quantification cKO cKO of metastatic KPC (n = 4 mice), KPC; Twist (n = 3 mice) and KPC; Snail (n = 4 mice) (scale, 50 μm; inset scale, 20 μm).H Ki-67 immunolabeling and quantification of Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 12 cKO cKO metastatic KPC (n = 7 mice), KPC; Twist (n = 3 mice) and KPC; Snail (n = 3 mice) (scale, 50 μm). Unless otherwise indicated error bars represent s.e.m, percentages indicated represent percent decrease from control, and significance determined by One-way ANOVA. * P <0.05, ** P <0.01, *** P <0.001. ns, not significant. Extended Figure 4. cKO cKO A Brightfield micrograph of cultured primary KPC, KPC; Twist and KPC; Snail cells (scale, 50 μm). B EMT and gemcitabine transport related gene expression shown by qPCR cKO cKO analysis in KPC (n = 3-4 cell lines), KPC; Twist (n = 5 cell lines) and KPC; Snail (n = 5-6 cell lines) (s.d., one-tailed t-test, * P < 0.05, numbers list non-significant P values. nd: not detected, ns: not significant). C MTT assay showing cell proliferation in KPC, KPC; cKO cKO Twist and KPC; Snail cells (n = 8, 8, and 8 biological replicates of a cell line for each cKO genotype). D Relative cell viability (MTT assay) in cultured KPC, KPC; Twist and KPC; cKO Snail cells treated with gemcitabine or erlotinib (n = 8, 8, and 8 biological replicates of a cell line for each genotype). Unless otherwise indicated error bars represent s.e.m, significance was determined by one-way ANOVA. ** P <0.01, *** P <0.001, **** P <0.0001. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 13 Extended Figure 5. A Representative H&E images (scale, 100 μm). B Relative percentage of each histological cKO tissue phenotype of KTC (n = 8 mice) and KTC; Snail (n = 6 mice) primary tumors cKO (s.d.). C Primary tumor invasiveness in KTC (n = 8 mice) and KTC; Snail (n = 6 mice) cKO (s.d.). D Pancreatic mass in KTC (n = 5 mice) and KTC; Snail (n = 6 mice) (s.d.). E cKO Immunolabeling and quantification of primary KTC (n = 5 mice), KTC; Snail (n = 4 mice) for αSMA (red), CK8 (green) and DAPI (blue); white arrows indicate double positive cells (scale, 20 μm), Zeb1 (scale, 50 μm; inset scale. 20μm), cleaved caspase-3 (scale, 50 μm; n = 4 and 4 mice), Ki-67 (scale, 100 μm), ENT2 (scale, 100 μm) and CNT3 (scale, 100 μm). Unless otherwise indicated error bars represent s.e.m, and significance determined by two-tailed t-test. * P <0.05, *** P <0.001. ns, not significant. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 14 Extended Figure 6. cKO A-B Staining and quantification of (A) KTC (n = 5 or 6 mice), KTC; Snail (n = 4 or 5 cKO mice) (B) KTC + GEM (n = 4 or 5 mice), KTC; Snail + GEM (n = 5 mice) for Masson's Trichrome Stain (MTS) (scale, 200 μm), Sirius Red staining (scale, 200 μm), and ENT1 (scale, 100 μm). Error bars represent s.d. (MTS and Sirius Red) or s.e.m. (ENT1), and significance determined by two-tailed t-test. ns, not significant. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 15 Nature. Author manuscript; available in PMC 2016 May 18. Extended Table 1 cKO cKO Pathological spectrum of disease and metastasis in KPC, KPC; Twist and KPC; Snail cohorts. Pathological Spectrum within cohorts ID AGE PDA Differentiation Histology 1 Histology 2 Liver Lung Spleen Any Moribund KPC (104) 1 158 Y W S G Y Y N Y Y 2 165 Y W G N N N N Y 3 148 Y P S G N N - N Y 4 135 Y M S G Y N Y Y Y 5 95 Y M G N Y N Y N 6 42 Y M G N N N N Y 7 55 Y P G S Y N N Y Y 8 91 Y M G N N N N N 9 87 Y W G N N N N N 10 63 Y P G Y Y Y Y N 11 108 Y P S G Y N N Y FD 12 110 Y W G N N N N N 13 104 Y W G Y N N Y Y 14 54 Y W S G N N N N Y 15 108 Y P S G N Y N Y Y 16 42 Y P S G N N N N Y 17 68 Y W G N N N N N 18 107 Y P G N N N N N 19 87 Y P G N N N N N 20 48 Y P G S N N N N Y 21 109 Y P G S Y Y N Y FD 22 81 Y P G Y Y N Y Y 23 151 Y W G N Y N Y Y 24 47 Y M G S N Y N Y Y 25 143 Y P G S N Y N Y Y 26 122 Y W G Y N N Y N Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 16 Nature. Author manuscript; available in PMC 2016 May 18. Pathological Spectrum within cohorts ID AGE PDA Differentiation Histology 1 Histology 2 Liver Lung Spleen Any Moribund 27 115 Y P G Y Y N Y N 28 76 Y W G N Y N Y N 29 122 Y M S G Y N N Y Y 30 97 Y P G N N N N N 31 107 Y W G N N N N N Totals (Median) 31/31 11/31 11/31 2/30 17/31 % 100.0% 35.5% 35.5% 6.7% 54.8% cKO Twist (111) 1 148 Y W G S Y N N Y N 2 151 Y P S G Y Y Y Y N 3 140 Y P G Y Y N Y Y 4 53 Y P G S N N N N Y 5 43 Y P G N N N N Y 6 117 Y P G S N N N N N 7 90 Y P S G Y N N Y Y 8 52 Y P G S N N N N Y 9 104 Y P G N N N N N 10 218 Y P G S N N Y Y Y 11 153 Y P G N Y N Y Y 12 45 Y P G S N N N N Y 13 77 Y P G S Y N N Y Y 14 126 Y P G S Y Y N Y Y Totals (Median) 14/14 6/14 4/14 2/14 8/14 % 100.0% 42.9% 28.6% 14.3% 57.1% cKO Snail (103) 1 144 Y W G N Y N Y N 2 51 Y P G S N N N N Y Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 17 Nature. Author manuscript; available in PMC 2016 May 18. Pathological Spectrum within cohorts ID AGE PDA Differentiation Histology 1 Histology 2 Liver Lung Spleen Any Moribund 3 105 Y P G S N Y N Y Y 4 111 Y P G N N N N N 5 106 Y P G S Y N Y Y Y 6 129 Y P G N N N N N 7 102 Y P G S N Y - Y N 8 98 Y P G S Y N Y Y N 9 47 Y P G S N N N N Y 10 54 Y W G Y Y N Y FD 11 59 Y M G Y N N Y N 12 103 Y P G Y N N Y N 13 60 Y P S G Y N Y Y Y 14 77 Y P G Y N N Y Y 15 57 Y M S G Y N N Y FD 16 130 Y P G Y Y N Y FD 17 76 Y P G S N N N N FD 18 111 Y P G N Y N Y Y 19 100 Y P G S Y N Y Y FD 20 104 Y P G S Y N N Y Y 21 124 Y M G N N N N FD 22 88 Y P G S N N N N Y 23 192 Y W G Y Y N Y Y 24 122 Y P G N N N N Y 25 60 Y W G S N N N N Y 26 112 Y W G N Y N Y N 27 48 Y P G S N N N N Y 28 48 Y P G S N N N N Y 29 124 Y P G S Y Y Y Y N 30 215 Y W G N N N N N Totals (Median) 30/30 13/30 9/30 5/29 18/30 % 100.0% 43.3% 30.0% 17.2% 60.0% Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 18 Extended Table 2 Results of χ analysis reporting Fisher's Exact P value. χ2 Analysis Group Perameter Fisher's Exact P value Differentiation All Ages cKO Control vs. Twist Early Tumor progression 0.458 cKO Control vs. Snail 0.106 cKO Control vs. Twist Late Tumor progression 0.458 cKO Control vs. Snail 0.106 cKO Control vs. Twist Sarcomatoid 0.108 cKO Control vs. Snail 0.446 Differentiation ≥120 days cKO Control vs. Twist Early Tumor progression 0.580 Nature. Author manuscript; available in PMC 2016 May 18. Key: (Y) yes. (N) no, (W) well, (M) moderate, (P) poor, (G) glandular, (S) sarcomatoid, (FD) found dead, (-) no tissue Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 19 χ2 Analysis Group Perameter Fisher's Exact P value cKO Control vs. Snail 0.569 cKO Control vs. Twist Late Tumor progression 0.580 cKO Control vs. Snail 0.569 cKO Control vs. Twist Sarcomatoid 1.000 cKO Control vs. Snail 0.119 Metastasis All Ages cKO Control vs. Twist Liver Metastasis 0.744 cKO Control vs. Snail 0.358 cKO Control vs. Twist Lung Metastasis 0.743 cKO Control vs. Snail 0.786 cKO Control vs. Twist Spleen Invasion 0.581 cKO Control vs. Snail 0.254 cKO Control vs. Twist Any Metastasis 1.000 cKO Control vs. Snail 0.797 Metastasis ≥120 days cKO Control vs. Twist Liver Metastasis 0.627 Control vs. SnailcKO 1.000 cKO Control vs. Twist Lung Metastasis 0.592 Control vs. SnailcKO 1.000 cKO Control vs. Twist Spleen Invasion 0.559 Control vs. SnailcKO 1.000 cKO Control vs. Twist Any Metastasis 0.473 Control vs. SnailcKO 0.608 Extended Table 3 cKO cKO Pathological spectrum of disease and metastasis in KPC, KPC; Twist and KPC; Snail cohorts treated with Gemcitabine KPC Gemcitabine cohorts 3 3 ID Start Age (Days) Start Volume (mm ) End Volume (mm ) Survival (Days) KPC + GEM (89) (13) 1 148 1610.351 D 7 2 72 29.736 D 13 3 72 439.795 902.759 21 Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 20 KPC Gemcitabine cohorts 3 3 ID Start Age (Days) Start Volume (mm ) End Volume (mm ) Survival (Days) 4 80 44.14 D 14 5 100 536.304 592.31 21 6 89 166.968 D 2 7 94 52.734 D 7 6 122 90.211 D 14 9 164 217.919 D 8 10 143 212.817 D 18 11 84 323.829 897.217 21 12 58 76.734 D 4 13 58 116.186 D 8 Mean (Median) 301.4 797.4 Stdev 406.9 145.1 cKO Twist + GEM (79) (21) 1 117 243.0 644.2 21 2 75 47.2 180.0 21 3 75 45.4 460.9 21 4 78 54.6 47.5 21 5 46 53.7 66.5 21 6 96 63.1 D 13 7 90 23.9 D 13 8 79 101.0 D 14 9 52 28.5 D 14 10 52 49.4 98.706 21 11 104 43.4 127.0 21 12 104 53.5 12.1 21 13 68 56.7 D 15 14 122 650.1 164.1 21 15 104 181.8 78.6 21 Mean (Median) 113.0 187.9 Stdev 154.8 193.0 cKO Snail + GEM (96) (21) 1 188 255.2 D 12 2 181 854.7 D 4 3 127 32.0 59.6 21 4 127 58.7 107.4 21 5 142 109.8 D 14 6 54 33.6 57.2 21 7 89 17.0 D 13 Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 21 KPC Gemcitabine cohorts 3 3 ID Start Age (Days) Start Volume (mm ) End Volume (mm ) Survival (Days) 8 78 54.9 39.6 21 9 78 3.1 D 15 10 104 209.7 134.3 21 11 96 220.0 280.2 21 12 96 24.1 46.2 21 13 119 711.0 D 18 14 126 655.6 805.4 21 15 119 168.6 D 18 16 82 453.8 517.4 21 17 82 56.7 74.1 21 18 90 40.0 D 16 19 67 80.5 D 10 20 66 49.5 226.2 21 Mean (Median) 204.4 213.4 Stdev 250.7 231.7 Key: (D) died Supplementary Material Refer to Web version on PubMed Central for supplementary material. Acknowledgements We wish to thank Donna Lundy, Sujuan Yang, Zhenna Xiao, Rafael Deliz-Aguirre, Toru Miyake, and Sara Lovisa for technical support and Karen M. Ramirez and Ryan Jewell in the South Campus Flow Cytometry Core Lab of MD Anderson Cancer Center for FACS sorting and analysis (Grant, NCI# P30CA16672). As well as Edward Chang for scanning slides of histopathological specimens. This study was primarily supported by the Cancer Prevention and Research Institute of Texas and the Metastasis Research Center at the MD Anderson Cancer Center. The research in R.K. laboratory is also supported by the NIH grants P30CA016672, CA125550, CA155370, CA151925 and CA163191. The research in V.S.L. laboratory is supported by the NIH/NCI CCSG New Faculty Award P30CA016672 and UT MDACC Khalifa Bin Zayed Al Nahya Foundation. References 1. Hotz B, et al. Epithelial to mesenchymal transition: expression of the regulators snail, slug, and twist in pancreatic cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007; 13:4769–4776. doi:10.1158/1078-0432.CCR-06-2926. [PubMed: 17699854] 2. Arumugam T, et al. Epithelial to mesenchymal transition contributes to drug resistance in pancreatic cancer. Cancer research. 2009; 69:5820–5828. doi:10.1158/0008-5472.CAN-08-2819. [PubMed: 19584296] 3. Taube JH, et al. Core epithelial-to-mesenchymal transition interactome gene- expression signature is associated with claudin-low and metaplastic breast cancer subtypes. Proceedings of the National Academy of Sciences of the United States of America. 2010; 107:15449–15454. doi:10.1073/pnas. 1004900107. [PubMed: 20713713] 4. Rhim AD, et al. EMT and dissemination precede pancreatic tumor formation. Cell. 2012; 148:349– 361. doi:10.1016/j.cell.2011.11.025. [PubMed: 22265420] Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 22 5. Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 2009; 119:1420–1428. doi:10.1172/jci39104. [PubMed: 19487818] 6. McDonald OG, Maitra A, Hruban RH. Human correlates of provocative questions in pancreatic pathology. Advances in anatomic pathology. 2012; 19:351–362. doi:10.1097/PAP. 0b013e318273f998. [PubMed: 23060061] 7. Guaita S, et al. Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. The Journal of biological chemistry. 2002; 277:39209– 39216. doi:10.1074/jbc.M206400200. [PubMed: 12161443] 8. Wellner U, et al. The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness- inhibiting microRNAs. Nature cell biology. 2009; 11:1487–1495. doi:10.1038/ncb1998. [PubMed: 19935649] 9. Zhang K, et al. Knockdown of snail sensitizes pancreatic cancer cells to chemotherapeutic agents and irradiation. International journal of molecular sciences. 2010; 11:4891–4892. doi:10.3390/ ijms11124891. [PubMed: 21614180] 10. Tsai JH, Donaher JL, Murphy DA, Chau S, Yang J. Spatiotemporal regulation of epithelial- mesenchymal transition is essential for squamous cell carcinoma metastasis. Cancer cell. 2012; 22:725–736. doi:10.1016/j.ccr.2012.09.022. [PubMed: 23201165] 11. Stockinger A, Eger A, Wolf J, Beug H, Foisner R. E-cadherin regulates cell growth by modulating proliferation-dependent beta-catenin transcriptional activity. The Journal of cell biology. 2001; 154:1185–1196. doi:10.1083/jcb.200104036. [PubMed: 11564756] 12. Muraoka-Cook RS, Dumont N, Arteaga CL. Dual role of transforming growth factor beta in mammary tumorigenesis and metastatic progression. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005; 11:937s–943s. [PubMed: 15701890] 13. Hugo HJ, et al. Direct repression of MYB by ZEB1 suppresses proliferation and epithelial gene expression during epithelial-to-mesenchymal transition of breast cancer cells. Breast cancer research : BCR. 2013; 15:R113. doi:10.1186/bcr3580. [PubMed: 24283570] 14. Mani SA, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 2008; 133:704–715. doi:10.1016/j.cell.2008.03.027. [PubMed: 18485877] 15. Liu H, et al. Cancer stem cells from human breast tumors are involved in spontaneous metastases in orthotopic mouse models. Proceedings of the National Academy of Sciences of the United States of America. 2010; 107:18115–18120. doi:10.1073/pnas.1006732107. [PubMed: 20921380] 16. Wang Z, et al. Activated K-Ras and INK4a/Arf deficiency promote aggressiveness of pancreatic cancer by induction of EMT consistent with cancer stem cell phenotype. Journal of cellular physiology. 2013; 228:556–562. doi:10.1002/jcp.24162. [PubMed: 22806240] 17. Yang J, et al. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell. 2004; 117:927–939. doi:10.1016/j.cell.2004.06.006. [PubMed: 15210113] 18. Vega S, et al. Snail blocks the cell cycle and confers resistance to cell death. Genes & development. 2004; 18:1131–1143. doi:10.1101/gad.294104. [PubMed: 15155580] 19. Shah AN, et al. Development and characterization of gemcitabine-resistant pancreatic tumor cells. Annals of surgical oncology. 2007; 14:3629–3637. doi:10.1245/s10434-007-9583-5. [PubMed: 17909916] 20. Yin T, et al. Expression of snail in pancreatic cancer promotes metastasis and chemoresistance. The Journal of surgical research. 2007; 141:196–203. doi:10.1016/j.jss.2006.09.027. [PubMed: 17583745] 21. Wang Z, et al. Acquisition of epithelial-mesenchymal transition phenotype of gemcitabine-resistant pancreatic cancer cells is linked with activation of the notch signaling pathway. Cancer research. 2009; 69:2400–2407. doi:10.1158/0008-5472.CAN-08-4312. [PubMed: 19276344] 22. Alagesan B, et al. Combined MEK and PI3K inhibition in a mouse model of pancreatic cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015; 21:396–404. doi:10.1158/1078-0432.ccr-14-1591. [PubMed: 25348516] 23. Cursons J, et al. Stimulus-dependent differences in signalling regulate epithelial mesenchymal plasticity and change the effects of drugs in breast cancer cell lines. Cell communication and signaling : CCS. 2015; 13:26. doi:10.1186/s12964-015-0106-x. [PubMed: 25975820] Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 23 24. Javle MM, et al. Epithelial-mesenchymal transition (EMT) and activated extracellular signal- regulated kinase (p-Erk) in surgically resected pancreatic cancer. Annals of surgical oncology. 2007; 14:3527–3533. doi:10.1245/s10434-007-9540-3. [PubMed: 17879119] 25. Masugi Y, et al. Solitary cell infiltration is a novel indicator of poor prognosis and epithelial- mesenchymal transition in pancreatic cancer. Human pathology. 2010; 41:1061–1068. doi: 10.1016/j.humpath.2010.01.016. [PubMed: 20413143] 26. Park JY, et al. Pdx1 expression in pancreatic precursor lesions and neoplasms. Applied immunohistochemistry & molecular morphology : AIMM / official publication of the Society for Applied Immunohistochemistry. 2011; 19:444–449. doi:10.1097/PAI.0b013e318206d958. [PubMed: 21297446] 27. Offield MF, et al. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development. 1996; 122:983–995. [PubMed: 8631275] 28. Hidalgo M. Pancreatic cancer. The New England journal of medicine. 2010; 362:1605–1617. doi: 10.1056/NEJMra0901557. [PubMed: 20427809] 29. Kleger A, Perkhofer L, Seufferlein T. Smarter drugs emerging in pancreatic cancer therapy. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2014; 25:1260–1270. doi:10.1093/annonc/mdu013. [PubMed: 24631947] 30. Gore AJ, Deitz SL, Palam LR, Craven KE, Korc M. Pancreatic cancer-associated retinoblastoma 1 dysfunction enables TGF-beta to promote proliferation. The Journal of clinical investigation. 2014; 124:338–352. doi:10.1172/jci71526. [PubMed: 24334458] 31. Hingorani SR, et al. Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer cell. 2005; 7:469–483. doi:10.1016/j.ccr.2005.04.023. [PubMed: 15894267] 32. Ijichi H, et al. Aggressive pancreatic ductal adenocarcinoma in mice caused by pancreas-specific blockade of transforming growth factor-beta signaling in cooperation with active Kras expression. Genes & development. 2006; 20:3147–3160. doi:10.1101/gad.1475506. [PubMed: 17114585] 33. Ozdemir BC, et al. Depletion of carcinoma-associated fibroblasts and fibrosis induces immunosuppression and accelerates pancreas cancer with reduced survival. Cancer cell. 2014; 25:719–734. doi:10.1016/j.ccr.2014.04.005. [PubMed: 24856586] 34. Keskin D, et al. Targeting Vascular Pericytes in Hypoxic Tumors Increases Lung Metastasis via Angiopoietin-2. Cell reports. 2015; 10:1066–1081. doi:10.1016/j.celrep.2015.01.035. [PubMed: 25704811] 35. Smyth, GK. Limma: linear models for microarray data. In Bioinformatics and Computational Biology Solutions using R and Bioconductor. Gentleman, R.; Carey, V.; Dudoit, S.; Irizarry, R.; Huber, W., editors. Springer; New York: 2005. 36. Ying H, et al. Oncogenic Kras maintains pancreatic tumors through regulation of anabolic glucose metabolism. Cell. 2012; 149:656–670. doi:10.1016/j.cell.2012.01.058. [PubMed: 22541435] 37. Melo SA, et al. Glypican-1 identifies cancer exosomes and detects early pancreatic cancer. Nature. 2015; 523:177–182. doi:10.1038/nature14581. [PubMed: 26106858] Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 24 Figure 1. EMT inhibition does not alter primary tumor progression A Representative H&E stained primary tumors (scale; 100μm). B Relative percentages of each primary tumor histological tissue phenotype (n = 31, 14, and 30 mice; s.d.). C Local invasiveness (n = 31, 14, and 30 mice; s.d.). D Overall survival (n = 29, 12, and 33 mice). E Twist1 or Snai1 in situ hybridization (black) with CK8 (red) immunolabeling in primary + + + + tumors (n = 3 mice for all groups) relative percentage of Twist1 CK8 or Snai1 CK8 double positive cells (scale, 50μm; two-tailed t-test). F αSMA immunolabeling in YFP lineage traced tumors (n = 3 and 3 mice; scale, 50μm; two-tailed t-test). G αSMA (red), Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 25 CK8 (green) and DAPI (blue); white arrows indicate double positive cells (n = 4 mice for all groups; scale, 20μm). H Zeb1 (n = 5, 6, and 6 mice; scale, 50 μm; inset scale, 20 μm). I Masson's Trichrome Stain (MTS) (n = 8, 7, and 7 mice; scale, 200 μm; s.d.). Unless otherwise indicated error bars represent s.e.m, percentages represent percent change from control and significance determined by oneway ANOVA. *P < 0.05, ** P <0.01, *** P <0.001, **** P <0.0001. ns, not significant. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 26 Figure 2. EMT inhibition does not alter invasion and metastasis Primary tumor immunolabeling for (A) Cleaved caspase-3 (n = 6 mice for all groups; scale, 50μm) and (B) Ki-67 (n = 7, 7, and 9 mice; scale, 100 μm). C Percentage of YFP G12D circulating tumor cells (CTC) (n = 8 and 8 mice; two-tailed t-test; s.d.). D Kras expression in whole blood cell pellets (n = 5, 3, and 5 mice; s.d.). E H&E and CK19 immunolabeling of metastatic liver nodules. Metastatic tumor (T) nodules outlined by a dotted line (scale, 100μm). Table representing the number of positive tissues out of total tissues examined (χ analysis). F Expression analysis of Twist1 and Snai1 in cultured Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 27 primary tumor cell lines (n = 4 and 5 or 4 and 6 individual cell lines; one-tailed t-test of ΔCt; s.d.). G Brightfield or YFP images and quantification of sphere number in cultured tumor cell lines (n = 3, 2, and 3 individual cell lines; scale, 50μm). H H&E images (scale, 100μm) of colonized lungs from i.v. injected cultured primary tumor cell lines KPC (n = 5 and 5 cKO mice for each cell line) and KPC; Twist (n = 11 and 4 mice for each cell line) and KPC; cKO Snail (n = 4, 5, and 5 mice for each cell line). Table representing the number of colonized tissues out of total tissues examined (χ analysis). Unless otherwise indicated error bars represent s.e.m and significance determined by one-way ANOVA. * P <0.05, ** P <0.01, **** P <0.0001. ns, not significant. nd, not detected. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 28 Figure 3. EMT inhibition sensitizes tumors to gemcitabine in KPC GEMM Primary tumor immunolabeling for (A) ENT1, (B) ENT2, and (C) CNT3 (n = 6, 5, and 4 mice; scale, 100 μm; s.e.m., two-tailed t-test). D MRI tumor volumes of KPC + GEM (n = cKO 13 mice, 10 died before Day 19), KPC; Twist + GEM (n = 15 mice, 6 died before Day cKO 19) and KPC; Snail + GEM (n = 20 mice, 9 died before Day 19) (one-way ANOVA comparing mean tumor volumes on Day 0 and Day 19, respectively). E Survival on gemcitabine treatment to end point (Day 21). F H&E stained primary tumors (scale, Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 29 100μm). G Relative percentages of each histological tissue phenotype of end point mice (n = 3, 9, and 11 mice; s.d.; two-tailed t-test). * P <0.05, ** P <0.01. ns, not significant. Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 30 Figure 4. EMT inhibition sensitizes tumors to gemcitabine in KTC GEMM Primary tumor (A) H&E (scale, 100 μm) and (B) relative percentage of each histological tissue phenotype (n = 5 and 7 mice; s.d.) C Local invasiveness (n = 5 and 7 mice; s.d.). D Pancreatic mass (n = 3 and 4 mice; s.d.). E Overall survival of KTC + GEM (n = 8 mice) cKO and KTC; Snail + GEM (n = 4 mice). F Overall survival of KTC (n = 6 mice) and KTC; cKO Snail (n = 3 mice). G αSMA (red), CK8 (green) and DAPI (blue); white arrows indicate double positive cells (n = 4 mice; scale, 20 μm), Zeb1 (n = 4 and 5 mice; scale, 50 μm; inset scale, 20μm), cleaved caspase-3 (n = 4 and 5 mice; scale, 50 μm), Ki-67 (n = 4 and 5 mice; Nature. Author manuscript; available in PMC 2016 May 18. Author Manuscript Author Manuscript Author Manuscript Author Manuscript Zheng et al. Page 31 scale, 100 μm), ENT2 (n = 5 mice; scale, 100 μm), and CNT3 (n = 5 mice; scale, 100 μm). Unless otherwise indicated error bars represent s.e.m and significance determined by two- tailed t-test. * P <0.05, ** P <0.01, *** P <0.001. ns, not significant. Nature. Author manuscript; available in PMC 2016 May 18.

Journal

Nature – Pubmed Central

Published: Nov 11, 2015

There are no references for this article.