Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Isoliquiritigenin alleviates early brain injury after experimental intracerebral hemorrhage via suppressing ROS- and/or NF-κB-mediated NLRP3 inflammasome activation by promoting Nrf2 antioxidant pathway

Isoliquiritigenin alleviates early brain injury after experimental intracerebral hemorrhage via... Background: Intracerebral hemorrhage (ICH) induces potently oxidative stress responses and inflammatory processes. Isoliquiritigenin (ILG) is a flavonoid with a chalcone structure and can activate nuclear factor erythroid-2 related factor 2 (Nrf2)-mediated antioxidant system, negatively regulate nuclear factor-κB (NF-κB) and nod-like receptor family, pyrin domain-containing 3 (NLRP3) inflammasome pathways, but its role and potential molecular mechanisms in the pathology following ICH remain unclear. The present study aimed to explore the effects of ILG after ICH and underlying mechanisms. Methods: ICH model was induced by collagenase IV (0.2 U in 1 μl sterile normal saline) in male Sprague-Dawley rats weighing 280–320 g. Different doses of ILG (10, 20, or 40 mg/kg) was administrated intraperitoneally at 30 min, 12 h, 24 h, and 48 h after modeling, respectively. Rats were intracerebroventricularly administrated with control scramble small interfering RNA (siRNA) or Nrf2 siRNA at 24 h before ICH induction, and after 24 h, ICH model was established with or without ILG (20 mg/kg) treatment. All rats were dedicated at 24 or 72 h after ICH. Neurological deficits, histological damages, brain water content (BWC), blood-brain barrier (BBB) disruption, and neuronal degeneration were evaluated; quantitative real-time RT-PCR (qRT-PCR), immunohistochemistry/immunofluorescence, western blot, and enzyme-linked immunosorbent assay (ELISA) were carried out; catalase, superoxide dismutase activities and reactive oxygen species (ROS), and glutathione/oxidized glutathione contents were measured. (Continued on next page) * Correspondence: [email protected] Department of Neurosurgery, Zhujiang Hospital, The National Key Clinical Specialty, The Neurosurgery Institute of Guangdong Province, Guangdong Provincial Key Laboratory on Brain Function Repair and Regeneration, The Engineering Technology Research Center of Education Ministry of China, Southern Medical University, Guangzhou 510282, China Full list of author information is available at the end of the article © The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 2 of 19 (Continued from previous page) Results: ILG (20 and 40 mg/kg) markedly alleviated neurological deficits, histological damages, BBB disruption, brain edema, and neuronal degeneration, but there was no significant difference between two dosages. ILG (20 mg/kg) significantly suppressed the NF-κB and NLRP3 inflammasome pathways and activated Nrf2-mediated antioxidant system. Gene silencing of Nrf2 aggravated the neurological deficits, brain edema, and neuronal degeneration and increased the protein levels of NF-κB p65, NLRP3 inflammasome components, and IL-1β. ILG delivery significantly attenuated the effects of Nrf2 siRNA interference mentioned above. Conclusions: Intraperitoneal administration of ILG after ICH reduced early brain impairments and neurological deficits, and the mechanisms were involved in the regulation of ROS and/or NF-κB on the activation of NLRP3 inflammasome pathway by the triggering of Nrf2 activity and Nrf2-induced antioxidant system. In addition, our experimental results may make ILG a potential candidate for a novel therapeutical strategy for ICH. Keywords: ICH, Early brain injury, ILG, Nrf2, ROS, NF-κB, NLRP3 inflammasome Background identified to hold the neuroprotective effects against the Spontaneous intracerebral hemorrhage (ICH) belongs to a early brain injury after ICH by translocating into nucleus fatal cerebrovascular disorder, accounting for 15 to 20% in after being activated, binding to the antioxidant response all stroke types, commonly accompanied with high mor- element (ARE), then initiating the expression of a series bidity and mortality [1, 2]. Brain injury after ICH is of antioxidant and detoxification enzymes and proteins, broadly classified as primary brain injury and secondary as a result, improving neurological deficits, alleviating brain injury [3, 4]. Primary brain injury occurring within brain edema, and decreasing the infiltration of inflam- first several hours post ICH is caused by the hemorrhage matory cells [11–15]. and growth of hematoma which lead to the mechanical The NLRP3 (NALP3, cryopyrin) inflammasome [NLR impairments and compression of adjacent cerebrovascular (Nod-like receptor) family, pyrin domain-containing 3 architecture [1, 3–5]. Hematoma size is a powerful and inflammasome], a best characterized member of NLR easy-to-use predictor of 30-day mortality and morbidity in family and one of the key components of innate immune patients with ICH, and large hemorrhage often indicates a system, has been reported by others [8, 16] and us [17] to poor prognosis [4, 6]. Blood components extravasated take part in the processes of early brain injury after ICH from the ruptured blood vessels and degradation products via facilitating caspase-1 and interleukin-1beta (IL-1β) of blood cells can induce severe secondary brain injury processing, which amplifies the inflammatory response including neurobehavioral deterioration, brain cell death, and blockade or knockdown of NLRP3 inflammasome can cerebral edema, and blood-brain barrier (BBB) disruption alleviate the brain damages [8, 16, 17]. Recently, reports [1, 3–5]. Though the understanding of pathophysiological have indicated that Nrf2 could negatively regulate NLRP3 mechanisms to brain injury after ICH has been well im- inflammasome activity by inhibiting reactive oxygen proved in recent decades, there are still no effective ther- species (ROS)-induced NLRP3 inflammasome activation apies being available for the prevention of ICH-induced [18, 19]. However, the relationship between Nrf2 antioxi- brain impairments [3–5, 7]. Furthermore, increasing dant pathway and NLRP3 inflammasome activation and evidences have shown that inflammatory response and whether Nrf2 reduces the early brain injury via the oxidative stress which occur following ICH play a key role suppression of NLRP3 inflammasome and whether the in pathophysiological processes of ICH-induced early above-mentioned inhibitory effect is involved in Nrf2 brain dysfunctions [3–5, 7, 8]. mediated ROS and/or nuclear factor-κB(NF-κB) sup- Nuclear factor erythroid-2 related factor 2 (Nrf2) is a pression have not beenexploredintheexperimental rat key transcription factor and master regulator of the ICH model. cellular response of oxidative stress, which can induce Isoliquiritigenin (ILG), a component of Glycyrrhiza the expression of antioxidant and detoxification enzymes uralensis (G. uralensis), is a flavonoid with a chalcone and downstream proteins such as NAD(P)H: quinone structure and it holds multiple biological activities [20]. oxidoreductase-1 (NQO1), catalase (CAT), superoxide Recent papers have shown that ILG was a potent in- dismutase (SOD), heme oxygenase-1 (HO-1), glutathi- hibitor of NLRP3 inflammasome [21, 22] and NF-κB one peroxidase (GPX), and glutathione-S-transferase [23–25],thusexertingaprotective effect.Also,there (GST) [9, 10]. Recent study report showed that the were reports showing that ILG could activate Nrf2- expression of Nrf2 was gradually increased following mediated antioxidant pathway via promoting Nrf2 trans- ICH at 2 h, peaked at 24 h, and then slightly decreased location into the nucleus and then initiating a series of with time until 10 days [11]. In addition, Nrf2 has been genes to express [9, 26–29]. However, it remains unclear Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 3 of 19 whether ILG has a protective effect against the early glutathione (GSH/GSSG) contents, ROS content, CAT brain injury following ICH, and the detailed molecu- activity, and SOD activity analyses (n =6). lar mechanisms have not been elucidated. Thus, in In the third experiment, 132 rats were used (132 of 137 this study, we are attempting to explore the effects of rats after the surgery survived) to execute the study on ef- ILG on the early brain injury after an experimental fects of Nrf2 small interfering RNA (siRNA) interference rat intracerebral hemorrhage model and the potential and Nrf2 siRNA together with ILG co-administration on molecular mechanisms. early brain injury following ICH. The rats were randomly divided into six groups (sham group, ICH + vehicle-2 TM Methods [mixtures of Entranster in vivo transfection reagent and Animals siRNA diluent (RNase-free H O)] group, ICH + control Adult male Sprague-Dawley rats (SD rats) weighing be- scramble siRNA group, ICH + Nrf2 siRNA group, ICH + tween 280 and 320 g (8–10 weeks) were obtained from Nrf2 siRNA + vehicle-1 group, ICH + Nrf2 siRNA + ILG the Animal Experiment Center of Southern Medical 20 mg/kg group). All rats were decapitated to perform re- University. All experimental procedures and animal care lated RT-qPCR (n = 6), WB (n = 6), mNSS scoring (n =6), were approved by the Southern Medical University Ethics BWC (n = 6), FJC staining analyses (n =6). Committee and were conducted in accordance with the guidelines of the National Institutes of Health on the care ICH model and use of animals. All rats were housed in a light-, The procedure for ICH model in rats has been described temperature-, and humidity-controlled specific pathogen- in previous publications with some small modifications free (SPF) environment (under a 12-h light/dark cycle [17, 30]. In brief, the rats were anesthetized by intraperi- with constant temperature about 25 °C and relative toneal injection (i.p.) of pentobarbital sodium (45 mg/ humidity approximating 55%). All rats had free access to kg). Then, the animals were placed in a rat brain stereo- standard food and water during the experiments. taxic apparatus and under aseptic condition. Rectal temperature was maintained at 37 °C throughout the Experimental design and groups surgical procedure using an insulation board connected Experiments were conducted in a rat model of collagenase with water bath circulation system. Next, a midline inci- type IV-induced ICH. In the first experiment, 180 rats sion on the scalp to expose the skull and bregma and a were used (183 rats suffered to the surgery, 180 rats cranial burr hole (1 mm in diameter) was drilled in the survived) to evaluate the effects of ILG on the early brain right part of the brain, a 5-μl microsyringe with a needle injury post ICH. The rats were randomly and evenly tip (Shanghai high pigeon industry & trade co., LTD, assigned to five groups of 36 rats each, namely, sham Shanghai, China) was inserted stereotactically through group, ICH + vehicle-1 [dimethylsulfoxide (DMSO)] the burr hole and into the right striatum which coordi- group, ICH + ILG 10 mg/kg group, ICH + ILG 20 mg/kg nates were 0.1 mm anterior, 3.5 mm lateral, and 6.0 mm group, and ICH + ILG 40 mg/kg group. All rats in this ventral to the bregma. Collagenase type IV (0.2 U in 1 μl experiment were evaluated with a Modified Neurological sterile normal saline) was administrated over a period of Severity Score (mNSS) (n = 12) scale at 24 or 72 h after 10 min via stereotaxic intrastriatal injection. The needle ICH, except for the rats that perform extravasation detec- was kept in situ for an additional 10 min to prevent tion of Evans blue (EB) dyes (n=6) at the same time back-flow. Then, the microsyringe was slowly removed points. Then, the rats were killed, and brain tissue samples and the craniotomy was sealed with bone wax. Finally, were taken to perform brain water content (BWC) mea- the wound was sutured. The sham-operated rats were surements (n = 6), hematoxylin and eosin (H&E) staining treated via the same way except that they were adminis- (n = 6), and Fluoro-Jade® C (FJC) staining (n =6). trated 1 μl sterile normal saline into the right striatum. In the second experiment, 120 rats were used (122 rats The rats were allowed to recover in separate cages with experienced the operation, 120 rats survived) to explore free access to food and water. the underlying molecular mechanisms of ILG’s effects on the early brain injury after ICH. The rats were randomized In vivo siRNA transfection and drug delivery into four groups (30 rats per group): sham group, ICH The transfection of Nrf2 siRNA for rat brains in vivo group, ICH + vehicle-1 (DMSO) group, and ICH + ILG were conducted according to the method described 20 mg/kg group. All rats in the experiment were sacrificed formerly [17, 31, 32]. Briefly, the rats were placed under at 24 h after ICH for real-time reverse transcription- anesthesia, then a cranial burr hole (1 mm in diameter) quantitative polymerase chain reaction (RT-qPCR) (n =6), was drilled, following a 25-μl microsyringe with a nee- western blot (WB) (n = 6), immunohistochemistry (IHC)/ dle tip (Shanghai high pigeon industry & trade co., immunofluorescence (IF) (n = 6), enzyme-linked immuno- LTD, Shanghai, China) was inserted stereotaxically into sorbent assay (ELISA) (n = 6), and glutathione/oxidized the right lateral ventricle. The stereotaxic coordinates Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 4 of 19 were 1.5 mm posterior, 1.0 mm lateral, and 3.2 mm extravasation, as described previously with minor modi- below the horizontal plane of the bregma [32]. Nrf2 fications [38–40]. Briefly, the rats were anesthetized and siRNA (sc-156128, Santa Cruz biotechnology, USA) administrated intravenously 2% EB solution in normal and control scramble siRNA (sc-37007, Santa Cruz Bio- saline (4 ml/kg) by the femoral vein. After a circulation technology, USA) were applied with in vivo transfection of 2 h, intracardiac perfusion was performed under deep TM reagent (Entranster -in vivo, 18668-11-1, Engreen anesthesia with 0.01 M phosphate buffer solution (PBS) BiosystemCo, Ltd.,Beijing,China)at24hbefore mod- (pH 7.4) of 250 ml to clear EB dyes in cerebral circula- eling by intracerebroventricular injection [31, 32]. The tion. Subsequently, the brains were removed and the microsyringe was left in place for an additional 10 min brain samples were immediately separated into the left after administration and then slowly withdrawn. At last, hemisphere and right hemisphere. Tissue samples were the incision was closed with sutures. The sham-operated then incubated in 50% trichloroacetic acid solution rats received a cranial burr hole, but only a needle was (2 ml). Following homogenization and centrifugation inserted. (15,000 rpm for 20 min), the supernatant (1 ml) was ILG (1811912, Shanghai Macklin Biochemical Co., Ltd., diluted with ethanol (1: 3), and its fluorescence intensity Shanghai, China) was dissolved into DMSO (D5879, was measured at an excitation wavelength of 620 nm Sigma-Aldrich) solution (20 mg/ml). The rats were and an emission wavelength of 680 nm with an automatic administrated intraperitoneally with either ILG at 10, 20, microplate reader. The EB dye leakage was expressed as and 40 mg/kg or the same volume of DMSO at 30 min, micrograms per gram brain weight. 12 h, 24 h, and 48 h after ICH induction. Preparation of paraffin-embedded sections Behavioral assessment Paraffin-embedded sections were made as previously We used a mNSS scale [33, 34] to assess the behavioral described [17, 35, 40] with some modifications. After deficits at 24 h and 72 h after ICH, which was performed deep anesthetization with pentobarbital sodium, the rats by two trained investigators and both of whom had been were transcardially perfused with 250 ml of 0.01 M PBS blinded to animal grouping. The mNSS is consisted of (pH 7.4) followed by 500 ml 4% paraformaldehyde solu- motor, sensory, balance, and reflex tests. Neurological tion. And then, the brains were removed and post-fixed function is graded via the scale of 0–18 points (1–6, by immersion in the same fixative solution at 4 °C for mild injury; 7–12, moderate injury; 13–18, severe injury; 24–48 h. After dehydration and vitrification, tissue sam- the scores of 0 and 18 represent normal performance ples were embedded in paraffin, and 4-μm sections were and severe neurological deficit, respectively). In the se- prepared. The sections were then dewaxed in xylene, re- verity scores of neurological function injury, 1 score hydrated in graded ethanol and deionized water, and point is obtained for the incapacity to complete the test then processed for H&E, IHC, IF, and FJC staining. or the absence of a tested reflex. Thus, a higher score in- dicates a more severe neurological injury [33–35]. H&E staining The coronal brain sections (4-μm thickness, paraffin- Measurement of BWC embedded) were prepared as mentioned above, then BWC was evaluated via a wet/dry weight method, as were stained with eosin for 10 s followed by hematoxylin previously described [36, 37]. Briefly, at 24 or 72 h after re-staining for 5 min. After dehydrated in graded ethanol ICH, the rats were deeply anesthetized with an i.p. of and cleared in xylene, slides were mounted by neutral pentobarbital sodium and then were decapitated. The balsam. Images were obtained using a microscope brain of the rats were immediately removed and sepa- (Leica-DM2500, Germany). rated into five parts, namely ipsilateral and contralateral cortex, ipsilateral and contralateral basal ganglia, and IHC staining cerebellum. The cerebellum was used as an internal IHC staining was conducted as described previously control. Each part was placed on a pre-weighed piece of [35, 36] with a few modifications. Coronal paraffin- aluminum foil and obtained the wet weight by an elec- embedded brain sections (4-μmthickness) were prepared tric analytic balance, and then was dried at 100 °C for as before-mentioned and antigen retrieval was performed 24 h in an electric oven to get the dry weight. BWC was by heat treatment in a microwave oven for 21 min in assessed using the following formula: [(wet weight − dry Tris–ethylene diamine tetraacetic acid (EDTA) buffer weight)]/(wet weight) × 100%. solution (0.05 mol/l Tris, 0.001 mol/l EDTA; pH 8.5). Endogenous peroxidase activity was inactivated using Evaluation of BBB permeability 0.3% H O for 10 min followed by washing with PBS. 2 2 Quantitative analysis of BBB permeability was evaluated After blocking by 5% bovine serum albumin (BSA) for via EB dye (Wako Pure Chemical Industries, Ltd., Japan) 20 min, the slides were incubated overnight at 4 °C with Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 5 of 19 the following primary antibodies used: rabbit monoclonal cleared in xylene for 5 min and then coverslipped with anti-NF-κB p65 (D14E12) XP® antibody (1:800, #8242, Cell DPX mountant for histology (06522-100 ml, Sigma). Four Signaling Technology); rabbit polyclonal anti-Nrf2 (L593) high-power images (×400 magnification) were taken around antibody (1:200, BS1258, Bioworld); rabbit polyclonal anti- hematoma using a fluorescence microscope (ZEISS-AXIO HO-1 antibody (1:200, BS6626, Bioworld); goat polyclonal Scope, Al, Germany) in each slide. FJC staining positive anti-NQO1 antibody (1:200, ab2346, Abcam); mouse cells were counted on these four areas. monoclonal anti-Cryopyrin (NLRP3) (6F12) antibody (1:100, sc-134306, Santa Cruz Biotechnology); mouse Real-time RT-qPCR monoclonal anti-3-Nitrotyrosine (3-NT) antibody [39B6] Quantitative real-time RT-PCR assessment for the mes- (1:200, ab61392, Abcam); mouse monoclonal anti-8- senger RNA (mRNA) levels was conducted via using Hydroxyguanosine (8-OHdG) antibody [N45.1] (1:200, Prime Script RT-PCR kits (RR047A and RR820A, Takara) ab48508, Abcam); rabbit polyclonal anti-Iba-1 antibody according to the manufacturer’s instructions. The mRNA (1:600, WAKO, Osaka, Japan); and mouse monoclonal level of β-actin was used as an internal control. The real- anti-CD68 antibody [ED1] (1:200, ab31630, Abcam). After time PCR program steps were 95 °C for 30 s, 40 cycles of washing with PBS, the sections were incubated with bio- 95 °C for 3 s, 60 °C for 34 s. The mRNA level of each tinylated goat anti-mouse IgG, goat anti-rabbit IgG, and target gene was normalized to that of β-actin mRNA. −ΔΔCT donkey anti-goat IgG secondary antibodies for 20 min and Fold-induction was calculated using the 2 method, then incubated with horseradish peroxidase (HRP)-strep- as previously described [42, 43]. The specific sequences of tavidin reagent for 20 min. Finally, immunoreactivity was primers used were shown as Table 1. detected using 3,3-diaminobenzidine (DAB), followed by re-staining with hematoxylin. Images were obtained by WB using a microscope (Leica-DM2500, Germany). The num- WB was performed according to our previous study ber of immunopositive cells in the perihematomal region method [17, 35]. We used the following primary anti- was counted in a blinded manner and was expressed as bodies to perform the WB analyses: rabbit monoclonal number/0.1 mm areas. anti-NF-κB p65 (D14E12) XP® antibody (1:1000, #8242, Cell Signaling Technology); rabbit polyclonal anti-Nrf2 IF staining (L593) antibody (1:500, BS1258, Bioworld); mouse IF staining was performed as described previously [17, 35] monoclonal anti-Cryopyrin (NLRP3) (6F12) antibody with a few modifications. Coronal paraffin-embedded 4- (1:1000, sc-134306, Santa Cruz Biotechnology); rabbit μm thickness brain sections were prepared as mentioned polyclonal anti-PYCARD (ASC) antibody (1:500, A1170, above. Antigen retrieval was conducted as IHC staining. Abclonal); goat polyclonal anti-caspase-1 p20 (M-19) After blocking by 5% BSA for 40 min, sections were incu- antibody(1:1000, sc-1218, Santa Cruz Biotechnology); bated overnight at 4 °C with the following primary anti- rabbit polyclonal anti-IL-1β (H-153) antibody (1: 1000, sc- body used: rabbit polyclonal anti-myeloperoxidase (MPO) 7884, Santa Cruz Biotechnology); and rabbit polyclonal antibody (1:50, ab9535, Abcam). After washing with PBS, anti-IL-18 (H-173) antibody (1:1000, sc-7954, Santa Cruz sections were then incubated with the secondary antibody: Biotechnology), and glyceraldehyde 3-phosphate dehydro- Alexa Fluor 594 goat anti-rabbit IgG (H + L) (1:100, A- genase (GAPDH) (1:1000, Cell Signaling Technology) was 11012, Invitrogen) for 1 h at room temperature. Following used as an internal reference. Blot bands were quantified washing three times with PBS, the sections were re-stained via densitometry with ImageJ software (National Institutes by 4′6-diamidino-2-phenylindole (DAPI) for 10 min. Then, of Health, Baltimore, MD, USA), and protein levels were images were obtained with a fluorescence microscope expressed as the ratio of values of the detected protein (ZEISS-AXIO Scope. Al, Germany). bands to that of GAPDH bands. Table 1 Primers used in real-time qRT-PCR reactions FJC staining Gene Forward primer (5′-3′) Reverse primer (5′-3′) For the detection of degenerating neuron, FJC staining NLRP3 CGGTGACCTTGTGTGTGCTT TCATGTCCTGAGCCATGGAAG was conducted as described previously with some modi- ASC GACAGTACCAGGCAGTTCGT AGTAGGGCTGTGTTTGCCTC fications [41]. Briefly, rat brain sections were prepared as Caspase-1 GAACAAAGAAGGTGGCGCAT AGACGTGTACGAGTGGGTGT mentioned above, then sections were rinsed with dis- tilled water and immersed into 0.06% potassium per- IL-1beta CCTATGTCTTGCCCGTGGAG CACACACTAGCAGGTCGTCA manganate solution for 10 min followed by transferred IL-18 ACCACTTTGGCAGACTTCACT ACACAGGCGGGTTTCTTTTG into a 0.0001% solution of FJC (AG325, Merck millipore) Nqo1 GTTTGCCTGGCTTGCTTTCA ACAGCCGTGGCAGAACTATC dissolved in 0.1% acetic acid vehicle for 30 min. After HO-1 GGTGATGGCCTCCTTGTACC GTGGGGCATAGACTGGGTTC washing with distilled water, the slides were put into an Actin TCAGCAAGCAGGAGTACGATG GTGTAAAACGCAGCTCAGTAACA oven at 50 °C for 20 min. The dried slides were then Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 6 of 19 Cytokine ELISA assay 8.92 ± 0.79 vs. 9.00 ± 0.95, p > 0.05, 72 h). However, ILG At 24 h after ICH, the rats were deeply anesthetized. obviously reduced the mNSS scores at 20 mg/kg The serum samples from intracardiac puncture blood (vehicle-DMSO vs. 20 mg/kg: vs. 8.25 ± 0.87, p < 0.01, and the supernatant samples from perihematomal brain 24 h; vs. 6.25 ± 1.06, p < 0.01, 72 h) and 40 mg/kg tissue homogenate were obtained and stored at −80 °C (vehicle-DMSO vs. 40 mg/kg: vs. 8.17 ± 0.94, p < 0.01, until use. Measurements of IL-1β and IL-18 levels were 24 h; vs. 6.83 ± 1.03, p < 0.01, 72 h), but the effects conducted by a double-antibody sandwich ELISA Array between two dosages were no significant difference (20 Kit according to the reagent manufacturer’s instructions. vs. 40 mg/kg, p > 0.05, 24 and 72 h) (Fig. 1b). Consistent Briefly, prepared tissue supernatant or serum samples with the behavioral results, H&E staining of brain tissues were added to monoclonal antibody enzyme well which surrounding the hematoma showed that ILG treatment is pre-coated with rats IL-1β or IL-18 antibodies labeled obviously improved histological impairments at the dos- with biotin and combined with Streptavidin-HRP to ages of 20 and 40 mg/kg, but 10 mg/kg were not form immune complex, then incubated for 1.5 h in a (Fig. 1c). Besides, we also evaluated the effect of ILG 37 °C condition and washed three times with PBS to re- (20 mg/kg) on hematoma volume at 24 and 72 h after move the uncombined enzyme. After adding the ICH induction (Additional file 1D). Typical magnetic chromogen solution A and B, the samples were detected resonance imaging (MRI) T2-weighted images (T2WI) using an automatic microplate reader at 450 nm. were obtained (Additional file 2A). The hematoma vol- ume of ICH + DMSO group at 24 and 72 h after ICH Measurements of CAT activity, SOD activity and ROS were 24.81 ± 1.64, 29.11 ± 2.06 mm , respectively. ILG content, GSH/GSSG contents administration significantly reduced hematoma volume to CAT assay kit (visible light) (A007-1), total SOD assay 22.95 ± 3.26 mm at 72 h after ICH but not 24 h (23.10 ± kit (Hydroxylamine method) (A001-1), ROS assay kit 2.02 mm )(p < 0.05 vs. ICH + DMSO, 72 h; p >0.05 vs. (E004), and total GSH/GSSG assay kit (A061-1) were all ICH + DMSO, 24 h) (Additional file 2B). Consequently, purchased from Nanjing Jiancheng Bioengineering Insti- the results indicated that ILG treatment (20 mg/kg) had tute (Nanjing, China) and were used to measure the no notably effect on bleeding but possibly promoted CAT activity, SOD activity and ROS content, GSH/ hematoma clearance after ICH induction. GSSG contents according to the instructions of reagent manufacturers, respectively. Intraperitoneal administration of ILG alleviated brain edema and disruption of BBB at 24 and 72 h after ICH Statistical analysis After induction of ICH at 24 and 72 h, BWC increased All data were presented as means ± standard deviation clearly (p<0.01vs. sham,24and 72 h) andEvansblue (SD). Statistical analyses were performed with SPSS ver- dyes significantly extravasated through disrupted BBB sion 19.0 software (SPSS, Inc., Chicago, IL, USA), and (p < 0.01 vs. sham, 24 and 72 h). The effects of ILG plots were drawn by GraphPad Prism 5 software (Graph- treatment on the brain edema and BBB disruption were Pad Software, Inc., San Diego, CA). If data are equal var- in keeping with that on the behavioral deficits and iances, one-way analysis of variance (ANOVA) followed brain tissue damages. Assessment of BWC using a wet/ by least significant difference (LSD) tests were used to dry weight method showed that ILG treatment at the compare differences among multiple groups; for the re- dosage of 10 mg/kg (vehicle-DMSO vs. 10 mg/kg: sults being unequal, Dunnett’s T3 tests were taken into 81.96 ± 0.68% vs. 81.57 ± 0.64%, p > 0.05, 24 h; 81.40 ± account. Differences with a p < 0.05 were considered sta- 0.73% vs. 81.05 ± 0.90%, p > 0.05, 72 h) was unable to tistically significant. improve brain edema, but the dosages at 20 mg/kg (ve- hicle-DMSO vs. 20 mg/kg: vs. 80.40 ± 0.87%, p < 0.01, Results 24 h; vs. 79.65 ± 1.01%, p < 0.01, 72 h) and 40 mg/kg ILG improved behavioral deficits and reduced histological (vehicle-DMSO vs. 40 mg/kg: vs. 80.07 ± 0.43%, p < damages at 24 and 72 h after ICH by intraperitoneal 0.01, 24 h; vs. 79.53 ± 0.85%, p < 0.01, 72 h) did play a administration positive role on the reduction of brain edema. However, Figure 1a shows the representative macrographs (left, there was no clear difference on the extent of protective sham, 24 h; right, ICH, 24 h). The rats subject to ICH effects about the ILG dosages of 20 and 40 mg/kg (20 induction showed obvious behavioral deficits at 24 and vs. 40 mg/kg: p > 0.05, 24 and 72 h) (Fig. 1d, e). Quanti- 72 h after ICH graded by a mNSS score scale (p < 0.01 tative measurements of EB dyes after extravasation in vs. sham, 24 h and 72 h). Administration of ILG at the the ipsilateral hemisphere indicated that ILG treatment dosage of 10 mg/kg was not significantly effective for the significantly alleviated the extravasation of EB dyes at improvement of behavioral deficits (vehicle-DMSO vs. the dosages of 20 mg/kg (p <0.01 vs. vehicle-DMSO, 24 10 mg/kg: 10.33 ± 1.07 vs. 10.25 ± 1.14, p > 0.05, 24 h; and 72 h) and 40 mg/kg (p <0.01 vs. vehicle-DMSO, 24 Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 7 of 19 Fig. 1 Representative macrographs and the effects of ILG treatment on ICH-induced brain impairments (a–e). Typical macrographs (left: sham, 24 h after operation; right: 24 h after ICH induction) (a). ILG administration at the doses of 20 and 40 mg/kg at 24 and 72 h after ICH induction significantly reduced the neurological deficits assessed by a mNSS score scale (b)(n = 12 rats/group). Similarly, ILG treatment at doses of 20 and 40 mg/kg markedly alleviated the histological changes evaluated via H&E staining (c)(n = 6 rats/group) and BWC (d, e)(n = 6 rats/group) measured by the dry/wet weight method at 24 and 72 h after ICH. Scale bar = 50 and 20 μm. Values are shown as means ± SD. **p < 0.01; *’: ICH + vehicle (DMSO) vs. ICH + ILG 20 mg/kg, p < 0.01; ICH + ILG 10 mg/kg vs. ICH + ILG 20 mg/kg, p < 0.05 and 72 h), but not 10 mg/kg (p >0.05 vs. vehicle- 72 h) and 40 mg/kg (p < 0.01 vs. vehicle-DMSO, 24 and DMSO, 24 and 72 h) after ICH modeling (Fig. 2a, b). 72 h) markedly dropped the number of FJC cells. Add- itionally, a 10 mg/kg dosage of ILG treatment had no ILG administration decreased the number of distinct effect on the reduction of degenerating neurons degenerating neurons in the brain tissue surrounding the (p > 0.05 vs. vehicle-DMSO, 24 and 72 h) and treatment hematoma after ICH induction results of ILG between 20 and 40 mg/kg were similar To further estimate the effects of ILG treatment on (20 vs. 40 mg/kg: p > 0.05, 24 and 72 h) (Fig. 2c, d). brain damages in a rat ICH model, we assessed the neur- In conclusion, experimental results displayed above onal degeneration in brain tissue of perihematomal re- clearly suggested that ILG treatment by intraperitoneal gion. FJC neurons were significantly increased in the delivery significantly reduced the behavioral deficits, brain tissue surrounding hematoma after ICH (p < 0.01 histological impairments, BBB disruption, brain edema vs. sham, 24 and 72 h) and administration of ILG at the and degenerating neurons of perihematomal brain tissue dosages of 20 mg/kg (p < 0.01 vs. vehicle-DMSO, 24 and at the doses of 20 and 40 mg/kg, but there were no Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 8 of 19 Fig. 2 Effects of ILG on BBB disruption and the number of degenerating neuron following ICH (a-d). ILG administration at the dosages of 20 and 40 mg/ kg significantly alleviated the extravasation of EB dyes and the number of FJC staining cells. Macroscopic images of brains with extravasated EB dyes (a) and corresponding quantitative analyses (b)(n = 6 rats/group). Typical microscopic images for FJC staining cells from injury brain tissues (c)and quantitative analyses of the number of FJC staining cells (d)(n =6 rats/group). Scale bar = 20 μm. Values are reported as means ± SD. **p <0.01 obvious difference on the extent between them. Thus, tissue at 24 h after ICH and the results suggested that ILG we selected the dosage of 20 mg/kg to further explore 20 mg/kg treatment significantly increased the expression the potential molecular mechanisms of ILG’s protective of total Nrf2 protein (p < 0.01 vs. ICH) (Fig. 3a, d) and de- effects on early brain injury after ICH induction. creased that of total NF-κBp65protein (p <0.01 vs. ICH) (Fig. 3a, b). Typical IHC images were obtained from the in- The expression and nuclear translocation of Nrf2 was jury brain tissue (Fig. 4). Meanwhile, Nrf2 protein level in promoted by ILG treatment at 24 h after ICH induction the cytoplasm was significantly dropped (p <0.01 vs. ICH) and that of NF-κB p65 was suppressed (Fig. 3a, e) and notably increased in the nucleus (p <0.01 ILG was reported to hold capacity to activate the Nrf2- vs. ICH) (Fig. 3a, g); cytoplasmic level of NF-κBp65 was mediated antioxidant system and inhibit the activation of significantly increased (p <0.01 vs. ICH) (Fig. 3a, c) and the NF-κB. Thus, we guessed that whether ILG alleviated early nuclear level was notably deceased (p < 0.01 vs. ICH) brain injury post ICH involved in Nrf2 and NF-κBpath- (Fig. 3a, f). Consequently, experimental results indicated ways. In order to verify our supposition, we performed WB that ILG promoted the expression and nuclear transloca- analyses and IHC staining using the perihematomal brain tion of Nrf2 and suppressed that of NF-κB p65. Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 9 of 19 Fig. 3 Effects of ILG on protein levels of NF-κB p65 and Nrf2 after ICH. Representative WB bands of NF-κB p65 and Nrf2 proteins (total, cytoplasmic and nuclear) (a) and quantitative analyses of total NF-κBp65 (b), cytoplasmic NF-κBp65(c), and nuclear NF-κBp65(f) protein levels and total Nrf2 (d), cytoplasmic Nrf2 (e), and nuclear Nrf2 (g)protein levels (n = 6 rats/group). Values are indicated by means ± SD; **p < 0.01; *p <0.05 The components of NLRP3 inflammasome pathway and ILG delivery reduced the markers of oxidative stress + + + subsequent IL-1β/IL-18 release were suppressed by ILG injury, infiltration of MPO , CD68 , Iba-1 cells, and treatment expression of MPO in the brain tissue surrounding the Activation of NLRP3 inflammasome and induction of its hematoma components aggravated the early brain injury after ICH, Excessive production of ROS mediates seriously oxida- and blockades were protective reported by our [17] and tive injury and is a key promoting factor for the activa- other studies [8, 16]. In addition, a recent study showed tion of NLRP3 inflammasome, and the antioxidant that Nrf2 negatively regulates NLRP3 inflammasome ac- responses initiated through nuclear translocation of Nrf2 tivity by inhibiting ROS [18]. Therefore, we investigated could alleviate the ROS-induced brain injury and inflam- that whether ILG decreased the activation and induction matory cell infiltration. Therefore, we probed that if ILG of NLRP3 inflammasome pathway components or not. treatment at 20 mg/kg dropped the production of oxida- The results showed that ILG at the dosage of 20 mg/kg tive stress markers 3-NT and 8-OHdG by IHC staining significantly suppressed the expression of NLRP3 inflam- and infiltration of neutrophils (indicated by MPO, a neu- masome components: NLRP3, ASC, caspase-1 (p < 0.01 trophil marker) using IF staining and WB analyses. The vs. ICH) (Fig. 5a, b, c, e), and blocked the activation of results suggested that ILG (20 mg/kg) could significantly NLRP3 inflammasome as indicated by the reduction of decrease the amounts of 3-NT cells (p < 0.01 vs. ICH) cleaved IL-1β and IL-18 (p < 0.01 vs. ICH) (Fig. 5a, g, i). (Fig. 6a, b), 8-OHdG cells (p < 0.05 vs. ICH) (Fig. 6a, c) Representative IHC images of NLRP3 protein were in perihematomal brain tissues. Also, the expression shown (Fig. 4). Consistent with the above results, ILG level of MPO was notably decreased in the injury brain treatment obviously reduced the protein levels of pro- tissue (p < 0.01 vs. ICH) (Fig. 7c), and representative IF IL-1β (p < 0.01 vs. ICH) (Fig. 5a, f) and pro-IL-18 (p < images and WB band of MPO protein were shown, re- 0.01 vs. ICH) (Fig. 5a, h) and increased the expression of spectively (Fig. 7a, b). Meanwhile, ILG (20 mg/kg) could + + pro-caspase-1 (p < 0.05 vs. ICH) (Fig. 5a, d). significantly drop the amounts of CD68 , Iba-1 (CD68 Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 10 of 19 Fig. 4 Effects of ILG on protein levels of NF-κB and Nrf2 pathways evaluated by IHC staining. Typical IHC images of NF-κB p65, Nrf2, NLRP3, NQO1, and HO-1 (n = 6 rats/group). Scale bar =20 μm and Iba-1, the microglia/macrophage markers) cell recruit- Inflammatory cytokine levels in the brain tissue and ments in injury brain tissue after ICH as well (p <0.05 vs. serum from the blood of cardiac puncture were both ICH) (Additional file 2C, D, E). significantly reduced by ILG treatment We measured the levels of inflammatory cytokines IL- 1β and IL-18 both in perihematomal brain tissues and ILG treatment lowered the mRNA levels of NLRP3 the serum, respectively. The results were similar to the inflammasome, NF-κB, and Nrf2 pathway components previous experimental findings, namely, ILG treatment To further explore the effects of ILG treatment on the significantly dropped the levels of IL-1β in damaged mRNA levels of NLRP3 inflammasome, NF-κB, and brain tissues and the serum (p < 0.01 vs. ICH) (Fig. 8h, i). Nrf2 pathway components at 24 h after ICH induc- The contents of IL-18 in the damaged brain tissue and tion, we performed relative real-time RT-qPCR study. serum were significantly decreased as well (p <0.01 vs. The results showed that 24 h after ICH induction, the ICH) (Fig. 8j, k). mRNA levels of NLRP3, ASC, caspase-1, IL-1β,IL-18, NQO1, and HO-1 were obviously increased (p <0.01 ILG reduced the contents of ROS and GSSG, increased the vs.sham)(Fig.8) and ILG (20 mg/kg)significantly level of GSH and upregulated the enzyme activities of weakened the increases of NLRP3, caspase-1, IL-18 (p < SOD and CAT 0.05 vs. ICH) (Fig. 8a, c, e), ASC, and IL-1β mRNA levels We also detected the activities of SOD and CAT enzymes (p < 0.01 vs. ICH) (Fig. 8b, d). Meanwhile, NQO1 (p <0.01 and the contents of GSH/GSSG and ROS after ILG treat- vs. ICH) (Fig. 8f) and HO-1 (p < 0.05 vs. ICH) (Fig. 8g) ment at 24 h post ICH. Experimental results indicated that were further distinctly upregulated at the mRNA after ICH induction, enzyme activities of CAT and SOD levels by ILG treatment. In addition, representative and the content of GSH were significantly decreased (p < IHC images of NQO1 and HO-1 proteins were 0.01 vs. sham) (Fig. 8l, m, o), the levels of GSSG and ROS shown (Fig. 4). were evidently increased (p < 0.01 vs. sham) (Fig. 8o, n). Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 11 of 19 Fig. 5 Effects of ILG on NLRP3 inflammasome activation and IL-1β/IL-18 maturation. Representative WB bands (a) and inhibited effects of ILG on NLRP3 (b), ASC (c), pro-caspase-1 (d), caspase-1 (e), pro-IL-1β (f), IL-1β (g), pro-IL-18 (h), and IL-18 (i) protein levels in the ipsilateral hemisphere at 24 h after ICH (n = 6 rats/group). Data are indicated by means ± SD. *p < 0.05; **p < 0.01 ILG treatment at 20 mg/kg could strikingly reverse the We conducted the Nrf2 siRNA interfering and Nrf2 decreases of CAT and SOD enzyme activities, increases of siRNA together with ILG 20 mg/kg co-treatment re- GSSG and ROS levels, and reduction of GSH content search by intraventricular injection and intraperitoneal (p <0.01 vs. ICH) (Fig. 8l–o). delivery, respectively. Interfering effects of Nrf2 siRNA were identified using real-time RT-qPCR and WB ana- Nrf2 siRNA interference aggravated the behavioral lyses. The results showed that Nrf2 siRNA significantly deficits and brain edema and raised the number of FJC dropped the mRNA and protein expression (p < 0.01 vs. cells and administration of ILG lowered those vehicle-2) levels of Nrf2 (Fig. 9a–c). In the study, we uncomfortable effects found that Nrf2 siRNA interference markedly exacer- In our studies mentioned above, some preliminary con- bated the function deficits (Nrf2 siRNA vs. vehicle-2: clusions were obtained that ILG could effectively reduce 13.67 ± 0.91 vs. 10.89 ± 0.96, p < 0.01) (Fig. 9d) and brain the early brain injury after ICH induction and the pro- edema (Nrf2 siRNA vs. vehicle-2: 83.57 ± 0.80% vs. tective effects of ILG might be involved in the regulation 82.35 ± 0.98%, p < 0.05) (Fig. 9f) and increased the of Nrf2, ROS, NF-κB, and NLPR3 inflammasome path- amounts of degenerating neuronal cells (p < 0.01 vs. ways. We wondered if ILG treatment reduced the brain vehicle-2) (Fig. 9e, g) at 24 h after ICH induction. How- injury mediated by NLRP3 inflammasome pathway via ever, ILG administration (20 mg/kg) distinctly reversed Nrf2 activation-induced ROS and/or NF-κB inhibition. those uncomfortable results: function deficits (Nrf2 Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 12 of 19 Fig. 6 Effects of ILG on oxidative stress marker levels in the injury brain tissue after ICH. ILG significantly decreased the oxidative stress marker levels (3-NT and 8-OHdG) after ICH. Typical oxidative stress markers 3-NT and 8-OHdG IHC images (a) and quantitative analyses (b, c)(n =6 rats/group). Scale bar =20 μm. Values are reported as means ± SD. **p < 0.01; *p <0.05 siRNA vs. Nrf2 siRNA + ILG 20 mg/kg: vs. 11.89 ± 0.90, Discussion p < 0.01), brain edema (Nrf2 siRNA vs. Nrf2 siRNA + Accumulating studies have displayed that oxidative ILG 20 mg/kg: vs. 82.27 ± 0.57%, p < 0.05), and FJC cells stress and inflammation played key roles in the (p < 0.01 vs. Nrf2 siRNA) (Fig. 9d–g). pathophysiological processes of early brain injury after ICH induction and inhibition of them were beneficial Nrf2 siRNA interference increased the expression of NF-κB [5,7,44–46]. In our first experiment, we found that p65 and NLRP3 inflammasome components and triggered ILG administration at the dosages of 20 and 40 mg/ the activation of NLRP3 inflammasome pathway and ILG kg ameliorated the early brain tissue impairments and reduced these effects behavioral defects as indicated by the reduction of mNSS We further evaluated the effects of Nrf2 siRNA on the ex- scores and FJC neuronal cells, the improvement of histo- pression of NF-κB p65 and induction and activation of logical damages, BBB disruption, and brain edema at 24 NLRP3 inflammasome pathway components. We found and 72 h post ICH modeling and obtained the ideal dose that Nrf2 siRNA interfering could significantly increase of ILG at 20 mg/kg for the following experiments. In the the expression of NF-κBp65(p < 0.05 vs. vehicle-2) second experiment, the results showed that ILG delivery (Fig. 10a, b); NLRP3 inflammasome components: NLRP3, at 20 mg/kg activated the Nrf2-mediated antioxidative sig- ASC, caspase-1, and downstream molecule, IL-1β (p < naling pathway and suppressed the activation of NF-κB 0.01 vs. vehicle-2) (Fig. 10a, c, d, e, f). ILG at the dosage of and NLRP3 inflammasome pathways as indicated by the 20 mg/kg and Nrf2 siRNA co-administration obviously increasing of nuclear translocation and decreasing of the alleviated the enhancement of protein expression levels of cytoplasmic level of Nrf2, the reduction of nuclear trans- NF-κB p65, caspase-1, IL-1β (p < 0.05 vs. Nrf2 siRNA) location and upregulation of cytoplasmic level of NF-κB (Fig. 10a, b, e, f), NLRP3, and ASC (p < 0.01 vs. Nrf2 p65, and the induction and activation of NLRP3 inflam- siRNA) (Fig. 10a, c, d) after Nrf2 siRNA treatment at 24 h masome (components) and its downstream molecules. In following ICH. the third experiment, we found that Nrf2 siRNA notably Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 13 of 19 Fig. 7 Effects of ILG on the number of MPO cells in perihematomal brain tissues (a–c). Representative microscopic images (a), WB bands (b), and quantitative analysis of the bands (c)(n = 6 rats/group). Scale bar =20 μm. Values are reported as means ± SD. **p < 0.01 exacerbated the early brain injury post ICH as supported in vitro [26, 51, 52]. Pretreatment of ILG significantly alle- by aggravated behavioral deficits, brain edema, and degen- viated neurological deficits, cerebral infarct, and brain eration of neuronal cells, and ILG treatment visibly edema, and these neuroprotective effects are involved in alleviated the effects. Based on the results above, we hy- the increases of brain ATP content, energy charge (EC) pothesized here that ILG alleviates early brain injury after and total adenine nucleotides (TAN) and preservation of + + ICH induction by activating Nrf2 antioxidant pathway, brain Na K ATPase activity, SOD, CAT, and GSH-Px, inhibiting the activation and induction of NLRP3 inflam- and inhibition of the increase of brain MDA content in a masome (components), and this process may be involved rat cerebral ischemia-reperfusion model [50]. Toxicity of in the suppression of ROS and/or NF-κB signaling path- brain cells induced by cocaine and methamphetamine de- ways. Potential molecular mechanisms of ILG’s effects on livery was also able to be attenuated by ILG treatment the early brain injury after ICH induction is shown in [47–49]. Consistently, in in vitro studies, ILG protected Additional file 3. neuronal cells from glutamate and 6-hydroxydopamine Results from our study have powerful evidence showing (6-OHDA)-induced neurotoxicity by reducing the produc- that ILG possesses a brain cell-protective function, and tion of ROS [51, 52]. Meanwhile, a recent report also this was in line with previous studies in vivo [47–50] and showed that ILG treatment could notably alleviate Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 14 of 19 Fig. 8 Effects of ILG on the mRNA levels of NLRP3 inflammasome pathway components and downstream molecules of Nrf2-mediated antioxidant system, contents of inflammatory cytokines and antioxidants, and activity of antioxidative enzymes. ILG treatment at 20 mg/kg notably decreased the mRNA levels of NLRP3 (a), ASC (b), caspase-1 (c), IL-1β (d), IL-18 (e), and further increased the NQO1 (f), HO-1 (g) mRNA levels (n = 6 rats/ group). Similarly, ILG administration at 20 mg/kg obviously reduced the levels of IL-1β (h, i) and IL-18 (j, k) in the perihematomal brain tissue and serum measured by ELISA (n = 6 rats/group). Besides, ILG delivery also markedly reversed the reduction of CAT and SOD activities (l, m), increasing of ROS (n) and GSSG (o) contents and decreasing of GSH level (o)(n = 6 rats/group). Values are reported as means ± SD. **p < 0.01; *p < 0.05; *’: ICH vs. ICH + ILG 20 mg/kg, p < 0.01; ICH + vehicle (DMSO) vs. ICH + ILG 20 mg/kg, p < 0.05 rotenone and sodium nitroprusside (SNP)-induced oxida- and its downstream genes [28]. The activation mechanisms tive stress and nitrosative stress by improving MMP, ATP of Nrf2 by ILG might be involved in the alkylation of levels, and neural cell viability [26]. kelchlike ECH-associated protein 1 (Keap1) at specific cyst- ILG, one of the active extracts isolated from G. uralensis, eine residues, especially at the site of C151, a most reactive is a flavonoid with chalcone structure and is brain- cysteine residue site of human Keap1 [54]. At the same permeable after administration [53], which showed various time, there were reports showing that ILG upregulated the biological activities including anti-inflammatory, anti- expression of HO-1 in RAW264.7 macrophages through oxidative stress [9]. Increasing studies suggested that ILG the extracellular signal-regulated kinase1/2 (ERK1/2) path- exerts biological effects by activating Nrf2-mediated anti- way post lipopolysaccharide (LPS) treatment [55] and had oxidative system and eliminating ROS [9] and was the inhibitory effects on LPS-induced inflammatory responses most potent inducer to stimulate the expression of Nrf2 of mouse macrophages by suppressing NF-κB signaling Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 15 of 19 Fig. 9 Effects of Nrf2 siRNA delivery and Nrf2 siRNA with ILG 20 mg/kg co-administration in ICH rats. Real-time RT-qPCR assay of Nrf2 after siRNA delivery 24 h following ICH (n =6 rats/group) (a). WB assay (b)and quantification (c) of Nrf2 protein after siRNA treatment 24 h following ICH (n = 6 rats/group); mNSS score (d) at 24 h post ICH (n = 18 rats/group). BWC (f)at24h afterICH (n = 6 rats/group). FJC staining (g) and quantification (e)ofFJC staining cells (n = 6 rats/group). Data represent means ± SD. Scale bar =20 μm. **p < 0.01; *p < 0.05. *’: ICH + vehicle-2 vs. ICH + Nrf2 siRNA, p < 0.05; ICH + control scramble siRNA vs. ICH + Nrf2 siRNA, p <0.01 involved in the blockade of inhibitor of κBα (IκBα)degrad- of ROS, mitochondrial DNA or the mitochondrial ation and phosphorylation [56]. In addition, recent reports phospholipid cardiolipin, potassium efflux, changes in also indicated that ILG induced the activation of Nrf2 as cell volume, calcium, and lysosomal impairments have indicated by an increase in its nuclear translocation and all been proposed as critical active signals to trigger the the expression of Nrf2-targeted phase II enzymes, such as activation of NLRP3 inflammasome [60, 61]. Activation HO-1 and NQO1 [29]. In addition to the regulation of ILG of NLRP3 inflammasome demands two signals. One is on Nrf2 pathway, increasing evidences have suggested that the stimulus of NF-kB pathway that after NF-κB activa- ILG notably inhibited the activation of NF-κB pathway by tion, NF-κB translocates into the nucleus, after binding suppressing LPS-induced TLR4/MD-2 homodimerization with DNA and initiating the transcription and translation [57], blocking IκBα phosphorylation and degradation, re- of IL-1β precursor protein and NLRP3 protein; another ducing NF-κB p65 nuclear translocation [58], downregulat- one is to trigger the assembly of NLRP3 inflammasome ing mRNA and protein levels of NF-κB and its activation and lead to its stimulus such as production of ROS. [25, 59], and inhibiting RANKL-stimulated NF-κBexpres- Following triggered, active NLRP3 inflammasome recruits sion and nuclear translocation [23]. precursor caspase-1 and cleaves it into active caspase-1, The NLRP3 inflammasome, a best characterized pat- and then the cleaved caspase-1 processes IL-1β and tern recognition receptor (PRR) in innate immune IL-18 precursors into mature IL-1β and IL-18, eventu- response, played a crucial component in the early brain ally augmenting the inflammatory responses and injury post ICH [8, 16, 17] and was composed by a impairments [60, 61]. sensor (NLRP3 protein), an adaptor (ASC protein), and Recently, several studies have demonstrated that an effector (zymogen pro-caspase-1) [60, 61]. Production NLRP3 inflammasome pathway was activated after ICH Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 16 of 19 Fig. 10 Effects of Nrf2 siRNA and Nrf2 siRNA with ILG co-treatment on the protein levels of NF-κB p65 and NLRP3 inflammasome pathway components after ICH. WB assay (a) and quantification of NF-κB p65 (b), NLRP3 (c), ASC (d), caspase-1 (e), and IL-1β (f) protein levels after Nrf2 siRNA and ILG 20 mg/kg co-treatment at 24 h following ICH (n = 6 rats/group). Data are indicated by means ± SD. **p < 0.01; *p < 0.05 induction, and the inhibiting of NLRP3 using siRNA or are considered to be the first non-neuronal cells to recombinant adenovirus encoding NLRP3 RNAi could react to various pathological processes after ICH and attenuate the brain injury including improving behav- thus once the condition ictus, microglia are immedi- ioral deficits and reducing brain edema and MPO level. ately activated by a various of blood components and Hence, ROS and the activation of NF-κB pathway were then activated microglia release multiple cytokines the crucial upstream signals, and blocking them can and chemokines, following peripheral inflammatory reduce the activation of NLRP3 inflammasome. In our cells (including neutrophils, macrophages) infiltrating study, we have verified that Nrf2 triggering via ILG into the hemorrhagic brain and are activated, next administration significantly decreased the production of producing a mass of cytokines, chemokines, and cyto- oxidative stress markers 3-NT and 8-OHdG and sup- toxicity substance [4, 62]. Thus, both the activation pressed the activation of NF-κB; meanwhile, the NLRP3 and infiltration of neutrophils and microglia/macro- inflammasome was restrained. The results suggested that phages synergistically contribute to the inflammatory Nrf2 could downregulate the activity and expression of brain injury post ICH and play crucial role on the NLRP3 inflammasome (components) and were in keep- pathological mechanisms [4, 62]. Our experimental ing with previous reports [18, 22]. To further proved our results have shown that ILG administration could assumption, we conducted Nrf2 siRNA interfering and notably reduce the number of perihematomal neutro- Nrf2 siRNA + ILG 20 mg/kg co-administration study in phils and microglia/macrophages as well. a rat ICH model. The results showed that after Nrf2 Also, iron, one key component of hemoglobin (Hb) siRNA treatment, the brain injuries were more severe metabolites, was reported to be involved in the second- and ILG (20 mg/kg) obviously attenuated the impair- ary brain injury. Excessive production of iron could lead ments. These also were consistent with the studies of to oxidative brain impairments by Fenton reaction, other groups, namely, Nrf2 was involved in the regula- which yields massive ROS. Furthermore, HO-1 promotes tion of ILG-mediated NLRP3 inflammasome activation the level of iron by participating in the degradation of [18, 22] and the activation of Nrf2 pathway was neuro- heme [63, 64]. Besides, ILG was also reported to coun- protective [9, 12, 13, 31]. teract iron-catalyzed oxidative stress damages in HepG2 Microglia are the key immune cells existing in the cells by AMPK-mediated GSK3β inhibition which was central nervous system (CNS) and are commonly re- involved in mitochondrial dysfunction and superoxide ferred to as the macrophage of the brain. Microglia generation [65]. Meanwhile, in our experiments, we Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 17 of 19 found that ILG administration could significantly inhibit Additional file 2: Effects of ILG on the hematoma volume and the level of ROS and promote the expression of HO-1 in expansion at 24 h and 72 h after ICH (a, b) and effects of ILG on the + + number of CD68 , Iba-1 cells in the perihematomal brain tissue at 24 h the injury brain tissue. Thus, the relationship of iron after ICH (c-e). Representative MRI T2WI images (a) and quantitative analyses metabolism and neuroprotective effects of ILG needs to of hematoma volume (b) (n = 6 rats / group). Representative microscopic + + be further explored. images (c) and quantitative analyses of CD68 ,Iba-1 cells (d, e) (n = 6 rats /group). Scale bar = 20 μm. Values are reported as means ± SD. ** p < 0.01, Thrombin, a serine protease produced immediately * p < 0.05. (TIF 7318 kb) in brain after ICH to prevent the bleeding. It may be a Additional file 3: Mechanism diagram. Underlying molecular mechanisms central injury mechanism of ICH and was shown to of ILG’s neuroprotective effects on the early brain injury after ICH induction. mediate the secondary brain injury by multiple path- ILG alleviated the early brain injury following ICH may be involved in the regulation of ROS and / or NF-κB on the activation of NLRP3 inflammasome ways including complement cascade and protease- pathway by the triggering of Nrf2 activity and the induction of Nrf2-mediated activated receptors (PAR) [63, 64]. Recently, thrombin antioxidant system. (TIF 232 kb) was also reported to be involved in the activation of NLRP3 inflammasome and microglia and induced Abbreviations severe brain injury including brain edema, BBB 3-NT: 3-Nitrotyrosine; 6-OHDA: 6-Hydroxydopamine; 8-OHdG: 8- disruption, and brain cell loss [66, 67]. In our study, Hydroxyguanosine; ANOVA: Analysis of variance; ARE: Antioxidant response element; BBB: Blood-brain barrier; BSA: Bovine serum albumin; BWC: Brain we found that ILG 20 mg/kg could efficaciously block- water content; CAT: Catalase; CNS: Central nervous system; DAB: 3,3- ade the activation of NLRP3 inflammasome and infil- Diaminobenzidine; DAPI: 4′6-Diamidino-2-phenylindole; tration of neutrophils and microglia/macrophages into DMSO: Dimethylsulfoxide; EB: Evans blue; EC: Energy charge; EDTA: Ethylene diamine tetraacetic acid; ELISA: Enzyme-linked immunosorbent assay; ERK1/ the injury brain tissue. Thus, whether ILG exerts its 2: Extracellular signal-regulated kinase1/2; FJC: Fluoro-Jade® C; G. protective effects involved in the thrombin-mediated brain uralensis: Glycyrrhiza uralensis; GAPDH: Glyceraldehyde 3-phosphate dehydro- injury pathway remains to be further investigated. genase; GPX: Glutathione peroxidase; GSH/GSSG: Glutathione/oxidized glutathione; GST: Glutathione-S-transferase; H&E: Hematoxylin and eosin; There are several potential limitations deserving atten- Hb: Hemoglobin; HO-1: Heme oxygenase-1; HRP: Horseradish peroxidase; tion in our experiments. Firstly, ILG was reported to i.p.: Intraperitoneal injection; ICH: Intracerebral hemorrhage; perform a variety of biological functions by regulating IF: Immunofluorescence; IHC: Immunohistochemistry; IL-1β: Interleukin-1 beta; ILG: Isoliquiritigenin; IκBα: Inhibitor of κBα; Keap1: Kelchlike ECH- multiple signaling pathways, and we mainly concentrated associated protein 1; LPS: Lipopolysaccharide; LSD: Least significant on the Nrf2, ROS, NF-κB, and NLRP3 inflammasome difference; mNSS: Modified Neurological Severity Score; pathways. However, ILG may exert its effects on other sig- MPO: Myeloperoxidase; MRI: Magnetic resonance imaging; NF-κB: Nuclear factor-κB; NLRP3: Nod-like receptor family, pyrin domain-containing 3; naling pathways. Secondly, we just carried out our study NO: Nitric oxide; NQO1: NAD(P)H: quinone oxidoreductase-1; Nrf2: Nuclear on a kind of ICH model (sterile-filtered collagenase type factor erythroid-2 related factor 2; PAR: Protease-activated receptor; IV-induced), not concurrently on other ICH models such PBS: Phosphate buffer solution; PRR: Pattern recognition receptor; ROS: Reactive oxygen species; RT-qPCR: Real-time reverse transcription- as autologous blood-imitated model of ICH. The results quantitative polymerase chain reaction; SD: Standard deviation; SD derived from our experiments should be more convincing rats: Sprague-Dawley rats; siRNA: Small interfering RNA; SNP: Sodium by more than one model to be verified. Finally, collagenase nitroprusside; SOD: Superoxide dismutase; SPF: Specific pathogen-free; T2WI: T2-weighted images; TAN: Total adenine nucleotides; WB: Western blot itself is a kind of foreign matter and is unavoidable to trig- ger extra inflammatory responses. Consequently, further Acknowledgements experiments are needed to settle these issues. It has been shown as Funding. Funding Conclusions This work was supported by the National Natural Science Foundation of Taken together, our experiments have identified that China (Nos. 81671125, 81271314, and 30500526), Special Project on the ILG administration notably attenuated the early Integration of Industry, Education and Research of Guangdong Province and Ministry of Education (No. 2012B091100154), Natural Science Foundation of brain injury after ICH induction and the underlying Guangdong (No. 2014A030313346 and 5300468), and the Guangdong molecular mechanisms of these beneficial effects are Provincial Clinical Medical Centre for Neurosurgery (No. 2013B020400005). involved in the regulation of ROS and/or NF-κBon the activation of NLRP3 inflammasome pathway by Availability of data and materials the triggering of Nrf2 activity and Nrf2-induced anti- Please contact author for data requests. oxidant system. In addition, our experimental results might provide a novel therapeutical strategy for ICH. Authors’ contributions YZC and JZ conceived and designed the experiments. JZ performed the experiments. YZC and JZ analyzed the data. JZ wrote the paper. YZC, RD, LF, SY, XQD, ZHF, ZCX, and SZZ contributed to the paper revision, provided Additional files experimental technical support, and assisted in completing the study at different stages. All authors read and approved the final manuscript. Additional file 1: Experimental design and groups (a-c). MRI and Hematoma Volume Evaluation (d). The captions of Additional file 2 and 3 Competing interests (e). (PDF 235 kb) The authors declare that they have no competing interests. Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 18 of 19 Ethics approval 15. Zhao X, Sun G, Zhang J, Strong R, Dash PK, Kan YW, Grotta JC, Aronowski J. All experimental procedures and animal care were approved by the Transcription factor Nrf2 protects the brain from damage produced by Southern Medical University Ethics Committee and were conducted in intracerebral hemorrhage. Stroke. 2007;38:3280–6. accordance with the guidelines of the National Institutes of Health on the 16. Yuan B, Shen H, Lin L, Su T, Zhong S, Yang Z. Recombinant adenovirus care and use of animals. encoding NLRP3 RNAi attenuate inflammation and brain injury after intracerebral hemorrhage. J Neuroimmunol. 2015;287:71–5. 17. Feng L, Chen Y, Ding R, Fu Z, Yang S, Deng X, Zeng J. P2X7R blockade prevents Publisher’sNote NLRP3 inflammasome activation and brain injury in a rat model of intracerebral Springer Nature remains neutral with regard to jurisdictional claims in hemorrhage: involvement of peroxynitrite. J Neuroinflammation. 2015;12:190. published maps and institutional affiliations. 18. Liu X, Zhang X, Ding Y, Zhou W, Tao L, Hu R. Nuclear factor E2-related factor-2 (Nrf2) negatively regulates NLRP3 inflammasome activity by Author details inhibiting reactive oxygen species (ROS)-induced NLRP3 priming. Antioxid Department of Neurosurgery, Zhujiang Hospital, The National Key Clinical Redox Signal. 2017;26(1):28–43. Specialty, The Neurosurgery Institute of Guangdong Province, Guangdong 19. Rzepecka J, Pineda MA, Al-Riyami L, Rodgers DT, Huggan JK, Lumb FE, Khalaf Provincial Key Laboratory on Brain Function Repair and Regeneration, The AI, Meakin PJ, Corbet M, Ashford ML, et al. Prophylactic and therapeutic Engineering Technology Research Center of Education Ministry of China, treatment with a synthetic analogue of a parasitic worm product prevents Southern Medical University, Guangzhou 510282, China. Department of experimental arthritis and inhibits IL-1beta production via NRF2-mediated Neurosurgery, Jingmen No. 1 People’s Hospital, Jingmen 448000, Hubei, counter-regulation of the inflammasome. J Autoimmun. 2015;60:59–73. China. Department of Neurosurgery, Affiliated Hospital of Xiangnan 20. Peng F, Du Q, Peng C, Wang N, Tang H, Xie X, Shen J, Chen J. A review: the University, Chenzhou 423000, Hunan, China. Department of Neurosurgery, pharmacology of isoliquiritigenin. Phytother Res. 2015;29:969–77. The Fifth Affiliated Hospital of Southern Medical University, Guangzhou 21. Gnanaguru G, Choi AR, Amarnani D, D’Amore PA. Oxidized lipoprotein uptake 510900, Guangdong, China. Department of Neurosurgery, Gaoqing Campus through the CD36 receptor activates the NLRP3 inflammasome in human of Central Hospital of Zibo, Gaoqing People’s Hospital, Gaoqing, Zibo 256300, retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 2016;57:4704–12. Shandong, China. Department of Neurosurgery, 999 Brain Hospital, Jinan 22. Honda H, Nagai Y, Matsunaga T, Okamoto N, Watanabe Y, Tsuneyama K, University, Guangzhou 510510, Guangdong, China. Hayashi H, Fujii I, Ikutani M, Hirai Y, et al. Isoliquiritigenin is a potent inhibitor of NLRP3 inflammasome activation and diet-induced adipose Received: 14 February 2017 Accepted: 5 June 2017 tissue inflammation. J Leukoc Biol. 2014;96:1087–100. 23. Liu S, Zhu L, Zhang J, Yu J, Cheng X, Peng B. Anti-osteoclastogenic activity of isoliquiritigenin via inhibition of NF-kappaB-dependent autophagic pathway. Biochem Pharmacol. 2016;106:82–93. References 24. Kwon HM, Choi YJ, Choi JS, Kang SW, Bae JY, Kang IJ, Jun JG, Lee SS, Lim 1. Keep RF, Hua Y, Xi G. Intracerebral haemorrhage: mechanisms of injury and SS, Kang YH. Blockade of cytokine-induced endothelial cell adhesion therapeutic targets. Lancet Neurol. 2012;11:720–31. molecule expression by licorice isoliquiritigenin through NF-kappaB signal 2. Adeoye O, Broderick JP. Advances in the management of intracerebral disruption. Exp Biol Med (Maywood). 2007;232:235–45. hemorrhage. Nat Rev Neurol. 2010;6:593–601. 25. Wu Y, Chen X, Ge X, Xia H,WangY,SuS,LiW,YangT,Wei M, ZhangH,etal. 3. Chen S, Yang Q, Chen G, Zhang JH. An update on inflammation in the Isoliquiritigenin prevents the progression of psoriasis-like symptoms by inhibiting acute phase of intracerebral hemorrhage. Transl Stroke Res. 2015;6:4–8. NF-kappaB and proinflammatory cytokines. J Mol Med (Berl). 2016;94:195–206. 4. Zhou Y, Wang Y, Wang J, Anne SR, Yang QW. Inflammation in intracerebral 26. Denzer I, Munch G, Pischetsrieder M, Friedland K. S-allyl-L-cysteine and hemorrhage: from mechanisms to clinical translation. Prog Neurobiol. 2014; isoliquiritigenin improve mitochondrial function in cellular models of 115:25–44. oxidative and nitrosative stress. Food Chem. 2016;194:843–8. 5. Hu X, Tao C, Gan Q, Zheng J, Li H, You C. Oxidative stress in intracerebral 27. Foresti R, Bains SK, Pitchumony TS, de Castro BL, Drago F, Dubois-Rande JL, hemorrhage: sources, mechanisms, and therapeutic targets. Oxid Med Cell Bucolo C, Motterlini R. Small molecule activators of the Nrf2-HO-1 Longev. 2016;2016:3215391. antioxidant axis modulate heme metabolism and inflammation in BV2 6. Broderick JP, Brott TG, Duldner JE, Tomsick T, Huster G. Volume of microglia cells. Pharmacol Res. 2013;76:132–48. intracerebral hemorrhage. A powerful and easy-to-use predictor of 30-day 28. Gong H, Zhang BK, Yan M, Fang PF, Li HD, Hu CP, Yang Y, Cao P, Jiang P, mortality. Stroke. 1993;24:987–93. Fan XR. A protective mechanism of licorice (Glycyrrhiza uralensis): 7. Duan X, Wen Z, Shen H, Shen M, Chen G. Intracerebral hemorrhage, isoliquiritigenin stimulates detoxification system via Nrf2 activation. J oxidative stress, and antioxidant therapy. Oxid Med Cell Longev. 2016;2016: Ethnopharmacol. 2015;162:134–9. 29. Park SM, Lee JR, Ku SK, Cho IJ, Byun SH, Kim SC, Park SJ, Kim YW. 8. Ma Q, Chen S, Hu Q, Feng H, Zhang JH, Tang J. NLRP3 inflammasome Isoliquiritigenin in licorice functions as a hepatic protectant by induction of contributes to inflammation after intracerebral hemorrhage. Ann Neurol. antioxidant genes through extracellular signal-regulated kinase-mediated 2014;75:209–19. NF-E2-related factor-2 signaling pathway. Eur J Nutr. 2016;55(8):2431–44. 9. Denzer I, Munch G, Friedland K. Modulation of mitochondrial dysfunction in 30. Rosenberg GA, Mun-Bryce S, Wesley M, Kornfeld M. Collagenase-induced neurodegenerative diseases via activation of nuclear factor erythroid-2-related intracerebral hemorrhage in rats. Stroke. 1990;21:801–7. factor 2 by food-derived compounds. Pharmacol Res. 2016;103:80–94. 31. Xue F, Huang JW, Ding PY, Zang HG, Kou ZJ, Li T, Fan J, Peng ZW, Yan WJ. 10. Calkins MJ, Johnson DA, Townsend JA, Vargas MR, Dowell JA, Williamson TP, Nrf2/antioxidant defense pathway is involved in the neuroprotective effects Kraft AD, Lee JM, Li J, Johnson JA. The Nrf2/ARE pathway as a potential of Sirt1 against focal cerebral ischemia in rats after hyperbaric oxygen therapeutic target in neurodegenerative disease. Antioxid Redox Signal. preconditioning. Behav Brain Res. 2016;309:1–8. 2009;11:497–508. 32. Dang B, Li H, Xu X, Shen H, Wang Y, Gao A, He W, Wang Z, Chen G. 11. Shang H, Yang D, Zhang W, Li T, Ren X, Wang X, Zhao W. Time course of Cyclophilin A/cluster of differentiation 147 interactions participate in early brain Keap1-Nrf2 pathway expression after experimental intracerebral injury after subarachnoid hemorrhage in rats. Crit Care Med. 2015;43:e369–81. haemorrhage: correlation with brain oedema and neurological deficit. Free 33. Chen J, Li Y, Wang L, Zhang Z, Lu D, Lu M, Chopp M. Therapeutic benefit of Radic Res. 2013;47:368–75. intravenous administration of bone marrow stromal cells after cerebral 12. Iniaghe LO, Krafft PR, Klebe DW, Omogbai EK, Zhang JH, Tang J. Dimethyl ischemia in rats. Stroke. 2001;32:1005–11. fumarate confers neuroprotection by casein kinase 2 phosphorylation of Nrf2 in murine intracerebral hemorrhage. Neurobiol Dis. 2015;82:349–58. 34. Chen J, Sanberg PR, Li Y, Wang L, Lu M, Willing AE, Sanchez-Ramos J, 13. Zhao X, Sun G, Zhang J, Ting SM, Gonzales N, Aronowski J. Dimethyl Chopp M. Intravenous administration of human umbilical cord blood fumarate protects brain from damage produced by intracerebral reduces behavioral deficits after stroke in rats. Stroke. 2001;32:2682–8. hemorrhage by mechanism involving Nrf2. Stroke. 2015;46:1923–8. 35. Ding R, Feng L, He L, Chen Y, Wen P, Fu Z, Lin C, Yang S, Deng X, Zeng J, 14. Wang J, Fields J, Zhao C, Langer J, Thimmulappa RK, Kensler TW, Yamamoto Sun G. Peroxynitrite decomposition catalyst prevents matrix M, Biswal S, Dore S. Role of Nrf2 in protection against intracerebral metalloproteinase-9 activation and neurovascular injury after hemoglobin hemorrhage injury in mice. Free Radic Biol Med. 2007;43:408–14. injection into the caudate nucleus of rats. Neuroscience. 2015;297:182–93. Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 19 of 19 36. Ding R, Chen Y, Yang S, Deng X, Fu Z, Feng L, Cai Y, Du M, Zhou Y, Tang Y. 58. Zhu L, Wei H, Wu Y, Yang S, Xiao L, Zhang J, Peng B. Licorice isoliquiritigenin Blood-brain barrier disruption induced by hemoglobin in vivo: Involvement suppresses RANKL-induced osteoclastogenesis in vitro and prevents of up-regulation of nitric oxide synthase and peroxynitrite formation. Brain inflammatory bone loss in vivo. Int J Biochem Cell Biol. 2012;44:1139–52. Res. 2014;1571:25–38. 59. Watanabe Y, Nagai Y, Honda H, Okamoto N, Yamamoto S, Hamashima T, 37. Yang F, Wang Z, Zhang JH, Tang J, Liu X, Tan L, Huang QY, Feng H. Receptor Ishii Y, Tanaka M, Suganami T, Sasahara M, et al. Isoliquiritigenin attenuates for advanced glycation end-product antagonist reduces blood-brain barrier adipose tissue inflammation in vitro and adipose tissue fibrosis through damage after intracerebral hemorrhage. Stroke. 2015;46:1328–36. inhibition of innate immune responses in mice. Sci Rep. 2016;6:23097. 60. Sharma D, Kanneganti TD. The cell biology of inflammasomes: mechanisms 38. Belayev L, Busto R, Zhao W, Ginsberg MD. Quantitative evaluation of blood- of inflammasome activation and regulation. J Cell Biol. 2016;213:617–29. brain barrier permeability following middle cerebral artery occlusion in rats. 61. Lamkanfi M, Dixit VM. Mechanisms and functions of inflammasomes. Cell. Brain Res. 1996;739:88–96. 2014;157:1013–22. 39. Uyama O, Okamura N, Yanase M, Narita M, Kawabata K, Sugita M. 62. Zhang Z, Zhang Z, Lu H, Yang Q, Wu H, Wang J. Microglial polarization and Quantitative evaluation of vascular permeability in the gerbil brain after inflammatory mediators after intracerebral hemorrhage. Mol Neurobiol. transient ischemia using Evans blue fluorescence. J Cereb Blood Flow 2017;54:1874–86. Metab. 1988;8:282–4. 63. Babu R, Bagley JH, Di C, Friedman AH, Adamson C. Thrombin and hemin as 40. Yang S, Chen Y, Deng X, Jiang W, Li B, Fu Z, Du M, Ding R. Hemoglobin- central factors in the mechanisms of intracerebral hemorrhage-induced induced nitric oxide synthase overexpression and nitric oxide production secondary brain injury and as potential targets for intervention. Neurosurg contribute to blood-brain barrier disruption in the rat. J Mol Neurosci. 2013; Focus. 2012;32:E8. 51:352–63. 64. Hua Y, Keep RF, Hoff JT, Xi G. Brain injury after intracerebral hemorrhage: 41. Schmued LC, Stowers CC, Scallet AC, Xu L. Fluoro-Jade C results in ultra the role of thrombin and iron. Stroke. 2007;38:759–62. high resolution and contrast labeling of degenerating neurons. Brain Res. 65. Choi SH, Kim YW, Kim SG. AMPK-mediated GSK3beta inhibition by 2005;1035:24–31. isoliquiritigenin contributes to protecting mitochondria against iron- 42. Min H, Jang YH, Cho IH, Yu SW, Lee SJ. Alternatively activated brain- catalyzed oxidative stress. Biochem Pharmacol. 2010;79:1352–62. infiltrating macrophages facilitate recovery from collagenase-induced 66. Wan S, Cheng Y, Jin H, Guo D, Hua Y, Keep RF, Xi G. Microglia activation intracerebral hemorrhage. Mol Brain. 2016;9:42. and polarization after intracerebral hemorrhage in mice: the role of 43. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using protease-activated receptor-1. Transl Stroke Res. 2016;7(6):478–87. real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 67. Zuo D, Ye X, Yu L, Zhang L, Tang J, Cui C, Bao L, Zan K, Zhang Z, Yang X, 2001;25:402–8. et al. ROS/TXNIP pathway contributes to thrombin induced NLRP3 44. Mracsko E, Veltkamp R. Neuroinflammation after intracerebral hemorrhage. inflammasome activation and cell apoptosis in BV2 cells. Biochem Biophys Front Cell Neurosci. 2014;8:388. Res Commun. 2017;485(2):499–505. 45. Qu J, Chen W, Hu R, Feng H. The injury and therapy of reactive oxygen species in intracerebral hemorrhage looking at mitochondria. Oxid Med Cell Longev. 2016;2016:2592935. 46. Ziai WC. Hematology and inflammatory signaling of intracerebral hemorrhage. Stroke. 2013;44:S74–8. 47. Jang EY, Choe ES, Hwang M, Kim SC, Lee JR, Kim SG, Jeon JP, Buono RJ, Yang CH. Isoliquiritigenin suppresses cocaine-induced extracellular dopamine release in rat brain through GABA(B) receptor. Eur J Pharmacol. 2008;587:124–8. 48. Jeon JP, Buono RJ, Han BG, Jang EY, Kim SC, Yang CH, Hwang M. Proteomic and behavioral analysis of response to isoliquiritigenin in brains of acute cocaine treated rats. J Proteome Res. 2008;7:5094–102. 49. Lee MJ, Yang CH, Jeon JP, Hwang M. Protective effects of isoliquiritigenin against methamphetamine-induced neurotoxicity in mice. J Pharmacol Sci. 2009;111:216–20. 50. Zhan C, Yang J. Protective effects of isoliquiritigenin in transient middle cerebral artery occlusion-induced focal cerebral ischemia in rats. Pharmacol Res. 2006;53:303–9. 51. Hwang CK, Chun HS. Isoliquiritigenin isolated from licorice Glycyrrhiza uralensis prevents 6-hydroxydopamine-induced apoptosis in dopaminergic neurons. Biosci Biotechnol Biochem. 2012;76:536–43. 52. Yang EJ, Min JS, Ku HY, Choi HS, Park MK, Kim MK, Song KS, Lee DS. Isoliquiritigenin isolated from Glycyrrhiza uralensis protects neuronal cells against glutamate-induced mitochondrial dysfunction. Biochem Biophys Res Commun. 2012;421:658–64. 53. Mogami S, Sadakane C, Nahata M, Mizuhara Y, Yamada C, Hattori T, Takeda H. CRF receptor 1 antagonism and brain distribution of active components contribute to the ameliorative effect of rikkunshito on stress-induced anorexia. Sci Rep. 2016;6:27516. Submit your next manuscript to BioMed Central 54. Luo Y, Eggler AL, Liu D, Liu G, Mesecar AD, van Breemen RB. Sites of alkylation of human Keap1 by natural chemoprevention agents. J Am Soc and we will help you at every step: Mass Spectrom. 2007;18:2226–32. • We accept pre-submission inquiries 55. Lee SH, Kim JY, Seo GS, Kim YC, Sohn DH. Isoliquiritigenin, from Dalbergia odorifera, up-regulates anti-inflammatory heme oxygenase-1 expression in � Our selector tool helps you to find the most relevant journal RAW264.7 macrophages. Inflamm Res. 2009;58:257–62. � We provide round the clock customer support 56. Wang R, Zhang CY, Bai LP, Pan HD, Shu LM, Kong AN, Leung EL, Liu L, Li T. � Convenient online submission Flavonoids derived from liquorice suppress murine macrophage activation by up-regulating heme oxygenase-1 independent of Nrf2 activation. Int � Thorough peer review Immunopharmacol. 2015;28:917–24. � Inclusion in PubMed and all major indexing services 57. Honda H, Nagai Y, Matsunaga T, Saitoh S, Akashi-Takamura S, Hayashi H, � Maximum visibility for your research Fujii I, Miyake K, Muraguchi A, Takatsu K. Glycyrrhizin and isoliquiritigenin suppress the LPS sensor toll-like receptor 4/MD-2 complex signaling in a Submit your manuscript at different manner. J Leukoc Biol. 2012;91:967–76. www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Neuroinflammation Springer Journals

Isoliquiritigenin alleviates early brain injury after experimental intracerebral hemorrhage via suppressing ROS- and/or NF-κB-mediated NLRP3 inflammasome activation by promoting Nrf2 antioxidant pathway

Download PDF
19 pages

Loading next page...
 
/lp/springer-journals/isoliquiritigenin-alleviates-early-brain-injury-after-experimental-V4CZ732w5C

References (63)

Publisher
Springer Journals
Copyright
Copyright © 2017 by The Author(s).
Subject
Biomedicine; Neurosciences; Neurology; Neurobiology; Immunology
eISSN
1742-2094
DOI
10.1186/s12974-017-0895-5
pmid
28610608
Publisher site
See Article on Publisher Site

Abstract

Background: Intracerebral hemorrhage (ICH) induces potently oxidative stress responses and inflammatory processes. Isoliquiritigenin (ILG) is a flavonoid with a chalcone structure and can activate nuclear factor erythroid-2 related factor 2 (Nrf2)-mediated antioxidant system, negatively regulate nuclear factor-κB (NF-κB) and nod-like receptor family, pyrin domain-containing 3 (NLRP3) inflammasome pathways, but its role and potential molecular mechanisms in the pathology following ICH remain unclear. The present study aimed to explore the effects of ILG after ICH and underlying mechanisms. Methods: ICH model was induced by collagenase IV (0.2 U in 1 μl sterile normal saline) in male Sprague-Dawley rats weighing 280–320 g. Different doses of ILG (10, 20, or 40 mg/kg) was administrated intraperitoneally at 30 min, 12 h, 24 h, and 48 h after modeling, respectively. Rats were intracerebroventricularly administrated with control scramble small interfering RNA (siRNA) or Nrf2 siRNA at 24 h before ICH induction, and after 24 h, ICH model was established with or without ILG (20 mg/kg) treatment. All rats were dedicated at 24 or 72 h after ICH. Neurological deficits, histological damages, brain water content (BWC), blood-brain barrier (BBB) disruption, and neuronal degeneration were evaluated; quantitative real-time RT-PCR (qRT-PCR), immunohistochemistry/immunofluorescence, western blot, and enzyme-linked immunosorbent assay (ELISA) were carried out; catalase, superoxide dismutase activities and reactive oxygen species (ROS), and glutathione/oxidized glutathione contents were measured. (Continued on next page) * Correspondence: [email protected] Department of Neurosurgery, Zhujiang Hospital, The National Key Clinical Specialty, The Neurosurgery Institute of Guangdong Province, Guangdong Provincial Key Laboratory on Brain Function Repair and Regeneration, The Engineering Technology Research Center of Education Ministry of China, Southern Medical University, Guangzhou 510282, China Full list of author information is available at the end of the article © The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 2 of 19 (Continued from previous page) Results: ILG (20 and 40 mg/kg) markedly alleviated neurological deficits, histological damages, BBB disruption, brain edema, and neuronal degeneration, but there was no significant difference between two dosages. ILG (20 mg/kg) significantly suppressed the NF-κB and NLRP3 inflammasome pathways and activated Nrf2-mediated antioxidant system. Gene silencing of Nrf2 aggravated the neurological deficits, brain edema, and neuronal degeneration and increased the protein levels of NF-κB p65, NLRP3 inflammasome components, and IL-1β. ILG delivery significantly attenuated the effects of Nrf2 siRNA interference mentioned above. Conclusions: Intraperitoneal administration of ILG after ICH reduced early brain impairments and neurological deficits, and the mechanisms were involved in the regulation of ROS and/or NF-κB on the activation of NLRP3 inflammasome pathway by the triggering of Nrf2 activity and Nrf2-induced antioxidant system. In addition, our experimental results may make ILG a potential candidate for a novel therapeutical strategy for ICH. Keywords: ICH, Early brain injury, ILG, Nrf2, ROS, NF-κB, NLRP3 inflammasome Background identified to hold the neuroprotective effects against the Spontaneous intracerebral hemorrhage (ICH) belongs to a early brain injury after ICH by translocating into nucleus fatal cerebrovascular disorder, accounting for 15 to 20% in after being activated, binding to the antioxidant response all stroke types, commonly accompanied with high mor- element (ARE), then initiating the expression of a series bidity and mortality [1, 2]. Brain injury after ICH is of antioxidant and detoxification enzymes and proteins, broadly classified as primary brain injury and secondary as a result, improving neurological deficits, alleviating brain injury [3, 4]. Primary brain injury occurring within brain edema, and decreasing the infiltration of inflam- first several hours post ICH is caused by the hemorrhage matory cells [11–15]. and growth of hematoma which lead to the mechanical The NLRP3 (NALP3, cryopyrin) inflammasome [NLR impairments and compression of adjacent cerebrovascular (Nod-like receptor) family, pyrin domain-containing 3 architecture [1, 3–5]. Hematoma size is a powerful and inflammasome], a best characterized member of NLR easy-to-use predictor of 30-day mortality and morbidity in family and one of the key components of innate immune patients with ICH, and large hemorrhage often indicates a system, has been reported by others [8, 16] and us [17] to poor prognosis [4, 6]. Blood components extravasated take part in the processes of early brain injury after ICH from the ruptured blood vessels and degradation products via facilitating caspase-1 and interleukin-1beta (IL-1β) of blood cells can induce severe secondary brain injury processing, which amplifies the inflammatory response including neurobehavioral deterioration, brain cell death, and blockade or knockdown of NLRP3 inflammasome can cerebral edema, and blood-brain barrier (BBB) disruption alleviate the brain damages [8, 16, 17]. Recently, reports [1, 3–5]. Though the understanding of pathophysiological have indicated that Nrf2 could negatively regulate NLRP3 mechanisms to brain injury after ICH has been well im- inflammasome activity by inhibiting reactive oxygen proved in recent decades, there are still no effective ther- species (ROS)-induced NLRP3 inflammasome activation apies being available for the prevention of ICH-induced [18, 19]. However, the relationship between Nrf2 antioxi- brain impairments [3–5, 7]. Furthermore, increasing dant pathway and NLRP3 inflammasome activation and evidences have shown that inflammatory response and whether Nrf2 reduces the early brain injury via the oxidative stress which occur following ICH play a key role suppression of NLRP3 inflammasome and whether the in pathophysiological processes of ICH-induced early above-mentioned inhibitory effect is involved in Nrf2 brain dysfunctions [3–5, 7, 8]. mediated ROS and/or nuclear factor-κB(NF-κB) sup- Nuclear factor erythroid-2 related factor 2 (Nrf2) is a pression have not beenexploredintheexperimental rat key transcription factor and master regulator of the ICH model. cellular response of oxidative stress, which can induce Isoliquiritigenin (ILG), a component of Glycyrrhiza the expression of antioxidant and detoxification enzymes uralensis (G. uralensis), is a flavonoid with a chalcone and downstream proteins such as NAD(P)H: quinone structure and it holds multiple biological activities [20]. oxidoreductase-1 (NQO1), catalase (CAT), superoxide Recent papers have shown that ILG was a potent in- dismutase (SOD), heme oxygenase-1 (HO-1), glutathi- hibitor of NLRP3 inflammasome [21, 22] and NF-κB one peroxidase (GPX), and glutathione-S-transferase [23–25],thusexertingaprotective effect.Also,there (GST) [9, 10]. Recent study report showed that the were reports showing that ILG could activate Nrf2- expression of Nrf2 was gradually increased following mediated antioxidant pathway via promoting Nrf2 trans- ICH at 2 h, peaked at 24 h, and then slightly decreased location into the nucleus and then initiating a series of with time until 10 days [11]. In addition, Nrf2 has been genes to express [9, 26–29]. However, it remains unclear Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 3 of 19 whether ILG has a protective effect against the early glutathione (GSH/GSSG) contents, ROS content, CAT brain injury following ICH, and the detailed molecu- activity, and SOD activity analyses (n =6). lar mechanisms have not been elucidated. Thus, in In the third experiment, 132 rats were used (132 of 137 this study, we are attempting to explore the effects of rats after the surgery survived) to execute the study on ef- ILG on the early brain injury after an experimental fects of Nrf2 small interfering RNA (siRNA) interference rat intracerebral hemorrhage model and the potential and Nrf2 siRNA together with ILG co-administration on molecular mechanisms. early brain injury following ICH. The rats were randomly divided into six groups (sham group, ICH + vehicle-2 TM Methods [mixtures of Entranster in vivo transfection reagent and Animals siRNA diluent (RNase-free H O)] group, ICH + control Adult male Sprague-Dawley rats (SD rats) weighing be- scramble siRNA group, ICH + Nrf2 siRNA group, ICH + tween 280 and 320 g (8–10 weeks) were obtained from Nrf2 siRNA + vehicle-1 group, ICH + Nrf2 siRNA + ILG the Animal Experiment Center of Southern Medical 20 mg/kg group). All rats were decapitated to perform re- University. All experimental procedures and animal care lated RT-qPCR (n = 6), WB (n = 6), mNSS scoring (n =6), were approved by the Southern Medical University Ethics BWC (n = 6), FJC staining analyses (n =6). Committee and were conducted in accordance with the guidelines of the National Institutes of Health on the care ICH model and use of animals. All rats were housed in a light-, The procedure for ICH model in rats has been described temperature-, and humidity-controlled specific pathogen- in previous publications with some small modifications free (SPF) environment (under a 12-h light/dark cycle [17, 30]. In brief, the rats were anesthetized by intraperi- with constant temperature about 25 °C and relative toneal injection (i.p.) of pentobarbital sodium (45 mg/ humidity approximating 55%). All rats had free access to kg). Then, the animals were placed in a rat brain stereo- standard food and water during the experiments. taxic apparatus and under aseptic condition. Rectal temperature was maintained at 37 °C throughout the Experimental design and groups surgical procedure using an insulation board connected Experiments were conducted in a rat model of collagenase with water bath circulation system. Next, a midline inci- type IV-induced ICH. In the first experiment, 180 rats sion on the scalp to expose the skull and bregma and a were used (183 rats suffered to the surgery, 180 rats cranial burr hole (1 mm in diameter) was drilled in the survived) to evaluate the effects of ILG on the early brain right part of the brain, a 5-μl microsyringe with a needle injury post ICH. The rats were randomly and evenly tip (Shanghai high pigeon industry & trade co., LTD, assigned to five groups of 36 rats each, namely, sham Shanghai, China) was inserted stereotactically through group, ICH + vehicle-1 [dimethylsulfoxide (DMSO)] the burr hole and into the right striatum which coordi- group, ICH + ILG 10 mg/kg group, ICH + ILG 20 mg/kg nates were 0.1 mm anterior, 3.5 mm lateral, and 6.0 mm group, and ICH + ILG 40 mg/kg group. All rats in this ventral to the bregma. Collagenase type IV (0.2 U in 1 μl experiment were evaluated with a Modified Neurological sterile normal saline) was administrated over a period of Severity Score (mNSS) (n = 12) scale at 24 or 72 h after 10 min via stereotaxic intrastriatal injection. The needle ICH, except for the rats that perform extravasation detec- was kept in situ for an additional 10 min to prevent tion of Evans blue (EB) dyes (n=6) at the same time back-flow. Then, the microsyringe was slowly removed points. Then, the rats were killed, and brain tissue samples and the craniotomy was sealed with bone wax. Finally, were taken to perform brain water content (BWC) mea- the wound was sutured. The sham-operated rats were surements (n = 6), hematoxylin and eosin (H&E) staining treated via the same way except that they were adminis- (n = 6), and Fluoro-Jade® C (FJC) staining (n =6). trated 1 μl sterile normal saline into the right striatum. In the second experiment, 120 rats were used (122 rats The rats were allowed to recover in separate cages with experienced the operation, 120 rats survived) to explore free access to food and water. the underlying molecular mechanisms of ILG’s effects on the early brain injury after ICH. The rats were randomized In vivo siRNA transfection and drug delivery into four groups (30 rats per group): sham group, ICH The transfection of Nrf2 siRNA for rat brains in vivo group, ICH + vehicle-1 (DMSO) group, and ICH + ILG were conducted according to the method described 20 mg/kg group. All rats in the experiment were sacrificed formerly [17, 31, 32]. Briefly, the rats were placed under at 24 h after ICH for real-time reverse transcription- anesthesia, then a cranial burr hole (1 mm in diameter) quantitative polymerase chain reaction (RT-qPCR) (n =6), was drilled, following a 25-μl microsyringe with a nee- western blot (WB) (n = 6), immunohistochemistry (IHC)/ dle tip (Shanghai high pigeon industry & trade co., immunofluorescence (IF) (n = 6), enzyme-linked immuno- LTD, Shanghai, China) was inserted stereotaxically into sorbent assay (ELISA) (n = 6), and glutathione/oxidized the right lateral ventricle. The stereotaxic coordinates Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 4 of 19 were 1.5 mm posterior, 1.0 mm lateral, and 3.2 mm extravasation, as described previously with minor modi- below the horizontal plane of the bregma [32]. Nrf2 fications [38–40]. Briefly, the rats were anesthetized and siRNA (sc-156128, Santa Cruz biotechnology, USA) administrated intravenously 2% EB solution in normal and control scramble siRNA (sc-37007, Santa Cruz Bio- saline (4 ml/kg) by the femoral vein. After a circulation technology, USA) were applied with in vivo transfection of 2 h, intracardiac perfusion was performed under deep TM reagent (Entranster -in vivo, 18668-11-1, Engreen anesthesia with 0.01 M phosphate buffer solution (PBS) BiosystemCo, Ltd.,Beijing,China)at24hbefore mod- (pH 7.4) of 250 ml to clear EB dyes in cerebral circula- eling by intracerebroventricular injection [31, 32]. The tion. Subsequently, the brains were removed and the microsyringe was left in place for an additional 10 min brain samples were immediately separated into the left after administration and then slowly withdrawn. At last, hemisphere and right hemisphere. Tissue samples were the incision was closed with sutures. The sham-operated then incubated in 50% trichloroacetic acid solution rats received a cranial burr hole, but only a needle was (2 ml). Following homogenization and centrifugation inserted. (15,000 rpm for 20 min), the supernatant (1 ml) was ILG (1811912, Shanghai Macklin Biochemical Co., Ltd., diluted with ethanol (1: 3), and its fluorescence intensity Shanghai, China) was dissolved into DMSO (D5879, was measured at an excitation wavelength of 620 nm Sigma-Aldrich) solution (20 mg/ml). The rats were and an emission wavelength of 680 nm with an automatic administrated intraperitoneally with either ILG at 10, 20, microplate reader. The EB dye leakage was expressed as and 40 mg/kg or the same volume of DMSO at 30 min, micrograms per gram brain weight. 12 h, 24 h, and 48 h after ICH induction. Preparation of paraffin-embedded sections Behavioral assessment Paraffin-embedded sections were made as previously We used a mNSS scale [33, 34] to assess the behavioral described [17, 35, 40] with some modifications. After deficits at 24 h and 72 h after ICH, which was performed deep anesthetization with pentobarbital sodium, the rats by two trained investigators and both of whom had been were transcardially perfused with 250 ml of 0.01 M PBS blinded to animal grouping. The mNSS is consisted of (pH 7.4) followed by 500 ml 4% paraformaldehyde solu- motor, sensory, balance, and reflex tests. Neurological tion. And then, the brains were removed and post-fixed function is graded via the scale of 0–18 points (1–6, by immersion in the same fixative solution at 4 °C for mild injury; 7–12, moderate injury; 13–18, severe injury; 24–48 h. After dehydration and vitrification, tissue sam- the scores of 0 and 18 represent normal performance ples were embedded in paraffin, and 4-μm sections were and severe neurological deficit, respectively). In the se- prepared. The sections were then dewaxed in xylene, re- verity scores of neurological function injury, 1 score hydrated in graded ethanol and deionized water, and point is obtained for the incapacity to complete the test then processed for H&E, IHC, IF, and FJC staining. or the absence of a tested reflex. Thus, a higher score in- dicates a more severe neurological injury [33–35]. H&E staining The coronal brain sections (4-μm thickness, paraffin- Measurement of BWC embedded) were prepared as mentioned above, then BWC was evaluated via a wet/dry weight method, as were stained with eosin for 10 s followed by hematoxylin previously described [36, 37]. Briefly, at 24 or 72 h after re-staining for 5 min. After dehydrated in graded ethanol ICH, the rats were deeply anesthetized with an i.p. of and cleared in xylene, slides were mounted by neutral pentobarbital sodium and then were decapitated. The balsam. Images were obtained using a microscope brain of the rats were immediately removed and sepa- (Leica-DM2500, Germany). rated into five parts, namely ipsilateral and contralateral cortex, ipsilateral and contralateral basal ganglia, and IHC staining cerebellum. The cerebellum was used as an internal IHC staining was conducted as described previously control. Each part was placed on a pre-weighed piece of [35, 36] with a few modifications. Coronal paraffin- aluminum foil and obtained the wet weight by an elec- embedded brain sections (4-μmthickness) were prepared tric analytic balance, and then was dried at 100 °C for as before-mentioned and antigen retrieval was performed 24 h in an electric oven to get the dry weight. BWC was by heat treatment in a microwave oven for 21 min in assessed using the following formula: [(wet weight − dry Tris–ethylene diamine tetraacetic acid (EDTA) buffer weight)]/(wet weight) × 100%. solution (0.05 mol/l Tris, 0.001 mol/l EDTA; pH 8.5). Endogenous peroxidase activity was inactivated using Evaluation of BBB permeability 0.3% H O for 10 min followed by washing with PBS. 2 2 Quantitative analysis of BBB permeability was evaluated After blocking by 5% bovine serum albumin (BSA) for via EB dye (Wako Pure Chemical Industries, Ltd., Japan) 20 min, the slides were incubated overnight at 4 °C with Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 5 of 19 the following primary antibodies used: rabbit monoclonal cleared in xylene for 5 min and then coverslipped with anti-NF-κB p65 (D14E12) XP® antibody (1:800, #8242, Cell DPX mountant for histology (06522-100 ml, Sigma). Four Signaling Technology); rabbit polyclonal anti-Nrf2 (L593) high-power images (×400 magnification) were taken around antibody (1:200, BS1258, Bioworld); rabbit polyclonal anti- hematoma using a fluorescence microscope (ZEISS-AXIO HO-1 antibody (1:200, BS6626, Bioworld); goat polyclonal Scope, Al, Germany) in each slide. FJC staining positive anti-NQO1 antibody (1:200, ab2346, Abcam); mouse cells were counted on these four areas. monoclonal anti-Cryopyrin (NLRP3) (6F12) antibody (1:100, sc-134306, Santa Cruz Biotechnology); mouse Real-time RT-qPCR monoclonal anti-3-Nitrotyrosine (3-NT) antibody [39B6] Quantitative real-time RT-PCR assessment for the mes- (1:200, ab61392, Abcam); mouse monoclonal anti-8- senger RNA (mRNA) levels was conducted via using Hydroxyguanosine (8-OHdG) antibody [N45.1] (1:200, Prime Script RT-PCR kits (RR047A and RR820A, Takara) ab48508, Abcam); rabbit polyclonal anti-Iba-1 antibody according to the manufacturer’s instructions. The mRNA (1:600, WAKO, Osaka, Japan); and mouse monoclonal level of β-actin was used as an internal control. The real- anti-CD68 antibody [ED1] (1:200, ab31630, Abcam). After time PCR program steps were 95 °C for 30 s, 40 cycles of washing with PBS, the sections were incubated with bio- 95 °C for 3 s, 60 °C for 34 s. The mRNA level of each tinylated goat anti-mouse IgG, goat anti-rabbit IgG, and target gene was normalized to that of β-actin mRNA. −ΔΔCT donkey anti-goat IgG secondary antibodies for 20 min and Fold-induction was calculated using the 2 method, then incubated with horseradish peroxidase (HRP)-strep- as previously described [42, 43]. The specific sequences of tavidin reagent for 20 min. Finally, immunoreactivity was primers used were shown as Table 1. detected using 3,3-diaminobenzidine (DAB), followed by re-staining with hematoxylin. Images were obtained by WB using a microscope (Leica-DM2500, Germany). The num- WB was performed according to our previous study ber of immunopositive cells in the perihematomal region method [17, 35]. We used the following primary anti- was counted in a blinded manner and was expressed as bodies to perform the WB analyses: rabbit monoclonal number/0.1 mm areas. anti-NF-κB p65 (D14E12) XP® antibody (1:1000, #8242, Cell Signaling Technology); rabbit polyclonal anti-Nrf2 IF staining (L593) antibody (1:500, BS1258, Bioworld); mouse IF staining was performed as described previously [17, 35] monoclonal anti-Cryopyrin (NLRP3) (6F12) antibody with a few modifications. Coronal paraffin-embedded 4- (1:1000, sc-134306, Santa Cruz Biotechnology); rabbit μm thickness brain sections were prepared as mentioned polyclonal anti-PYCARD (ASC) antibody (1:500, A1170, above. Antigen retrieval was conducted as IHC staining. Abclonal); goat polyclonal anti-caspase-1 p20 (M-19) After blocking by 5% BSA for 40 min, sections were incu- antibody(1:1000, sc-1218, Santa Cruz Biotechnology); bated overnight at 4 °C with the following primary anti- rabbit polyclonal anti-IL-1β (H-153) antibody (1: 1000, sc- body used: rabbit polyclonal anti-myeloperoxidase (MPO) 7884, Santa Cruz Biotechnology); and rabbit polyclonal antibody (1:50, ab9535, Abcam). After washing with PBS, anti-IL-18 (H-173) antibody (1:1000, sc-7954, Santa Cruz sections were then incubated with the secondary antibody: Biotechnology), and glyceraldehyde 3-phosphate dehydro- Alexa Fluor 594 goat anti-rabbit IgG (H + L) (1:100, A- genase (GAPDH) (1:1000, Cell Signaling Technology) was 11012, Invitrogen) for 1 h at room temperature. Following used as an internal reference. Blot bands were quantified washing three times with PBS, the sections were re-stained via densitometry with ImageJ software (National Institutes by 4′6-diamidino-2-phenylindole (DAPI) for 10 min. Then, of Health, Baltimore, MD, USA), and protein levels were images were obtained with a fluorescence microscope expressed as the ratio of values of the detected protein (ZEISS-AXIO Scope. Al, Germany). bands to that of GAPDH bands. Table 1 Primers used in real-time qRT-PCR reactions FJC staining Gene Forward primer (5′-3′) Reverse primer (5′-3′) For the detection of degenerating neuron, FJC staining NLRP3 CGGTGACCTTGTGTGTGCTT TCATGTCCTGAGCCATGGAAG was conducted as described previously with some modi- ASC GACAGTACCAGGCAGTTCGT AGTAGGGCTGTGTTTGCCTC fications [41]. Briefly, rat brain sections were prepared as Caspase-1 GAACAAAGAAGGTGGCGCAT AGACGTGTACGAGTGGGTGT mentioned above, then sections were rinsed with dis- tilled water and immersed into 0.06% potassium per- IL-1beta CCTATGTCTTGCCCGTGGAG CACACACTAGCAGGTCGTCA manganate solution for 10 min followed by transferred IL-18 ACCACTTTGGCAGACTTCACT ACACAGGCGGGTTTCTTTTG into a 0.0001% solution of FJC (AG325, Merck millipore) Nqo1 GTTTGCCTGGCTTGCTTTCA ACAGCCGTGGCAGAACTATC dissolved in 0.1% acetic acid vehicle for 30 min. After HO-1 GGTGATGGCCTCCTTGTACC GTGGGGCATAGACTGGGTTC washing with distilled water, the slides were put into an Actin TCAGCAAGCAGGAGTACGATG GTGTAAAACGCAGCTCAGTAACA oven at 50 °C for 20 min. The dried slides were then Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 6 of 19 Cytokine ELISA assay 8.92 ± 0.79 vs. 9.00 ± 0.95, p > 0.05, 72 h). However, ILG At 24 h after ICH, the rats were deeply anesthetized. obviously reduced the mNSS scores at 20 mg/kg The serum samples from intracardiac puncture blood (vehicle-DMSO vs. 20 mg/kg: vs. 8.25 ± 0.87, p < 0.01, and the supernatant samples from perihematomal brain 24 h; vs. 6.25 ± 1.06, p < 0.01, 72 h) and 40 mg/kg tissue homogenate were obtained and stored at −80 °C (vehicle-DMSO vs. 40 mg/kg: vs. 8.17 ± 0.94, p < 0.01, until use. Measurements of IL-1β and IL-18 levels were 24 h; vs. 6.83 ± 1.03, p < 0.01, 72 h), but the effects conducted by a double-antibody sandwich ELISA Array between two dosages were no significant difference (20 Kit according to the reagent manufacturer’s instructions. vs. 40 mg/kg, p > 0.05, 24 and 72 h) (Fig. 1b). Consistent Briefly, prepared tissue supernatant or serum samples with the behavioral results, H&E staining of brain tissues were added to monoclonal antibody enzyme well which surrounding the hematoma showed that ILG treatment is pre-coated with rats IL-1β or IL-18 antibodies labeled obviously improved histological impairments at the dos- with biotin and combined with Streptavidin-HRP to ages of 20 and 40 mg/kg, but 10 mg/kg were not form immune complex, then incubated for 1.5 h in a (Fig. 1c). Besides, we also evaluated the effect of ILG 37 °C condition and washed three times with PBS to re- (20 mg/kg) on hematoma volume at 24 and 72 h after move the uncombined enzyme. After adding the ICH induction (Additional file 1D). Typical magnetic chromogen solution A and B, the samples were detected resonance imaging (MRI) T2-weighted images (T2WI) using an automatic microplate reader at 450 nm. were obtained (Additional file 2A). The hematoma vol- ume of ICH + DMSO group at 24 and 72 h after ICH Measurements of CAT activity, SOD activity and ROS were 24.81 ± 1.64, 29.11 ± 2.06 mm , respectively. ILG content, GSH/GSSG contents administration significantly reduced hematoma volume to CAT assay kit (visible light) (A007-1), total SOD assay 22.95 ± 3.26 mm at 72 h after ICH but not 24 h (23.10 ± kit (Hydroxylamine method) (A001-1), ROS assay kit 2.02 mm )(p < 0.05 vs. ICH + DMSO, 72 h; p >0.05 vs. (E004), and total GSH/GSSG assay kit (A061-1) were all ICH + DMSO, 24 h) (Additional file 2B). Consequently, purchased from Nanjing Jiancheng Bioengineering Insti- the results indicated that ILG treatment (20 mg/kg) had tute (Nanjing, China) and were used to measure the no notably effect on bleeding but possibly promoted CAT activity, SOD activity and ROS content, GSH/ hematoma clearance after ICH induction. GSSG contents according to the instructions of reagent manufacturers, respectively. Intraperitoneal administration of ILG alleviated brain edema and disruption of BBB at 24 and 72 h after ICH Statistical analysis After induction of ICH at 24 and 72 h, BWC increased All data were presented as means ± standard deviation clearly (p<0.01vs. sham,24and 72 h) andEvansblue (SD). Statistical analyses were performed with SPSS ver- dyes significantly extravasated through disrupted BBB sion 19.0 software (SPSS, Inc., Chicago, IL, USA), and (p < 0.01 vs. sham, 24 and 72 h). The effects of ILG plots were drawn by GraphPad Prism 5 software (Graph- treatment on the brain edema and BBB disruption were Pad Software, Inc., San Diego, CA). If data are equal var- in keeping with that on the behavioral deficits and iances, one-way analysis of variance (ANOVA) followed brain tissue damages. Assessment of BWC using a wet/ by least significant difference (LSD) tests were used to dry weight method showed that ILG treatment at the compare differences among multiple groups; for the re- dosage of 10 mg/kg (vehicle-DMSO vs. 10 mg/kg: sults being unequal, Dunnett’s T3 tests were taken into 81.96 ± 0.68% vs. 81.57 ± 0.64%, p > 0.05, 24 h; 81.40 ± account. Differences with a p < 0.05 were considered sta- 0.73% vs. 81.05 ± 0.90%, p > 0.05, 72 h) was unable to tistically significant. improve brain edema, but the dosages at 20 mg/kg (ve- hicle-DMSO vs. 20 mg/kg: vs. 80.40 ± 0.87%, p < 0.01, Results 24 h; vs. 79.65 ± 1.01%, p < 0.01, 72 h) and 40 mg/kg ILG improved behavioral deficits and reduced histological (vehicle-DMSO vs. 40 mg/kg: vs. 80.07 ± 0.43%, p < damages at 24 and 72 h after ICH by intraperitoneal 0.01, 24 h; vs. 79.53 ± 0.85%, p < 0.01, 72 h) did play a administration positive role on the reduction of brain edema. However, Figure 1a shows the representative macrographs (left, there was no clear difference on the extent of protective sham, 24 h; right, ICH, 24 h). The rats subject to ICH effects about the ILG dosages of 20 and 40 mg/kg (20 induction showed obvious behavioral deficits at 24 and vs. 40 mg/kg: p > 0.05, 24 and 72 h) (Fig. 1d, e). Quanti- 72 h after ICH graded by a mNSS score scale (p < 0.01 tative measurements of EB dyes after extravasation in vs. sham, 24 h and 72 h). Administration of ILG at the the ipsilateral hemisphere indicated that ILG treatment dosage of 10 mg/kg was not significantly effective for the significantly alleviated the extravasation of EB dyes at improvement of behavioral deficits (vehicle-DMSO vs. the dosages of 20 mg/kg (p <0.01 vs. vehicle-DMSO, 24 10 mg/kg: 10.33 ± 1.07 vs. 10.25 ± 1.14, p > 0.05, 24 h; and 72 h) and 40 mg/kg (p <0.01 vs. vehicle-DMSO, 24 Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 7 of 19 Fig. 1 Representative macrographs and the effects of ILG treatment on ICH-induced brain impairments (a–e). Typical macrographs (left: sham, 24 h after operation; right: 24 h after ICH induction) (a). ILG administration at the doses of 20 and 40 mg/kg at 24 and 72 h after ICH induction significantly reduced the neurological deficits assessed by a mNSS score scale (b)(n = 12 rats/group). Similarly, ILG treatment at doses of 20 and 40 mg/kg markedly alleviated the histological changes evaluated via H&E staining (c)(n = 6 rats/group) and BWC (d, e)(n = 6 rats/group) measured by the dry/wet weight method at 24 and 72 h after ICH. Scale bar = 50 and 20 μm. Values are shown as means ± SD. **p < 0.01; *’: ICH + vehicle (DMSO) vs. ICH + ILG 20 mg/kg, p < 0.01; ICH + ILG 10 mg/kg vs. ICH + ILG 20 mg/kg, p < 0.05 and 72 h), but not 10 mg/kg (p >0.05 vs. vehicle- 72 h) and 40 mg/kg (p < 0.01 vs. vehicle-DMSO, 24 and DMSO, 24 and 72 h) after ICH modeling (Fig. 2a, b). 72 h) markedly dropped the number of FJC cells. Add- itionally, a 10 mg/kg dosage of ILG treatment had no ILG administration decreased the number of distinct effect on the reduction of degenerating neurons degenerating neurons in the brain tissue surrounding the (p > 0.05 vs. vehicle-DMSO, 24 and 72 h) and treatment hematoma after ICH induction results of ILG between 20 and 40 mg/kg were similar To further estimate the effects of ILG treatment on (20 vs. 40 mg/kg: p > 0.05, 24 and 72 h) (Fig. 2c, d). brain damages in a rat ICH model, we assessed the neur- In conclusion, experimental results displayed above onal degeneration in brain tissue of perihematomal re- clearly suggested that ILG treatment by intraperitoneal gion. FJC neurons were significantly increased in the delivery significantly reduced the behavioral deficits, brain tissue surrounding hematoma after ICH (p < 0.01 histological impairments, BBB disruption, brain edema vs. sham, 24 and 72 h) and administration of ILG at the and degenerating neurons of perihematomal brain tissue dosages of 20 mg/kg (p < 0.01 vs. vehicle-DMSO, 24 and at the doses of 20 and 40 mg/kg, but there were no Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 8 of 19 Fig. 2 Effects of ILG on BBB disruption and the number of degenerating neuron following ICH (a-d). ILG administration at the dosages of 20 and 40 mg/ kg significantly alleviated the extravasation of EB dyes and the number of FJC staining cells. Macroscopic images of brains with extravasated EB dyes (a) and corresponding quantitative analyses (b)(n = 6 rats/group). Typical microscopic images for FJC staining cells from injury brain tissues (c)and quantitative analyses of the number of FJC staining cells (d)(n =6 rats/group). Scale bar = 20 μm. Values are reported as means ± SD. **p <0.01 obvious difference on the extent between them. Thus, tissue at 24 h after ICH and the results suggested that ILG we selected the dosage of 20 mg/kg to further explore 20 mg/kg treatment significantly increased the expression the potential molecular mechanisms of ILG’s protective of total Nrf2 protein (p < 0.01 vs. ICH) (Fig. 3a, d) and de- effects on early brain injury after ICH induction. creased that of total NF-κBp65protein (p <0.01 vs. ICH) (Fig. 3a, b). Typical IHC images were obtained from the in- The expression and nuclear translocation of Nrf2 was jury brain tissue (Fig. 4). Meanwhile, Nrf2 protein level in promoted by ILG treatment at 24 h after ICH induction the cytoplasm was significantly dropped (p <0.01 vs. ICH) and that of NF-κB p65 was suppressed (Fig. 3a, e) and notably increased in the nucleus (p <0.01 ILG was reported to hold capacity to activate the Nrf2- vs. ICH) (Fig. 3a, g); cytoplasmic level of NF-κBp65 was mediated antioxidant system and inhibit the activation of significantly increased (p <0.01 vs. ICH) (Fig. 3a, c) and the NF-κB. Thus, we guessed that whether ILG alleviated early nuclear level was notably deceased (p < 0.01 vs. ICH) brain injury post ICH involved in Nrf2 and NF-κBpath- (Fig. 3a, f). Consequently, experimental results indicated ways. In order to verify our supposition, we performed WB that ILG promoted the expression and nuclear transloca- analyses and IHC staining using the perihematomal brain tion of Nrf2 and suppressed that of NF-κB p65. Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 9 of 19 Fig. 3 Effects of ILG on protein levels of NF-κB p65 and Nrf2 after ICH. Representative WB bands of NF-κB p65 and Nrf2 proteins (total, cytoplasmic and nuclear) (a) and quantitative analyses of total NF-κBp65 (b), cytoplasmic NF-κBp65(c), and nuclear NF-κBp65(f) protein levels and total Nrf2 (d), cytoplasmic Nrf2 (e), and nuclear Nrf2 (g)protein levels (n = 6 rats/group). Values are indicated by means ± SD; **p < 0.01; *p <0.05 The components of NLRP3 inflammasome pathway and ILG delivery reduced the markers of oxidative stress + + + subsequent IL-1β/IL-18 release were suppressed by ILG injury, infiltration of MPO , CD68 , Iba-1 cells, and treatment expression of MPO in the brain tissue surrounding the Activation of NLRP3 inflammasome and induction of its hematoma components aggravated the early brain injury after ICH, Excessive production of ROS mediates seriously oxida- and blockades were protective reported by our [17] and tive injury and is a key promoting factor for the activa- other studies [8, 16]. In addition, a recent study showed tion of NLRP3 inflammasome, and the antioxidant that Nrf2 negatively regulates NLRP3 inflammasome ac- responses initiated through nuclear translocation of Nrf2 tivity by inhibiting ROS [18]. Therefore, we investigated could alleviate the ROS-induced brain injury and inflam- that whether ILG decreased the activation and induction matory cell infiltration. Therefore, we probed that if ILG of NLRP3 inflammasome pathway components or not. treatment at 20 mg/kg dropped the production of oxida- The results showed that ILG at the dosage of 20 mg/kg tive stress markers 3-NT and 8-OHdG by IHC staining significantly suppressed the expression of NLRP3 inflam- and infiltration of neutrophils (indicated by MPO, a neu- masome components: NLRP3, ASC, caspase-1 (p < 0.01 trophil marker) using IF staining and WB analyses. The vs. ICH) (Fig. 5a, b, c, e), and blocked the activation of results suggested that ILG (20 mg/kg) could significantly NLRP3 inflammasome as indicated by the reduction of decrease the amounts of 3-NT cells (p < 0.01 vs. ICH) cleaved IL-1β and IL-18 (p < 0.01 vs. ICH) (Fig. 5a, g, i). (Fig. 6a, b), 8-OHdG cells (p < 0.05 vs. ICH) (Fig. 6a, c) Representative IHC images of NLRP3 protein were in perihematomal brain tissues. Also, the expression shown (Fig. 4). Consistent with the above results, ILG level of MPO was notably decreased in the injury brain treatment obviously reduced the protein levels of pro- tissue (p < 0.01 vs. ICH) (Fig. 7c), and representative IF IL-1β (p < 0.01 vs. ICH) (Fig. 5a, f) and pro-IL-18 (p < images and WB band of MPO protein were shown, re- 0.01 vs. ICH) (Fig. 5a, h) and increased the expression of spectively (Fig. 7a, b). Meanwhile, ILG (20 mg/kg) could + + pro-caspase-1 (p < 0.05 vs. ICH) (Fig. 5a, d). significantly drop the amounts of CD68 , Iba-1 (CD68 Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 10 of 19 Fig. 4 Effects of ILG on protein levels of NF-κB and Nrf2 pathways evaluated by IHC staining. Typical IHC images of NF-κB p65, Nrf2, NLRP3, NQO1, and HO-1 (n = 6 rats/group). Scale bar =20 μm and Iba-1, the microglia/macrophage markers) cell recruit- Inflammatory cytokine levels in the brain tissue and ments in injury brain tissue after ICH as well (p <0.05 vs. serum from the blood of cardiac puncture were both ICH) (Additional file 2C, D, E). significantly reduced by ILG treatment We measured the levels of inflammatory cytokines IL- 1β and IL-18 both in perihematomal brain tissues and ILG treatment lowered the mRNA levels of NLRP3 the serum, respectively. The results were similar to the inflammasome, NF-κB, and Nrf2 pathway components previous experimental findings, namely, ILG treatment To further explore the effects of ILG treatment on the significantly dropped the levels of IL-1β in damaged mRNA levels of NLRP3 inflammasome, NF-κB, and brain tissues and the serum (p < 0.01 vs. ICH) (Fig. 8h, i). Nrf2 pathway components at 24 h after ICH induc- The contents of IL-18 in the damaged brain tissue and tion, we performed relative real-time RT-qPCR study. serum were significantly decreased as well (p <0.01 vs. The results showed that 24 h after ICH induction, the ICH) (Fig. 8j, k). mRNA levels of NLRP3, ASC, caspase-1, IL-1β,IL-18, NQO1, and HO-1 were obviously increased (p <0.01 ILG reduced the contents of ROS and GSSG, increased the vs.sham)(Fig.8) and ILG (20 mg/kg)significantly level of GSH and upregulated the enzyme activities of weakened the increases of NLRP3, caspase-1, IL-18 (p < SOD and CAT 0.05 vs. ICH) (Fig. 8a, c, e), ASC, and IL-1β mRNA levels We also detected the activities of SOD and CAT enzymes (p < 0.01 vs. ICH) (Fig. 8b, d). Meanwhile, NQO1 (p <0.01 and the contents of GSH/GSSG and ROS after ILG treat- vs. ICH) (Fig. 8f) and HO-1 (p < 0.05 vs. ICH) (Fig. 8g) ment at 24 h post ICH. Experimental results indicated that were further distinctly upregulated at the mRNA after ICH induction, enzyme activities of CAT and SOD levels by ILG treatment. In addition, representative and the content of GSH were significantly decreased (p < IHC images of NQO1 and HO-1 proteins were 0.01 vs. sham) (Fig. 8l, m, o), the levels of GSSG and ROS shown (Fig. 4). were evidently increased (p < 0.01 vs. sham) (Fig. 8o, n). Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 11 of 19 Fig. 5 Effects of ILG on NLRP3 inflammasome activation and IL-1β/IL-18 maturation. Representative WB bands (a) and inhibited effects of ILG on NLRP3 (b), ASC (c), pro-caspase-1 (d), caspase-1 (e), pro-IL-1β (f), IL-1β (g), pro-IL-18 (h), and IL-18 (i) protein levels in the ipsilateral hemisphere at 24 h after ICH (n = 6 rats/group). Data are indicated by means ± SD. *p < 0.05; **p < 0.01 ILG treatment at 20 mg/kg could strikingly reverse the We conducted the Nrf2 siRNA interfering and Nrf2 decreases of CAT and SOD enzyme activities, increases of siRNA together with ILG 20 mg/kg co-treatment re- GSSG and ROS levels, and reduction of GSH content search by intraventricular injection and intraperitoneal (p <0.01 vs. ICH) (Fig. 8l–o). delivery, respectively. Interfering effects of Nrf2 siRNA were identified using real-time RT-qPCR and WB ana- Nrf2 siRNA interference aggravated the behavioral lyses. The results showed that Nrf2 siRNA significantly deficits and brain edema and raised the number of FJC dropped the mRNA and protein expression (p < 0.01 vs. cells and administration of ILG lowered those vehicle-2) levels of Nrf2 (Fig. 9a–c). In the study, we uncomfortable effects found that Nrf2 siRNA interference markedly exacer- In our studies mentioned above, some preliminary con- bated the function deficits (Nrf2 siRNA vs. vehicle-2: clusions were obtained that ILG could effectively reduce 13.67 ± 0.91 vs. 10.89 ± 0.96, p < 0.01) (Fig. 9d) and brain the early brain injury after ICH induction and the pro- edema (Nrf2 siRNA vs. vehicle-2: 83.57 ± 0.80% vs. tective effects of ILG might be involved in the regulation 82.35 ± 0.98%, p < 0.05) (Fig. 9f) and increased the of Nrf2, ROS, NF-κB, and NLPR3 inflammasome path- amounts of degenerating neuronal cells (p < 0.01 vs. ways. We wondered if ILG treatment reduced the brain vehicle-2) (Fig. 9e, g) at 24 h after ICH induction. How- injury mediated by NLRP3 inflammasome pathway via ever, ILG administration (20 mg/kg) distinctly reversed Nrf2 activation-induced ROS and/or NF-κB inhibition. those uncomfortable results: function deficits (Nrf2 Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 12 of 19 Fig. 6 Effects of ILG on oxidative stress marker levels in the injury brain tissue after ICH. ILG significantly decreased the oxidative stress marker levels (3-NT and 8-OHdG) after ICH. Typical oxidative stress markers 3-NT and 8-OHdG IHC images (a) and quantitative analyses (b, c)(n =6 rats/group). Scale bar =20 μm. Values are reported as means ± SD. **p < 0.01; *p <0.05 siRNA vs. Nrf2 siRNA + ILG 20 mg/kg: vs. 11.89 ± 0.90, Discussion p < 0.01), brain edema (Nrf2 siRNA vs. Nrf2 siRNA + Accumulating studies have displayed that oxidative ILG 20 mg/kg: vs. 82.27 ± 0.57%, p < 0.05), and FJC cells stress and inflammation played key roles in the (p < 0.01 vs. Nrf2 siRNA) (Fig. 9d–g). pathophysiological processes of early brain injury after ICH induction and inhibition of them were beneficial Nrf2 siRNA interference increased the expression of NF-κB [5,7,44–46]. In our first experiment, we found that p65 and NLRP3 inflammasome components and triggered ILG administration at the dosages of 20 and 40 mg/ the activation of NLRP3 inflammasome pathway and ILG kg ameliorated the early brain tissue impairments and reduced these effects behavioral defects as indicated by the reduction of mNSS We further evaluated the effects of Nrf2 siRNA on the ex- scores and FJC neuronal cells, the improvement of histo- pression of NF-κB p65 and induction and activation of logical damages, BBB disruption, and brain edema at 24 NLRP3 inflammasome pathway components. We found and 72 h post ICH modeling and obtained the ideal dose that Nrf2 siRNA interfering could significantly increase of ILG at 20 mg/kg for the following experiments. In the the expression of NF-κBp65(p < 0.05 vs. vehicle-2) second experiment, the results showed that ILG delivery (Fig. 10a, b); NLRP3 inflammasome components: NLRP3, at 20 mg/kg activated the Nrf2-mediated antioxidative sig- ASC, caspase-1, and downstream molecule, IL-1β (p < naling pathway and suppressed the activation of NF-κB 0.01 vs. vehicle-2) (Fig. 10a, c, d, e, f). ILG at the dosage of and NLRP3 inflammasome pathways as indicated by the 20 mg/kg and Nrf2 siRNA co-administration obviously increasing of nuclear translocation and decreasing of the alleviated the enhancement of protein expression levels of cytoplasmic level of Nrf2, the reduction of nuclear trans- NF-κB p65, caspase-1, IL-1β (p < 0.05 vs. Nrf2 siRNA) location and upregulation of cytoplasmic level of NF-κB (Fig. 10a, b, e, f), NLRP3, and ASC (p < 0.01 vs. Nrf2 p65, and the induction and activation of NLRP3 inflam- siRNA) (Fig. 10a, c, d) after Nrf2 siRNA treatment at 24 h masome (components) and its downstream molecules. In following ICH. the third experiment, we found that Nrf2 siRNA notably Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 13 of 19 Fig. 7 Effects of ILG on the number of MPO cells in perihematomal brain tissues (a–c). Representative microscopic images (a), WB bands (b), and quantitative analysis of the bands (c)(n = 6 rats/group). Scale bar =20 μm. Values are reported as means ± SD. **p < 0.01 exacerbated the early brain injury post ICH as supported in vitro [26, 51, 52]. Pretreatment of ILG significantly alle- by aggravated behavioral deficits, brain edema, and degen- viated neurological deficits, cerebral infarct, and brain eration of neuronal cells, and ILG treatment visibly edema, and these neuroprotective effects are involved in alleviated the effects. Based on the results above, we hy- the increases of brain ATP content, energy charge (EC) pothesized here that ILG alleviates early brain injury after and total adenine nucleotides (TAN) and preservation of + + ICH induction by activating Nrf2 antioxidant pathway, brain Na K ATPase activity, SOD, CAT, and GSH-Px, inhibiting the activation and induction of NLRP3 inflam- and inhibition of the increase of brain MDA content in a masome (components), and this process may be involved rat cerebral ischemia-reperfusion model [50]. Toxicity of in the suppression of ROS and/or NF-κB signaling path- brain cells induced by cocaine and methamphetamine de- ways. Potential molecular mechanisms of ILG’s effects on livery was also able to be attenuated by ILG treatment the early brain injury after ICH induction is shown in [47–49]. Consistently, in in vitro studies, ILG protected Additional file 3. neuronal cells from glutamate and 6-hydroxydopamine Results from our study have powerful evidence showing (6-OHDA)-induced neurotoxicity by reducing the produc- that ILG possesses a brain cell-protective function, and tion of ROS [51, 52]. Meanwhile, a recent report also this was in line with previous studies in vivo [47–50] and showed that ILG treatment could notably alleviate Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 14 of 19 Fig. 8 Effects of ILG on the mRNA levels of NLRP3 inflammasome pathway components and downstream molecules of Nrf2-mediated antioxidant system, contents of inflammatory cytokines and antioxidants, and activity of antioxidative enzymes. ILG treatment at 20 mg/kg notably decreased the mRNA levels of NLRP3 (a), ASC (b), caspase-1 (c), IL-1β (d), IL-18 (e), and further increased the NQO1 (f), HO-1 (g) mRNA levels (n = 6 rats/ group). Similarly, ILG administration at 20 mg/kg obviously reduced the levels of IL-1β (h, i) and IL-18 (j, k) in the perihematomal brain tissue and serum measured by ELISA (n = 6 rats/group). Besides, ILG delivery also markedly reversed the reduction of CAT and SOD activities (l, m), increasing of ROS (n) and GSSG (o) contents and decreasing of GSH level (o)(n = 6 rats/group). Values are reported as means ± SD. **p < 0.01; *p < 0.05; *’: ICH vs. ICH + ILG 20 mg/kg, p < 0.01; ICH + vehicle (DMSO) vs. ICH + ILG 20 mg/kg, p < 0.05 rotenone and sodium nitroprusside (SNP)-induced oxida- and its downstream genes [28]. The activation mechanisms tive stress and nitrosative stress by improving MMP, ATP of Nrf2 by ILG might be involved in the alkylation of levels, and neural cell viability [26]. kelchlike ECH-associated protein 1 (Keap1) at specific cyst- ILG, one of the active extracts isolated from G. uralensis, eine residues, especially at the site of C151, a most reactive is a flavonoid with chalcone structure and is brain- cysteine residue site of human Keap1 [54]. At the same permeable after administration [53], which showed various time, there were reports showing that ILG upregulated the biological activities including anti-inflammatory, anti- expression of HO-1 in RAW264.7 macrophages through oxidative stress [9]. Increasing studies suggested that ILG the extracellular signal-regulated kinase1/2 (ERK1/2) path- exerts biological effects by activating Nrf2-mediated anti- way post lipopolysaccharide (LPS) treatment [55] and had oxidative system and eliminating ROS [9] and was the inhibitory effects on LPS-induced inflammatory responses most potent inducer to stimulate the expression of Nrf2 of mouse macrophages by suppressing NF-κB signaling Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 15 of 19 Fig. 9 Effects of Nrf2 siRNA delivery and Nrf2 siRNA with ILG 20 mg/kg co-administration in ICH rats. Real-time RT-qPCR assay of Nrf2 after siRNA delivery 24 h following ICH (n =6 rats/group) (a). WB assay (b)and quantification (c) of Nrf2 protein after siRNA treatment 24 h following ICH (n = 6 rats/group); mNSS score (d) at 24 h post ICH (n = 18 rats/group). BWC (f)at24h afterICH (n = 6 rats/group). FJC staining (g) and quantification (e)ofFJC staining cells (n = 6 rats/group). Data represent means ± SD. Scale bar =20 μm. **p < 0.01; *p < 0.05. *’: ICH + vehicle-2 vs. ICH + Nrf2 siRNA, p < 0.05; ICH + control scramble siRNA vs. ICH + Nrf2 siRNA, p <0.01 involved in the blockade of inhibitor of κBα (IκBα)degrad- of ROS, mitochondrial DNA or the mitochondrial ation and phosphorylation [56]. In addition, recent reports phospholipid cardiolipin, potassium efflux, changes in also indicated that ILG induced the activation of Nrf2 as cell volume, calcium, and lysosomal impairments have indicated by an increase in its nuclear translocation and all been proposed as critical active signals to trigger the the expression of Nrf2-targeted phase II enzymes, such as activation of NLRP3 inflammasome [60, 61]. Activation HO-1 and NQO1 [29]. In addition to the regulation of ILG of NLRP3 inflammasome demands two signals. One is on Nrf2 pathway, increasing evidences have suggested that the stimulus of NF-kB pathway that after NF-κB activa- ILG notably inhibited the activation of NF-κB pathway by tion, NF-κB translocates into the nucleus, after binding suppressing LPS-induced TLR4/MD-2 homodimerization with DNA and initiating the transcription and translation [57], blocking IκBα phosphorylation and degradation, re- of IL-1β precursor protein and NLRP3 protein; another ducing NF-κB p65 nuclear translocation [58], downregulat- one is to trigger the assembly of NLRP3 inflammasome ing mRNA and protein levels of NF-κB and its activation and lead to its stimulus such as production of ROS. [25, 59], and inhibiting RANKL-stimulated NF-κBexpres- Following triggered, active NLRP3 inflammasome recruits sion and nuclear translocation [23]. precursor caspase-1 and cleaves it into active caspase-1, The NLRP3 inflammasome, a best characterized pat- and then the cleaved caspase-1 processes IL-1β and tern recognition receptor (PRR) in innate immune IL-18 precursors into mature IL-1β and IL-18, eventu- response, played a crucial component in the early brain ally augmenting the inflammatory responses and injury post ICH [8, 16, 17] and was composed by a impairments [60, 61]. sensor (NLRP3 protein), an adaptor (ASC protein), and Recently, several studies have demonstrated that an effector (zymogen pro-caspase-1) [60, 61]. Production NLRP3 inflammasome pathway was activated after ICH Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 16 of 19 Fig. 10 Effects of Nrf2 siRNA and Nrf2 siRNA with ILG co-treatment on the protein levels of NF-κB p65 and NLRP3 inflammasome pathway components after ICH. WB assay (a) and quantification of NF-κB p65 (b), NLRP3 (c), ASC (d), caspase-1 (e), and IL-1β (f) protein levels after Nrf2 siRNA and ILG 20 mg/kg co-treatment at 24 h following ICH (n = 6 rats/group). Data are indicated by means ± SD. **p < 0.01; *p < 0.05 induction, and the inhibiting of NLRP3 using siRNA or are considered to be the first non-neuronal cells to recombinant adenovirus encoding NLRP3 RNAi could react to various pathological processes after ICH and attenuate the brain injury including improving behav- thus once the condition ictus, microglia are immedi- ioral deficits and reducing brain edema and MPO level. ately activated by a various of blood components and Hence, ROS and the activation of NF-κB pathway were then activated microglia release multiple cytokines the crucial upstream signals, and blocking them can and chemokines, following peripheral inflammatory reduce the activation of NLRP3 inflammasome. In our cells (including neutrophils, macrophages) infiltrating study, we have verified that Nrf2 triggering via ILG into the hemorrhagic brain and are activated, next administration significantly decreased the production of producing a mass of cytokines, chemokines, and cyto- oxidative stress markers 3-NT and 8-OHdG and sup- toxicity substance [4, 62]. Thus, both the activation pressed the activation of NF-κB; meanwhile, the NLRP3 and infiltration of neutrophils and microglia/macro- inflammasome was restrained. The results suggested that phages synergistically contribute to the inflammatory Nrf2 could downregulate the activity and expression of brain injury post ICH and play crucial role on the NLRP3 inflammasome (components) and were in keep- pathological mechanisms [4, 62]. Our experimental ing with previous reports [18, 22]. To further proved our results have shown that ILG administration could assumption, we conducted Nrf2 siRNA interfering and notably reduce the number of perihematomal neutro- Nrf2 siRNA + ILG 20 mg/kg co-administration study in phils and microglia/macrophages as well. a rat ICH model. The results showed that after Nrf2 Also, iron, one key component of hemoglobin (Hb) siRNA treatment, the brain injuries were more severe metabolites, was reported to be involved in the second- and ILG (20 mg/kg) obviously attenuated the impair- ary brain injury. Excessive production of iron could lead ments. These also were consistent with the studies of to oxidative brain impairments by Fenton reaction, other groups, namely, Nrf2 was involved in the regula- which yields massive ROS. Furthermore, HO-1 promotes tion of ILG-mediated NLRP3 inflammasome activation the level of iron by participating in the degradation of [18, 22] and the activation of Nrf2 pathway was neuro- heme [63, 64]. Besides, ILG was also reported to coun- protective [9, 12, 13, 31]. teract iron-catalyzed oxidative stress damages in HepG2 Microglia are the key immune cells existing in the cells by AMPK-mediated GSK3β inhibition which was central nervous system (CNS) and are commonly re- involved in mitochondrial dysfunction and superoxide ferred to as the macrophage of the brain. Microglia generation [65]. Meanwhile, in our experiments, we Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 17 of 19 found that ILG administration could significantly inhibit Additional file 2: Effects of ILG on the hematoma volume and the level of ROS and promote the expression of HO-1 in expansion at 24 h and 72 h after ICH (a, b) and effects of ILG on the + + number of CD68 , Iba-1 cells in the perihematomal brain tissue at 24 h the injury brain tissue. Thus, the relationship of iron after ICH (c-e). Representative MRI T2WI images (a) and quantitative analyses metabolism and neuroprotective effects of ILG needs to of hematoma volume (b) (n = 6 rats / group). Representative microscopic + + be further explored. images (c) and quantitative analyses of CD68 ,Iba-1 cells (d, e) (n = 6 rats /group). Scale bar = 20 μm. Values are reported as means ± SD. ** p < 0.01, Thrombin, a serine protease produced immediately * p < 0.05. (TIF 7318 kb) in brain after ICH to prevent the bleeding. It may be a Additional file 3: Mechanism diagram. Underlying molecular mechanisms central injury mechanism of ICH and was shown to of ILG’s neuroprotective effects on the early brain injury after ICH induction. mediate the secondary brain injury by multiple path- ILG alleviated the early brain injury following ICH may be involved in the regulation of ROS and / or NF-κB on the activation of NLRP3 inflammasome ways including complement cascade and protease- pathway by the triggering of Nrf2 activity and the induction of Nrf2-mediated activated receptors (PAR) [63, 64]. Recently, thrombin antioxidant system. (TIF 232 kb) was also reported to be involved in the activation of NLRP3 inflammasome and microglia and induced Abbreviations severe brain injury including brain edema, BBB 3-NT: 3-Nitrotyrosine; 6-OHDA: 6-Hydroxydopamine; 8-OHdG: 8- disruption, and brain cell loss [66, 67]. In our study, Hydroxyguanosine; ANOVA: Analysis of variance; ARE: Antioxidant response element; BBB: Blood-brain barrier; BSA: Bovine serum albumin; BWC: Brain we found that ILG 20 mg/kg could efficaciously block- water content; CAT: Catalase; CNS: Central nervous system; DAB: 3,3- ade the activation of NLRP3 inflammasome and infil- Diaminobenzidine; DAPI: 4′6-Diamidino-2-phenylindole; tration of neutrophils and microglia/macrophages into DMSO: Dimethylsulfoxide; EB: Evans blue; EC: Energy charge; EDTA: Ethylene diamine tetraacetic acid; ELISA: Enzyme-linked immunosorbent assay; ERK1/ the injury brain tissue. Thus, whether ILG exerts its 2: Extracellular signal-regulated kinase1/2; FJC: Fluoro-Jade® C; G. protective effects involved in the thrombin-mediated brain uralensis: Glycyrrhiza uralensis; GAPDH: Glyceraldehyde 3-phosphate dehydro- injury pathway remains to be further investigated. genase; GPX: Glutathione peroxidase; GSH/GSSG: Glutathione/oxidized glutathione; GST: Glutathione-S-transferase; H&E: Hematoxylin and eosin; There are several potential limitations deserving atten- Hb: Hemoglobin; HO-1: Heme oxygenase-1; HRP: Horseradish peroxidase; tion in our experiments. Firstly, ILG was reported to i.p.: Intraperitoneal injection; ICH: Intracerebral hemorrhage; perform a variety of biological functions by regulating IF: Immunofluorescence; IHC: Immunohistochemistry; IL-1β: Interleukin-1 beta; ILG: Isoliquiritigenin; IκBα: Inhibitor of κBα; Keap1: Kelchlike ECH- multiple signaling pathways, and we mainly concentrated associated protein 1; LPS: Lipopolysaccharide; LSD: Least significant on the Nrf2, ROS, NF-κB, and NLRP3 inflammasome difference; mNSS: Modified Neurological Severity Score; pathways. However, ILG may exert its effects on other sig- MPO: Myeloperoxidase; MRI: Magnetic resonance imaging; NF-κB: Nuclear factor-κB; NLRP3: Nod-like receptor family, pyrin domain-containing 3; naling pathways. Secondly, we just carried out our study NO: Nitric oxide; NQO1: NAD(P)H: quinone oxidoreductase-1; Nrf2: Nuclear on a kind of ICH model (sterile-filtered collagenase type factor erythroid-2 related factor 2; PAR: Protease-activated receptor; IV-induced), not concurrently on other ICH models such PBS: Phosphate buffer solution; PRR: Pattern recognition receptor; ROS: Reactive oxygen species; RT-qPCR: Real-time reverse transcription- as autologous blood-imitated model of ICH. The results quantitative polymerase chain reaction; SD: Standard deviation; SD derived from our experiments should be more convincing rats: Sprague-Dawley rats; siRNA: Small interfering RNA; SNP: Sodium by more than one model to be verified. Finally, collagenase nitroprusside; SOD: Superoxide dismutase; SPF: Specific pathogen-free; T2WI: T2-weighted images; TAN: Total adenine nucleotides; WB: Western blot itself is a kind of foreign matter and is unavoidable to trig- ger extra inflammatory responses. Consequently, further Acknowledgements experiments are needed to settle these issues. It has been shown as Funding. Funding Conclusions This work was supported by the National Natural Science Foundation of Taken together, our experiments have identified that China (Nos. 81671125, 81271314, and 30500526), Special Project on the ILG administration notably attenuated the early Integration of Industry, Education and Research of Guangdong Province and Ministry of Education (No. 2012B091100154), Natural Science Foundation of brain injury after ICH induction and the underlying Guangdong (No. 2014A030313346 and 5300468), and the Guangdong molecular mechanisms of these beneficial effects are Provincial Clinical Medical Centre for Neurosurgery (No. 2013B020400005). involved in the regulation of ROS and/or NF-κBon the activation of NLRP3 inflammasome pathway by Availability of data and materials the triggering of Nrf2 activity and Nrf2-induced anti- Please contact author for data requests. oxidant system. In addition, our experimental results might provide a novel therapeutical strategy for ICH. Authors’ contributions YZC and JZ conceived and designed the experiments. JZ performed the experiments. YZC and JZ analyzed the data. JZ wrote the paper. YZC, RD, LF, SY, XQD, ZHF, ZCX, and SZZ contributed to the paper revision, provided Additional files experimental technical support, and assisted in completing the study at different stages. All authors read and approved the final manuscript. Additional file 1: Experimental design and groups (a-c). MRI and Hematoma Volume Evaluation (d). The captions of Additional file 2 and 3 Competing interests (e). (PDF 235 kb) The authors declare that they have no competing interests. Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 18 of 19 Ethics approval 15. Zhao X, Sun G, Zhang J, Strong R, Dash PK, Kan YW, Grotta JC, Aronowski J. All experimental procedures and animal care were approved by the Transcription factor Nrf2 protects the brain from damage produced by Southern Medical University Ethics Committee and were conducted in intracerebral hemorrhage. Stroke. 2007;38:3280–6. accordance with the guidelines of the National Institutes of Health on the 16. Yuan B, Shen H, Lin L, Su T, Zhong S, Yang Z. Recombinant adenovirus care and use of animals. encoding NLRP3 RNAi attenuate inflammation and brain injury after intracerebral hemorrhage. J Neuroimmunol. 2015;287:71–5. 17. Feng L, Chen Y, Ding R, Fu Z, Yang S, Deng X, Zeng J. P2X7R blockade prevents Publisher’sNote NLRP3 inflammasome activation and brain injury in a rat model of intracerebral Springer Nature remains neutral with regard to jurisdictional claims in hemorrhage: involvement of peroxynitrite. J Neuroinflammation. 2015;12:190. published maps and institutional affiliations. 18. Liu X, Zhang X, Ding Y, Zhou W, Tao L, Hu R. Nuclear factor E2-related factor-2 (Nrf2) negatively regulates NLRP3 inflammasome activity by Author details inhibiting reactive oxygen species (ROS)-induced NLRP3 priming. Antioxid Department of Neurosurgery, Zhujiang Hospital, The National Key Clinical Redox Signal. 2017;26(1):28–43. Specialty, The Neurosurgery Institute of Guangdong Province, Guangdong 19. Rzepecka J, Pineda MA, Al-Riyami L, Rodgers DT, Huggan JK, Lumb FE, Khalaf Provincial Key Laboratory on Brain Function Repair and Regeneration, The AI, Meakin PJ, Corbet M, Ashford ML, et al. Prophylactic and therapeutic Engineering Technology Research Center of Education Ministry of China, treatment with a synthetic analogue of a parasitic worm product prevents Southern Medical University, Guangzhou 510282, China. Department of experimental arthritis and inhibits IL-1beta production via NRF2-mediated Neurosurgery, Jingmen No. 1 People’s Hospital, Jingmen 448000, Hubei, counter-regulation of the inflammasome. J Autoimmun. 2015;60:59–73. China. Department of Neurosurgery, Affiliated Hospital of Xiangnan 20. Peng F, Du Q, Peng C, Wang N, Tang H, Xie X, Shen J, Chen J. A review: the University, Chenzhou 423000, Hunan, China. Department of Neurosurgery, pharmacology of isoliquiritigenin. Phytother Res. 2015;29:969–77. The Fifth Affiliated Hospital of Southern Medical University, Guangzhou 21. Gnanaguru G, Choi AR, Amarnani D, D’Amore PA. Oxidized lipoprotein uptake 510900, Guangdong, China. Department of Neurosurgery, Gaoqing Campus through the CD36 receptor activates the NLRP3 inflammasome in human of Central Hospital of Zibo, Gaoqing People’s Hospital, Gaoqing, Zibo 256300, retinal pigment epithelial cells. Invest Ophthalmol Vis Sci. 2016;57:4704–12. Shandong, China. Department of Neurosurgery, 999 Brain Hospital, Jinan 22. Honda H, Nagai Y, Matsunaga T, Okamoto N, Watanabe Y, Tsuneyama K, University, Guangzhou 510510, Guangdong, China. Hayashi H, Fujii I, Ikutani M, Hirai Y, et al. Isoliquiritigenin is a potent inhibitor of NLRP3 inflammasome activation and diet-induced adipose Received: 14 February 2017 Accepted: 5 June 2017 tissue inflammation. J Leukoc Biol. 2014;96:1087–100. 23. Liu S, Zhu L, Zhang J, Yu J, Cheng X, Peng B. Anti-osteoclastogenic activity of isoliquiritigenin via inhibition of NF-kappaB-dependent autophagic pathway. Biochem Pharmacol. 2016;106:82–93. References 24. Kwon HM, Choi YJ, Choi JS, Kang SW, Bae JY, Kang IJ, Jun JG, Lee SS, Lim 1. Keep RF, Hua Y, Xi G. Intracerebral haemorrhage: mechanisms of injury and SS, Kang YH. Blockade of cytokine-induced endothelial cell adhesion therapeutic targets. Lancet Neurol. 2012;11:720–31. molecule expression by licorice isoliquiritigenin through NF-kappaB signal 2. Adeoye O, Broderick JP. Advances in the management of intracerebral disruption. Exp Biol Med (Maywood). 2007;232:235–45. hemorrhage. Nat Rev Neurol. 2010;6:593–601. 25. Wu Y, Chen X, Ge X, Xia H,WangY,SuS,LiW,YangT,Wei M, ZhangH,etal. 3. Chen S, Yang Q, Chen G, Zhang JH. An update on inflammation in the Isoliquiritigenin prevents the progression of psoriasis-like symptoms by inhibiting acute phase of intracerebral hemorrhage. Transl Stroke Res. 2015;6:4–8. NF-kappaB and proinflammatory cytokines. J Mol Med (Berl). 2016;94:195–206. 4. Zhou Y, Wang Y, Wang J, Anne SR, Yang QW. Inflammation in intracerebral 26. Denzer I, Munch G, Pischetsrieder M, Friedland K. S-allyl-L-cysteine and hemorrhage: from mechanisms to clinical translation. Prog Neurobiol. 2014; isoliquiritigenin improve mitochondrial function in cellular models of 115:25–44. oxidative and nitrosative stress. Food Chem. 2016;194:843–8. 5. Hu X, Tao C, Gan Q, Zheng J, Li H, You C. Oxidative stress in intracerebral 27. Foresti R, Bains SK, Pitchumony TS, de Castro BL, Drago F, Dubois-Rande JL, hemorrhage: sources, mechanisms, and therapeutic targets. Oxid Med Cell Bucolo C, Motterlini R. Small molecule activators of the Nrf2-HO-1 Longev. 2016;2016:3215391. antioxidant axis modulate heme metabolism and inflammation in BV2 6. Broderick JP, Brott TG, Duldner JE, Tomsick T, Huster G. Volume of microglia cells. Pharmacol Res. 2013;76:132–48. intracerebral hemorrhage. A powerful and easy-to-use predictor of 30-day 28. Gong H, Zhang BK, Yan M, Fang PF, Li HD, Hu CP, Yang Y, Cao P, Jiang P, mortality. Stroke. 1993;24:987–93. Fan XR. A protective mechanism of licorice (Glycyrrhiza uralensis): 7. Duan X, Wen Z, Shen H, Shen M, Chen G. Intracerebral hemorrhage, isoliquiritigenin stimulates detoxification system via Nrf2 activation. J oxidative stress, and antioxidant therapy. Oxid Med Cell Longev. 2016;2016: Ethnopharmacol. 2015;162:134–9. 29. Park SM, Lee JR, Ku SK, Cho IJ, Byun SH, Kim SC, Park SJ, Kim YW. 8. Ma Q, Chen S, Hu Q, Feng H, Zhang JH, Tang J. NLRP3 inflammasome Isoliquiritigenin in licorice functions as a hepatic protectant by induction of contributes to inflammation after intracerebral hemorrhage. Ann Neurol. antioxidant genes through extracellular signal-regulated kinase-mediated 2014;75:209–19. NF-E2-related factor-2 signaling pathway. Eur J Nutr. 2016;55(8):2431–44. 9. Denzer I, Munch G, Friedland K. Modulation of mitochondrial dysfunction in 30. Rosenberg GA, Mun-Bryce S, Wesley M, Kornfeld M. Collagenase-induced neurodegenerative diseases via activation of nuclear factor erythroid-2-related intracerebral hemorrhage in rats. Stroke. 1990;21:801–7. factor 2 by food-derived compounds. Pharmacol Res. 2016;103:80–94. 31. Xue F, Huang JW, Ding PY, Zang HG, Kou ZJ, Li T, Fan J, Peng ZW, Yan WJ. 10. Calkins MJ, Johnson DA, Townsend JA, Vargas MR, Dowell JA, Williamson TP, Nrf2/antioxidant defense pathway is involved in the neuroprotective effects Kraft AD, Lee JM, Li J, Johnson JA. The Nrf2/ARE pathway as a potential of Sirt1 against focal cerebral ischemia in rats after hyperbaric oxygen therapeutic target in neurodegenerative disease. Antioxid Redox Signal. preconditioning. Behav Brain Res. 2016;309:1–8. 2009;11:497–508. 32. Dang B, Li H, Xu X, Shen H, Wang Y, Gao A, He W, Wang Z, Chen G. 11. Shang H, Yang D, Zhang W, Li T, Ren X, Wang X, Zhao W. Time course of Cyclophilin A/cluster of differentiation 147 interactions participate in early brain Keap1-Nrf2 pathway expression after experimental intracerebral injury after subarachnoid hemorrhage in rats. Crit Care Med. 2015;43:e369–81. haemorrhage: correlation with brain oedema and neurological deficit. Free 33. Chen J, Li Y, Wang L, Zhang Z, Lu D, Lu M, Chopp M. Therapeutic benefit of Radic Res. 2013;47:368–75. intravenous administration of bone marrow stromal cells after cerebral 12. Iniaghe LO, Krafft PR, Klebe DW, Omogbai EK, Zhang JH, Tang J. Dimethyl ischemia in rats. Stroke. 2001;32:1005–11. fumarate confers neuroprotection by casein kinase 2 phosphorylation of Nrf2 in murine intracerebral hemorrhage. Neurobiol Dis. 2015;82:349–58. 34. Chen J, Sanberg PR, Li Y, Wang L, Lu M, Willing AE, Sanchez-Ramos J, 13. Zhao X, Sun G, Zhang J, Ting SM, Gonzales N, Aronowski J. Dimethyl Chopp M. Intravenous administration of human umbilical cord blood fumarate protects brain from damage produced by intracerebral reduces behavioral deficits after stroke in rats. Stroke. 2001;32:2682–8. hemorrhage by mechanism involving Nrf2. Stroke. 2015;46:1923–8. 35. Ding R, Feng L, He L, Chen Y, Wen P, Fu Z, Lin C, Yang S, Deng X, Zeng J, 14. Wang J, Fields J, Zhao C, Langer J, Thimmulappa RK, Kensler TW, Yamamoto Sun G. Peroxynitrite decomposition catalyst prevents matrix M, Biswal S, Dore S. Role of Nrf2 in protection against intracerebral metalloproteinase-9 activation and neurovascular injury after hemoglobin hemorrhage injury in mice. Free Radic Biol Med. 2007;43:408–14. injection into the caudate nucleus of rats. Neuroscience. 2015;297:182–93. Zeng et al. Journal of Neuroinflammation (2017) 14:119 Page 19 of 19 36. Ding R, Chen Y, Yang S, Deng X, Fu Z, Feng L, Cai Y, Du M, Zhou Y, Tang Y. 58. Zhu L, Wei H, Wu Y, Yang S, Xiao L, Zhang J, Peng B. Licorice isoliquiritigenin Blood-brain barrier disruption induced by hemoglobin in vivo: Involvement suppresses RANKL-induced osteoclastogenesis in vitro and prevents of up-regulation of nitric oxide synthase and peroxynitrite formation. Brain inflammatory bone loss in vivo. Int J Biochem Cell Biol. 2012;44:1139–52. Res. 2014;1571:25–38. 59. Watanabe Y, Nagai Y, Honda H, Okamoto N, Yamamoto S, Hamashima T, 37. Yang F, Wang Z, Zhang JH, Tang J, Liu X, Tan L, Huang QY, Feng H. Receptor Ishii Y, Tanaka M, Suganami T, Sasahara M, et al. Isoliquiritigenin attenuates for advanced glycation end-product antagonist reduces blood-brain barrier adipose tissue inflammation in vitro and adipose tissue fibrosis through damage after intracerebral hemorrhage. Stroke. 2015;46:1328–36. inhibition of innate immune responses in mice. Sci Rep. 2016;6:23097. 60. Sharma D, Kanneganti TD. The cell biology of inflammasomes: mechanisms 38. Belayev L, Busto R, Zhao W, Ginsberg MD. Quantitative evaluation of blood- of inflammasome activation and regulation. J Cell Biol. 2016;213:617–29. brain barrier permeability following middle cerebral artery occlusion in rats. 61. Lamkanfi M, Dixit VM. Mechanisms and functions of inflammasomes. Cell. Brain Res. 1996;739:88–96. 2014;157:1013–22. 39. Uyama O, Okamura N, Yanase M, Narita M, Kawabata K, Sugita M. 62. Zhang Z, Zhang Z, Lu H, Yang Q, Wu H, Wang J. Microglial polarization and Quantitative evaluation of vascular permeability in the gerbil brain after inflammatory mediators after intracerebral hemorrhage. Mol Neurobiol. transient ischemia using Evans blue fluorescence. J Cereb Blood Flow 2017;54:1874–86. Metab. 1988;8:282–4. 63. Babu R, Bagley JH, Di C, Friedman AH, Adamson C. Thrombin and hemin as 40. Yang S, Chen Y, Deng X, Jiang W, Li B, Fu Z, Du M, Ding R. Hemoglobin- central factors in the mechanisms of intracerebral hemorrhage-induced induced nitric oxide synthase overexpression and nitric oxide production secondary brain injury and as potential targets for intervention. Neurosurg contribute to blood-brain barrier disruption in the rat. J Mol Neurosci. 2013; Focus. 2012;32:E8. 51:352–63. 64. Hua Y, Keep RF, Hoff JT, Xi G. Brain injury after intracerebral hemorrhage: 41. Schmued LC, Stowers CC, Scallet AC, Xu L. Fluoro-Jade C results in ultra the role of thrombin and iron. Stroke. 2007;38:759–62. high resolution and contrast labeling of degenerating neurons. Brain Res. 65. Choi SH, Kim YW, Kim SG. AMPK-mediated GSK3beta inhibition by 2005;1035:24–31. isoliquiritigenin contributes to protecting mitochondria against iron- 42. Min H, Jang YH, Cho IH, Yu SW, Lee SJ. Alternatively activated brain- catalyzed oxidative stress. Biochem Pharmacol. 2010;79:1352–62. infiltrating macrophages facilitate recovery from collagenase-induced 66. Wan S, Cheng Y, Jin H, Guo D, Hua Y, Keep RF, Xi G. Microglia activation intracerebral hemorrhage. Mol Brain. 2016;9:42. and polarization after intracerebral hemorrhage in mice: the role of 43. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using protease-activated receptor-1. Transl Stroke Res. 2016;7(6):478–87. real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 67. Zuo D, Ye X, Yu L, Zhang L, Tang J, Cui C, Bao L, Zan K, Zhang Z, Yang X, 2001;25:402–8. et al. ROS/TXNIP pathway contributes to thrombin induced NLRP3 44. Mracsko E, Veltkamp R. Neuroinflammation after intracerebral hemorrhage. inflammasome activation and cell apoptosis in BV2 cells. Biochem Biophys Front Cell Neurosci. 2014;8:388. Res Commun. 2017;485(2):499–505. 45. Qu J, Chen W, Hu R, Feng H. The injury and therapy of reactive oxygen species in intracerebral hemorrhage looking at mitochondria. Oxid Med Cell Longev. 2016;2016:2592935. 46. Ziai WC. Hematology and inflammatory signaling of intracerebral hemorrhage. Stroke. 2013;44:S74–8. 47. Jang EY, Choe ES, Hwang M, Kim SC, Lee JR, Kim SG, Jeon JP, Buono RJ, Yang CH. Isoliquiritigenin suppresses cocaine-induced extracellular dopamine release in rat brain through GABA(B) receptor. Eur J Pharmacol. 2008;587:124–8. 48. Jeon JP, Buono RJ, Han BG, Jang EY, Kim SC, Yang CH, Hwang M. Proteomic and behavioral analysis of response to isoliquiritigenin in brains of acute cocaine treated rats. J Proteome Res. 2008;7:5094–102. 49. Lee MJ, Yang CH, Jeon JP, Hwang M. Protective effects of isoliquiritigenin against methamphetamine-induced neurotoxicity in mice. J Pharmacol Sci. 2009;111:216–20. 50. Zhan C, Yang J. Protective effects of isoliquiritigenin in transient middle cerebral artery occlusion-induced focal cerebral ischemia in rats. Pharmacol Res. 2006;53:303–9. 51. Hwang CK, Chun HS. Isoliquiritigenin isolated from licorice Glycyrrhiza uralensis prevents 6-hydroxydopamine-induced apoptosis in dopaminergic neurons. Biosci Biotechnol Biochem. 2012;76:536–43. 52. Yang EJ, Min JS, Ku HY, Choi HS, Park MK, Kim MK, Song KS, Lee DS. Isoliquiritigenin isolated from Glycyrrhiza uralensis protects neuronal cells against glutamate-induced mitochondrial dysfunction. Biochem Biophys Res Commun. 2012;421:658–64. 53. Mogami S, Sadakane C, Nahata M, Mizuhara Y, Yamada C, Hattori T, Takeda H. CRF receptor 1 antagonism and brain distribution of active components contribute to the ameliorative effect of rikkunshito on stress-induced anorexia. Sci Rep. 2016;6:27516. Submit your next manuscript to BioMed Central 54. Luo Y, Eggler AL, Liu D, Liu G, Mesecar AD, van Breemen RB. Sites of alkylation of human Keap1 by natural chemoprevention agents. J Am Soc and we will help you at every step: Mass Spectrom. 2007;18:2226–32. • We accept pre-submission inquiries 55. Lee SH, Kim JY, Seo GS, Kim YC, Sohn DH. Isoliquiritigenin, from Dalbergia odorifera, up-regulates anti-inflammatory heme oxygenase-1 expression in � Our selector tool helps you to find the most relevant journal RAW264.7 macrophages. Inflamm Res. 2009;58:257–62. � We provide round the clock customer support 56. Wang R, Zhang CY, Bai LP, Pan HD, Shu LM, Kong AN, Leung EL, Liu L, Li T. � Convenient online submission Flavonoids derived from liquorice suppress murine macrophage activation by up-regulating heme oxygenase-1 independent of Nrf2 activation. Int � Thorough peer review Immunopharmacol. 2015;28:917–24. � Inclusion in PubMed and all major indexing services 57. Honda H, Nagai Y, Matsunaga T, Saitoh S, Akashi-Takamura S, Hayashi H, � Maximum visibility for your research Fujii I, Miyake K, Muraguchi A, Takatsu K. Glycyrrhizin and isoliquiritigenin suppress the LPS sensor toll-like receptor 4/MD-2 complex signaling in a Submit your manuscript at different manner. J Leukoc Biol. 2012;91:967–76. www.biomedcentral.com/submit

Journal

Journal of Neuroinflammation – Springer Journals

Published: Jun 13, 2017

There are no references for this article.