Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Phosphorylation at Thr167 is required for Schizosaccharomyces pombe p34cdc2 function.

Phosphorylation at Thr167 is required for Schizosaccharomyces pombe p34cdc2 function. The EMBO Journal vol.10 no.11 pp.3297-3309, 1991 Phosphorylation at Thri 67 is required for pombe p34Cdc2 function Schizosaccharomyces Booher et al., 1989; Dunphy and Newport, 1989; Felix Kathleen L.Gould', Sergio Moreno, et al., 1989; Gautier et al., 1989; Moreno et al., 1989; Pines David J.Owen, Shelley Sazer and Paul Nurse and Hunter, 1989; Pondaven et al., 1990; Krek and Nigg, Cell Cycle Group, Microbiology Unit, Department of Biochemistry, 1991; Surana et al., 1991). Further, the regulation of its of Oxford, Oxford OXI 3QU, UK University series of post-translational activation involves a complicated of Cell Biology, School of Medicine. associations (reviewed by Lohka, 'Present address: Department modifications and subunit University, Nashville, TN 37232, USA Vanderbilt 1989; Draetta, 1990; Lewin, 1990; Nurse, 1990; Pines and P.Nurse Hunter, 1990; Freeman and Donoghue, 1991). In particular, Communicated by activation of is associated with its binding to a 034cdc2 cycle progression requires the periodic cyclin molecule (Draetta and Beach, 1988; Booher et al., Eukaryotic cell and inactivation of a protein-serine/threonine 1989; Felix et al., 1989; Labbe et al., 1989a; Meijer et al., activation which in fission yeast is encoded by the cdc2+ 1989; Pines and Hunter, 1989; Gautier et al., 1990; Solomon kinase The of this gene product, p34cdc2, is et 1990) while inactivation of involves cyclin gene. activity al., p34cdc2 interactions with other et al., 1989; Murray et al., 1989; Felix controlled by numerous proteins destruction (Draetta In fission p34Cdc2 et Ghiara et al., 1991). In yeasts, two classes of and by its phosphorylation state. yeast, al., 1990; of which has been have been identified which appear to is phosphorylated on two sites, one cyclin-like proteins of Tyrl5 regulate function either during the G1 phase (Cross, identified as Tyrl5. Dephosphorylation p34cdc2 mitosis. To understand more et al., 1989; Richardson the initiation of 1988; Nash et al., 1988; Hadwiger regulates during the G2 the regulation of p34""'2 kinase activity, et al., 1989; Wittenberg et al., 1990) or completely 1988; Hagan et al., 1988; the second site of phosphorylation phase (Booher and Beach, 1987, we have identified et al., 1991; Surana et al., Thrl67, a residue conserved amongst all p34Cdc2 Moreno et al., 1989; Ghiara as a complex of p34cdc2 By analysing the phenotypes of cells 1991) of the cell cycle. However, homologues. and Mailer, various 167 mutations and performing bound to cyclin is not necessarily active (Gautier expressing position of is regulated further in vitro we establish that Thrl67 phos- 1991). The timing p34cdc2 activation experiments, is for p34"""2 kinase activity at the phosphorylation state of p34cdc2 (Draetta et al., phorylation required by and is involved in the association of p34cdc2 with 1988; Dunphy and Newport, 1989; Gould and Nurse, 1989; mitosis Jessus et B. of Thrl67 might also play Morla et al., 1989; Gould et al., 1990; al., cyclin Dephosphorylation a role in the exit from mitosis. 1990; Pondaven et al., 1990; Solomon et al., 1990; Krek cell kinase/ and 1991; Lundgren et al., 1991; Norbury et al., Key words: cycle/phosphorylation/protein Nigg, 1991). Schizosaccharomyces pombe p34cdc2 is phosphorylated on up to four different sites p34cdc2 on the cell type (Draetta et al., 1988; Gould and depending 1989; Morla et al., 1989; Norbury et al., 1991; Nurse, Introduction Solomon et Krek and Nigg, 1991). Phosphoryla- al., 1990; that kinase is a key regulator of eukaryotic tion of each site varies during the cell cycle indicating The protein p34cdc2 by Lohka, 1989; Murray each has a potential regulatory function (Draetta et al., 1988; cell cycle progression (reviewed Nurse, 1989; Labbe Nurse, 1990). In the Dunphy and Newport, 1989; Gould and and Kirschner, 1989; Draetta, 1990; al., et and kinase activity et al., 1989b; Morla et 1989; Norbury al., 1991; fission budding yeasts, p34cdc2 protein et Krek and Nigg, both the initiation of DNA replication and the entry Pondaven et al., 1990; Solomon al., 1990; controls in fission yeast, into mitosis and Bissett, 1981; Piggott et al., 1991). We have previously shown that (Nurse two sites during a normal and Surana et al., 1991). is phosphorylated on just 1982; Reed Wittenberg, 1990; p34cdc2 and of have been identified in all multi- cell one of which is Tyrl5 (Gould Nurse, 1989). Homologues cycle, p34cdc2 all and has examined et Lee and Tyrl5 is conserved amongst proteins cellular eukaryotes (Draetta al., 1987; p34cdc2 of in the and Krek and been identified as the site tyrosine phosphorylation Nurse, 1987; Cisek Corden, 1989; Nigg, and mammalian et 1990; Lehner and O'Farrell, 1990; chicken (Krek and 1991) (Norbury 1989; Jimenez al., Nigg, The role of Tyrl5 et 1990; Hirt et al., 1991) where et al., 1991) p34cdc2 homologues. Spurr al., p34cdc2 is to inhibit activation of p34cdc2 (Gould entry into mitosis (Th'ng et al., 1990) as a phosphorylation regulates factor and that is bound to cyclin (Solomon et al., of M-phase promoting (MPF) (Dunphy Nurse, 1989) component and controls the of Tyrl5 is dependent upon the et Gautier et al., 1988) probably 1990). Phosphorylation al., 1988; and as well and Nurse, 1990; of both the mitotic inhibitor, plO7weeJ (Russell initiation of DNA replication (Blow presence and and another Furukawa et 1987; Featherstone Russell, 1991), D'Urso et al., 1990; al., 1990). Nurse, molecule encodes a in a of cells and cell-free have which p107weel-related Studies variety systems gene, mikl, The mitotic activator kinase is in the (Lundgren et al., 1991). p80cdc25 shown that protein activity periodic p34cdc2 et Moreno and Ducommun al., at the transition (Russell Nurse, 1986; 1990; cell cycle peaking G2/M-phase (Mendenhall or de- Labbe et et regulates Tyrl5 Draetta and al., 1991b), directly indirectly et al., 1987; Beach, 1988; al., 1988; Oxford Press University et al. K.L.Gould since it is not within all four NCS phosphorylation (Gould et al., 1990; Kumagai and Dunphy, phosphorylation site In Thrl4 has also been identified fragments which contained the threonine. 1991). higher eukaryotes, phosphorylated as a major site of phosphorylation (Norbury et al., 1991; four different Partial V8 protease digestion yielded fragments Krek and Nigg, 1991). Phosphorylation of Thrl4 acts in con- - and -29 kDa and which ranged between 10 (Gould and immuno- junction with Tyrl5 phosphorylation to inhibit Nurse, 1989; Fleig Nurse, 1991). Again by p34cdc2 with antibodies for the termini of activation (Norbury et al., 1991). A serine phosphorylation blotting specific p34cdc2, V8 contained site has also been mapped in chicken although its it was determined that the largest fragment the p34cdc2 function is not known (Krek and Nigg, 1991). C-terminus while the smallest fragment of - 10 kDa We had observed previously that p34cdc2 was phos- contained the N-terminus (data not shown, schematized in phorylated on a threonine residue in addition to Tyrl5 (Gould The 10 kDa also reacted with an Figure lA). fragment the of the and Nurse, 1989). Here, we report identity iYY-a :I .je site is #A4 phosphorylated residue as Thrl67. The comparable O ,- _-;' Ts * . * in all present and is most likely phosphorylated p34cdc2 homologues (Solomon et al., 1990; Krek and Nigg, 1991; of Norbury et al., 1991). To examine the function Thrl67 with phosphorylation in cells, we have replaced Thrl67 several different amino acids by site-directed mutagenesis and expressed the mutant p34Cdc2 proteins in fission yeast. We have found that in contrast to the inhibitory effect of Tyrl5 phosphorylation, Thrl67 phosphorylation is essential for kinase activity at mitosis. It appears to be p34cdc2 in of with involved the stable association p34cdc2 p56cdcI3 of this residue a role in and dephosphorylation might play from mitosis. I exit I I IL ---- Results of the threonine site Localization phosphorylation - -1. -.. '.. 1- :" '. (- Ti e 1. -: Tryptic cleavage of 32P-labelled Schizosaccharomyces pombe p34cdc2 generated only two phosphopeptides, termed 1 2 1 and (Gould and Nurse, 1989). Phosphopeptide contained phosphorylated Tyrl5 and phosphopeptide contained phosphothreonine (Gould and Nurse, 1989). The of on electrophoretic mobility phosphopeptide thin-layer cellulose plates at pH 4.7 relative to a neutral dye marker and to phosphopeptide 1 (data not shown) indicated that the contained a and peptide single phosphate moiety suggested that was at a S.pombe phosphorylated single p34cd2 ser ,Op threonine. I,p-thr To identify this target threonine, we assumed that the site ,p-tyr of threonine phosphorylation would be conserved throughout evolution. A of and sequence comparison S.pombe (Hindley cerevisiae Phear, 1984), Saccharomyces (Lorincz and Reed, and 1984), human (Lee and Nurse, 1987), chicken (Krek Nigg, 1989), Drosophila melanogaster (Jimenez et al., 1990; Lehner and O'Farrell, 1990) and murine (Cisek and Corden, 1989; Spurr et al., 1990) p34cdc2 homologues revealed that six threonines were present in all of them, threonines at amino acid positions 14, 47, 167, 172, 189 and 228 of the S.pombe protein. 1. the site of threonine Schematic Fig. Locating phosphorylation. (A) of the sites of NCS and V8 and the Two different were representations protease clipping partial proteolytic mapping procedures resultant fragments which helped to localize the site of threonine used to localize the threonine: chemical phosphorylated phosphorylation. These representations are based on the ability of the with N-chlorosuccinimide and cleavage (NCS) enzymatic fragments to be recognized by antibodies directed against various with aureus V8 NCS cleavage Staphylococcus protease. peptides and bacterially produced fragments. We do not know exactly where the two intermediate-sized V8 fragments are derived from and cleavage of gave rise to four major fragments of p34cdc2 their is placement only approximate. (B) Phosphoamino acid analysis - 32-19 kDa. By immunoblotting with antibodies specific of Wild-type Spombe cells were labelled with p34cdc2. for either the N-terminal or the C-terminal seven amino acids [32P]orthophosphate, was immunoprecipitated with PN24 from p34cdc2 and it of (Simanis Nurse, 1986), was found that p34cdc2 denatured resolved lysates, by electrophoresis on SDS-polyacrylarnide these four contained the N of fragments terminus the protein gel, transferred to immobilon-P and partially hydrolysed in acid. The phosphoamino acids were resolved by two-dimensional thin-layer but lacked the C terminus (data not shown, schematized electrophoresis. Autoradiography was for 5 days at -70°C with in Figure 1A). Phosphoamino acid analyses of the four pre-sensitized Kodak XAR5 film and intensifying screens. Letters a-e 32P-labelled NCS fragments showed that all four contained indicate phosphopeptides and o indicates the position of the origin. P, both phosphotyrosine and phosphothreonine (data not free phosphate; p-ser, phosphoserine; p-thr, phosphothreonine; p-tyr, shown). Thus, threonine 228 was eliminated as a possible phosphotyrosine. 3298 Thr l67 S.pombe p34cdc2 phosphorylation antibody raised against a peptide containing amino acids and Thr 167 was changed to alanine. The mutant and 42-57 of p34cdc2 (the PSTAIRE peptide, Lee and Nurse, wild-type cDNAs were each subcloned into the S.pombe 1987) (data not shown). Phosphoamino acid analysis revealed expression vector, pMNS21L (Maundrell, 1990), such that that whereas the three larger V8 fragments contained only of transcription the mutants was driven by the thiamine phosphothreonine, the smallest fragment contained phospho- repressible nmtl promoter. Each mutant was then expressed tyrosine only (Fleig and Nurse, 1991). Therefore, threonines in HYl (a gift from Stuart MacNeill), an S.pombe strain 14 and 47 were eliminated as candidates since both are in which the wild-type cdc2 protein coding region has located within the N-terminal V8 fragment which did not been replaced with the human CDC2 cDNA. Mutant contain phosphothreonine leaving threonine 167, 172 or 189 S.pombe cdc2 proteins expressed in HY 1 can be examined as the potential target. biochemically using antibodies which recognize S.pombe Another piece of evidence regarding the identity of the but do not recognize human p34cdc2 (4711 or p34cdc2 phosphorylated threonine came from an examination of the PN24, described in Materials and methods). To permit 32P-labelled partial acid hydrolysis products of In analyses of the non-functional mutant proteins, it was p34cdc2. addition to the phosphoamino acids, a series of found necessary (see below) to select HY 1 strains in incompletely which hydrolysed small the pMNS21 L plasmids containing the phosphopeptides and free 32p could mutant cdc2 cDNAs be visualized by autoradiography of a had integrated into the genome and were two-dimensional maintained stably. separation of phosphoamino This was not necessary and was not acids (Figure iB). done in the cases of p34cdc2 There are two partial products above the origin (a and b) the cdc2 + and cdc2-S 167 cDNAs which had no deleterious and three to the of the right origin (c, d and e) (Figure IB). effects on the cells. HYI cells expressing various cdc2 Rehydrolysis in acid of products a and b together yielded 2 1|.l both phosphotyrosine and phosphothreonine whereas that of d and e c, together produced only phosphothreonine (data not shown). The electrophoretic - migration of products c e toward the negative electrode at pH 1.9 could only be explained by the presence of a amino positively charged acid(s) very close to the threonine residue. phosphorylated Of the three remaining candidates (threonines 167, 172 and 189), only threonine 167 (Thr167) is near a basic amino acid (histidine 168) and, therefore, it seemed likely to be the site of phosphorylation. To confirm that Thr167 was indeed the single site of threonine phosphorylation in S.pombe and to p34cdc2 discover what if at this effect, any, phosphorylation site had on p34cdc2 function, the codon Thr at specifying position 167 was replaced with those encoding either alanine (A 167), serine (S167), glutamic acid acid (E167), aspartic (D167) E3 or tyrosine site-directed of the (Y167) by mutagenesis cdc2 + cDNA. A double mutant was also cdc2- constructed, in F15/A167, which Tyrl5 was changed to phenylalanine -t S -.y Dl S . Fig. 2. acid of proteins. HYI strains Phosphoamino analyses p34cdc2 expressing wild-type or one of five mutants were labelled with p34cdc2 were The p34cdc2 proteins immunoprecipitated [32P]orthophosphate. with resolved on a transferred to PN24, SDS-polyacrylamide gel, and with acid. The resultant 3. of mutants to rescue The of various immobilon-P, partially hydrolysed Fig. Ability cdc2'. (A) ability cdc2-33 strain phosphoamino acids were resolved two-dimensional cdc2 mutants to rescue of the at the non- by thin-layer growth of Cells the various The times of the were 4-6 cdc2 electrophoresis. exposure autoradiographs permissive temperature 36°C. (B) expressing were to a of -5 x 106 at days at with Kodak XAR5 film and mutants grown density cells/mi 25°C, -70°C pre-sensitized intensifying for 4 and stained with DAPI. screens. transferred to 36°C h, fixed, s, phosphoserine; t, phosphothreonine; y, phosphotyrosine. 3299 K.L.Gould et al. The of cells proteins in the presence of thiamine were labelled with report (Booher and Beach, 1986). phenotypes these mutants in culture after 4 h at [32P]orthophosphate, and the S.pombe cdc2 proteins were expressing liquid 36°C are shown in 3B. Cells + or immunoprecipitated with PN24, transferred to immobilon-P Figure expressing p34cdc2 were and subjected to phosphoamino acid analyses. Wild-type -S167 phenotypically wild-type, p34cdc2-E67 p34cdc2 S.pombe contained all three phosphoamino acids expressing cells generally contained one or more septa p34cdc2 (Figure 2A) in the same relative amounts as we have reported and two or more nuclei, and cells expressing the other a nucleus previously (Gould and Nurse, 1989; and Nurse, 1991). mutants were highly elongated and contained single Fleig The p34cdc2-A167 p34cdc2El67 and p34cdc2- 167 proteins lacked (Figure 3B). but still contained phosphothreonine phosphotyrosine (Figure and of the mutant cdc2 2B, C and D). Both phosphothreonine phosphotyrosine Overproduction protein the mutants at were absent from p34cdc2-F15IA167 indicating that positions As show above, non-phosphorylatable position unable to when 167 and 15 were the only major phosphoacceptor sites in 167 were complement cdc2'5 they were levels. To examine whether the protein (Figure 2E). The cdc2-S167 protein was not expressed at low to moderate could for their defects phosphorylated on threonine but was heavily phosphorylated higher than normal levels compensate ts cdc2 mutants et on serine residues (Figure 2F). Further analysis of partial as is the case for certain (Durkacz al., acid hydrolysis products and phosphopeptides from 1985), thiamine was removed from the media to allow high the was levels of expression from nmtl promoter. Overexpression p34cdc2-S167 showed that Serl67 indeed phosphorylated mutants to rescue and accounted for all of the observed did not change the ability of the cdc2fs. phosphoserine (data not shown). These data establish that Thrl67 is the Moreover, in the HY1 strain or at the firmly permissive temperature site of in the cdc2-33 strain, overproduction of these mutants led phosphorylation. amount of serine observed to cell and cessation of division. The The small phosphorylation elongation phenotypes of of HYl cells induction of or 167 in many phosphoamino acid analyses S.pombe during p34cdc2 p34cdc2-A167 p34cdc-t in 4A and Twelve to (see Figure 2A-E) appears to be artefactual (Fleig and are shown Figure B, respectively. hours after thiamine was removed from the Nurse, 1991). If of 32P-labelled fourteen media, immunoprecipitates cells to This coincides with S.pombe are subjected to tryptic digestion or partial the began elongate. timing p34cdc2 or of nmtl + digestion with either V8 protease N-chlorosuccinimide, upregulation promoter activity (Maundrell, 1990) in or of the mutant phosphoserine is not recovered any fragment and overexpression proteins (see below; Fleig and and Nurse, 1991). In the case of cells became phosphopeptide (Gould and Nurse, 1989; Fleig Nurse, p34cdc2E167, the contamination branched and accumulated nuclei 1991). This indicates that phosphoserine multiply septated, multiple is from a multitude of minor contaminants and is The of these derived (Figure 4B). toxicity non-complementing a Further evidence our in them not due to major contaminating protein. mutants explained difficulty maintaining on vectors and it was supporting the notion that is not episomally high copy-number why S.pombe p34cdc2 in the to obtain of these mutants under phosphorylated on serine is that every serine residue necessary integrants control in order to their C-terminal third of the protein including the serine residue thiamine-repressible study protein in corresponding to serine 283, the site phosphorylated products. chicken p34`2 (Krek and Nigg, 1991), has been changed to an alanine without affecting the amount of serine phos- Kinase activity of the mutant cdc2 proteins in The first property of these non-functional position 167 phorylation detected S.pombe immunoprecipitates p34cdc2 mutants we examined was their to function as (U.N.Fleig and P.Nurse, unpublished data). ability protein kinases. Each 167 mutant was tested for histone H1 position kinase activity in both the HY1 and cdc2-33 strains. In Phenotypes of mutants p34cdc2 To examine the functional of HY1, each mutant was expressed from the nmtl promoter consequence Thr167 each was for 18 or 24 h and isolated from phosphorylation, mutant tested for its ability to derepressed 0, 6, equal rescue the temperature-sensitive (ts) cdc2 strain, amounts of cell with 4711. cdc2-33. lysates by immunoprecipitation This mutant arrests at both the G1/S and G2/M transition These immunoprecipitates were divided in half. The at the and abundance of was determined one half and the points non-permissive temperature produces highly using p34cdc2 cells. Each mutant in was transformed other half was assayed for kinase towards the elongated pMNS21L activity into cdc2-33 and colonies containing the plasmids were histone HI. The of 4711 for exogenous substrate, specificity allowed to form at the permissive temperature of S.pombe is demonstrated in 25°C. Figure 5, A, B, p34cdc2 panels Although thiamine was included in the growth medium to H and I. There was no 4711-reactive in immune p34cdc prevent overexpression from the nmtl promoter, moderate complexes from HYI cells (Figure SA) and the immune expression of p34cdc2 was still detectable under these complexes did not have histone HI kinase activity (Figure conditions When (see below and Fleig and Nurse, 1991). The 5H). S.pombe p34cdc2 was expressed in HYI from ability of the mutants to complement ts p34cdc2 was the then episomal pMNS21L, accumulation of p34cdc2 during the assessed by replica-plating to the restrictive temperature of time course of was derepression detected easily (Figure SB) 36'C still in the presence of thiamine. Only wild-type cdc2 and the immune complexes displayed histone HI kinase and the cdc2-S167 mutants were able to fully complement These results activity (Figure 51). demonstrated that we were cdc2'5 (Figure 3A). The cdc2-E 167 mutant gave rise to able to assay the protein kinase activity of the S.pombe slow-growing colonies at 36°C either when replica-plated mutants introduced into HY1 and that did not p34cdc2Hs from the permissive temperature or when placed directly at contribute to the activity measured in this assay. Further- 36°C after transformation into cdc2ts strains. The other more, protein kinase activity did not increase in parallel with mutants did not support any colony growth. The inability increasing levels of p34cdc2 indicating that some other of to component which was complement ts cdc2 agrees with an earlier necessary for kinase activation was p34cdc2-A167 3300 S.pombe p34cdc2 Thr167 phosphorylation limiting in the cells. p34cdc2-S167 like accumulated obtained. Lysates were made from cells growing at the p34cd(2', to high levels during derepression of the nmtl promoter from cells shifted to the permissive temperature (25°C) and (Figure 5C) and had histone HI kinase activity (Figure 5J). non-permissive (36°C) for 2 and 4 h. Only temperature A167 + 67 accumulated also but to lower levels because p34cdc2 and p34Cd2-S were active at 40°C both in p34cdc2 its gene was integrated as a single copy (Figure 5D). immune complexes and in lysates assayed directly (data not p34cdc2-A167 lacked histone HI kinase activity (Figure 5K). shown). The cdc2-A167, cdc2-E167 and cdc2-FI15AI67 In a second experiment, the kinase activities of two other proteins showed no evidence of histone HI kinase activity mutants were compared with In this experiment, under any of these conditions (data not shown). p34cdc2'. a background histone kinase activity was observed but neither p34cdc2-E167 nor p34cdc2-F15/A167 demonstrated any Thr167 dephosphorylation correlates with inhibition of protein kinase activity above this background (Figure 5L and M) activity the were present in the immune complexes The data presented above suggested that in contrast to although proteins (Figure 5E and F). Also in this second experiment, the of (Gould and the inhibitory effect TyriS phosphorylation linearity of the immunoblotting and protein kinase assays et Jessus et Nurse, 1989; Gould al., 1990; al., 1990; was examined by diluting 2-, 4- and 8-fold an immuno- and Thr167 Pondaven et al., 1990; Kumagai Dunphy, 1991), precipitate of p34cdc2+ from a 24 h-induced culture. Both a for function. To phosphorylation was prerequisite p34cdc2 the of activity decreased in was for level protein and protein kinase determine if Thri67 phosphorylation required a indicating that the activity detected in this we to remove linear manner phosphotransferase activity per se, sought is an of of active histone and the assay accurate reflection the amount phosphate from this residue enzymatically assay we whether or HI kinase in an immune complex (Figure SG and N). dephosphorylated protein. First, explored not When the mutants were assayed for histone H 1 kinase protein phosphatase 2A (PP2A) could dephosphorylate activity in a cdc2'5 background, the same results were ThrI67. An immunoprecipitate of 32P-labelled p34cdc2 A- .: ... ;> 1:1.....;,-!" L4 and HYI and HYI with of the induction of 4. (A) Fig. Photomicrographs p34cdc2-E167. integrated pMNS21L plasmids expressing p34cdc2-Al67 of thiamine-free media three times and thiamine were washed in a volume in the of 5 or p34cdc2-Al67 (A) (B) presence Ag/ml large p34cdc2-E167 media. of cells were taken at the indicated times, fixed, and stained with DAPI. once in thiamine-free Samples resuspended again 3301 K.L.Gould et al. HI kinase activities of mutants. HYI cells expressing either no S.pombe (panels A and H), wild-type (panels Fig. 5. Histone p34cdc2 p34Cdc2 p34Cdc2 or the indicated S.pombe p34cdc2 mutants (panels C, D, E, F, J, K, L and M) were grown in media containing B and I, also panels G and N), washed thoroughly in thiamine-free media to allow derepression of the nmtl promoter. Equivalent amounts of 5 thiamine. They were then lg/ml times after and The proteins were isolated by immunoprecipitation with 4711 and the cells were taken at the indicated derepression lysed. p34cdc2 two In the case of the shown in G and N, the immunoprecipitate of wild-type immunoprecipitates were divided into equal portions. samples panels for 24 h was diluted 4- and 8-fold. Panels A-G. One half of each immunoprecipitate was resolved on an from a culture derepressed 1-, 2-, p34cdc2 to immobilon-P. The blot was incubated with 4711 followed by ['25I]protein A. The blots were exposed to SDS-polyacrylamide gel and transferred for 16 h. The band on the autoradiographs corresponds to and the minor presensitized Kodak XAR5 film with intensifying screens major p34cdc2 chain. Panels H-N. The other half of each immunoprecipitate shown in panels A-G band of -50 kDa corresponds to the immunoglobulin heavy to for 2 min in 2 x gel sample buffer, the reactions were resolved on was assayed for histone Hl kinase activity. After being heated 100°C SDS-polyacrylamide gels and subjected to autoradiography with Kodak XAR5 film. The kinase reaction of each sample is shown underneath the h at with screens. The major band visualized corresponds to histone immunoblot from the same sample. Exposure times were 16 -70°C intensifying to and the minor band might be related p56cdc13. H1, and p13S"uC (Brizuela et al., 1987; Booher et al., was generated from cells arrested in late G2 due to a ts 1989) the of is required for p34cdc2 in the cdc25 gene. The 32P-labelled 1989), and presence p56cdc13 mutation p34cdc2 protein kinase activation (Moreno et al., 1989). Since the immunoprecipitate was divided in half; one half was treated alone. PP2A removed mutants which could not be phosphorylated at position 167 with PP2A and the other with buffer from the and also lacked protein kinase activity, we explored the possibility much of the phosphothreonine protein At a concen- that Thrl67 was a prerequisite for binding some (Figure 6A). higher phosphorylation phosphotyrosine most of the from If were unable to bind tration, PP2A removed phosphate p34cdc2 to p56cdc13 or to pl3s"cJ. they unlabelled immuno- this would their lack of protein kinase 6B). In parallel experiments, explain (Figure p56cdcJ3, in treated with were made from HY1 expressing either were divided half, protein activity. Lysates precipitates p34cdc2 p34cdc2 + or p34cdc2-AI67, and subjected divided once to no Spombe or buffers alone, and again phosphatases and At to with either antibodies to p34cdc2 histone H1 kinase p34cdc2 abundance. immunoprecipitation assay activity in late the kinase or coupled to agarose beads. the block of cdc25-22 G2, protein (4711), p56cdcJ pl35"c point decreased The were resolved on a SDS-poly- of was low and was slightly by immunoprecipitates activity p34cdc2 Fifteen minutes after release transferred to immobilon-P and then blotted PP2A treatment (Figure 6C). acrylamide gel, of the untreated half were detected in into the kinase activity with PN24. Both p34cdc2+ and mitosis, protein p34cdc2-A167 from 4711 (Figure 7A) and both were also had risen significantly as expected previous reports immunoprecipitates Moreno et while that of the of binding to pl3`Uc beads (Figure 7B). Both were et al., 1989; al., 1990) capable (Booher low 6C). As we showed also by anti-p56cdcJ3 serum (Figure PP2A-treated half remained (Figure immunoprecipitated treatment with the T-cell of was considerably before, protein-tyrosine phosphatase 7C), but the amount p34cdc2-A167 to activation of isolated from cells reduced compared with p34cdc2'. also leads p34cdc2 in late et 1990; Figure 6D, lane 2). blocked G2 (Gould al., PP2A treatment this activation whether added Thr167 at G1/S? prevented phosphorylation or lane the after (Figure 6D, lane 4) before (Figure 6D, 8) As shown Thrl67 is critical for above, phosphorylation PP2A treatment alone resulted protein-tyrosine phosphatase. function and is probably required for p34cdc2 p34cdc2 in a small inhibition of the basal activity (Figure 6D, lane phosphotransferase activity at the G2/M transition. To 6; also Figure 6C) and these treatments did not alter the level if role determine Thrl67 phosphorylation has a at the GI/S of 6E). (Figure phase transition as well, we examined the DNA content of p34cdc either cdc2'5 strains containing an integrated copy of Thr167 phosphorylation and subunit associations flow cdc2-A167 or cdc2-E167 by cytometry. As expected, Two are known to bind directly to p34dC2 in other proteins well the cdc2-L7 and cdc2-33 strains arrested with a IC as S.pombe, (a cyclin B homologue) (Booher et al., as a 2C DNA content within 1 h of temperature shift p56cdc13 3302 S.pombe p34dCk2 Thri 67 phosphorylation untreated +PP2A ReleaseD _ +. + s, iot it .... I. :W: Tdo q'" ". -OH I I~ - H :iI W-_ !~~~~~~~~~~~~~ , _ _ I~~~~~~~~~~~~~~~~~~ 7_ _--. -_ _ 3 .~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~1 M. _I. ............... . Fig. 6. PP2A inactivates histone HI kinase activity. (A) p34cdc2 was immunoprecipitated with 4711 from cdc25-22 cells labelled with [32P]orthophosphate and growth-arrested in late G2 at 36°C. One half of the immunoprecipitate was treated with PP2A buffer alone and the other half with buffer and 10 mU/ml PP2A for 30 min at 30°C. The immunoprecipitates were resolved on a SDS-polyacrylamide gel, transferred to immobilon-P, and partially hydrolysed in acid. The phosphoamino acids were separated by two-dimensional thin-layer electrophoresis and visualized by autoradiography for 5 days at -70°C with pre-sensitized Kodak XAR5 film and an intensifying screen. s, phosphoserine; t, phosphothreonine; y, phosphotyrosine. (B) p34Cdc2 was immunoprecipitated with 4711 from cdc25-22 cells labelled with [32P]orthophosphate and growth-arrested at 36°C. One half of the immunoprecipitate was treated with PP2A buffer alone and the other half with buffer and 10 times as much PP2A, 100 mU/ml, as in (A) for 30 min at 30°C. The immunoprecipitates were resolved on a SDS- 15% polyacrylamide gel, transferred to immobilon-P, and visualized by autoradiography for 16 h at -70°C with pre-sensitized Kodak XAR5 film and an intensifying screen. The arrow indicates the position of p34cdc2. (C) p34Cd was immunoprecipitated with 4711 from cdc25-22 cells which had been arrested in late G2 by being held at 36°C (Block) or had been released from this block for 15 min by rapid cooling to 25°C (Release). The immunoprecipitates were then split in half. One half of each was treated with PP2A buffer alone and the other half of each was treated with buffer and 10 mU/ml PP2A for 30 in at 30°C. All four samples were then assayed for histone H1 kinase activity. The HI histone kinase reactions were resolved on an SDS-polyacrylamide gel and the phosphoplated histone HI was visualized by autoradiography with pre-sensitized Kodak XAR5 at -700C and an intensifying screen for 16 h. (D) p34c c2 was immunoprecipitated with 4711 from cdc25-22 cells which had been arrested in late G2 by being held at 36°C. The immunoprecipitate was then split into four and each again in half. One half of each was incubated in buffer alone while their counterparts were treated with After into H15 phosphatases. washing buffer, the histone HI kinase activity of one half of the eight was assayed. The reactions samples were separated on an SDS-polyacrylamide gel, transferred to immobilon-P, and incubated with 4711 followed by [1 A. Histone HI kinase 5I]protein activity was visualized by autoradiography. Lane 2 is from a sample treated with the T-cell protein-tyrosine phosphatase for 30 min at 30°C. Lane 4 is from a treated as in 2 sample lane but for an additional 30 min at 30°C with 10 mU/ml PP2A. Lane 6 is from a sample treated for 30 min at with 10 mU/ml PP2A. Lane from 30°C 8 is a sample treated as in lane 6 but for an additional 30 min at 30°C with the T-cell protein-tyrosine phosphatase. Lanes 1, 3, 5 and 7 are from controls which to in were treated identically samples lanes 2, 4, 6 and 8, respectively, except that no were added. The other half of phosphatases (E) each immunoprecipitate shown in (D) was resolved on an SDS-polyacrylamide gel, transferred to immobilon-P, incubated with 4711 and then with [125I]protein A. was visualized by autoradiography for 16 h. Hi, histone HI. p34cdc2 indicative of both a G1 of this mutant to for the formation and a G2 block (Figure 8A and C). support enough growth Cells of both strains leaked the 4 h of slow colonies on at in cdc2' strains through block by at growing plates 36°C GI 36°C, arrested with a 2C DNA content and persisted in this (see Figure 3). state for at least h Anti-tubulin immunofluorescence revealed an 6 (Figure 8A and C; data not shown). unusually A to a IC DNA content number of mitotic in the cdc2-33 strain peak corresponding was seen high spindles after 4 h at reproducibly in the cdc2-L7 strain expressing p34cdc2-A167 expressing p34cdc2-El67 36°C (Figure 9B, panels at it was more than in the A and some cells contained two 36°C although transient parental B); spindles (Figure 9B, in strain DAPI these cells The DNA was often distributed (Figure 8B). By staining, appeared panel C). abnormally its or at its centre with a nucleus not relation to the spindle, either along length elongated single interphase (data shown). D To In cells with a IC DNA content were never (Figure 9B, panels and E). provide quantitative contrast, evidence that cells observed in the cdc2ts strain expressing at 36°C p34cdc2-El67-expressing spent longer p34cdc2-E167 in the index was deter- (Figure 8D). Instead, cells with a greater than 2C DNA than normal time mitosis, septation shifted to 360C. At time the content after 4 h at The of these mined as cells were 0, septa- appeared 36°C. phenotypes was than the normal 6 h cells are shown in 9A. the tion index 15% Figure During temperature shift, (higher 7%). By 93% of the cells contained at least cells with several and nuclei accumulated after temperature shift, septa (Figure 9A). with the DAPI one The flow cytometric analysis coupled septum (Table I). staining cells continued to and showed that these replicate separate Thr167 is not Tyrl5 but not phosphorylation their DNA to cells but did limiting daughter always complete that we noticed the into the next round of In cell division before proceeding previous 32P-labelling experiments, was in cells which These data are consistent with the amount of 32P-labelled DNA greater synthesis. ability p34cdc2 3303 K.L.Gould et al. To overexpressed investigate whether this was a p34cdc2. uniform increase or specific to one phosphorylation we site, labelled with [32P]orthophosphate a strain expressing 5-20 times more than in with a p34cdc2 wild-type parallel strain. wild-type p34cdc2 was immunoprecipitated from each and subjected to phosphoamino acid The analysis. amount of phosphothreonine on p34cdc2 increased significantly in the strain overexpressing while the level of p34cdc2 phosphotyrosine did not increase to the jA _ nearly same extent (Figure 1OA and B). Thr167 and Tyrl5 phosphorylation can occur in i.* jB _ .M phase We previously examined the phosphoamino acid content of p34cdc2 in asynchronous populations, and in cdc mutants blocked in late G2 or in mitosis. To see if Thrl67 and Tyrl5 phosphorylations occurred earlier in the cell cycle, we examined the phosphoamino acid content of p34cdc2 in cells which had not yet completed DNA synthesis. 7. were made from HYI Fig. Lysates expressing p34cdc2+, HYI, and Wild-type cells which had been pre-treated with hydroxyurea HYl 34cdc2-A167 and to with expressing subjected immunoprecipitation were labelled with [32P]orthophosphate in the continuing 4711 (A), pl3SuC to beads or antibodies coupled agarose (B), to presence of hydroxyurea. p34cdc2 was isolated p56cdcI3 (C). The immunoprecipitates were run on an SDS- by immuno- polyacrylamide 5gel, transferred to immobilon-P, and probed with PN24 precipitation and its phosphoamino acid content was [12 followed by I]protein A. The presence of indicated the by p34cdc2, determined. Both Thrl67 and Tyrl5 were phosphorylated was of the arrows, visualized by autoradiography relevant portions of under these conditions to equivalent levels indicating that the immunoblot. The of band in nature the lower (C) is not known. these phosphorylation events can occur times at with XAR5 film and before the completion Exposure -70°C Kodak intensifying screens were 4 h 16 h and 5 of (A), (B) days (C). DNA synthesis (Figure lOC). A B cdc2-L7 cdc2-L7 + cdc2-A167 Hr 0 Hr 0 I 1 Hr 3 iHr 21* 2~~~~~~~~~~~~3Hr 3 Hr 4 Hr Hr ~~~~~~~~~4 DNA Conten DNA Content cdc2-33 cdc2-33 + cdc2-E167 z &t _ ~~~~~O Hr - Ohr - Hr - I Hr a3 A C2bHr n3 - 2Hr lb- - 3Hr - - 4 * - 41* DNA Conten DNA Content Fig. 8. Flow cytometric analysis of DNA content of cdc2's cells expressing p34cdc2 mutants. Cells were grown to mid-exponential phase at the permissive of = 0 temperature 25°C in the presence of 5 tg/ml thiamine and then shifted at t to the restrictive temperature of 36°C for 4 h. Samples were withdrawn hourly, fixed in ethanol and stained with propidium iodide. Linear fluorescence histograms show relative DNA content in arbitrary units on the horizontal axis and the cell number on the vertical axis. (A) cdc2-L7 cells; (B) cdc2-L7 cells expressing p34CdC2-A 67; cdc2-33 cdc2-33 (C) cells; (D) cells expressing cdc2-E167. 3304 67 phosphorylation S.pombe Thrl p34cdc2 Discussion amino acids in place of Thr 167 cannot complement ts cdc2 We showed previously that S.pombe p34cdc2 was mutants and lack histone HI protein kinase activity in vitro. phosphorylated on two major sites, one of which we Although non-functional, these mutant proteins are stable, identified as Tyrl5 (Gould and Nurse, 1989). In this phosphorylated on tyrosine, and their overexpression in the identified the second site of phosphorylation of wild-type leads to cell and study, we have presence p34cdc2 elongation Thus, these mutant p34c c2 proteins in S.pombe p34cdc2 as Thrl67. Serine but not alanine, a block in cell division. the capacity to interact with and even titrate glutamic acid, aspartic acid or tyrosine can substitute for appear to retain which the wild-type protein must threonine at residue 167. The Serl67 mutant protein is away other proteins with to function normally. These data argue that indistinguishable from the wild-type protein functionally and interact in order mutant proteins is not dissimilar to can be Thrl67 is present in all the structure of the Serl67 phosphorylated. mutants are inactive as protein kinases. sequenced p34 c2 proteins (Figure 11) and is likely to be wild-type but that the of with similar proper- site of phosphorylation in vertebrate p34cdc2 as well Dominant negative mutants a major p34cdc2 have been described before (Mendenhall et al., 1988; as in the S.pombe protein although it has not been identified ties types (Krek and Nigg, 1990; Fleig and Nurse, 1991). definitively in other cell Lee et al., 1991; Norbury et al., In our study of S.pombe p34cdc2 phosphorylation, Solomon et al., 1990; previous both Tyrl5 and Thr167 were phosphorylated 1991). In vertebrate cells, Thrl4 is a third major site of we found that and that phosphorylation of both residues phosphorylation (Krek and Nigg, 1991; Norbury during G2 p34cdc2 into and through mitosis (Gould et al., 1991). We have not detected Thrl4 phosphorylation decreased as cells passed Although we did not observe complete of S.pombe under ordinary growth conditions. and Nurse, 1989). p34cdc2 of either site at any time and were unable In contrast to phosphorylation at Tyrl5 which inhibits dephosphorylation event preceded the other kinase activity, our evidence indicates that phos- to discern if one dephosphorylation p34cdc2 mitosis (Gould and Nurse, 1989), activa- at Thrl67 is required for function and as cells entered phorylation p34cdc2 was associated with tyrosine but not two phosphorylation events are completely inde- tion of in vitro that the p34cdc2 et al., 1990). In one which will be discussed below, threonine dephosphorylation (Gould pendent. With exception in cells where good cell cycle proteins which have non-phosphorylatable Xenopus oocyte extracts and mutant p34cdc2 lD \P BI O hr 2 hr 6 hr I.} 4 hr Fig. 9. Photomicrographs of cells expressing (A) The cdc2-33 strain expressing p34cdc2-E167 was grown at 25°C to a density of 5 x 106 p34cdc2-EI67. of 5 thiamine and then at 36°C for the indicated number of hours. Aliquots of cells were fixed as described in cells/ml in the presence placed fsg/ml 8 and stained with DAPI. The same cells as in (A) were taken at 4 h after shift to 36°C, fixed for immunofluorescence, the to Figure (B) legend a rabbit anti-tubulin followed by Texas Red-conjugated goat anti-rabbit Ig and with DAPI. and stained both with antibody 3305 K.L.Gould et al. completion of DNA synthesis and can occur during S phase, synchrony was achieved, in mitosis was found to be p34cdc2 but not on consistent with what has been observed in other cell phosphorylated on a threonine Tyrl5 (Solomon types et (Norbury et al.,199 1; Krek and 199 et al., 1990; Krek and Nigg, 1991; Norbury al., 1991). Nigg, 1). However, in seen in these studies is cells with a than is characteristic of The phosphorylated threonine almost longer phase fission GI have evidence certainly the equivalent of Thr167 and our molecular genetic yeast, 32P-labelling studies provided that the nor is studies are consistent with result that is neither Thrl67 Tyrl5 phosphorylated during (Lee p34cdc2 GI when it is phosphorylated at Thrl67 at a time active. et al., 1988; Morla et al., 1989; Krek and Nigg, 1990; We have found that Thrl67 and Tyrl5 become phos- Norbury et al., 1991). These data suggest that Thr167 phorylated in the presence of hydroxyurea, indicating that phosphorylation might not be involved in p34cdc2 function these phosphorylation events are not dependent upon the at the transition and appears only after S phase is GI/S initiated. Our flow cytometric analysis of a cdc2'5 strain is of interest in this context. In a expressing p34cdc2-Al67 Table I. the of 167 at the cdc2'5 strain, presence p34cdc2-A non-permissive temperature reduced the length of time those Time % Septated cells cells arrested in this is not what is Although expected GI. 15 if Thrl67 phosphorylation was important for p34cdc2 function in the effects of 167 on block p34cdc2-A the GI, GI 2 22 were this result makes the role small. Therefore, although 3 33 of in Thrl67 phosphorylation difficult to interpret, the GI 4 55 combined observations on the timing of Thrl67 and Tyrl5 5 78 phosphorylation in several cell systems have raised the 6 93 possibility that the strategy for regulating activity at p34cdc2 the transition, both positively and negatively, might The cdc2-33 strain expressing was grown at 25°C to a p34cdc2-E167 GI/S density of 5 106 cells/ml and then placed at 36°C for the indicated be entirely different from what is utilized at the G2/M number of hours, DAPI. fixed and stained with Cells were observed transition. microscopically and of the percentage cells containing a septum was In combination with in vivo 32P-labelling studies which determined 500 cells at each time by counting point. showed that Thr167 occurred as cells dephosphorylation passed through mitosis (Gould and the Nurse, 1989), of cells phenotype expressing indicate that p34cdc2-E Thrl67 dephosphorylation as well as phosphorylation might ..... (.[). . _'s be important for normal cell cycle We progression. replaced ..1) Thrl67 with the negatively charged residues, aspartate e T .T . _TT :. and glutamate, in an attempt to mimic constitutive phos- phorylation at position 167. This approach has been vF used successfully for the investigation of regulatory phos- phorylation events in the cAMP-dependent protein kinase C (Levin and Zoller, 1990) and in isocitrate dehydrogenase *+ I'Ul (Thorness and Koshland, 1987; Dean and Koshland, 1990; Hurley et al., 1990). In the former studies, aspartate seems 'T to have more closely approximated the phosphorylated residue functionally than glutamate but in only the p34cdc2, glutamate substitution gave a different phenotype than the alanine substitution. p34cdc2-E167 was the only non- phosphorylated position 167 mutant to rescue, albeit poorly, Fig. 10. Phosphoamino acid analyses. Equal numbers of wild-type cdc2ts mutants. Curiously, this mutant displayed no in vitro -5- to 20-fold S.pombe cells (A), cells overexpressing by p34cdC2 protein kinase activity indicating that it can function although from the multicopy plasmid pIRT2 (B), or wild-type S.pombe treated in cells, its ability to form appropriate complexes might be with hydroxyurea (C) were labelled with [32P]orthophosphate, lysed and subjected to immunoprecipitation with PN24. Immunoprecipitates compromised and the immune complex protein kinase assay were resolved on SDS-polyacrylamide gels, transferred to might be too stringent a measure of its functional capacity. and in acid. The immobilon-P, partially hydrolysed phosphoamino Flow cytometric analysis demonstrated that a cdc2ts strain acids were in two dimensions separated by thin-layer electrophoresis. expressing this mutant could pass through the G1/S and T, phosphothreonine; Y, phosphotyrosine; o.p., overproduced; HU, hydroxyurea. The dotted circles indicate the position of phosphoserine. transitions G2/M repeatedly. However, cells accumulated 167 179 S. cdc2 D F G L A R F G V P L R N Y T H E I V T L W Y R A P E pombe S V W P S. cerevisiae CDC28 D F G L A R A F G V P L R A Y T H E I T L Y R A E CDC2Hs D F G L A R A F G I P I R V Y T H E V V T L W Y R S P E CDC2Mm D F G L A R A F G I P I R V Y T H E V L T L W Y R S P E D F G L A R A F V V S CDC2Gg G I P V R Y T H E V T L W Y R P E CDC2Dm D F G L G R S F G I P V RI Y T HEI V T L W Y R A P E Fig. 11. Sequence alignment of p34cdc2 proteins in the region of Thrl67. Hs, human, Mm, mouse; Gg, chicken; D.melanogaster. Thrl67 is Dm, boxed in bold lines. 3306 S.pombe p34cdc2 Thrl 67 phosphorylation septa and mitotic spindles which indicates that they were genetic interactions and in vitro results, it would be delayed in transit through mitosis. These results are interesting to learn whether the phosphorylation state or activity of p34cdc2 was affected by deleting or over- consistent with the possibility that E167 does indeed mimic constitutive Thr167 phosphorylation and that p34cdc2 must expressing these phosphatase genes. dephosphorylated in order to complete p34cdc2 protein kinase activity in S.pombe requires the ordinarily be entirely the cycle. Studies in cell free Xenopus extracts (Murray presence of a cyclin subunit and the ability of to cell p34cdc2 yeast (Ghiara et al., 1991) have bind to it (Booher and Beach, 1987, 1988; Booher et al., et al., 1989) and in budding B in order to inactivate 1989; Moreno et al., 1989). Our results indicate that shown that cyclin must be degraded 1 and exit from the mitotic state. Thrl67 phosphorylation might be required for the stable histone H kinase activity that association between and cyclin B. We found that Our results raise the possibility dephosphoryla- p34cdc2 p34cdc2 in exit from mitosis. non-phosphorylatable mutant, p34cdc2 Al67, was co- tion might also have a role the the Additional evidence that Thr167 phosphorylation is with antibodies to p56cdc13 but that the immunoprecipitated for function is provided by experiments brought down in these co-immuno- required amount of p34cdc2 p34cdc2-A167 to experiments compared with the wild-type examining the consequence of Thrl67 dephosphorylation precipitation less (see Figure 7). Furthermore, p34cdc2 activity in vitro. Experiments with okadaic acid protein was significantly on Thrl67 contain conditions where it specifically inhibits PP2A have mutants which cannot be phosphorylated under level (see that PP2A activity negatively regulates phosphorylated Tyrl5 but at an apparently reduced shown p34cdc2 activation in Xenopus egg extracts (Felix et al., 1990) Figure 2). Since Tyrl5 phosphorylation is thought to occur kinase and that inhibiting PP2A can lead to early activation of only after cyclin B binding (Solomon et al., 1990), it in systems (Goris it is not a prerequisite for an initial protein kinase activity several cell could be that although p34cdc2 et Picard et al., 1989; Yamashita et al., 1990). cyclin B, Thrl67 phosphorylation is required al., 1989; interaction with INH, which inhibited B complex. Overproduction Indeed, an endogenous activity, termed to form a stable cyclin -p34C& MPF in extracts was recently to a increase in activation Xenopus oocyte of p34Cdc2+ in cells leads large phosphoryla- form of PP2A et 1991). Lee et al. not of 10). Since the shown to be a (Lee al., tion of Thr167 but Tyrl5 (Figure that PP2A treatment of p34cdc2 resulted in B in cells is limiting in this (1991) showed amount of cyclin probably that Thrl67 dephosphorylation of at least one phosphopeptide from experiment, this result suggests phosphorylation association with cyclin B and that the overall dephosphorylation of might take place without prior p34cdc2 p34cdc2 does not. In contrast, both inactivation of histone HI protein kinase activity. whereas phosphorylation of Tyrl5 paralleled increase when DNA We have found that PP2A and protein phosphatase 1 Thr167 and Tyrl5 phosphorylation This result is not shown) dephosphorylated p34cdc2 in vitro replication is inhibited with hydroxyurea. (PP1) (data at Thrl67 and that these treatments resulted in a consistent with the observation that both cyclin B (Dasso primarily loss of protein kinase activity. As noted by Lee and Newport, 1990) and tyrosine phosphorylation p34cdc2 p34cdc2 of B to increase (Kumagai and Dunphy, 1991) when DNA replica- et al. (1991), dephosphorylation cyclin complexed PP2A treatment (Lee et al., 1991; tion is blocked in Xenopus extracts. Although experiments also occurs upon p34cdc2 our unpublished observations) and it is possible that cyclin in Xenopus cell-free extracts indicated that modification of or of other components occurs only after binding to dephosphorylation dephosphorylation by phosphorylation p34cdc2 to is the event responsible for the observed these experiments would not have detected an early bound cyclin B, p34cdc2 of histone HI kinase activity. Since it is not event which does not turn over during the inactivation phosphorylation whether or not cyclin phosphorylation is important of the et 1990). known course 32P-labelling (Solomon al., or if other Thrl67 lies in a highly conserved region of p34cdc2 for the activity of the -cyclin complex p34cdc2 be in these it is 11) and in a sequence alignment is in the same components might present complexes, (Figure of these the threonine phosphorylation site in difficult to interpret fully the results experiments. position as regulatory the of what MAP kinase et However, these results raise interesting question (Boulton al., 1990; Hanks, 1991; Payne removes from Thr167 in vivo et Like Thr167 of p34cdc2, protein phosphatase phosphate al., 1981). phosphorylation what of the cell of MAP kinase is required for its and at stage cycle. threonine phosphorylation of each PP2A et al., 1990) and kinase et al., 1990). Despite their Two isoforms (Kinoshita protein activity (Anderson et 1989) have to autophosphorylation sites in the cAMP- PP1 (Booher and Beach 1989; Ohkura al., proximity in and both of kinase and Zoller, 1990) and in been identified S.pombe types phosphatase dependent protein (Levin to the of the cell cycle (Booher numerous kinases (Hanks, 1991), there is have been linked regulation protein-tyrosine et Kinoshita et al., no evidence for the autophosphorylation of these sites. In and Beach, 1989; Okhura al., 1989; been identified as a of the of these threonines in vitro followed 1990). PP1 has also regulator fact, dephosphorylation and and the addition of does not result in their re- Aspergillus nidulans (Doonan Morris, 1989) by Mg/ATP et cell In (Payne et al., 1991; our unpublished data). D.melanogaster (Axton al., 1990) cycles. S.pombe, phosphorylation kinase of which encodes the PP2A Thus, either Thr167 is the target of another protein deletion ppa2 major activity event and reduced cell size at mitosis or Thrl67 phosphorylation is an autophosphorylation leads to slow cell growth cellular factor. there are regulated by an unknown (Kinoshita et al., 1990). Although probably many of PP2A in if Thr167 were one of its substrates cells, targets was entry into and the phosphatase activity reduced, early in from mitosis is Materials and methods mitosis and a exit exactly perhaps delay is for exit from what one would PPI activity required expect. cell culture Strains and Kinoshita et and et al., 1990) mitosis (Ohkura al., 1989; in this were the strain 972 h- The strains used study wild-type Spombe with of activa- also interacts regulators p34cdc2 cdc25-22 cdc2-33 leul-32 cdc2-L7 leul-32 genetically et h-, (Gutz al., 1974), h-, his3-237 The HYI strain in Given these and HYI (cdc2::CDC2Hs, leul-32, h-). cdc25 and wee] and h+ tion, (Booher Beach, 1989). 3307 K.L.Gould at al. which the human CDC2 cDNA has replaced the Spomnbe cdc2 + gene was acid Phosphoamino analysis provided by MacNeill. Cells were grown in minimal medium membrane were Stuart (Nurse, Slices of immobilon-P 32P-labelled containing p34cdc2 1975) containing the supplements in the presence or absence and and the subjected to partial acid hydrolysis (Kamps Sefton, 1989) appro?riate of 5 thiamine. For [3 P]orthophosphate labelling, cells were were in two dimensions grown phosphoamino acids dig/ml separated by thin-layer overnight to a density of x 106- 1 x cells/ml and 3.5 et 5 107 in phosphate-free electrophoresis at 1.9 pH pH (Cooper al., 1983). minimal medium (Moreno et al., 1991a) with 100 NaH2PO4 and Ag/ml appropriate supplements. Cells were filtered, at 5 x 106 resuspended Phosphatase treatments cells/mi in mi phosphate-free minimal medium with 50 4711 as detailed above and 5 NaH2PO4, was with immunoprecipitated Ag/mi p34cdc2 h. buffer mM and labelled with 1-2 mCi [32P]orthophosphate (NEN) for 3-4 in 20 resuspended protein-tyrosine phosphatase (25 HEPES, I1 Hydroxyurea when used mM PMSF and 5 mM or PP2A was added to cultures at a final concentration of 0.1% 1 pH 7.2, /3-mercaptoethanol, EDTA) 12 mM. For experiments which mM involved a temperature shift, cells were buffer mM 1 bovine serum 1 (10 Tris, pH 7.5, mg/mi albumin, grown to a density of 5 x 106 cells/mi at 25°C and then placed at the 0.5 mM and 1 mM PP2A in 1 was added dithiothreitol, MnCl2 PMSF). Al restrictive temperature of 36°C. Transformations were carried out as to a final concentration of 10 One of the truncated 37 kDa mU/mi. 1il form described (Moreno et al., 1991). T-cell PTPase from SF9 cells with an undetermined of the purified specific from as activity was used to remove phosphotyrosine p34cdc2 reported Incubations with the were et previously (Gould al., 1990). phosphatases Oligonucleotide mutagenesis and plasmids for 30 at min. performed 30°C The cdc2 + cDNA with a NdeI site at the initiation codon and a BamHI site in shortly after the stop codon (Gould and Nurse, 1989) the phagemid pTZ19R (Pharmacia) in vitro was mutagenized using the Amersham mutagenesis kit Acknowledaements according to the manufacturer's instructions. The following 20-base long oligonucleotides were used. We wish to thank our colleagues in the Cell Cycle Group for helpful (1) CGGAACTATTCGCATGAGAT for Serl67 discussions. We are especially grateful to Rachel Bartlett for guiding K.L.G. (2) CGGAACTATGCGCATGAGAT for Alal67 through some of the FACS analyses, Kevin Crawford and Julian Blow for (3) for CGGAACTATTATCATGAGAT Tyrl67 p13 beads, Ursula Fleig for advice, encouragement and comments on the (4) for CGGAACTATGATCATGAGAT Aspl67 manuscript, Jacky Hayles for antibodies to for his p56cdc13, Gordy Hering (5) CGGAACTATGATCATGAGAT for Glu167 contributions to the artwork and photographic Dick MacIntosh for advice, (6) GAAGGAACCTTTGGCGTTGT for PhelS. advice on immunofluorescence procedures, and Stuart MacNeill for the HYl The coding regions of the mutant cDNAs were removed from pTZ19R strain. We are also grateful to Cohen for his kind of PP2A and Philip gift by digesting with NdeI and BamHI and cloned into pMNS21L under PP1, and to Nick Tonks, N.F.Zander and J.A.Lorenzen for the providing control of the thiamine-repressible nmtl promoter (Maundrell, 1990) using T-cell protein-tyrosine phosphatase. K.L.G. and S.S. were fellows of the standard recombinant DNA techniques (Maniatis et al., 1982). The resultant Jane Coffin Memorial Fund for Medical and the ICRF Childs Research, plasmids were then sequenced throughout the coding region of cdc2 and MRC provided financial support for this work. using the dideoxynucleotide techniques suggested in a Sequenase kit manual (US Biochemicals). References Immunoprecipitation, immunoblotting and protein kinase assays Approximately 2 x 108 cells were washed once in 4 ml 0.9% NaCl, and Anderson,N.G., Maller,J.L., Tonks,N.K. Sturgill,T.W. (1990) Nature, 1 mM NaN3, 10 mM EDTA, 50 mM NaF and lysed by with vortexing 343, 651-653. glass beads in 10 HB15 buffer (25 mM 60 mM MOPS, pH 7.2, Axton,M.A., Dombradi,V., Cohen,P.T.W. and Glover,D.M. (1990) Cell, Al (3-glycerophosphate, 15 mM 15 mM p-nitrophenylphosphate, EDTA, 63, 33-46. 15 mM MgCl2, 1 mM DTT, 100 sodium 1 mM orthovanadate, Blow,J.J. and Nurse,P. 855-862. /M (1990) Cell, 62, PMSF, 5 leupeptin, 1% Nonidet 130 TLCK and 130 ytg/ml P-40, Booher,R. and Beach,D. (1986) Mol. Cell. 3523-3530. AM AM Biol., 6, TPCK). For immunoprecipitation with the anti-C-terminal peptide antibody, Booher,R. and Beach,D. (1987) EMBO J., 3441-3447. 6, PN24 (Simanis and Nurse, 1986), 250 of B buffer was added M (10 Booher,R. and Beach,D. (1988) EMBO J., 2321-2327. Al 8, sodium phosphate, pH 1 mM 1 mM 50 mM 7.0, 0.5 % SDS, DTT, EDTA, Booher,R. and Beach,D. (1989) Cell, 57, 1009-1016. sodium 1 mM 4 fluoride, 100 sodium orthovanadate, PMSF, 1tM Agg/ml Booher,R.N., Alfa,C.E., Hyams,J.S. and Beach,D.H. (1989) Cell, 58, leupeptin and 4 aprotinin), the lysate was brought to for 2 mmn 100°C 485-497. Ag/ml and then diluted with 750 of buffer N mM sodium ,Il (10 phosphate, pH 7.0, Boulton,T.G., Yancopoulos,G.D., Gregory,J.S., Slaughter,C., Moomaw, 0.15 M NaCl, 1% Nonidet P40, 2 mM 50 mM sodium EDTA, fluoride, C., Hsu,J. and Cobb,M.H. (1990) Science, 249, 64-67. 100 1tM sodium orthovanadate, 1 mM For 5 leupeptin, PMSF). Brizeula,L., EMBO 3507-3514. Ag/ml Draetta,G. and Beach,D. (1987) J., 6, immunoprecipitation with an antiserum raised against bacterially produced Cisek,L.J. and 679-684. Corden,J.L. (1989) Nature, 339, fission yeast 4711 (Gould and Nurse, 1989), 1 ml of buffer N was p34cdc2, and Hunter,T. Methods 99, Cooper,J.A., Sefton,B.M. (1983) Enzymol., added. After two 30 min clearing spins in a incubations with microfuge, 387-402. PN24 and 4711 were performed in antibody excess for 1 h on ice. Protein Cross,F. (1988) Mol. Cell. Biol., 8, 4675-4684. A-Sepharose was then added for 30 min at 4°C and the immune complexes Dasso,M. and 811-823. Newport,J.W. (1990) Cell, 61, were washed thoroughly with buffer N. For immunoblotting, the immune Dean,A.M. and Jr 1044-1046. Koshland,D.E., (1990) Science, 249, complexes were heated to 100°C for 2 min in 1 x SDS-gel sample buffer, Doonan,J.H. and Morris,N.R. (1989) Cell, 57, 987-996. resolved on SDS- 15% polyacrylamide gels, transferred to immobilon-P Draetta,G. (1990) Trends Biochem. 378-383. Sci., 15, PN24 4711 (Millipore), and incubated with 400-fold dilutions of either or Draetta,G. and Beach,D. (1988) Cell, 54, 17-26. followed by [1251]protein A. Protein kinase assays of the immune com- Draetta,G., Brizuela,L., Potashkin,J. and Beach,D. (1987) Cell, 50, plexes 100 unlabelled were performed in 20 1l HB buffer with ATP, 319-325. AM 0.2 [32P]ATP (3000 Ci/mmol) and 10,ug histone HI (Boehringer ytCi Draetta,G., Luca,F., Westendorf,J., Brizeula,L., Rudeman,J. and Beach,D. Mannheim) for 10 min at 30°C. Reactions were stopped by the addition (1989) Cell, 56, 829-838. of 2 x sample buffer and loaded onto SDS- 15% polyacrylamide gels. Ducommun,B., Draetta,G., Young,P. and Beach,D. (1990) Biochem. Phosphorylated histone HI was visualized by autoradiography. Biophys. Res. Commun., 167, 301-309. Dunphy,W.G. and Newport,J.W. (1989) Cell, 58, 181-191. Flow Dunphy,W.G., cytometry and microscopy Brizuela,L., Beach,D. and Newport,J. (1988) Cell, 54, For flow cytometric analysis, cells were fixed in 70% 423-431. ethanol, stained with propidium iodide, and analysed as detailed previously Durkacz,B., Beach,D., Hayles,J. and (Sazer and Sherwood, Nurse,P. (1985) Mol. Gen. Genet., 1990) using a FACScan flow cytometer. 201, 543-545. 4',6-Diamidino-2-phenylindole (DAPI) staining was as described D'Urso,G., Marraccino,R.L., Marshak,D.R. and Roberts,J.M. (1990) (Moreno et al., 1991a). For indirect immunofluorescence, cells were fixed with Science, 250, 786-791. paraformaldehyde and glutaraldehyde and stained with a monoclonal antibody raised against rat Featherstone,C. and Russell,P. (1991) Nature, 349, 808-811. tubulin followed by Texas Red-conjugated goat anti-mouse IgG essentially Felix,M.-A., Pines,J., Hunt,T. and Karsenti,E. (1989) EMBO J., 8, as described (Moreno et al., 1991a). Cells were viewed with a Zeiss 3059-3069. Felix,M.-A., Axioskop microscope and photographs were taken using XP-1 film (Ilford). Cohen,P. and Karsenti,E. (1990) EMBO J., 9, 675-683. 3308 p34cdc2 Thr167 phosphorylation S.pombe Norbury,C.J., Blow,J.J. and Nurse,P. (1991) EMBO J., 10, 3321-3329. Fleig,U.N. and Nurse,P. (1991) Mol. Gen. Genet., 226, 432-440. Nurse,P. (1990) Nature, 344, 503-508. Freeman,R.A. and Donoghue,D.J. (1991) Biochemistry, 30, 2293-2302. Nurse,P. and Bissett,Y. (1981) Nature, 292, 558-560. Furukawa,Y., Piwnica-Worms,H., Ernst,T.J., Kanakura,Y. and Griffith, J.D. Science, 250, 805-808. Ohkura,H., Kinoshita,N., Miyatani,S., Toda,T. and Yanagida,M. (1989) (1990) Cell, 57, 997-1007. Gautier,J. and Maller,J.L. (1991) EMBO J., 10, 177-182. Payne,D.M., Rossomando,A.J., Martino,P., Erickson,A.K., Her,J.-H., Gautier,J., Norbury,C.J., Lohka,M., Nurse,P. and Maller,J. (1988) Cell, Shabanowitz,J., Hunt,D.F., Weber,M.J. and Sturgill,T.W. (1991) EMBO 433-439. 54, J., 10, 885-892. Gautier,J., Matsukawa,T., Nurse,P. and Maller,J. (1989) Nature, 339, Picard,A., Capony,J.P., Brautigan,D.L. and Doree,M. (1989) J. Cell Biol., 626-629. 109, 3347-3354. Gautier,J., Minshull,J., Lohka,M., Glotzer,M., Hunt,T. and Maller,J.L. Piggott,J.R., Rai,R. and Carter,B.L.A. (1982) Nature, 298, 391-393. Cell, 60, 487-494. (1990) Pines,J. and Hunter,T. (1989) Cell, 58, 833-846. Sugimoto,K., Henze,M., Lew,D.J., Ghiara,J.B., Richardson,H.E., Pines,J. and Hunter,T. (1990) The New Biol., 2, 389-401. Wittenberg,C. and Reed,S.I. (1991) Cell, 65, 163-174. Pondaven,P., Meijer,L. and Beach,D. (1990) Genes Dev., 4, 9-17. Goris,J., Hermann,J., Hendrix,P., Ozon,R. and Merlevede,W. (1989) FEBS Reed,S.I. and Wittenberg,C. (1990) Proc. Natl Acad. Sci. USA, 87, Lett., 245, 91-94. 5697-5701. and Nurse,P. (1989) Nature, 342, 39-45. Gould,K.L. Richardson,H.E., Wittenberg,C., Cross,F. and Reed,S.I. (1989) Cell, 59, Moreno,S., Tonks,N.K. and Nurse,P. (1990) Science, 250, Gould,K.L., 1127-1133. 1573-1576. Russell,P. and Nurse,P. (1986) Cell, 45, 145-153. Leupold,U. and Lopprieno,N. (1974) In King,R.C. Gutz,H., Heslot,H., Russell,P. and Nurse,P. (1987) Cell, 49, 559-567. Genetics. Plenum, New York, Vol. 1, pp. 395-446. (ed.), Handbook of Sazer,S. and Sherwood,S.W. (1990) J. Cell Sci., 97, 509-516. Wittenberg,C., Richardson,H.E., de Barros Lopes,M. and Hadwiger,J.A., Simanis,V. and Nurse,P. (1986) Cell, 45, 261-268. (1989) Proc. Natl Acad. Sci. USA, 86, 6255-6259. Reed,S.I. Solomon,M.J., Glotzer,M., Lee,T.H., Philippe,M. and Kirschner,M.W. (1988) J. Cell Sci., 91, 587-595. Hagan,I., Hayles,J. and Nurse,P. (1990) Cell, 63, 1013- 1024. Hanks,S.K. (1991) Curr. Opin. Structural Biol., 1, 369-383. Spurr,N.K., Gough,A.C. and Lee,M.G. (1990) J. DNA Sequencing Hindley,J. and Phear,G.A. (1984) Gene, 31, 129-134. Mapping, 1, 49-54. Hirt,H., Pay,A., Gyorgyey,J., Bako,L., Nemeth,K., Bogre,L., Schweyen, Surana,U., Robitsch,H., Price,C., Schuster,T., Fitch,I., Futcher,B. and R.J., Heberle-Bors,E. and Dudits,D. (1981) Proc. Natl Acad. Sci. USA, Nasmyth,K. (1991) Cell, 65, 145-161. 88, 1636-1640. Th'ng,J.P.H., Wright,P.S., Hamaguchi,J., Lee,M.G., Norbury,C.J., Hurley,J.S., Dean,A.M., Sohl,J.L., Koshland,D.E., Jr and Stroud,R.M. Nurse,P. and Bradbury,E.M. (1990) Cell, 63, 313-324. Science, 249, 1012-1016. (1990) Thomess,P.E. and Koshland,D.E., Jr (1987) Proc. Natl Acad. Sci. USA, Ducommun,B. and Beach,D. (1990) FEBS Lett., 266, 4-8. Jessus,C., 262, 10422-10425. and Glover,D.M. (1990) EMBO J., 9, Jimenez,J., Alphey,L., Nurse,P. Wittenberg,C., Sugimoto,K. and Reed,S.I. (1990) Cell, 62, 225-237. 3565-3571. Yamashita,K., Yasuda,H., Pines,J., Yasumoto,K., Hishitani,H., Ohtsubo, (1989) Anal. Biochem., 176, 22-27. Kamps,M.P. and Sefton,B.M. M., Hunter,T., Sugimura,T. and Nishimoto,T. (1990) EMBO J., 9, and Yanagida,M. (1990) Cell, 63, 405-415. Kinoshita,N., Ohkura,H. 4331 -4338. EMBO J., 8, 3071-3078. Krek,W. and Nigg,E.A. (1989) EMBO J., 10, 305-316. Krek,W. and Nigg,E.A. (1981) Received on June 7, 1991; revised on July 11, 1991 Cell, 64, 903-914. Kumagai,A. and Dunphy,W.G. (1981) and Doree,M. (1988) Nature, Labbe,J.-C., Lee,M.G., Nurse,P., Picard,A. 335, 251-254. Labbe,J.-C., Capony,J.-C., Caput,D., Cavadore,J.-C., Derancourt,J., Lelias,J.-M., Picard,A. and Doree,M. (1989a) EMBO J., Kaghad,M., 8, 3053-3058. Picard,A., Peaucellier,G., Cavadore,J.C., Nurse,P. and Labbe,J.-C., Doree,M. (1989b) Cell, 57, 253-263. and Nurse,P. (1987) Nature, 327, 31-35. Lee,M.G. and Nurse,P. (1988) Nature, 333, Norbury,C.J., Spurr,N.K. Lee,M.G., 676-679. Solomon,M.J., Mumby,M.C. and Kirschner,M.W. (1991) Cell, Lee,T.H., 64, 415-423. and O'Farrell,P.H. (1990) EMBO J., 9, 3573-3581. Lehner,C.F. and Zoller,M.J. (1990) Mol. Cell. Biol., 10, 1066-1075. Levin,L.R. 61, 743-752. Lewin,B. (1990) Cell, J. Cell Sci., 92, 131-135. Lohka,M.J. (1989) and (1984) Nature, 307, 183-185. Lorincz,A.T. Reed,S.I. Booher,R., Dembski,M., Kirschner,M. and Lundgren,K., Walwroth,N., (1991) Cell, 64, 1111-1122. Beach,D. and Sambrook,J. (1982) Molecular Cloning: A Maniatis,T., Fritsch,E.F. Manual. Cold Spring Harbor Laboratory Press, Cold Spring Laboratory NY. Harbor, J. Biol. Chem., 265, 10857-10861. Maundrell,K. (1990) Golsteyn,R., Pines,J., Brizuela,L., Hunt,T. and Meijer,L., Arion,D., EMBO J., 8, 2275-2282. Beach,D. (1989) and Reed,S.I. (1987) Cell, 50, 927-935. Mendenhall,M.D., Jones,C.A. Richardson,H.E. and Reed,S.I. (1988) Proc. Natl Acad. Mendenhall,M.D., Sci. 4426-4430. USA, 85, Hayles,J. and Nurse,P. (1989) Cell, 58, 361-372. Moreno,S., Klar,A. and Nurse,P. (1991a) Methods Enzymol., 194, Moreno,S., 795-823. Nature, 344, 549-552. Nurse,P. and Russell,P. (1991b) Moreno,S., and Cell, 58, Draetta,G., Beach,D. Wang,J.Y.J. (1989) Morla,A.O., 193-203. Science, 246, 614-621. and Kirschner,M.W. (1989) Murray,A.W. and (1989) Nature, 339, Murray,A.W., Solomon,M.J. Kirschner,M.W. 280-286. and Futcher,A.B. (1988) Anand,S., Erickson,K. Nash,R., Tokiwa,G., -4336. EMBO 4335 J., 7, http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

Phosphorylation at Thr167 is required for Schizosaccharomyces pombe p34cdc2 function.

Gould, K.L.; Moreno, S.; Owen, D.J.; Sazer, S.; Nurse, P.
The EMBO Journal , Volume 10 (11) – Nov 1, 1991
Download PDF
13 pages

Loading next page...
 
/lp/springer-journals/phosphorylation-at-thr167-is-required-for-schizosaccharomyces-pombe-VM30V9tqMW

References (0)

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 1991
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1002/j.1460-2075.1991.tb04894.x
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal vol.10 no.11 pp.3297-3309, 1991 Phosphorylation at Thri 67 is required for pombe p34Cdc2 function Schizosaccharomyces Booher et al., 1989; Dunphy and Newport, 1989; Felix Kathleen L.Gould', Sergio Moreno, et al., 1989; Gautier et al., 1989; Moreno et al., 1989; Pines David J.Owen, Shelley Sazer and Paul Nurse and Hunter, 1989; Pondaven et al., 1990; Krek and Nigg, Cell Cycle Group, Microbiology Unit, Department of Biochemistry, 1991; Surana et al., 1991). Further, the regulation of its of Oxford, Oxford OXI 3QU, UK University series of post-translational activation involves a complicated of Cell Biology, School of Medicine. associations (reviewed by Lohka, 'Present address: Department modifications and subunit University, Nashville, TN 37232, USA Vanderbilt 1989; Draetta, 1990; Lewin, 1990; Nurse, 1990; Pines and P.Nurse Hunter, 1990; Freeman and Donoghue, 1991). In particular, Communicated by activation of is associated with its binding to a 034cdc2 cycle progression requires the periodic cyclin molecule (Draetta and Beach, 1988; Booher et al., Eukaryotic cell and inactivation of a protein-serine/threonine 1989; Felix et al., 1989; Labbe et al., 1989a; Meijer et al., activation which in fission yeast is encoded by the cdc2+ 1989; Pines and Hunter, 1989; Gautier et al., 1990; Solomon kinase The of this gene product, p34cdc2, is et 1990) while inactivation of involves cyclin gene. activity al., p34cdc2 interactions with other et al., 1989; Murray et al., 1989; Felix controlled by numerous proteins destruction (Draetta In fission p34Cdc2 et Ghiara et al., 1991). In yeasts, two classes of and by its phosphorylation state. yeast, al., 1990; of which has been have been identified which appear to is phosphorylated on two sites, one cyclin-like proteins of Tyrl5 regulate function either during the G1 phase (Cross, identified as Tyrl5. Dephosphorylation p34cdc2 mitosis. To understand more et al., 1989; Richardson the initiation of 1988; Nash et al., 1988; Hadwiger regulates during the G2 the regulation of p34""'2 kinase activity, et al., 1989; Wittenberg et al., 1990) or completely 1988; Hagan et al., 1988; the second site of phosphorylation phase (Booher and Beach, 1987, we have identified et al., 1991; Surana et al., Thrl67, a residue conserved amongst all p34Cdc2 Moreno et al., 1989; Ghiara as a complex of p34cdc2 By analysing the phenotypes of cells 1991) of the cell cycle. However, homologues. and Mailer, various 167 mutations and performing bound to cyclin is not necessarily active (Gautier expressing position of is regulated further in vitro we establish that Thrl67 phos- 1991). The timing p34cdc2 activation experiments, is for p34"""2 kinase activity at the phosphorylation state of p34cdc2 (Draetta et al., phorylation required by and is involved in the association of p34cdc2 with 1988; Dunphy and Newport, 1989; Gould and Nurse, 1989; mitosis Jessus et B. of Thrl67 might also play Morla et al., 1989; Gould et al., 1990; al., cyclin Dephosphorylation a role in the exit from mitosis. 1990; Pondaven et al., 1990; Solomon et al., 1990; Krek cell kinase/ and 1991; Lundgren et al., 1991; Norbury et al., Key words: cycle/phosphorylation/protein Nigg, 1991). Schizosaccharomyces pombe p34cdc2 is phosphorylated on up to four different sites p34cdc2 on the cell type (Draetta et al., 1988; Gould and depending 1989; Morla et al., 1989; Norbury et al., 1991; Nurse, Introduction Solomon et Krek and Nigg, 1991). Phosphoryla- al., 1990; that kinase is a key regulator of eukaryotic tion of each site varies during the cell cycle indicating The protein p34cdc2 by Lohka, 1989; Murray each has a potential regulatory function (Draetta et al., 1988; cell cycle progression (reviewed Nurse, 1989; Labbe Nurse, 1990). In the Dunphy and Newport, 1989; Gould and and Kirschner, 1989; Draetta, 1990; al., et and kinase activity et al., 1989b; Morla et 1989; Norbury al., 1991; fission budding yeasts, p34cdc2 protein et Krek and Nigg, both the initiation of DNA replication and the entry Pondaven et al., 1990; Solomon al., 1990; controls in fission yeast, into mitosis and Bissett, 1981; Piggott et al., 1991). We have previously shown that (Nurse two sites during a normal and Surana et al., 1991). is phosphorylated on just 1982; Reed Wittenberg, 1990; p34cdc2 and of have been identified in all multi- cell one of which is Tyrl5 (Gould Nurse, 1989). Homologues cycle, p34cdc2 all and has examined et Lee and Tyrl5 is conserved amongst proteins cellular eukaryotes (Draetta al., 1987; p34cdc2 of in the and Krek and been identified as the site tyrosine phosphorylation Nurse, 1987; Cisek Corden, 1989; Nigg, and mammalian et 1990; Lehner and O'Farrell, 1990; chicken (Krek and 1991) (Norbury 1989; Jimenez al., Nigg, The role of Tyrl5 et 1990; Hirt et al., 1991) where et al., 1991) p34cdc2 homologues. Spurr al., p34cdc2 is to inhibit activation of p34cdc2 (Gould entry into mitosis (Th'ng et al., 1990) as a phosphorylation regulates factor and that is bound to cyclin (Solomon et al., of M-phase promoting (MPF) (Dunphy Nurse, 1989) component and controls the of Tyrl5 is dependent upon the et Gautier et al., 1988) probably 1990). Phosphorylation al., 1988; and as well and Nurse, 1990; of both the mitotic inhibitor, plO7weeJ (Russell initiation of DNA replication (Blow presence and and another Furukawa et 1987; Featherstone Russell, 1991), D'Urso et al., 1990; al., 1990). Nurse, molecule encodes a in a of cells and cell-free have which p107weel-related Studies variety systems gene, mikl, The mitotic activator kinase is in the (Lundgren et al., 1991). p80cdc25 shown that protein activity periodic p34cdc2 et Moreno and Ducommun al., at the transition (Russell Nurse, 1986; 1990; cell cycle peaking G2/M-phase (Mendenhall or de- Labbe et et regulates Tyrl5 Draetta and al., 1991b), directly indirectly et al., 1987; Beach, 1988; al., 1988; Oxford Press University et al. K.L.Gould since it is not within all four NCS phosphorylation (Gould et al., 1990; Kumagai and Dunphy, phosphorylation site In Thrl4 has also been identified fragments which contained the threonine. 1991). higher eukaryotes, phosphorylated as a major site of phosphorylation (Norbury et al., 1991; four different Partial V8 protease digestion yielded fragments Krek and Nigg, 1991). Phosphorylation of Thrl4 acts in con- - and -29 kDa and which ranged between 10 (Gould and immuno- junction with Tyrl5 phosphorylation to inhibit Nurse, 1989; Fleig Nurse, 1991). Again by p34cdc2 with antibodies for the termini of activation (Norbury et al., 1991). A serine phosphorylation blotting specific p34cdc2, V8 contained site has also been mapped in chicken although its it was determined that the largest fragment the p34cdc2 function is not known (Krek and Nigg, 1991). C-terminus while the smallest fragment of - 10 kDa We had observed previously that p34cdc2 was phos- contained the N-terminus (data not shown, schematized in phorylated on a threonine residue in addition to Tyrl5 (Gould The 10 kDa also reacted with an Figure lA). fragment the of the and Nurse, 1989). Here, we report identity iYY-a :I .je site is #A4 phosphorylated residue as Thrl67. The comparable O ,- _-;' Ts * . * in all present and is most likely phosphorylated p34cdc2 homologues (Solomon et al., 1990; Krek and Nigg, 1991; of Norbury et al., 1991). To examine the function Thrl67 with phosphorylation in cells, we have replaced Thrl67 several different amino acids by site-directed mutagenesis and expressed the mutant p34Cdc2 proteins in fission yeast. We have found that in contrast to the inhibitory effect of Tyrl5 phosphorylation, Thrl67 phosphorylation is essential for kinase activity at mitosis. It appears to be p34cdc2 in of with involved the stable association p34cdc2 p56cdcI3 of this residue a role in and dephosphorylation might play from mitosis. I exit I I IL ---- Results of the threonine site Localization phosphorylation - -1. -.. '.. 1- :" '. (- Ti e 1. -: Tryptic cleavage of 32P-labelled Schizosaccharomyces pombe p34cdc2 generated only two phosphopeptides, termed 1 2 1 and (Gould and Nurse, 1989). Phosphopeptide contained phosphorylated Tyrl5 and phosphopeptide contained phosphothreonine (Gould and Nurse, 1989). The of on electrophoretic mobility phosphopeptide thin-layer cellulose plates at pH 4.7 relative to a neutral dye marker and to phosphopeptide 1 (data not shown) indicated that the contained a and peptide single phosphate moiety suggested that was at a S.pombe phosphorylated single p34cd2 ser ,Op threonine. I,p-thr To identify this target threonine, we assumed that the site ,p-tyr of threonine phosphorylation would be conserved throughout evolution. A of and sequence comparison S.pombe (Hindley cerevisiae Phear, 1984), Saccharomyces (Lorincz and Reed, and 1984), human (Lee and Nurse, 1987), chicken (Krek Nigg, 1989), Drosophila melanogaster (Jimenez et al., 1990; Lehner and O'Farrell, 1990) and murine (Cisek and Corden, 1989; Spurr et al., 1990) p34cdc2 homologues revealed that six threonines were present in all of them, threonines at amino acid positions 14, 47, 167, 172, 189 and 228 of the S.pombe protein. 1. the site of threonine Schematic Fig. Locating phosphorylation. (A) of the sites of NCS and V8 and the Two different were representations protease clipping partial proteolytic mapping procedures resultant fragments which helped to localize the site of threonine used to localize the threonine: chemical phosphorylated phosphorylation. These representations are based on the ability of the with N-chlorosuccinimide and cleavage (NCS) enzymatic fragments to be recognized by antibodies directed against various with aureus V8 NCS cleavage Staphylococcus protease. peptides and bacterially produced fragments. We do not know exactly where the two intermediate-sized V8 fragments are derived from and cleavage of gave rise to four major fragments of p34cdc2 their is placement only approximate. (B) Phosphoamino acid analysis - 32-19 kDa. By immunoblotting with antibodies specific of Wild-type Spombe cells were labelled with p34cdc2. for either the N-terminal or the C-terminal seven amino acids [32P]orthophosphate, was immunoprecipitated with PN24 from p34cdc2 and it of (Simanis Nurse, 1986), was found that p34cdc2 denatured resolved lysates, by electrophoresis on SDS-polyacrylarnide these four contained the N of fragments terminus the protein gel, transferred to immobilon-P and partially hydrolysed in acid. The phosphoamino acids were resolved by two-dimensional thin-layer but lacked the C terminus (data not shown, schematized electrophoresis. Autoradiography was for 5 days at -70°C with in Figure 1A). Phosphoamino acid analyses of the four pre-sensitized Kodak XAR5 film and intensifying screens. Letters a-e 32P-labelled NCS fragments showed that all four contained indicate phosphopeptides and o indicates the position of the origin. P, both phosphotyrosine and phosphothreonine (data not free phosphate; p-ser, phosphoserine; p-thr, phosphothreonine; p-tyr, shown). Thus, threonine 228 was eliminated as a possible phosphotyrosine. 3298 Thr l67 S.pombe p34cdc2 phosphorylation antibody raised against a peptide containing amino acids and Thr 167 was changed to alanine. The mutant and 42-57 of p34cdc2 (the PSTAIRE peptide, Lee and Nurse, wild-type cDNAs were each subcloned into the S.pombe 1987) (data not shown). Phosphoamino acid analysis revealed expression vector, pMNS21L (Maundrell, 1990), such that that whereas the three larger V8 fragments contained only of transcription the mutants was driven by the thiamine phosphothreonine, the smallest fragment contained phospho- repressible nmtl promoter. Each mutant was then expressed tyrosine only (Fleig and Nurse, 1991). Therefore, threonines in HYl (a gift from Stuart MacNeill), an S.pombe strain 14 and 47 were eliminated as candidates since both are in which the wild-type cdc2 protein coding region has located within the N-terminal V8 fragment which did not been replaced with the human CDC2 cDNA. Mutant contain phosphothreonine leaving threonine 167, 172 or 189 S.pombe cdc2 proteins expressed in HY 1 can be examined as the potential target. biochemically using antibodies which recognize S.pombe Another piece of evidence regarding the identity of the but do not recognize human p34cdc2 (4711 or p34cdc2 phosphorylated threonine came from an examination of the PN24, described in Materials and methods). To permit 32P-labelled partial acid hydrolysis products of In analyses of the non-functional mutant proteins, it was p34cdc2. addition to the phosphoamino acids, a series of found necessary (see below) to select HY 1 strains in incompletely which hydrolysed small the pMNS21 L plasmids containing the phosphopeptides and free 32p could mutant cdc2 cDNAs be visualized by autoradiography of a had integrated into the genome and were two-dimensional maintained stably. separation of phosphoamino This was not necessary and was not acids (Figure iB). done in the cases of p34cdc2 There are two partial products above the origin (a and b) the cdc2 + and cdc2-S 167 cDNAs which had no deleterious and three to the of the right origin (c, d and e) (Figure IB). effects on the cells. HYI cells expressing various cdc2 Rehydrolysis in acid of products a and b together yielded 2 1|.l both phosphotyrosine and phosphothreonine whereas that of d and e c, together produced only phosphothreonine (data not shown). The electrophoretic - migration of products c e toward the negative electrode at pH 1.9 could only be explained by the presence of a amino positively charged acid(s) very close to the threonine residue. phosphorylated Of the three remaining candidates (threonines 167, 172 and 189), only threonine 167 (Thr167) is near a basic amino acid (histidine 168) and, therefore, it seemed likely to be the site of phosphorylation. To confirm that Thr167 was indeed the single site of threonine phosphorylation in S.pombe and to p34cdc2 discover what if at this effect, any, phosphorylation site had on p34cdc2 function, the codon Thr at specifying position 167 was replaced with those encoding either alanine (A 167), serine (S167), glutamic acid acid (E167), aspartic (D167) E3 or tyrosine site-directed of the (Y167) by mutagenesis cdc2 + cDNA. A double mutant was also cdc2- constructed, in F15/A167, which Tyrl5 was changed to phenylalanine -t S -.y Dl S . Fig. 2. acid of proteins. HYI strains Phosphoamino analyses p34cdc2 expressing wild-type or one of five mutants were labelled with p34cdc2 were The p34cdc2 proteins immunoprecipitated [32P]orthophosphate. with resolved on a transferred to PN24, SDS-polyacrylamide gel, and with acid. The resultant 3. of mutants to rescue The of various immobilon-P, partially hydrolysed Fig. Ability cdc2'. (A) ability cdc2-33 strain phosphoamino acids were resolved two-dimensional cdc2 mutants to rescue of the at the non- by thin-layer growth of Cells the various The times of the were 4-6 cdc2 electrophoresis. exposure autoradiographs permissive temperature 36°C. (B) expressing were to a of -5 x 106 at days at with Kodak XAR5 film and mutants grown density cells/mi 25°C, -70°C pre-sensitized intensifying for 4 and stained with DAPI. screens. transferred to 36°C h, fixed, s, phosphoserine; t, phosphothreonine; y, phosphotyrosine. 3299 K.L.Gould et al. The of cells proteins in the presence of thiamine were labelled with report (Booher and Beach, 1986). phenotypes these mutants in culture after 4 h at [32P]orthophosphate, and the S.pombe cdc2 proteins were expressing liquid 36°C are shown in 3B. Cells + or immunoprecipitated with PN24, transferred to immobilon-P Figure expressing p34cdc2 were and subjected to phosphoamino acid analyses. Wild-type -S167 phenotypically wild-type, p34cdc2-E67 p34cdc2 S.pombe contained all three phosphoamino acids expressing cells generally contained one or more septa p34cdc2 (Figure 2A) in the same relative amounts as we have reported and two or more nuclei, and cells expressing the other a nucleus previously (Gould and Nurse, 1989; and Nurse, 1991). mutants were highly elongated and contained single Fleig The p34cdc2-A167 p34cdc2El67 and p34cdc2- 167 proteins lacked (Figure 3B). but still contained phosphothreonine phosphotyrosine (Figure and of the mutant cdc2 2B, C and D). Both phosphothreonine phosphotyrosine Overproduction protein the mutants at were absent from p34cdc2-F15IA167 indicating that positions As show above, non-phosphorylatable position unable to when 167 and 15 were the only major phosphoacceptor sites in 167 were complement cdc2'5 they were levels. To examine whether the protein (Figure 2E). The cdc2-S167 protein was not expressed at low to moderate could for their defects phosphorylated on threonine but was heavily phosphorylated higher than normal levels compensate ts cdc2 mutants et on serine residues (Figure 2F). Further analysis of partial as is the case for certain (Durkacz al., acid hydrolysis products and phosphopeptides from 1985), thiamine was removed from the media to allow high the was levels of expression from nmtl promoter. Overexpression p34cdc2-S167 showed that Serl67 indeed phosphorylated mutants to rescue and accounted for all of the observed did not change the ability of the cdc2fs. phosphoserine (data not shown). These data establish that Thrl67 is the Moreover, in the HY1 strain or at the firmly permissive temperature site of in the cdc2-33 strain, overproduction of these mutants led phosphorylation. amount of serine observed to cell and cessation of division. The The small phosphorylation elongation phenotypes of of HYl cells induction of or 167 in many phosphoamino acid analyses S.pombe during p34cdc2 p34cdc2-A167 p34cdc-t in 4A and Twelve to (see Figure 2A-E) appears to be artefactual (Fleig and are shown Figure B, respectively. hours after thiamine was removed from the Nurse, 1991). If of 32P-labelled fourteen media, immunoprecipitates cells to This coincides with S.pombe are subjected to tryptic digestion or partial the began elongate. timing p34cdc2 or of nmtl + digestion with either V8 protease N-chlorosuccinimide, upregulation promoter activity (Maundrell, 1990) in or of the mutant phosphoserine is not recovered any fragment and overexpression proteins (see below; Fleig and and Nurse, 1991). In the case of cells became phosphopeptide (Gould and Nurse, 1989; Fleig Nurse, p34cdc2E167, the contamination branched and accumulated nuclei 1991). This indicates that phosphoserine multiply septated, multiple is from a multitude of minor contaminants and is The of these derived (Figure 4B). toxicity non-complementing a Further evidence our in them not due to major contaminating protein. mutants explained difficulty maintaining on vectors and it was supporting the notion that is not episomally high copy-number why S.pombe p34cdc2 in the to obtain of these mutants under phosphorylated on serine is that every serine residue necessary integrants control in order to their C-terminal third of the protein including the serine residue thiamine-repressible study protein in corresponding to serine 283, the site phosphorylated products. chicken p34`2 (Krek and Nigg, 1991), has been changed to an alanine without affecting the amount of serine phos- Kinase activity of the mutant cdc2 proteins in The first property of these non-functional position 167 phorylation detected S.pombe immunoprecipitates p34cdc2 mutants we examined was their to function as (U.N.Fleig and P.Nurse, unpublished data). ability protein kinases. Each 167 mutant was tested for histone H1 position kinase activity in both the HY1 and cdc2-33 strains. In Phenotypes of mutants p34cdc2 To examine the functional of HY1, each mutant was expressed from the nmtl promoter consequence Thr167 each was for 18 or 24 h and isolated from phosphorylation, mutant tested for its ability to derepressed 0, 6, equal rescue the temperature-sensitive (ts) cdc2 strain, amounts of cell with 4711. cdc2-33. lysates by immunoprecipitation This mutant arrests at both the G1/S and G2/M transition These immunoprecipitates were divided in half. The at the and abundance of was determined one half and the points non-permissive temperature produces highly using p34cdc2 cells. Each mutant in was transformed other half was assayed for kinase towards the elongated pMNS21L activity into cdc2-33 and colonies containing the plasmids were histone HI. The of 4711 for exogenous substrate, specificity allowed to form at the permissive temperature of S.pombe is demonstrated in 25°C. Figure 5, A, B, p34cdc2 panels Although thiamine was included in the growth medium to H and I. There was no 4711-reactive in immune p34cdc prevent overexpression from the nmtl promoter, moderate complexes from HYI cells (Figure SA) and the immune expression of p34cdc2 was still detectable under these complexes did not have histone HI kinase activity (Figure conditions When (see below and Fleig and Nurse, 1991). The 5H). S.pombe p34cdc2 was expressed in HYI from ability of the mutants to complement ts p34cdc2 was the then episomal pMNS21L, accumulation of p34cdc2 during the assessed by replica-plating to the restrictive temperature of time course of was derepression detected easily (Figure SB) 36'C still in the presence of thiamine. Only wild-type cdc2 and the immune complexes displayed histone HI kinase and the cdc2-S167 mutants were able to fully complement These results activity (Figure 51). demonstrated that we were cdc2'5 (Figure 3A). The cdc2-E 167 mutant gave rise to able to assay the protein kinase activity of the S.pombe slow-growing colonies at 36°C either when replica-plated mutants introduced into HY1 and that did not p34cdc2Hs from the permissive temperature or when placed directly at contribute to the activity measured in this assay. Further- 36°C after transformation into cdc2ts strains. The other more, protein kinase activity did not increase in parallel with mutants did not support any colony growth. The inability increasing levels of p34cdc2 indicating that some other of to component which was complement ts cdc2 agrees with an earlier necessary for kinase activation was p34cdc2-A167 3300 S.pombe p34cdc2 Thr167 phosphorylation limiting in the cells. p34cdc2-S167 like accumulated obtained. Lysates were made from cells growing at the p34cd(2', to high levels during derepression of the nmtl promoter from cells shifted to the permissive temperature (25°C) and (Figure 5C) and had histone HI kinase activity (Figure 5J). non-permissive (36°C) for 2 and 4 h. Only temperature A167 + 67 accumulated also but to lower levels because p34cdc2 and p34Cd2-S were active at 40°C both in p34cdc2 its gene was integrated as a single copy (Figure 5D). immune complexes and in lysates assayed directly (data not p34cdc2-A167 lacked histone HI kinase activity (Figure 5K). shown). The cdc2-A167, cdc2-E167 and cdc2-FI15AI67 In a second experiment, the kinase activities of two other proteins showed no evidence of histone HI kinase activity mutants were compared with In this experiment, under any of these conditions (data not shown). p34cdc2'. a background histone kinase activity was observed but neither p34cdc2-E167 nor p34cdc2-F15/A167 demonstrated any Thr167 dephosphorylation correlates with inhibition of protein kinase activity above this background (Figure 5L and M) activity the were present in the immune complexes The data presented above suggested that in contrast to although proteins (Figure 5E and F). Also in this second experiment, the of (Gould and the inhibitory effect TyriS phosphorylation linearity of the immunoblotting and protein kinase assays et Jessus et Nurse, 1989; Gould al., 1990; al., 1990; was examined by diluting 2-, 4- and 8-fold an immuno- and Thr167 Pondaven et al., 1990; Kumagai Dunphy, 1991), precipitate of p34cdc2+ from a 24 h-induced culture. Both a for function. To phosphorylation was prerequisite p34cdc2 the of activity decreased in was for level protein and protein kinase determine if Thri67 phosphorylation required a indicating that the activity detected in this we to remove linear manner phosphotransferase activity per se, sought is an of of active histone and the assay accurate reflection the amount phosphate from this residue enzymatically assay we whether or HI kinase in an immune complex (Figure SG and N). dephosphorylated protein. First, explored not When the mutants were assayed for histone H 1 kinase protein phosphatase 2A (PP2A) could dephosphorylate activity in a cdc2'5 background, the same results were ThrI67. An immunoprecipitate of 32P-labelled p34cdc2 A- .: ... ;> 1:1.....;,-!" L4 and HYI and HYI with of the induction of 4. (A) Fig. Photomicrographs p34cdc2-E167. integrated pMNS21L plasmids expressing p34cdc2-Al67 of thiamine-free media three times and thiamine were washed in a volume in the of 5 or p34cdc2-Al67 (A) (B) presence Ag/ml large p34cdc2-E167 media. of cells were taken at the indicated times, fixed, and stained with DAPI. once in thiamine-free Samples resuspended again 3301 K.L.Gould et al. HI kinase activities of mutants. HYI cells expressing either no S.pombe (panels A and H), wild-type (panels Fig. 5. Histone p34cdc2 p34Cdc2 p34Cdc2 or the indicated S.pombe p34cdc2 mutants (panels C, D, E, F, J, K, L and M) were grown in media containing B and I, also panels G and N), washed thoroughly in thiamine-free media to allow derepression of the nmtl promoter. Equivalent amounts of 5 thiamine. They were then lg/ml times after and The proteins were isolated by immunoprecipitation with 4711 and the cells were taken at the indicated derepression lysed. p34cdc2 two In the case of the shown in G and N, the immunoprecipitate of wild-type immunoprecipitates were divided into equal portions. samples panels for 24 h was diluted 4- and 8-fold. Panels A-G. One half of each immunoprecipitate was resolved on an from a culture derepressed 1-, 2-, p34cdc2 to immobilon-P. The blot was incubated with 4711 followed by ['25I]protein A. The blots were exposed to SDS-polyacrylamide gel and transferred for 16 h. The band on the autoradiographs corresponds to and the minor presensitized Kodak XAR5 film with intensifying screens major p34cdc2 chain. Panels H-N. The other half of each immunoprecipitate shown in panels A-G band of -50 kDa corresponds to the immunoglobulin heavy to for 2 min in 2 x gel sample buffer, the reactions were resolved on was assayed for histone Hl kinase activity. After being heated 100°C SDS-polyacrylamide gels and subjected to autoradiography with Kodak XAR5 film. The kinase reaction of each sample is shown underneath the h at with screens. The major band visualized corresponds to histone immunoblot from the same sample. Exposure times were 16 -70°C intensifying to and the minor band might be related p56cdc13. H1, and p13S"uC (Brizuela et al., 1987; Booher et al., was generated from cells arrested in late G2 due to a ts 1989) the of is required for p34cdc2 in the cdc25 gene. The 32P-labelled 1989), and presence p56cdc13 mutation p34cdc2 protein kinase activation (Moreno et al., 1989). Since the immunoprecipitate was divided in half; one half was treated alone. PP2A removed mutants which could not be phosphorylated at position 167 with PP2A and the other with buffer from the and also lacked protein kinase activity, we explored the possibility much of the phosphothreonine protein At a concen- that Thrl67 was a prerequisite for binding some (Figure 6A). higher phosphorylation phosphotyrosine most of the from If were unable to bind tration, PP2A removed phosphate p34cdc2 to p56cdc13 or to pl3s"cJ. they unlabelled immuno- this would their lack of protein kinase 6B). In parallel experiments, explain (Figure p56cdcJ3, in treated with were made from HY1 expressing either were divided half, protein activity. Lysates precipitates p34cdc2 p34cdc2 + or p34cdc2-AI67, and subjected divided once to no Spombe or buffers alone, and again phosphatases and At to with either antibodies to p34cdc2 histone H1 kinase p34cdc2 abundance. immunoprecipitation assay activity in late the kinase or coupled to agarose beads. the block of cdc25-22 G2, protein (4711), p56cdcJ pl35"c point decreased The were resolved on a SDS-poly- of was low and was slightly by immunoprecipitates activity p34cdc2 Fifteen minutes after release transferred to immobilon-P and then blotted PP2A treatment (Figure 6C). acrylamide gel, of the untreated half were detected in into the kinase activity with PN24. Both p34cdc2+ and mitosis, protein p34cdc2-A167 from 4711 (Figure 7A) and both were also had risen significantly as expected previous reports immunoprecipitates Moreno et while that of the of binding to pl3`Uc beads (Figure 7B). Both were et al., 1989; al., 1990) capable (Booher low 6C). As we showed also by anti-p56cdcJ3 serum (Figure PP2A-treated half remained (Figure immunoprecipitated treatment with the T-cell of was considerably before, protein-tyrosine phosphatase 7C), but the amount p34cdc2-A167 to activation of isolated from cells reduced compared with p34cdc2'. also leads p34cdc2 in late et 1990; Figure 6D, lane 2). blocked G2 (Gould al., PP2A treatment this activation whether added Thr167 at G1/S? prevented phosphorylation or lane the after (Figure 6D, lane 4) before (Figure 6D, 8) As shown Thrl67 is critical for above, phosphorylation PP2A treatment alone resulted protein-tyrosine phosphatase. function and is probably required for p34cdc2 p34cdc2 in a small inhibition of the basal activity (Figure 6D, lane phosphotransferase activity at the G2/M transition. To 6; also Figure 6C) and these treatments did not alter the level if role determine Thrl67 phosphorylation has a at the GI/S of 6E). (Figure phase transition as well, we examined the DNA content of p34cdc either cdc2'5 strains containing an integrated copy of Thr167 phosphorylation and subunit associations flow cdc2-A167 or cdc2-E167 by cytometry. As expected, Two are known to bind directly to p34dC2 in other proteins well the cdc2-L7 and cdc2-33 strains arrested with a IC as S.pombe, (a cyclin B homologue) (Booher et al., as a 2C DNA content within 1 h of temperature shift p56cdc13 3302 S.pombe p34dCk2 Thri 67 phosphorylation untreated +PP2A ReleaseD _ +. + s, iot it .... I. :W: Tdo q'" ". -OH I I~ - H :iI W-_ !~~~~~~~~~~~~~ , _ _ I~~~~~~~~~~~~~~~~~~ 7_ _--. -_ _ 3 .~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~1 M. _I. ............... . Fig. 6. PP2A inactivates histone HI kinase activity. (A) p34cdc2 was immunoprecipitated with 4711 from cdc25-22 cells labelled with [32P]orthophosphate and growth-arrested in late G2 at 36°C. One half of the immunoprecipitate was treated with PP2A buffer alone and the other half with buffer and 10 mU/ml PP2A for 30 min at 30°C. The immunoprecipitates were resolved on a SDS-polyacrylamide gel, transferred to immobilon-P, and partially hydrolysed in acid. The phosphoamino acids were separated by two-dimensional thin-layer electrophoresis and visualized by autoradiography for 5 days at -70°C with pre-sensitized Kodak XAR5 film and an intensifying screen. s, phosphoserine; t, phosphothreonine; y, phosphotyrosine. (B) p34Cdc2 was immunoprecipitated with 4711 from cdc25-22 cells labelled with [32P]orthophosphate and growth-arrested at 36°C. One half of the immunoprecipitate was treated with PP2A buffer alone and the other half with buffer and 10 times as much PP2A, 100 mU/ml, as in (A) for 30 min at 30°C. The immunoprecipitates were resolved on a SDS- 15% polyacrylamide gel, transferred to immobilon-P, and visualized by autoradiography for 16 h at -70°C with pre-sensitized Kodak XAR5 film and an intensifying screen. The arrow indicates the position of p34cdc2. (C) p34Cd was immunoprecipitated with 4711 from cdc25-22 cells which had been arrested in late G2 by being held at 36°C (Block) or had been released from this block for 15 min by rapid cooling to 25°C (Release). The immunoprecipitates were then split in half. One half of each was treated with PP2A buffer alone and the other half of each was treated with buffer and 10 mU/ml PP2A for 30 in at 30°C. All four samples were then assayed for histone H1 kinase activity. The HI histone kinase reactions were resolved on an SDS-polyacrylamide gel and the phosphoplated histone HI was visualized by autoradiography with pre-sensitized Kodak XAR5 at -700C and an intensifying screen for 16 h. (D) p34c c2 was immunoprecipitated with 4711 from cdc25-22 cells which had been arrested in late G2 by being held at 36°C. The immunoprecipitate was then split into four and each again in half. One half of each was incubated in buffer alone while their counterparts were treated with After into H15 phosphatases. washing buffer, the histone HI kinase activity of one half of the eight was assayed. The reactions samples were separated on an SDS-polyacrylamide gel, transferred to immobilon-P, and incubated with 4711 followed by [1 A. Histone HI kinase 5I]protein activity was visualized by autoradiography. Lane 2 is from a sample treated with the T-cell protein-tyrosine phosphatase for 30 min at 30°C. Lane 4 is from a treated as in 2 sample lane but for an additional 30 min at 30°C with 10 mU/ml PP2A. Lane 6 is from a sample treated for 30 min at with 10 mU/ml PP2A. Lane from 30°C 8 is a sample treated as in lane 6 but for an additional 30 min at 30°C with the T-cell protein-tyrosine phosphatase. Lanes 1, 3, 5 and 7 are from controls which to in were treated identically samples lanes 2, 4, 6 and 8, respectively, except that no were added. The other half of phosphatases (E) each immunoprecipitate shown in (D) was resolved on an SDS-polyacrylamide gel, transferred to immobilon-P, incubated with 4711 and then with [125I]protein A. was visualized by autoradiography for 16 h. Hi, histone HI. p34cdc2 indicative of both a G1 of this mutant to for the formation and a G2 block (Figure 8A and C). support enough growth Cells of both strains leaked the 4 h of slow colonies on at in cdc2' strains through block by at growing plates 36°C GI 36°C, arrested with a 2C DNA content and persisted in this (see Figure 3). state for at least h Anti-tubulin immunofluorescence revealed an 6 (Figure 8A and C; data not shown). unusually A to a IC DNA content number of mitotic in the cdc2-33 strain peak corresponding was seen high spindles after 4 h at reproducibly in the cdc2-L7 strain expressing p34cdc2-A167 expressing p34cdc2-El67 36°C (Figure 9B, panels at it was more than in the A and some cells contained two 36°C although transient parental B); spindles (Figure 9B, in strain DAPI these cells The DNA was often distributed (Figure 8B). By staining, appeared panel C). abnormally its or at its centre with a nucleus not relation to the spindle, either along length elongated single interphase (data shown). D To In cells with a IC DNA content were never (Figure 9B, panels and E). provide quantitative contrast, evidence that cells observed in the cdc2ts strain expressing at 36°C p34cdc2-El67-expressing spent longer p34cdc2-E167 in the index was deter- (Figure 8D). Instead, cells with a greater than 2C DNA than normal time mitosis, septation shifted to 360C. At time the content after 4 h at The of these mined as cells were 0, septa- appeared 36°C. phenotypes was than the normal 6 h cells are shown in 9A. the tion index 15% Figure During temperature shift, (higher 7%). By 93% of the cells contained at least cells with several and nuclei accumulated after temperature shift, septa (Figure 9A). with the DAPI one The flow cytometric analysis coupled septum (Table I). staining cells continued to and showed that these replicate separate Thr167 is not Tyrl5 but not phosphorylation their DNA to cells but did limiting daughter always complete that we noticed the into the next round of In cell division before proceeding previous 32P-labelling experiments, was in cells which These data are consistent with the amount of 32P-labelled DNA greater synthesis. ability p34cdc2 3303 K.L.Gould et al. To overexpressed investigate whether this was a p34cdc2. uniform increase or specific to one phosphorylation we site, labelled with [32P]orthophosphate a strain expressing 5-20 times more than in with a p34cdc2 wild-type parallel strain. wild-type p34cdc2 was immunoprecipitated from each and subjected to phosphoamino acid The analysis. amount of phosphothreonine on p34cdc2 increased significantly in the strain overexpressing while the level of p34cdc2 phosphotyrosine did not increase to the jA _ nearly same extent (Figure 1OA and B). Thr167 and Tyrl5 phosphorylation can occur in i.* jB _ .M phase We previously examined the phosphoamino acid content of p34cdc2 in asynchronous populations, and in cdc mutants blocked in late G2 or in mitosis. To see if Thrl67 and Tyrl5 phosphorylations occurred earlier in the cell cycle, we examined the phosphoamino acid content of p34cdc2 in cells which had not yet completed DNA synthesis. 7. were made from HYI Fig. Lysates expressing p34cdc2+, HYI, and Wild-type cells which had been pre-treated with hydroxyurea HYl 34cdc2-A167 and to with expressing subjected immunoprecipitation were labelled with [32P]orthophosphate in the continuing 4711 (A), pl3SuC to beads or antibodies coupled agarose (B), to presence of hydroxyurea. p34cdc2 was isolated p56cdcI3 (C). The immunoprecipitates were run on an SDS- by immuno- polyacrylamide 5gel, transferred to immobilon-P, and probed with PN24 precipitation and its phosphoamino acid content was [12 followed by I]protein A. The presence of indicated the by p34cdc2, determined. Both Thrl67 and Tyrl5 were phosphorylated was of the arrows, visualized by autoradiography relevant portions of under these conditions to equivalent levels indicating that the immunoblot. The of band in nature the lower (C) is not known. these phosphorylation events can occur times at with XAR5 film and before the completion Exposure -70°C Kodak intensifying screens were 4 h 16 h and 5 of (A), (B) days (C). DNA synthesis (Figure lOC). A B cdc2-L7 cdc2-L7 + cdc2-A167 Hr 0 Hr 0 I 1 Hr 3 iHr 21* 2~~~~~~~~~~~~3Hr 3 Hr 4 Hr Hr ~~~~~~~~~4 DNA Conten DNA Content cdc2-33 cdc2-33 + cdc2-E167 z &t _ ~~~~~O Hr - Ohr - Hr - I Hr a3 A C2bHr n3 - 2Hr lb- - 3Hr - - 4 * - 41* DNA Conten DNA Content Fig. 8. Flow cytometric analysis of DNA content of cdc2's cells expressing p34cdc2 mutants. Cells were grown to mid-exponential phase at the permissive of = 0 temperature 25°C in the presence of 5 tg/ml thiamine and then shifted at t to the restrictive temperature of 36°C for 4 h. Samples were withdrawn hourly, fixed in ethanol and stained with propidium iodide. Linear fluorescence histograms show relative DNA content in arbitrary units on the horizontal axis and the cell number on the vertical axis. (A) cdc2-L7 cells; (B) cdc2-L7 cells expressing p34CdC2-A 67; cdc2-33 cdc2-33 (C) cells; (D) cells expressing cdc2-E167. 3304 67 phosphorylation S.pombe Thrl p34cdc2 Discussion amino acids in place of Thr 167 cannot complement ts cdc2 We showed previously that S.pombe p34cdc2 was mutants and lack histone HI protein kinase activity in vitro. phosphorylated on two major sites, one of which we Although non-functional, these mutant proteins are stable, identified as Tyrl5 (Gould and Nurse, 1989). In this phosphorylated on tyrosine, and their overexpression in the identified the second site of phosphorylation of wild-type leads to cell and study, we have presence p34cdc2 elongation Thus, these mutant p34c c2 proteins in S.pombe p34cdc2 as Thrl67. Serine but not alanine, a block in cell division. the capacity to interact with and even titrate glutamic acid, aspartic acid or tyrosine can substitute for appear to retain which the wild-type protein must threonine at residue 167. The Serl67 mutant protein is away other proteins with to function normally. These data argue that indistinguishable from the wild-type protein functionally and interact in order mutant proteins is not dissimilar to can be Thrl67 is present in all the structure of the Serl67 phosphorylated. mutants are inactive as protein kinases. sequenced p34 c2 proteins (Figure 11) and is likely to be wild-type but that the of with similar proper- site of phosphorylation in vertebrate p34cdc2 as well Dominant negative mutants a major p34cdc2 have been described before (Mendenhall et al., 1988; as in the S.pombe protein although it has not been identified ties types (Krek and Nigg, 1990; Fleig and Nurse, 1991). definitively in other cell Lee et al., 1991; Norbury et al., In our study of S.pombe p34cdc2 phosphorylation, Solomon et al., 1990; previous both Tyrl5 and Thr167 were phosphorylated 1991). In vertebrate cells, Thrl4 is a third major site of we found that and that phosphorylation of both residues phosphorylation (Krek and Nigg, 1991; Norbury during G2 p34cdc2 into and through mitosis (Gould et al., 1991). We have not detected Thrl4 phosphorylation decreased as cells passed Although we did not observe complete of S.pombe under ordinary growth conditions. and Nurse, 1989). p34cdc2 of either site at any time and were unable In contrast to phosphorylation at Tyrl5 which inhibits dephosphorylation event preceded the other kinase activity, our evidence indicates that phos- to discern if one dephosphorylation p34cdc2 mitosis (Gould and Nurse, 1989), activa- at Thrl67 is required for function and as cells entered phorylation p34cdc2 was associated with tyrosine but not two phosphorylation events are completely inde- tion of in vitro that the p34cdc2 et al., 1990). In one which will be discussed below, threonine dephosphorylation (Gould pendent. With exception in cells where good cell cycle proteins which have non-phosphorylatable Xenopus oocyte extracts and mutant p34cdc2 lD \P BI O hr 2 hr 6 hr I.} 4 hr Fig. 9. Photomicrographs of cells expressing (A) The cdc2-33 strain expressing p34cdc2-E167 was grown at 25°C to a density of 5 x 106 p34cdc2-EI67. of 5 thiamine and then at 36°C for the indicated number of hours. Aliquots of cells were fixed as described in cells/ml in the presence placed fsg/ml 8 and stained with DAPI. The same cells as in (A) were taken at 4 h after shift to 36°C, fixed for immunofluorescence, the to Figure (B) legend a rabbit anti-tubulin followed by Texas Red-conjugated goat anti-rabbit Ig and with DAPI. and stained both with antibody 3305 K.L.Gould et al. completion of DNA synthesis and can occur during S phase, synchrony was achieved, in mitosis was found to be p34cdc2 but not on consistent with what has been observed in other cell phosphorylated on a threonine Tyrl5 (Solomon types et (Norbury et al.,199 1; Krek and 199 et al., 1990; Krek and Nigg, 1991; Norbury al., 1991). Nigg, 1). However, in seen in these studies is cells with a than is characteristic of The phosphorylated threonine almost longer phase fission GI have evidence certainly the equivalent of Thr167 and our molecular genetic yeast, 32P-labelling studies provided that the nor is studies are consistent with result that is neither Thrl67 Tyrl5 phosphorylated during (Lee p34cdc2 GI when it is phosphorylated at Thrl67 at a time active. et al., 1988; Morla et al., 1989; Krek and Nigg, 1990; We have found that Thrl67 and Tyrl5 become phos- Norbury et al., 1991). These data suggest that Thr167 phorylated in the presence of hydroxyurea, indicating that phosphorylation might not be involved in p34cdc2 function these phosphorylation events are not dependent upon the at the transition and appears only after S phase is GI/S initiated. Our flow cytometric analysis of a cdc2'5 strain is of interest in this context. In a expressing p34cdc2-Al67 Table I. the of 167 at the cdc2'5 strain, presence p34cdc2-A non-permissive temperature reduced the length of time those Time % Septated cells cells arrested in this is not what is Although expected GI. 15 if Thrl67 phosphorylation was important for p34cdc2 function in the effects of 167 on block p34cdc2-A the GI, GI 2 22 were this result makes the role small. Therefore, although 3 33 of in Thrl67 phosphorylation difficult to interpret, the GI 4 55 combined observations on the timing of Thrl67 and Tyrl5 5 78 phosphorylation in several cell systems have raised the 6 93 possibility that the strategy for regulating activity at p34cdc2 the transition, both positively and negatively, might The cdc2-33 strain expressing was grown at 25°C to a p34cdc2-E167 GI/S density of 5 106 cells/ml and then placed at 36°C for the indicated be entirely different from what is utilized at the G2/M number of hours, DAPI. fixed and stained with Cells were observed transition. microscopically and of the percentage cells containing a septum was In combination with in vivo 32P-labelling studies which determined 500 cells at each time by counting point. showed that Thr167 occurred as cells dephosphorylation passed through mitosis (Gould and the Nurse, 1989), of cells phenotype expressing indicate that p34cdc2-E Thrl67 dephosphorylation as well as phosphorylation might ..... (.[). . _'s be important for normal cell cycle We progression. replaced ..1) Thrl67 with the negatively charged residues, aspartate e T .T . _TT :. and glutamate, in an attempt to mimic constitutive phos- phorylation at position 167. This approach has been vF used successfully for the investigation of regulatory phos- phorylation events in the cAMP-dependent protein kinase C (Levin and Zoller, 1990) and in isocitrate dehydrogenase *+ I'Ul (Thorness and Koshland, 1987; Dean and Koshland, 1990; Hurley et al., 1990). In the former studies, aspartate seems 'T to have more closely approximated the phosphorylated residue functionally than glutamate but in only the p34cdc2, glutamate substitution gave a different phenotype than the alanine substitution. p34cdc2-E167 was the only non- phosphorylated position 167 mutant to rescue, albeit poorly, Fig. 10. Phosphoamino acid analyses. Equal numbers of wild-type cdc2ts mutants. Curiously, this mutant displayed no in vitro -5- to 20-fold S.pombe cells (A), cells overexpressing by p34cdC2 protein kinase activity indicating that it can function although from the multicopy plasmid pIRT2 (B), or wild-type S.pombe treated in cells, its ability to form appropriate complexes might be with hydroxyurea (C) were labelled with [32P]orthophosphate, lysed and subjected to immunoprecipitation with PN24. Immunoprecipitates compromised and the immune complex protein kinase assay were resolved on SDS-polyacrylamide gels, transferred to might be too stringent a measure of its functional capacity. and in acid. The immobilon-P, partially hydrolysed phosphoamino Flow cytometric analysis demonstrated that a cdc2ts strain acids were in two dimensions separated by thin-layer electrophoresis. expressing this mutant could pass through the G1/S and T, phosphothreonine; Y, phosphotyrosine; o.p., overproduced; HU, hydroxyurea. The dotted circles indicate the position of phosphoserine. transitions G2/M repeatedly. However, cells accumulated 167 179 S. cdc2 D F G L A R F G V P L R N Y T H E I V T L W Y R A P E pombe S V W P S. cerevisiae CDC28 D F G L A R A F G V P L R A Y T H E I T L Y R A E CDC2Hs D F G L A R A F G I P I R V Y T H E V V T L W Y R S P E CDC2Mm D F G L A R A F G I P I R V Y T H E V L T L W Y R S P E D F G L A R A F V V S CDC2Gg G I P V R Y T H E V T L W Y R P E CDC2Dm D F G L G R S F G I P V RI Y T HEI V T L W Y R A P E Fig. 11. Sequence alignment of p34cdc2 proteins in the region of Thrl67. Hs, human, Mm, mouse; Gg, chicken; D.melanogaster. Thrl67 is Dm, boxed in bold lines. 3306 S.pombe p34cdc2 Thrl 67 phosphorylation septa and mitotic spindles which indicates that they were genetic interactions and in vitro results, it would be delayed in transit through mitosis. These results are interesting to learn whether the phosphorylation state or activity of p34cdc2 was affected by deleting or over- consistent with the possibility that E167 does indeed mimic constitutive Thr167 phosphorylation and that p34cdc2 must expressing these phosphatase genes. dephosphorylated in order to complete p34cdc2 protein kinase activity in S.pombe requires the ordinarily be entirely the cycle. Studies in cell free Xenopus extracts (Murray presence of a cyclin subunit and the ability of to cell p34cdc2 yeast (Ghiara et al., 1991) have bind to it (Booher and Beach, 1987, 1988; Booher et al., et al., 1989) and in budding B in order to inactivate 1989; Moreno et al., 1989). Our results indicate that shown that cyclin must be degraded 1 and exit from the mitotic state. Thrl67 phosphorylation might be required for the stable histone H kinase activity that association between and cyclin B. We found that Our results raise the possibility dephosphoryla- p34cdc2 p34cdc2 in exit from mitosis. non-phosphorylatable mutant, p34cdc2 Al67, was co- tion might also have a role the the Additional evidence that Thr167 phosphorylation is with antibodies to p56cdc13 but that the immunoprecipitated for function is provided by experiments brought down in these co-immuno- required amount of p34cdc2 p34cdc2-A167 to experiments compared with the wild-type examining the consequence of Thrl67 dephosphorylation precipitation less (see Figure 7). Furthermore, p34cdc2 activity in vitro. Experiments with okadaic acid protein was significantly on Thrl67 contain conditions where it specifically inhibits PP2A have mutants which cannot be phosphorylated under level (see that PP2A activity negatively regulates phosphorylated Tyrl5 but at an apparently reduced shown p34cdc2 activation in Xenopus egg extracts (Felix et al., 1990) Figure 2). Since Tyrl5 phosphorylation is thought to occur kinase and that inhibiting PP2A can lead to early activation of only after cyclin B binding (Solomon et al., 1990), it in systems (Goris it is not a prerequisite for an initial protein kinase activity several cell could be that although p34cdc2 et Picard et al., 1989; Yamashita et al., 1990). cyclin B, Thrl67 phosphorylation is required al., 1989; interaction with INH, which inhibited B complex. Overproduction Indeed, an endogenous activity, termed to form a stable cyclin -p34C& MPF in extracts was recently to a increase in activation Xenopus oocyte of p34Cdc2+ in cells leads large phosphoryla- form of PP2A et 1991). Lee et al. not of 10). Since the shown to be a (Lee al., tion of Thr167 but Tyrl5 (Figure that PP2A treatment of p34cdc2 resulted in B in cells is limiting in this (1991) showed amount of cyclin probably that Thrl67 dephosphorylation of at least one phosphopeptide from experiment, this result suggests phosphorylation association with cyclin B and that the overall dephosphorylation of might take place without prior p34cdc2 p34cdc2 does not. In contrast, both inactivation of histone HI protein kinase activity. whereas phosphorylation of Tyrl5 paralleled increase when DNA We have found that PP2A and protein phosphatase 1 Thr167 and Tyrl5 phosphorylation This result is not shown) dephosphorylated p34cdc2 in vitro replication is inhibited with hydroxyurea. (PP1) (data at Thrl67 and that these treatments resulted in a consistent with the observation that both cyclin B (Dasso primarily loss of protein kinase activity. As noted by Lee and Newport, 1990) and tyrosine phosphorylation p34cdc2 p34cdc2 of B to increase (Kumagai and Dunphy, 1991) when DNA replica- et al. (1991), dephosphorylation cyclin complexed PP2A treatment (Lee et al., 1991; tion is blocked in Xenopus extracts. Although experiments also occurs upon p34cdc2 our unpublished observations) and it is possible that cyclin in Xenopus cell-free extracts indicated that modification of or of other components occurs only after binding to dephosphorylation dephosphorylation by phosphorylation p34cdc2 to is the event responsible for the observed these experiments would not have detected an early bound cyclin B, p34cdc2 of histone HI kinase activity. Since it is not event which does not turn over during the inactivation phosphorylation whether or not cyclin phosphorylation is important of the et 1990). known course 32P-labelling (Solomon al., or if other Thrl67 lies in a highly conserved region of p34cdc2 for the activity of the -cyclin complex p34cdc2 be in these it is 11) and in a sequence alignment is in the same components might present complexes, (Figure of these the threonine phosphorylation site in difficult to interpret fully the results experiments. position as regulatory the of what MAP kinase et However, these results raise interesting question (Boulton al., 1990; Hanks, 1991; Payne removes from Thr167 in vivo et Like Thr167 of p34cdc2, protein phosphatase phosphate al., 1981). phosphorylation what of the cell of MAP kinase is required for its and at stage cycle. threonine phosphorylation of each PP2A et al., 1990) and kinase et al., 1990). Despite their Two isoforms (Kinoshita protein activity (Anderson et 1989) have to autophosphorylation sites in the cAMP- PP1 (Booher and Beach 1989; Ohkura al., proximity in and both of kinase and Zoller, 1990) and in been identified S.pombe types phosphatase dependent protein (Levin to the of the cell cycle (Booher numerous kinases (Hanks, 1991), there is have been linked regulation protein-tyrosine et Kinoshita et al., no evidence for the autophosphorylation of these sites. In and Beach, 1989; Okhura al., 1989; been identified as a of the of these threonines in vitro followed 1990). PP1 has also regulator fact, dephosphorylation and and the addition of does not result in their re- Aspergillus nidulans (Doonan Morris, 1989) by Mg/ATP et cell In (Payne et al., 1991; our unpublished data). D.melanogaster (Axton al., 1990) cycles. S.pombe, phosphorylation kinase of which encodes the PP2A Thus, either Thr167 is the target of another protein deletion ppa2 major activity event and reduced cell size at mitosis or Thrl67 phosphorylation is an autophosphorylation leads to slow cell growth cellular factor. there are regulated by an unknown (Kinoshita et al., 1990). Although probably many of PP2A in if Thr167 were one of its substrates cells, targets was entry into and the phosphatase activity reduced, early in from mitosis is Materials and methods mitosis and a exit exactly perhaps delay is for exit from what one would PPI activity required expect. cell culture Strains and Kinoshita et and et al., 1990) mitosis (Ohkura al., 1989; in this were the strain 972 h- The strains used study wild-type Spombe with of activa- also interacts regulators p34cdc2 cdc25-22 cdc2-33 leul-32 cdc2-L7 leul-32 genetically et h-, (Gutz al., 1974), h-, his3-237 The HYI strain in Given these and HYI (cdc2::CDC2Hs, leul-32, h-). cdc25 and wee] and h+ tion, (Booher Beach, 1989). 3307 K.L.Gould at al. which the human CDC2 cDNA has replaced the Spomnbe cdc2 + gene was acid Phosphoamino analysis provided by MacNeill. Cells were grown in minimal medium membrane were Stuart (Nurse, Slices of immobilon-P 32P-labelled containing p34cdc2 1975) containing the supplements in the presence or absence and and the subjected to partial acid hydrolysis (Kamps Sefton, 1989) appro?riate of 5 thiamine. For [3 P]orthophosphate labelling, cells were were in two dimensions grown phosphoamino acids dig/ml separated by thin-layer overnight to a density of x 106- 1 x cells/ml and 3.5 et 5 107 in phosphate-free electrophoresis at 1.9 pH pH (Cooper al., 1983). minimal medium (Moreno et al., 1991a) with 100 NaH2PO4 and Ag/ml appropriate supplements. Cells were filtered, at 5 x 106 resuspended Phosphatase treatments cells/mi in mi phosphate-free minimal medium with 50 4711 as detailed above and 5 NaH2PO4, was with immunoprecipitated Ag/mi p34cdc2 h. buffer mM and labelled with 1-2 mCi [32P]orthophosphate (NEN) for 3-4 in 20 resuspended protein-tyrosine phosphatase (25 HEPES, I1 Hydroxyurea when used mM PMSF and 5 mM or PP2A was added to cultures at a final concentration of 0.1% 1 pH 7.2, /3-mercaptoethanol, EDTA) 12 mM. For experiments which mM involved a temperature shift, cells were buffer mM 1 bovine serum 1 (10 Tris, pH 7.5, mg/mi albumin, grown to a density of 5 x 106 cells/mi at 25°C and then placed at the 0.5 mM and 1 mM PP2A in 1 was added dithiothreitol, MnCl2 PMSF). Al restrictive temperature of 36°C. Transformations were carried out as to a final concentration of 10 One of the truncated 37 kDa mU/mi. 1il form described (Moreno et al., 1991). T-cell PTPase from SF9 cells with an undetermined of the purified specific from as activity was used to remove phosphotyrosine p34cdc2 reported Incubations with the were et previously (Gould al., 1990). phosphatases Oligonucleotide mutagenesis and plasmids for 30 at min. performed 30°C The cdc2 + cDNA with a NdeI site at the initiation codon and a BamHI site in shortly after the stop codon (Gould and Nurse, 1989) the phagemid pTZ19R (Pharmacia) in vitro was mutagenized using the Amersham mutagenesis kit Acknowledaements according to the manufacturer's instructions. The following 20-base long oligonucleotides were used. We wish to thank our colleagues in the Cell Cycle Group for helpful (1) CGGAACTATTCGCATGAGAT for Serl67 discussions. We are especially grateful to Rachel Bartlett for guiding K.L.G. (2) CGGAACTATGCGCATGAGAT for Alal67 through some of the FACS analyses, Kevin Crawford and Julian Blow for (3) for CGGAACTATTATCATGAGAT Tyrl67 p13 beads, Ursula Fleig for advice, encouragement and comments on the (4) for CGGAACTATGATCATGAGAT Aspl67 manuscript, Jacky Hayles for antibodies to for his p56cdc13, Gordy Hering (5) CGGAACTATGATCATGAGAT for Glu167 contributions to the artwork and photographic Dick MacIntosh for advice, (6) GAAGGAACCTTTGGCGTTGT for PhelS. advice on immunofluorescence procedures, and Stuart MacNeill for the HYl The coding regions of the mutant cDNAs were removed from pTZ19R strain. We are also grateful to Cohen for his kind of PP2A and Philip gift by digesting with NdeI and BamHI and cloned into pMNS21L under PP1, and to Nick Tonks, N.F.Zander and J.A.Lorenzen for the providing control of the thiamine-repressible nmtl promoter (Maundrell, 1990) using T-cell protein-tyrosine phosphatase. K.L.G. and S.S. were fellows of the standard recombinant DNA techniques (Maniatis et al., 1982). The resultant Jane Coffin Memorial Fund for Medical and the ICRF Childs Research, plasmids were then sequenced throughout the coding region of cdc2 and MRC provided financial support for this work. using the dideoxynucleotide techniques suggested in a Sequenase kit manual (US Biochemicals). References Immunoprecipitation, immunoblotting and protein kinase assays Approximately 2 x 108 cells were washed once in 4 ml 0.9% NaCl, and Anderson,N.G., Maller,J.L., Tonks,N.K. Sturgill,T.W. (1990) Nature, 1 mM NaN3, 10 mM EDTA, 50 mM NaF and lysed by with vortexing 343, 651-653. glass beads in 10 HB15 buffer (25 mM 60 mM MOPS, pH 7.2, Axton,M.A., Dombradi,V., Cohen,P.T.W. and Glover,D.M. (1990) Cell, Al (3-glycerophosphate, 15 mM 15 mM p-nitrophenylphosphate, EDTA, 63, 33-46. 15 mM MgCl2, 1 mM DTT, 100 sodium 1 mM orthovanadate, Blow,J.J. and Nurse,P. 855-862. /M (1990) Cell, 62, PMSF, 5 leupeptin, 1% Nonidet 130 TLCK and 130 ytg/ml P-40, Booher,R. and Beach,D. (1986) Mol. Cell. 3523-3530. AM AM Biol., 6, TPCK). For immunoprecipitation with the anti-C-terminal peptide antibody, Booher,R. and Beach,D. (1987) EMBO J., 3441-3447. 6, PN24 (Simanis and Nurse, 1986), 250 of B buffer was added M (10 Booher,R. and Beach,D. (1988) EMBO J., 2321-2327. Al 8, sodium phosphate, pH 1 mM 1 mM 50 mM 7.0, 0.5 % SDS, DTT, EDTA, Booher,R. and Beach,D. (1989) Cell, 57, 1009-1016. sodium 1 mM 4 fluoride, 100 sodium orthovanadate, PMSF, 1tM Agg/ml Booher,R.N., Alfa,C.E., Hyams,J.S. and Beach,D.H. (1989) Cell, 58, leupeptin and 4 aprotinin), the lysate was brought to for 2 mmn 100°C 485-497. Ag/ml and then diluted with 750 of buffer N mM sodium ,Il (10 phosphate, pH 7.0, Boulton,T.G., Yancopoulos,G.D., Gregory,J.S., Slaughter,C., Moomaw, 0.15 M NaCl, 1% Nonidet P40, 2 mM 50 mM sodium EDTA, fluoride, C., Hsu,J. and Cobb,M.H. (1990) Science, 249, 64-67. 100 1tM sodium orthovanadate, 1 mM For 5 leupeptin, PMSF). Brizeula,L., EMBO 3507-3514. Ag/ml Draetta,G. and Beach,D. (1987) J., 6, immunoprecipitation with an antiserum raised against bacterially produced Cisek,L.J. and 679-684. Corden,J.L. (1989) Nature, 339, fission yeast 4711 (Gould and Nurse, 1989), 1 ml of buffer N was p34cdc2, and Hunter,T. Methods 99, Cooper,J.A., Sefton,B.M. (1983) Enzymol., added. After two 30 min clearing spins in a incubations with microfuge, 387-402. PN24 and 4711 were performed in antibody excess for 1 h on ice. Protein Cross,F. (1988) Mol. Cell. Biol., 8, 4675-4684. A-Sepharose was then added for 30 min at 4°C and the immune complexes Dasso,M. and 811-823. Newport,J.W. (1990) Cell, 61, were washed thoroughly with buffer N. For immunoblotting, the immune Dean,A.M. and Jr 1044-1046. Koshland,D.E., (1990) Science, 249, complexes were heated to 100°C for 2 min in 1 x SDS-gel sample buffer, Doonan,J.H. and Morris,N.R. (1989) Cell, 57, 987-996. resolved on SDS- 15% polyacrylamide gels, transferred to immobilon-P Draetta,G. (1990) Trends Biochem. 378-383. Sci., 15, PN24 4711 (Millipore), and incubated with 400-fold dilutions of either or Draetta,G. and Beach,D. (1988) Cell, 54, 17-26. followed by [1251]protein A. Protein kinase assays of the immune com- Draetta,G., Brizuela,L., Potashkin,J. and Beach,D. (1987) Cell, 50, plexes 100 unlabelled were performed in 20 1l HB buffer with ATP, 319-325. AM 0.2 [32P]ATP (3000 Ci/mmol) and 10,ug histone HI (Boehringer ytCi Draetta,G., Luca,F., Westendorf,J., Brizeula,L., Rudeman,J. and Beach,D. Mannheim) for 10 min at 30°C. Reactions were stopped by the addition (1989) Cell, 56, 829-838. of 2 x sample buffer and loaded onto SDS- 15% polyacrylamide gels. Ducommun,B., Draetta,G., Young,P. and Beach,D. (1990) Biochem. Phosphorylated histone HI was visualized by autoradiography. Biophys. Res. Commun., 167, 301-309. Dunphy,W.G. and Newport,J.W. (1989) Cell, 58, 181-191. Flow Dunphy,W.G., cytometry and microscopy Brizuela,L., Beach,D. and Newport,J. (1988) Cell, 54, For flow cytometric analysis, cells were fixed in 70% 423-431. ethanol, stained with propidium iodide, and analysed as detailed previously Durkacz,B., Beach,D., Hayles,J. and (Sazer and Sherwood, Nurse,P. (1985) Mol. Gen. Genet., 1990) using a FACScan flow cytometer. 201, 543-545. 4',6-Diamidino-2-phenylindole (DAPI) staining was as described D'Urso,G., Marraccino,R.L., Marshak,D.R. and Roberts,J.M. (1990) (Moreno et al., 1991a). For indirect immunofluorescence, cells were fixed with Science, 250, 786-791. paraformaldehyde and glutaraldehyde and stained with a monoclonal antibody raised against rat Featherstone,C. and Russell,P. (1991) Nature, 349, 808-811. tubulin followed by Texas Red-conjugated goat anti-mouse IgG essentially Felix,M.-A., Pines,J., Hunt,T. and Karsenti,E. (1989) EMBO J., 8, as described (Moreno et al., 1991a). Cells were viewed with a Zeiss 3059-3069. Felix,M.-A., Axioskop microscope and photographs were taken using XP-1 film (Ilford). Cohen,P. and Karsenti,E. (1990) EMBO J., 9, 675-683. 3308 p34cdc2 Thr167 phosphorylation S.pombe Norbury,C.J., Blow,J.J. and Nurse,P. (1991) EMBO J., 10, 3321-3329. Fleig,U.N. and Nurse,P. (1991) Mol. Gen. Genet., 226, 432-440. Nurse,P. (1990) Nature, 344, 503-508. Freeman,R.A. and Donoghue,D.J. (1991) Biochemistry, 30, 2293-2302. Nurse,P. and Bissett,Y. (1981) Nature, 292, 558-560. Furukawa,Y., Piwnica-Worms,H., Ernst,T.J., Kanakura,Y. and Griffith, J.D. Science, 250, 805-808. Ohkura,H., Kinoshita,N., Miyatani,S., Toda,T. and Yanagida,M. (1989) (1990) Cell, 57, 997-1007. Gautier,J. and Maller,J.L. (1991) EMBO J., 10, 177-182. Payne,D.M., Rossomando,A.J., Martino,P., Erickson,A.K., Her,J.-H., Gautier,J., Norbury,C.J., Lohka,M., Nurse,P. and Maller,J. (1988) Cell, Shabanowitz,J., Hunt,D.F., Weber,M.J. and Sturgill,T.W. (1991) EMBO 433-439. 54, J., 10, 885-892. Gautier,J., Matsukawa,T., Nurse,P. and Maller,J. (1989) Nature, 339, Picard,A., Capony,J.P., Brautigan,D.L. and Doree,M. (1989) J. Cell Biol., 626-629. 109, 3347-3354. Gautier,J., Minshull,J., Lohka,M., Glotzer,M., Hunt,T. and Maller,J.L. Piggott,J.R., Rai,R. and Carter,B.L.A. (1982) Nature, 298, 391-393. Cell, 60, 487-494. (1990) Pines,J. and Hunter,T. (1989) Cell, 58, 833-846. Sugimoto,K., Henze,M., Lew,D.J., Ghiara,J.B., Richardson,H.E., Pines,J. and Hunter,T. (1990) The New Biol., 2, 389-401. Wittenberg,C. and Reed,S.I. (1991) Cell, 65, 163-174. Pondaven,P., Meijer,L. and Beach,D. (1990) Genes Dev., 4, 9-17. Goris,J., Hermann,J., Hendrix,P., Ozon,R. and Merlevede,W. (1989) FEBS Reed,S.I. and Wittenberg,C. (1990) Proc. Natl Acad. Sci. USA, 87, Lett., 245, 91-94. 5697-5701. and Nurse,P. (1989) Nature, 342, 39-45. Gould,K.L. Richardson,H.E., Wittenberg,C., Cross,F. and Reed,S.I. (1989) Cell, 59, Moreno,S., Tonks,N.K. and Nurse,P. (1990) Science, 250, Gould,K.L., 1127-1133. 1573-1576. Russell,P. and Nurse,P. (1986) Cell, 45, 145-153. Leupold,U. and Lopprieno,N. (1974) In King,R.C. Gutz,H., Heslot,H., Russell,P. and Nurse,P. (1987) Cell, 49, 559-567. Genetics. Plenum, New York, Vol. 1, pp. 395-446. (ed.), Handbook of Sazer,S. and Sherwood,S.W. (1990) J. Cell Sci., 97, 509-516. Wittenberg,C., Richardson,H.E., de Barros Lopes,M. and Hadwiger,J.A., Simanis,V. and Nurse,P. (1986) Cell, 45, 261-268. (1989) Proc. Natl Acad. Sci. USA, 86, 6255-6259. Reed,S.I. Solomon,M.J., Glotzer,M., Lee,T.H., Philippe,M. and Kirschner,M.W. (1988) J. Cell Sci., 91, 587-595. Hagan,I., Hayles,J. and Nurse,P. (1990) Cell, 63, 1013- 1024. Hanks,S.K. (1991) Curr. Opin. Structural Biol., 1, 369-383. Spurr,N.K., Gough,A.C. and Lee,M.G. (1990) J. DNA Sequencing Hindley,J. and Phear,G.A. (1984) Gene, 31, 129-134. Mapping, 1, 49-54. Hirt,H., Pay,A., Gyorgyey,J., Bako,L., Nemeth,K., Bogre,L., Schweyen, Surana,U., Robitsch,H., Price,C., Schuster,T., Fitch,I., Futcher,B. and R.J., Heberle-Bors,E. and Dudits,D. (1981) Proc. Natl Acad. Sci. USA, Nasmyth,K. (1991) Cell, 65, 145-161. 88, 1636-1640. Th'ng,J.P.H., Wright,P.S., Hamaguchi,J., Lee,M.G., Norbury,C.J., Hurley,J.S., Dean,A.M., Sohl,J.L., Koshland,D.E., Jr and Stroud,R.M. Nurse,P. and Bradbury,E.M. (1990) Cell, 63, 313-324. Science, 249, 1012-1016. (1990) Thomess,P.E. and Koshland,D.E., Jr (1987) Proc. Natl Acad. Sci. USA, Ducommun,B. and Beach,D. (1990) FEBS Lett., 266, 4-8. Jessus,C., 262, 10422-10425. and Glover,D.M. (1990) EMBO J., 9, Jimenez,J., Alphey,L., Nurse,P. Wittenberg,C., Sugimoto,K. and Reed,S.I. (1990) Cell, 62, 225-237. 3565-3571. Yamashita,K., Yasuda,H., Pines,J., Yasumoto,K., Hishitani,H., Ohtsubo, (1989) Anal. Biochem., 176, 22-27. Kamps,M.P. and Sefton,B.M. M., Hunter,T., Sugimura,T. and Nishimoto,T. (1990) EMBO J., 9, and Yanagida,M. (1990) Cell, 63, 405-415. Kinoshita,N., Ohkura,H. 4331 -4338. EMBO J., 8, 3071-3078. Krek,W. and Nigg,E.A. (1989) EMBO J., 10, 305-316. Krek,W. and Nigg,E.A. (1981) Received on June 7, 1991; revised on July 11, 1991 Cell, 64, 903-914. Kumagai,A. and Dunphy,W.G. (1981) and Doree,M. (1988) Nature, Labbe,J.-C., Lee,M.G., Nurse,P., Picard,A. 335, 251-254. Labbe,J.-C., Capony,J.-C., Caput,D., Cavadore,J.-C., Derancourt,J., Lelias,J.-M., Picard,A. and Doree,M. (1989a) EMBO J., Kaghad,M., 8, 3053-3058. Picard,A., Peaucellier,G., Cavadore,J.C., Nurse,P. and Labbe,J.-C., Doree,M. (1989b) Cell, 57, 253-263. and Nurse,P. (1987) Nature, 327, 31-35. Lee,M.G. and Nurse,P. (1988) Nature, 333, Norbury,C.J., Spurr,N.K. Lee,M.G., 676-679. Solomon,M.J., Mumby,M.C. and Kirschner,M.W. (1991) Cell, Lee,T.H., 64, 415-423. and O'Farrell,P.H. (1990) EMBO J., 9, 3573-3581. Lehner,C.F. and Zoller,M.J. (1990) Mol. Cell. Biol., 10, 1066-1075. Levin,L.R. 61, 743-752. Lewin,B. (1990) Cell, J. Cell Sci., 92, 131-135. Lohka,M.J. (1989) and (1984) Nature, 307, 183-185. Lorincz,A.T. Reed,S.I. Booher,R., Dembski,M., Kirschner,M. and Lundgren,K., Walwroth,N., (1991) Cell, 64, 1111-1122. Beach,D. and Sambrook,J. (1982) Molecular Cloning: A Maniatis,T., Fritsch,E.F. Manual. Cold Spring Harbor Laboratory Press, Cold Spring Laboratory NY. Harbor, J. Biol. Chem., 265, 10857-10861. Maundrell,K. (1990) Golsteyn,R., Pines,J., Brizuela,L., Hunt,T. and Meijer,L., Arion,D., EMBO J., 8, 2275-2282. Beach,D. (1989) and Reed,S.I. (1987) Cell, 50, 927-935. Mendenhall,M.D., Jones,C.A. Richardson,H.E. and Reed,S.I. (1988) Proc. Natl Acad. Mendenhall,M.D., Sci. 4426-4430. USA, 85, Hayles,J. and Nurse,P. (1989) Cell, 58, 361-372. Moreno,S., Klar,A. and Nurse,P. (1991a) Methods Enzymol., 194, Moreno,S., 795-823. Nature, 344, 549-552. Nurse,P. and Russell,P. (1991b) Moreno,S., and Cell, 58, Draetta,G., Beach,D. Wang,J.Y.J. (1989) Morla,A.O., 193-203. Science, 246, 614-621. and Kirschner,M.W. (1989) Murray,A.W. and (1989) Nature, 339, Murray,A.W., Solomon,M.J. Kirschner,M.W. 280-286. and Futcher,A.B. (1988) Anand,S., Erickson,K. Nash,R., Tokiwa,G., -4336. EMBO 4335 J., 7,

Journal

The EMBO Journal – Springer Journals

Published: Nov 1, 1991

There are no references for this article.