Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Mesenchymal stem cells detect and defend against gammaherpesvirus infection via the cGAS-STING pathway

Mesenchymal stem cells detect and defend against gammaherpesvirus infection via the cGAS-STING... OPEN Mesenchymal stem cells detect and defend against gammaherpesvirus SUBJECT AREAS: PATTERN RECOGNITION infection via the cGAS-STING pathway RECEPTORS INFECTION 1,2 1,2 1,2 1,2 1,2 1,2 Kun Yang , Jinli Wang , Minhao Wu , Meiyu Li , Yi Wang & Xi Huang Received Department of Immunology, Institute of Tuberculosis Control, Institute of Human Virology, Zhongshan School of Medicine, Sun 17 October 2014 Yat-sen University, Guangzhou 510080, China, Key Laboratory of Tropical Diseases Control (Sun Yat-sen University), Ministry of Education, Guangzhou 510080, China. Accepted 27 November 2014 Mesenchymal stem cells (MSCs) are widely used in clinical settings to treat tissue injuries and autoimmune Published disorders due to their multipotentiality and immunomodulation. Long-term observations reveal several 16 January 2015 complications after MSCs infusion, especially herpesviral infection. However, the mechanism of host defense against herpesviruses in MSCs remains largely unknown. Here we showed that murine gammaherpesvirus-68 (MHV-68), which is genetically and biologically related to human Correspondence and gammaherpesviruses, efficiently infected MSCs both in vitro and in vivo. Cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS) was identified as the sensor of MHV-68 in MSCs for the first time. Moreover, requests for materials the cytosolic DNA sensing pathway mediated a potent anti-herpesviral effect through the adaptor STING should be addressed to and downstream kinase TBK1. Furthermore, blockade of IFN signaling suggested that cytosolic DNA X.H. (huangxi6@mail. sensing triggered both IFN-dependent and -independent anti-herpesviral responses. Our findings sysu.edu.cn) demonstrate that cGAS-STING mediates innate immunity to gammaherpesvirus infection in MSCs, which may provide a clue to develop therapeutic strategy. ultipotent mesenchymal stem cells (MSCs) are a heterogeneous population of stromal cells that exist in almost all adult tissues . They can be readily isolated from several tissues, such as bone marrow, adipose M tissue and umbilical cord. Due to their tissue regenerative capacity and immunoregulatory property, MSCs recently have attracted considerable attention for potential clinical applications. They have been success- fully used to enhance the efficiency of hematopoietic stem cell engraftment , and to treat acute graft-versus-host 3 4 disease (GvHD) as well as autoimmune disorders . Although MSCs are widely used clinically, long-term observations reveal several complications after MSCs infusion, especially infectious complications . Herpesviral infection is a major cause of morbidity and mortality after stem cell transplantation . Recently, increasing experimental evidence shows that MSCs are highly suscept- ible to herpesviruses. Herpes simplex virus type 1 (HSV-1) and cytomegalovirus (CMV) can infect MSCs and induce obvious cytopathic effect (CPE) . A recent study shows that placenta-derived MSCs are fully permissive to infection with HSV-1, HSV-2, Varicella-zoster virus (VZV) and CMV . In addition, human fetal MSCs are susceptible to Kaposi sarcoma-associated herpesvirus (KSHV) in culture, and the infection persists within half of the cells for up to six weeks . Thus, it is possible that MSCs carrying herpesviruses lead to horizontal trans- mission of pathogens to recipients after cells infusion. Moreover, KSHV efficiently infects and transforms MSCs to induce tumors . These observations raise a safety concern with ex vitro expansion and subsequent clinical transplantation of MSCs. Besides, CMV-infected MSCs show impaired immunosuppressive and antimicrobial functions, which may undermine the clinical efficacy of MSC-based therapies . Therefore, it is important to investigate the mechanism by which MSCs recognize and defend against invading herpesviruses to develop a novel strategy to eliminate viruses in MSCs. As a large family of double-stranded DNA (dsDNA) viruses, herpesviruses can cause lytic infection in per- missive cells, and establish life-long latency in specific cell types. These viruses cause diseases during both primary infection (e.g. infectious mononucleosis, chickenpox) and reactivation from a latent infection (e.g. shingles). Moreover, gammaherpesviral latency proteins could drive virus-associated carcinogenesis in genetically predis- posed individuals, and result in several cancers, such as Kaposi’s sarcoma, primary effusion lymphoma , Burkitt’s lymphoma, Hodgkin’s lymphoma and nasopharyngeal carcinoma . The innate immune system is an important arm in control of herpesviruses infection. Distinct classes of pattern recognition receptors (PRRs) detect invading SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 1 www.nature.com/scientificreports pathogens on the cell surface or in cytosolic compartments . DNA was detected in primary isolated MSCs, as well as in lung and Genomic DNA is the most potent immune-stimulating component spleen, which are well-characterized sites of acute infection and of herpesviruses. Substantial evidence suggests that human herpes- latency of MHV-68 (Fig. 1d). viruses can be recognized by Toll-like receptor (TLR) 9 located in endosomes in plasmacytoid dendritic cells or primary mono- The cGAS-STING cytosolic DNA sensing pathway mediates 15–17 cytes , while other studies demonstrate the existence of TLR9- recognition of MHV-68 in MSCs. To investigate the innate independent recognition of herpesviruses . Most recently, several immune response to MHV-68 in MSCs, cells were infected with cytosolic receptors have been proposed for recognition of foreign MHV-68, and induction of the downstream gene IFN-b was 19,20 DNA in the cytosol , which may also contribute to innate immune examined. We found that IFN-b was not induced in MSCs after 21,22 response to herpesviruses . infection (Fig. 2a), suggesting that MHV-68 may inhibit the IFN To date, several cytosolic DNA sensors have been identified, response. To explore how MSCs detected foreign nucleic acid of including DNA-dependent activator of IFN-regulatory factors invading MHV-68, we stimulated cells with viral DNA by 23 24 (DAI) , absent in melanoma 2 (AIM2) , IFN-c-inducible protein transfection. Real-time PCR data showed that viral DNA induced 16 (IFI16, also called p204 in the mouse) and DEAD box polypep- the expression of IFN-b (Fig. 2b), indicating activation of the innate tide 41 (DDX41) . Recent studies report that cyclic GMP-AMP immune response. Next, we examined which receptors detected viral synthase (cGAS) also functions as a cytosolic DNA sensor to induce DNA in MSCs. Since MHV-68 is a dsDNA virus, we first tested 27,28 IFN by producing the second messenger cyclic GMP-AMP . whether TLR9 was involved in detection of MHV-68. The Although cytosolic DNA can be detected by distinct sensors, expression of TLR9 was examined by RT-PCR in MSCs. While STING is a central adaptor protein shared by these cytosolic DNA BMDM expressed TLR9, mRNA of TLR9 was not detectable in sensing pathways . In the presence of cytosolic dsDNA or cyclic MSCs (Fig. 2c). We further stimulated MSCs with TLR9 ligand dinucleotides, STING recruits and phosphorylates TANK-binding CpG DNA, and examined the expression of the downstream gene kinase 1 (TBK1). The activated TBK1 phosphorylates IFN-regula- IFN-b. While CpG DNA induced the expression of IFN-b in murine tory factor 3 (IRF3), which is a key transcription factor required for macrophage-like RAW264.7 cells, MSCs failed to respond to CpG the expression of type I IFNs . Subsequently, type I IFNs induce DNA (Fig. 2d). These results indicated that mouse MSCs did not various interferon-stimulated genes (ISGs) via the Janus kinase express functional TLR9, thus ruling out the possibility of TLR9- (JAK)-signal transducer and activator of transcription (STAT) path- mediated recognition of MHV-68 in MSCs. In addition to way to mount an efficient antiviral response . Therefore, the cyto- endosomal TLR9, foreign dsDNA can also be detected by cytosolic solic DNA sensing pathway is critical for host defense against DNA sensors. Therefore, we tested the hypothesis that cytosolic cytosolic bacteria and DNA viruses in innate immune cells . DNA sensors may recognize MHV-68 in MSCs. The expressions Several studies reveal that MSCs express some PRRs, including of well-characterized cytosolic DNA sensors including cGAS, TLRs (TLR3 and TLR4) , nucleotide binding and oligomerization DDX41, p204, AIM2, DAI and the adaptor STING were detected domain (NOD)-like receptors (NLRs) and retinoic acid inducible with RT-PCR. BMDM were used as positive control, which gene I (RIG-I)-like receptors (RLRs) , which regulate differenti- expressed the receptors above (Fig. 2e). Similarly, all of the ation, immunomodulation and survival of MSCs. Nonetheless, little receptors were expressed in MSCs, though at different levels is known regarding the expression and function of cytosolic DNA (Fig. 2e). Furthermore, we knocked down each DNA sensor with a sensors in MSCs. small interfering RNA (siRNA) to determine which sensor was The present study explores a novel mechanism by which murine responsible for detection of MHV-68 (Fig. 2f). Notably, MHV- MSCs recognize and defend against invading herpesviruses. Our 68 DNA-induced IFN-b expression in MSCs was impaired by results indicate that the cytosolic cGAS-STING pathway but not cGAS-specific siRNA, whereas siRNAs targeting other DNA endosomal TLR9 is responsible for sensing murine gammaherpes- sensors did not reduce IFN-b expression (Fig. 2g). During virus-68 (MHV-68). Activation of the cytosolic DNA sensing path- cytosolic DNA sensing, STING is a central adaptor protein. Thus, way triggers a robust antiviral response via STING-TBK1 signaling we knocked down STING to examine whether STING mediated axis, and restricts the replication of MHV-68 in both IFN-dependent recognition of MHV-68 in MSC. The knockdown efficacy was and -independent manners. Our findings provide insight into both confirmed by Western blot (Fig. 2h). Real-time data showed that the mechanism of innate immunity against herpesviruses in MSCs knockdown of STING attenuated the expression of IFN-b in MSCs and the antiviral function of the cytosolic DNA sensing pathway. stimulated with viral DNA (Fig. 2i). These results suggest that the cGAS-STING cytosolic DNA sensing pathway recognized MHV-68 Results in MSCs. MHV-68 infects MSCs both in vitro and in vivo. To explore the Activation of the cytosolic DNA sensing pathway restricts the mechanism of innate recognition and host defense against replication of MHV-68 in MSCs. To further explore whether the herpesviruses in MSCs, we established a cellular infection model of cytosolic DNA sensing pathway mediated anti-herpesviral response murine gammaherpesvirus MHV-68, which is genetically and in MSCs, we stimulated MSCs with synthetic dsDNA poly(dA:dT) or biologically similar to human gammaherpesviruses. We challenged interferon stimulatory DNA (ISD, a synthetic 45 bp dsDNA) to MSCs with MHV-68 at an MOI 0.1, and typical CPE was detected at activate the cytosolic DNA sensing pathway. Western blot data 24 hr post-infection (Fig. 1a). Most of MSCs lysed or detached from showed that both poly(dA:dT) (Fig. 3a) and ISD (Fig. 3b) induced the culture dish at 72 hr after exposure to MHV-68 (Fig. 1a). We phosphorylation of IRF3 in a time-dependent manner in MSCs, further detected viral DNA in MSCs by real-time PCR, and found suggesting activation of the cytosolic DNA sensing pathway. Next, that MHV-68 DNA copies increased in a time-dependent manner, we examined the replication of MHV-68 in MSCs after dsDNA peaking at 36 hr post-infection (Fig. 1b). Extracellular virion yield of stimulation. Pretreatment with poly(dA:dT) dramatically inhibited infected MSCs was examined by plaque assay. As shown in Fig. 1c, virus titers in the supernatant of MSCs increased markedly post- the replication of viral DNA (Fig. 3c). Plaque assay also showed a marked decrease in infectious viral particle yield of poly(dA:dT)- infection, indicating that cultured MSCs were permissive to MHV- 68 infection. To further investigate whether MHV-68 infects MSCs in pretreated MSCs (Fig. 3d). Similarly, ISD stimulation led to vivo, MSCs were isolated from mice intranasally infected with MHV- inhibition of MHV-68 DNA replication (Fig. 3e) and viral particle 68, and the existence of viral DNA was detected by using nested PCR. yield (Fig. 3f). These observations suggest an anti-herpesviral At all the indicated times (from 1 to 4 weeks) post-infection, viral response upon activation of cytosolic DNA sensing pathway. SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 2 www.nature.com/scientificreports Figure 1 | MHV-68 infects MSCs both in vitro and in vivo. MSCs were infected with MHV-68 (MOI 0.1) for the indicated time, and the cytopathic effect was examined microscopically (a). The replication of viral DNA was detected by real-time PCR (b). The virus titers in the supernatant were determined by plaque assay (c). Data are shown as mean 6 SEM of three independent experiments. (d) C57BL/6 mice were intranasally inoculated with MHV-68. Viral DNA in lung, spleen or bone-marrow-derived MSCs was detected with nested PCR of ORF50 gene at the indicated time post-infection. Data are representative of three experiments with similar results. STING-TBK1 signaling axis is required for the anti-herpesviral the adaptor STING mediated the antiviral response of cytosolic response of cytosolic DNA sensing. During cytosolic DNA sensing, DNA sensing pathway. the adaptor STING recruits and phosphorylates TBK1 kinase To further test the involvement of TBK1 in the cytosolic DNA to activate downstream signaling. To examine STING-TBK1 sensing-mediated antiviral response, small molecule kinase inhibitor signaling, MSCs were stimulated with poly(dA:dT), and the BX795 was used to inhibit TBK1 activity. When stimulated with subcellular distribution of STING and phosphorylated TBK1 was poly(dA:dT), TBK1-inhibited MSCs showed less phosphorylation visualized with immunofluorescence microscopy. In mock-treated of IRF3 (Fig. 4f). When TBK1 kinase was inhibited, poly(dA:dT)- MSCs, STING distributed diffusely in the cytosol, and treated MSCs showed increased viral DNA replication (Fig. 4g) and phosphorylation of TBK1 was not observed (Fig. 4a). However, in virion production (Fig. 4h). Thus, TBK1 kinase was required for the response to dsDNA transfection, STING aggregated perinuclearly, cytosolic DNA sensing-mediated antiviral effect. and phosphorylated TBK1 was found to co-localize with STING (Fig. 4a). Moreover, Western blot showed that phosphorylation of Cytosolic DNA sensing mediates both IFN-dependent and - TBK1 in MSCs after poly(dA:dT) transfection was time-dependent independent antiviral effects. Activation of STING-TBK1 (Fig. 4b). These observations indicated activation of the STING- signaling axis after cytosolic dsDNA stimulation leads to the TBK1 signaling in dsDNA-stimulated MSCs. To elucidate whether production of type I IFNs, which initiate an innate antiviral the adaptor STING mediated the cytosolic DNA sensing-induced response by inducing hundreds of ISGs through the JAK-STAT antiviral response, we silenced endogenous STING with siRNA in pathway. To determine whether cytosolic DNA sensing-mediated MSCs, and stimulated the cells with poly(dA:dT). Western blot antiviral effect depended on an autocrine effect of type I IFNs, JAK showed that phosphorylation of downstream transcription factor inhibitor Ruxolitinib was used to block IFN-JAK-STAT signaling in IRF3 was dramatically attenuated in poly(dA:dT)-stimulated MSCs dsDNA-stimulated MSCs. Western blot showed that at the in which STING was knocked down (Fig. 4c), suggesting a critical concentration of 1.0 mM, Ruxolitinib almost completely blocked role of STING in cytosolic DNA sensing. Furthermore, viral DNA dsDNA-induced phosphorylation of STAT1 downstream of IFN- replication and virion yield were examined in STING-silenced JAK-STAT pathway (Fig. 5a). Furthermore, we found that MSCs. Both real-time PCR (Fig. 4d) and plaque assay (Fig. 4e) blocking of the JAK-STAT pathway partially reduced the DNA data showed that dsDNA stimulation decreased viral replication in sensing-mediated antiviral activity, as indicated by both viral DNA siNC-treated MSCs, while the antiviral effect was abolished in (Fig. 5b) and plaque assay data (Fig. 5c). These results suggest that the STING-silenced MSCs (Fig. 4d, 4e). These results indicated that DNA-sensing pathway could mediate antiviral effects in the absence SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 3 www.nature.com/scientificreports Figure 2 | The cGAS-STING cytosolic DNA sensing pathway mediates recognition of MHV-68 in MSCs. MSCs were infected with MHV-68 (MOI 0.1) (a) or transfected with MHV-68 DNA (0.5 mg/ml) (b) for the indicated time, and then analyzed for IFN-b expression by real-time PCR. The expressions of TLR9 and MyD88 in MSCs or BMDM were detected with RT-PCR (c). MSCs and RAW264.7 cells were stimulated with CpG DNA (2 mM) for the indicated time, and then analyzed for IFN-b mRNA expression (d). The expressions of cytosolic DNA sensors and adaptor STING in MSCs or BMDM were detected with RT-PCR (e). MSCs were transfected with indicated siRNA for 48 hr, and then stimulated with MHV-68 DNA (0.5 mg/ml) for 6 hr (f)–(i). The knockdown efficacy was confirmed by real-time PCR (f) or Western blot (h), and the expressions of IFN-b were detected by real-time PCR (g), (i). RT-PCR and Western blot data are representative of three experiments with similar results. Real-time PCR data are shown as mean 6 SEM of three independent experiments. *, p , 0.05; ***, p , 0.001. of canonical IFN-JAK-STAT signaling. Moreover, we examined Discussion whether the DNA-sensing pathway can mediate antiviral ISGs Recently, MSCs infusion is a plausible strategy in clinical treatment 36,37 expression independently of IFN signaling. Real-time PCR data of tissue injury and immune-related disorders , due to the multi- showed that when IFN-JAK-STAT pathway was blocked by potentiality and immunomodulatory properties of MSCs. Never- Ruxolitinib, transfection with poly(dA:dT) still induced expres- theless, increasing clinical reports reveal that allogeneic stem cell 38–40 sions of ISGs, including IFIT1-3, ISG15 and Mx1, though the ex- transplantation is often complicated by herpesviral infection , pression levels were lower than that in MSCs without Ruxolitinib thus raising the safety concerns . However, the mechanism of host treatment (Fig. 5d). Together, these data imply that cytosolic DNA defense against herpesviruses in MSCs remains elusive. In this study, sensing mediated both IFN-dependent and -independent antiviral for the first time, we identify functional cytosolic DNA sensors in effects. MSCs, and demonstrate that the cGAS-STING cytosolic DNA sens- SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 4 www.nature.com/scientificreports Figure 3 | Activation of the cytosolic DNA sensing pathway restricts the replication of MHV-68 in MSCs. MSCs were transfected with poly (dA:dT) (a) or ISD (b) (0.5 mg/ml), and phosphorylation of IRF3 was detected by Western blot. Data are representative of three experiments with similar results. MSCs were transfected with poly (dA:dT) (c), (d) or ISD (e), (f) at the indicated concentration for 6 hr, then infected with MHV-68 (MOI 0.1). The replication of viral DNA was detected by real-time PCR at 6 hr post-infection (c and e). The virus titers in the supernatant were determined by plaque assay at 24 hr post-infection (d), (f). Data are shown as mean 6 SD. of three independent experiments. ing pathway is responsible for detecting murine gammaherpesvirus Upon detection of viral dsDNA, cytosolic DNA sensing pathway MHV-68, and mediates both IFN-dependent and independent anti- plays a critical role in host antiviral response. For example, AIM2- herpesviral responses in MSCs. knockout mice have a higher viral load in spleens after exposure to mouse cytomegalovirus than wild-type mice . A recent study reveals Previous studies suggest that human MSCs are highly susceptible 7 9 to several herpesviruses, including HSV, CMV and KSHV . In the that cGAS is essential for immune defense against HSV-1 infection in present study, we find that cultured MSCs are lytically infected by vivo . IFI16 acts as a restriction factor against HCMV replication in human embryonic lung fibroblasts . We find that activation of cyto- murine gammaherpesvirus MHV-68. Moreover, viral DNA is detected in MSCs from MHV-68-infected mice, suggesting that solic DNA sensing pathway restricts the replication of MHV-68. In MSCs may be latently infected with gammaherpesvirus in vivo and addition, previous studies show that the deficiency of adaptor STING renders mice more susceptible to lethal infection with HSV-1 , and serve as viral reservoirs. This observation supports a general belief that horizontal transmission of herpesviruses from grafts to recipi- that downstream TBK1 kinase is required for host defense against ents results in serious complication in patients receiving allogeneic DNA viruses infection, including MHV-68 . Consistently, we dem- onstrate that cytosolic DNA sensing mediates an anti-herpesviral stem cell transplantation. Herpesviruses can be sensed via both TLR-dependent and -inde- effect, and that this requires the STING-TBK1 signaling axis. 18,42 pendent pathways . In plasmacytoid dendritic cells (pDCs), endo- Previous studies demonstrate that MHV-68 develops several strat- 43–45 egies to evade host antiviral defense at multiple stages, such as somal TLR9 mediates recognition of HSV and KSHV . Here, we 49 39 50 find that murine MSCs do not express functional TLR9, which is TBK1 , IRF3 and IFNAR . Here, we find that MHV-68 infection consistent with a previous report . Other studies reveal that cytosolic does not induce an IFN response. It is possible that MHV-68 antag- onizes the cytosolic DNA sensing-mediated IFN response in MSCs DNA sensors are also responsible for recognition of herpesviruses, such as IFI16 detecting KSHV DNA in endothelial cells , DAI sens- after infection. It may explain why knockdown of STING or inhibi- ing human cytomegalovirus (HCMV) in fibroblasts, as well as DAI , tion of TBK1 in MSCs without exogenous dsDNA stimulation does 25 26 32 not affect MHV-68 replication. Therefore, activation of the cytosolic IFI16 , DDX41 and AIM2 all of which recognize HSV-1 in macrophages. These studies reveal redundant cytosolic DNA sen- DNA sensing pathway with synthetic dsDNA may provide a novel sors, and cell type-specific DNA sensing pathways. However, a recent strategy to elicit host antiviral response to inhibit MHV-68 replication. study demonstrates a non-redundant role of newly-discovered cyto- solic sensor cGAS for DNA sensing in macrophages, dendritic cells Cytosolic DNA sensing activates STING-TBK1-IRF3 signaling and fibroblasts . These cytosolic DNA sensors have not been axis that triggers the expression of type I IFNs . It is generally thought that PRRs induce the expression of type I IFNs that act in reported in MSCs before. We show here that all of the sensors above are expressed in MSCs, and cGAS is indispensible for recognition of an autocrine manner to amplify ISGs expression and direct a multi- MHV-68 in MSCs. Previous studies show that AIM2 recognizes faceted antiviral response. However, ISGs can also be induced cytosolic DNA and assembles the inflammasome to mediate an directly without need for canonical IFN signaling. For example, inflammatory response . Nevertheless, upon binding to dsDNA, RIG-I-like receptor (RLR) adaptor protein IPS-I located on the per- AIM2 does not induce an IFN response, and rather serves as a nega- oxisome induces rapid IFN-independent expression of ISGs upon 24,32 51 RNA virus infection, and provides short-term protection . tive regulator . Here, we also observe enhanced IFN-b expression in AIM2-knocked down MSCs after viral DNA stimulation. Whether Knockout of cytosolic exonuclease Trex1 induces high expression AIM2 triggers the inflammasome in MSCs after MHV-68 infection of antiviral ISGs genes in type I IFN receptor deficient cells . The 2/2 IFN-independent activation of antiviral genes in Trex1 cells may be possible, but needs further investigation. SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 5 www.nature.com/scientificreports Figure 4 | STING adaptor and TBK1 kinase are required for the antiviral response of cytosolic DNA sensing pathway. MSCs were transfected with poly(dA:dT) (0.5 mg/ml) for 1 hr, and the subcellular distribution of STING and phosphorylated TBK1 were analyzed by immunofluorescence microscopy (a). Phosphorylation of TBK1 kinase was detected by Western blot (b). MSCs were transfected with siSTING for 48 hr (c)-(e) or pretreated with BX795 for 1 hr (f)-(h), and then transfected with poly(dA:dT) (0.5 mg/ml), followed by MHV-68 infection (MOI 0.1). Protein levels of STING and phosphorylated IRF3 were analyzed by Western blot (c), (f). Data are representative of three experiments with similar results. The replication of viral DNA was detected by real-time PCR at 6 hr post-infection (d), (g). The virus titers in the supernatant were determined by plaque assay at 24 hr post-infection (e), (h). Real-time PCR data are shown as mean 6 SEM of three independent experiments. **, p , 0.01; ***, p , 0.001. requires the adaptor STING, the kinase TBK1 and the transcription findings give a better understanding of not only host defense against factors IRF3 . Most recently, Schoggins et al. report that ectopic gammaherpesvirus infection in MSCs but also the antiviral function 2/2 expression of cGAS in STAT1 fibroblasts which are deficient in of the cGAS-STING pathway. Therefore, our study may provide a IFN signaling, induces many ISGs via the STING-IRF3 pathway . novel strategy for clinical treatment of gammaherpesvirus infections. This study indicates that cytosolic DNA sensing can also mediate an antiviral program independent of canonical IFN signaling. In this Methods study, we find that cytosolic DNA sensing mediates an antiviral Ethics statement. The methods used were carried out in accordance with the response in MSCs via STING-TBK1 signaling axis, and blockade of approved guidelines. All experimental protocols were approved by Sun Yat-sen IFN signaling with JAK inhibitor can only partially reduce cytosolic University. All animal experiments were approved by the Animal Ethics Committee of Sun Yat-sen University and performed in accordance with the guidelines of Animal DNA sensing-mediated antiviral activity. The result implies an IFN/ Care and Use of Sun Yat-sen University. JAK/STAT-independent antiviral response. However, further invest- 2/2 igation using MSCs isolated from STAT1 mice is needed to pro- Reagents. Poly(dA:dT) was purchased from Sigma (St. Louis, MO). CpG vide convincing evidence to demonstrate the IFN-independent oligodeoxynucleotide (CpG DNA, TLR9 ligand) and BX795 (TBK1 inhibitor) were mechanism. from Invivogen (San Diego, CA). Ruxolitinib (JAK inhibitor) was obtained from In summary, we demonstrate that MSCs recognize gammaherpes- Selleck Chemicals (Houston, TX). Anti-STING (3337S), anti-phosphorylated IRF3 (4947S), anti-phosphorylated TBK1 (5483S), anti-phosphorylated STAT1 (Tyr701) virus MHV-68 via cytosolic DNA sensor cGAS. Activation of the (9171S) and (for Western blot) antibodies were obtained from Cell Signaling cytosolic DNA sensing pathway by dsDNA limits the replication of Technology (Beverly, MA). Anti-IRF3 (sc-9082), anti-STAT1 (sc-346) and anti- MHV-68 via STING-TBK1 signaling axis. Furthermore, our data STING antibody (sc-241049) (for immunofluorescence microscopy) were from Santa suggest that the cytosolic DNA sensing pathway mediates antiviral Cruz Biotechnology (Santa Cruz, CA). Anti-b-actin antibody (A1978) was from defense in both IFN-dependent and -independent manners. These Sigma (St. Louis, MO). SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 6 www.nature.com/scientificreports Figure 5 | Cytosolic DNA sensing pathway mediates both IFN-dependent and -independent antiviral responses. MSCs were pretreated with JAK inhibitor Ruxolitinib (Rux) for 1 hr, then transfected with poly(dA:dT) (0.5 mg/ml), followed by MHV-68 infection (MOI 0.1). The phosphorylation of STAT1 was examined by Western blot at 2 hr post-tranfection (a). The replication of viral DNA was detected by real-time PCR at 6 hr post-infection (b). The virus titers in supernatant were determined by plaque assay at 24 hr post-infection (c). The mRNA expressions of selected ISGs were analyzed by real- time PCR at 6 hr post-tranfection (d). Data are shown as mean 6 SEM of three independent experiments. **, p , 0.01; ***, p , 0.001. Cell culture. MSCs were obtained from bone marrow of tibia and femur of 6- to 8- cells were then overlaid with culture medium containing 0.5% agarose. After one 35,54 week-old female C57BL/6 mice as described previously . Cells were maintained in week incubation, plaques were visualized with 0.03% neutral red staining and counted DMEM low glucose medium supplemented with 10% FBS, 2 mM glutamine, 100 U/ at the optimum dilution to calculate virus titer. ml penicillin, and 100 mg/ml streptomycin (all from Invitrogen, Carlsbad, CA). The isolated MSCs were immunophenotyped by flow cytometry as reported previously . Mice infection and organ harvesting. C57BL/6 mice were anesthetized and MSCs from passage 5 to 20 were used in all experiments. Macrophage-like RAW264.7 intranasally inoculated with 5 000 PFU of MHV-68. The infected mice were sacrificed cells were maintained in DMEM supplemented with 10% FBS as reported at indicated time post-infection, and lung and spleen tissues were harvested and previously . Bone marrow-derived macrophages (BMDMs) were isolated and homogenized for DNA isolation. MSCs were isolated as described above. All mice cultured as described previously . All experiments involving animals were approved procedures here were performed according to the Animal Ethics Committee guides of by the Animal Ethics Committee of Sun Yat-sen University. Sun Yat-sen University. MHV68 DNA was determined by using nested PCR of viral ORF50 gene sequence as described previously . Nucleic acids transfection. To activate cytosolic DNA sensing pathway or stimulate MSCs with viral DNA, poly(dA:dT), interferon stimulatory DNA (ISD, a synthetic Western blot. Western blot was performed as described previously . Briefly, the 45 bp dsDNA) or MHV-68 DNA was transfected into the cytosol of MSCs by using whole-cell extract was resolved by SDS-polyacrylamide gel electrophoresis and Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. transferred to nitrocellulose membranes. The membranes were blocked in 5% bovine serum albumin and then incubated with diluted primary antibodies overnight at 4uC. Virus and plaque assay. MHV-68 was kindly provided by Prof. Yan Yuan (University Western blot detection was performed with IRDye 800 CW conjugated anti-rabbit of Pennsylvania School of Dental Medicine, Philadelphia), and propagated in Vero IgG or IRDye 680 CW conjugated anti-mouse IgG secondary antibodies according to cells. Viral titer was determined by plaque assay and viral stocks were stored at the manufacturer’s protocols (LI-COR Biosciences, Lincoln, NE). The blots were 280uC. For plaque assay, ten-fold serial dilutions of each cell-free supernatant were visualized using an Odyssey infrared imaging system (LI-COR Biosciences, Lincoln, incubated on a monolayer of Vero cells for 1 hr with occasional rocking. The infected NE). SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 7 www.nature.com/scientificreports 5. von Bahr, L. et al. Long-term complications, immunologic effects, and role of passage for outcome in mesenchymal stromal cell therapy. Biol. Blood Marrow Table 1 | Sequence of primers used in PCR amplification Transplant. 18, 557–564 (2012). Gene Primer Sequence (59 -39) 6. Forslow, U. et al. Treatment with mesenchymal stromal cells is a risk factor for pneumonia-related death after allogeneic hematopoietic stem cell cGAS Fwd:ACCGGACAAGCTAAAGAAGGTGCT transplantation. Eur. J. Haematol. 89, 220–227 (2012). Rev: GCAGCAGGCGTTCCACAACTTTAT 7. Sundin, M. et al. Mesenchymal stem cells are susceptible to human herpesviruses, DDX41 Fwd: TGAAGCTGACCGCATGATTGAC but viral DNA cannot be detected in the healthy seropositive individual. Bone Marrow Transplant. 37, 1051–1059 (2006). Rev: TCCAGCACGACCCACATTGA 8. Avanzi, S. et al. Susceptibility of human placenta derived mesenchymal stromal/ p204 Fwd: ACCAAGAGCAATACACCACG stem cells to human herpesviruses infection. PLoS One 8, e71412 (2013). Rev: TCTCGCCTCTTTCAGATGCT 9. Parsons, C. H., Szomju, B. & Kedes, D. H. Susceptibility of human fetal AIM2 Fwd: GTTATTAAGACTGCCCAACCTG mesenchymal stem cells to Kaposi sarcoma-associated herpesvirus. Blood 104, Rev: CATCCAATAGATGACTGTGAGC 2736–2738 (2004). DAI Fwd: AATCAAGTCCTTTACCGCCTG 10. Jones, T. et al. Direct and efficient cellular transformation of primary rat Rev: TTTCATCAAGGCTAGGCTGG mesenchymal precursor cells by KSHV. J. Clin. Invest. 122, 1076–1081 (2012). STING Fwd: ATTCCAACAGCGTCTACGAG 11. Meisel, R. et al. Cytomegalovirus infection impairs immunosuppressive and Rev: GCAGAAGAGTTTAGCCTGCT antimicrobial effector functions of human multipotent mesenchymal stromal Mx1 Fwd: ACAGGACACCAGTAAGTGCAGC cells. Mediators Inflamm. 2014, 898630 (2014). 12. Mesri, E. A., Cesarman, E. & Boshoff, C. Kaposi’s sarcoma and its associated Rev: AGCGACCAGGAAAGCCACATAG herpesvirus. Nat. Rev. Cancer 10, 707–719 (2010). ISG15 Fwd: ACTAACTCCATGACGGTGTCAG 13. Thompson, M. P. & Kurzrock, R. Epstein-Barr virus and cancer. Clin. Cancer Res. Rev: GTTCCTCACCAGGATGCTCAG 10, 803–821 (2004). IFIT1 Fwd: CGCGTAGACAAAGCTCTTCATC 14. Akira, S., Uematsu, S. & Takeuchi, O. Pathogen recognition and innate immunity. Rev: ATGGCCTGTTGTGCCAATTC Cell 124, 783–801 (2006). IFIT2 Fwd: ATGAGTTTCAGAACAGTGAGTTTAA 15. Lund, J., Sato, A., Akira, S., Medzhitov, R. & Iwasaki, A. Toll-like receptor 9- Rev: AACTGGCCCATGTGATAGTAGACCC mediated recognition of Herpes simplex virus-2 by plasmacytoid dendritic cells. IFIT3 Fwd: TGGCCTACATAAAGCACCTAGATGG J. Exp. Med. 198, 513–520 (2003). Rev: CGCAAACTTTTGGCAAACTTGTCT 16. Varani, S. et al. Human cytomegalovirus differentially controls B cell and T cell responses through effects on plasmacytoid dendritic cells. J. Immunol. 179, 7767–7776 (2007). siRNA knockdown. siRNAs were chemically synthesized by Invitrogen, and 17. Fiola, S., Gosselin, D., Takada, K. & Gosselin, J. TLR9 contributes to the scrambled siRNA (siNC) was used as negative control. The target sequences of recognition of EBV by primary monocytes and plasmacytoid dendritic cells. 27,28 siRNAs used were as following: STING, 59-GAGCTTGACTCCAGCGGAA-39 ; J. Immunol. 185, 3620–3631 (2010). cGAS, 59-GGATTGAGCTACAAGAATA-39 ; DDX41, 59- 18. Hochrein, H. et al. Herpes simplex virus type-1 induces IFN-alpha production via TGACATGCCTGAAGAGATA-39 ; p204, 59-AGAAAACAGTGAACCGAAA- Toll-like receptor 9-dependent and -independent pathways. Proc. Natl. Acad. Sci. 27 58 39 ; AIM2, 59-ACATAGACACTGAGGGTAT-39 ; DAI, 59- U. S. A. 101, 11416–11421 (2004). GGTCAAAGGGTGAAGTCAT-39 ; For knockdown experiments, cells were 19. Hornung, V. & Latz, E. Intracellular DNA recognition. Nat. Rev. Immunol. 10, transfected with siRNA using Lipofectamine 2000 (Invitrogen) following the 123–130 (2010). manufacturer’s protocol. 20. Paludan, S. R. & Bowie, A. G. Immune sensing of DNA. Immunity 38, 870–880 (2013). Quantitative nucleic acid analysis. Total RNA was extracted from cells with TRIzol 21. DeFilippis, V. R., Alvarado, D., Sali, T., Rothenburg, S. & Fruh, K. Human Reagent (Life Technologies, Carlsbad, CA) and reverse transcribed into cDNA by cytomegalovirus induces the interferon response via the DNA sensor ZBP1. TM RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, J. Virol. 84, 585–598 (2010). MA). For RT-PCR, the expression of various transcripts was assessed by PCR 22. Kerur, N. et al. IFI16 acts as a nuclear pathogen sensor to induce the amplification using a standard protocol. Amplified products were fractionated by inflammasome in response to Kaposi Sarcoma-associated herpesvirus infection. 1.0% agarose gel electrophoresis and visualized by ethidium bromide staining. Cell Host Microbe 9, 363–375 (2011). Quantitative real-time PCR analysis of transcripts was performed on Bio-Rad CFX96 23. Takaoka, A. et al. DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator real-time detection system using SYBR Green Master Mix (Applied Biosystems, of innate immune response. Nature 448, 501–505 (2007). Foster City, CA). Sequences of primer pairs used were listed in Table 1. Other primers 24. Hornung, V. et al. AIM2 recognizes cytosolic dsDNA and forms a caspase-1- used in the present study were described previously . For cytosolic MHV-68 DNA activating inflammasome with ASC. Nature 458, 514–518 (2009). quantification, DNA was isolated from MHV-68-infected MSCs using TRIzol 25. Unterholzner, L. et al. IFI16 is an innate immune sensor for intracellular DNA. Reagent (Life Technologies, Carlsbad, CA) per manufacturer’s protocol. Viral DNA Nat. Immunol. 11, 997–1004 (2010). (ORF56) and cellular b-actin were quantified by real-time PCR . Viral genomic DNA 26. Zhang, Z. et al. The helicase DDX41 senses intracellular DNA mediated by the in infected cells was calculated as compared to internal control b-actin. adaptor STING in dendritic cells. Nat. Immunol. 12, 959–965 (2011). 27. Sun, L., Wu, J., Du, F., Chen, X. & Chen, Z. J. Cyclic GMP-AMP synthase is a Immunofluorescence microscopy. Cells were grown on glass coverslips and treated cytosolic DNA sensor that activates the type I interferon pathway. Science 339, as indicated, and then fixed with 4% paraformaldehyde, permeabilized with 0.2% 786–791 (2013). Triton X-100 and blocked with 5% BSA. Samples were incubated with primary 28. Wu, J. et al. Cyclic GMP-AMP is an endogenous second messenger in innate antibody at 4uC overnight, and then with secondary antibody for 1 hr at room immune signaling by cytosolic DNA. Science 339, 826–830 (2013). temperature. Nuclei were labeled with 4, 6-diamidino-2-phenylindole (DAPI) 29. Ishikawa, H., Ma, Z. & Barber, G. N. STING regulates intracellular DNA- staining. Coverslips were mounted with ProLong Gold antifade reagent (Invitrogen) mediated, type I interferon-dependent innate immunity. Nature 461, 788–792 and visualized using Olympus BX53 fluorescence microscope (Olympus (2009). Corporation, Tokyo, Japan). 30. Tanaka, Y. & Chen, Z. J. STING specifies IRF3 phosphorylation by TBK1 in the cytosolic DNA signaling pathway. Sci. Signal. 5, ra20 (2012). 31. Schneider, W. M., Chevillotte, M. D. & Rice, C. M. Interferon-stimulated genes: a Statistical analysis. Experiments were performed for at least three times independently. GraphPad Prism 4.0 (GraphPad Software, San Diego, CA) was used complex web of host defenses. Annu. Rev. Immunol. 32, 513–545 (2014). 32. Rathinam, V. A. et al. The AIM2 inflammasome is essential for host defense for statistical analysis. Differences between two groups were compared by using an unpaired Student’s t-test. Differences between three groups or more were compared against cytosolic bacteria and DNA viruses. Nat. Immunol. 11, 395–402 (2010). by using a one-way analysis of variance with Bonferroni’s post-test. Differences were 33. Pevsner-Fischer, M. et al. Toll-like receptors and their ligands control considered statistically significant with a p value less than 0.05. mesenchymal stem cell functions. Blood 109, 1422–1432 (2007). 34. Kim, H. S. et al. Implication of NOD1 and NOD2 for the differentiation of multipotent mesenchymal stem cells derived from human umbilical cord blood. 1. Uccelli, A., Moretta, L. & Pistoia, V. Mesenchymal stem cells in health and disease. PLoS One 5, e15369 (2010). Nat. Rev. Immunol. 8, 726–736 (2008). 35. Yang, K. et al. Functional RIG-I-like receptors control the survival of 2. Chou, S. H. et al. Mesenchymal stem cell insights: prospects in hematological mesenchymal stem cells. Cell Death Dis. 4, e967 (2013). transplantation. Cell Transplant. 22, 711–721 (2013). 36. Marigo, I. & Dazzi, F. The immunomodulatory properties of mesenchymal stem 3. Le Blanc, K. et al. Treatment of severe acute graft-versus-host disease with third cells. Semin. Immunopathol. 33, 593–602 (2011). party haploidentical mesenchymal stem cells. Lancet 363, 1439–1441 (2004). 37. Bernardo, M. E., Pagliara, D. & Locatelli, F. Mesenchymal stromal cell therapy: a 4. Bernardo, M. E. & Fibbe, W. E. Safety and efficacy of mesenchymal stromal cell revolution in Regenerative Medicine? Bone Marrow Transplant. 47, 164–171 therapy in autoimmune disorders. Ann. N. Y. Acad. Sci. 1266, 107–117 (2012). (2012). SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 8 www.nature.com/scientificreports 38. Allain, J. P. Emerging viral infections relevant to transfusion medicine. Blood Rev. 57. Gargano, L. M., Forrest, J. C. & Speck, S. H. Signaling through Toll-like receptors 14, 173–181 (2000). induces murine gammaherpesvirus 68 reactivation in vivo. J. Virol. 83, 1474–1482 39. Luppi, M. et al. Bone marrow failure associated with human herpesvirus 8 (2009). infection after transplantation. N. Engl. J. Med. 343, 1378–1385 (2000). 58. Fernandes-Alnemri, T., Yu, J. W., Datta, P., Wu, J. & Alnemri, E. S. AIM2 activates 40. Dulery, R. et al. Early human herpesvirus type 6 reactivation after allogeneic stem the inflammasome and cell death in response to cytoplasmic DNA. Nature 458, cell transplantation: a large-scale clinical study. Biol. Blood Marrow Transplant. 509–513 (2009). 18, 1080–1089 (2012). 59. Hwang, S. et al. Conserved herpesviral kinase promotes viral persistence by 41. Behzad-Behbahani, A. et al. Risk of viral transmission via bone marrow progenitor inhibiting the IRF-3-mediated type I interferon response. Cell Host Microbe 5, cells versus umbilical cord blood hematopoietic stem cells in bone marrow 166–178 (2009). transplantation. Transplant. Proc. 37, 3211–3212 (2005). 42. Malmgaard, L., Melchjorsen, J., Bowie, A. G., Mogensen, S. C. & Paludan, S. R. Viral activation of macrophages through TLR-dependent and -independent pathways. J. Immunol. 173, 6890–6898 (2004). Acknowledgments 43. Krug, A. et al. Herpes simplex virus type 1 activates murine natural interferon- This work was supported by grants National Natural Science Foundation of China producing cells through toll-like receptor 9. Blood 103, 1433–1437 (2004). (31470877, 81261160323, 81172811, 30972763, U0832006, 31200662), Guangdong 44. West, J. A., Gregory, S. M., Sivaraman, V., Su, L. & Damania, B. Activation of Innovative Research Team Program (No. 2009010058), Guangdong Natural Science plasmacytoid dendritic cells by Kaposi’s sarcoma-associated herpesvirus. J. Virol. Foundation (10251008901000013, S2012040006680), Guangdong Province Universities 85, 895–904 (2011). and Colleges Pearl River Scholar Funded Scheme (No. 2009), National Science and 45. Guggemoos, S. et al. TLR9 contributes to antiviral immunity during Technology Key Projects for Major Infectious Diseases (2013ZX10003001), The 111 Project gammaherpesvirus infection. J. Immunol. 180, 438–443 (2008). (No. B13037). The authors wish to thank Dr. Linda D. Hazlett from Wayne State University 46. Li, X. D. et al. Pivotal roles of cGAS-cGAMP signaling in antiviral defense and School of Medicine for her useful comments and in-depth language editing. immune adjuvant effects. Science 341, 1390–1394 (2013). 47. Gariano, G. R. et al. The intracellular DNA sensor IFI16 gene acts as restriction factor for human cytomegalovirus replication. PLoS Pathog. 8, e1002498 (2012). Author contributions 48. Miyahira, A. K., Shahangian, A., Hwang, S., Sun, R. & Cheng, G. TANK-binding X.H. conceived and supervised the project; X.H., M.W. and K.Y. designed the experiments; kinase-1 plays an important role during in vitro and in vivo type I IFN responses K.Y. performed most of the experiments; J.W. performed Western blot analysis; Y.W. to DNA virus infections. J. Immunol. 182, 2248–2257 (2009). performed some plaque-forming assays; M.L. provided key reagents; X.H., K.Y. and M.W. 49. Kang, H. R. et al. Murine gammaherpesvirus 68 encoding open reading frame 11 analyzed the data and wrote the manuscript. targets TANK binding kinase 1 to negatively regulate the host type I interferon response. J. Virol. 88, 6832–6846 (2014). 50. Leang, R. S. et al. The anti-interferon activity of conserved viral dUTPase ORF54 is Additional information essential for an effective MHV-68 infection. PLoS Pathog. 7, e1002292 (2011). Competing financial interests: The authors declare no competing financial interests. 51. Dixit, E. et al. Peroxisomes are signaling platforms for antiviral innate immunity. How to cite this article: Yang, K. et al. Mesenchymal stem cells detect and defend against Cell 141, 668–681 (2010). gammaherpesvirus infection via the cGAS-STING pathway. Sci. Rep. 5, 7820; DOI:10.1038/ 52. Hasan, M. et al. Trex1 regulates lysosomal biogenesis and interferon-independent srep07820 (2015). activation of antiviral genes. Nat. Immunol. 14, 61–71 (2013). 53. Schoggins, J. W. et al. Pan-viral specificity of IFN-induced genes reveals new roles This work is licensed under a Creative Commons Attribution-NonCommercial- for cGAS in innate immunity. Nature 505, 691–695 (2014). 54. Lei, J. et al. Ligation of TLR2 and TLR4 on murine bone marrow-derived NoDerivs 4.0 International License. The images or other third party material in mesenchymal stem cells triggers differential effects on their immunosuppressive this article are included in the article’s Creative Commons license, unless indicated activity. Cell. Immunol. 271, 147–156 (2011). otherwise in the credit line; if the material is not included under the Creative 55. Wang, J. et al. MicroRNA-155 promotes autophagy to eliminate intracellular Commons license, users will need to obtain permission from the license holder mycobacteria by targeting Rheb. PLoS Pathog. 9, e1003697 (2013). in order to reproduce the material. To view a copy of this license, visit http:// 56. Yang, K. et al. miR-155 suppresses bacterial clearance in Pseudomonas creativecommons.org/licenses/by-nc-nd/4.0/ aeruginosa-induced keratitis by targeting Rheb. J. Infect. Dis. 210, 89–98 (2014). SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 9 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Scientific Reports Springer Journals

Mesenchymal stem cells detect and defend against gammaherpesvirus infection via the cGAS-STING pathway

Download PDF
9 pages

Loading next page...
 
/lp/springer-journals/mesenchymal-stem-cells-detect-and-defend-against-gammaherpesvirus-aIgwDCyX6C

References (69)

Publisher
Springer Journals
Copyright
Copyright © 2015 by The Author(s)
Subject
Science, Humanities and Social Sciences, multidisciplinary; Science, Humanities and Social Sciences, multidisciplinary; Science, multidisciplinary
eISSN
2045-2322
DOI
10.1038/srep07820
Publisher site
See Article on Publisher Site

Abstract

OPEN Mesenchymal stem cells detect and defend against gammaherpesvirus SUBJECT AREAS: PATTERN RECOGNITION infection via the cGAS-STING pathway RECEPTORS INFECTION 1,2 1,2 1,2 1,2 1,2 1,2 Kun Yang , Jinli Wang , Minhao Wu , Meiyu Li , Yi Wang & Xi Huang Received Department of Immunology, Institute of Tuberculosis Control, Institute of Human Virology, Zhongshan School of Medicine, Sun 17 October 2014 Yat-sen University, Guangzhou 510080, China, Key Laboratory of Tropical Diseases Control (Sun Yat-sen University), Ministry of Education, Guangzhou 510080, China. Accepted 27 November 2014 Mesenchymal stem cells (MSCs) are widely used in clinical settings to treat tissue injuries and autoimmune Published disorders due to their multipotentiality and immunomodulation. Long-term observations reveal several 16 January 2015 complications after MSCs infusion, especially herpesviral infection. However, the mechanism of host defense against herpesviruses in MSCs remains largely unknown. Here we showed that murine gammaherpesvirus-68 (MHV-68), which is genetically and biologically related to human Correspondence and gammaherpesviruses, efficiently infected MSCs both in vitro and in vivo. Cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS) was identified as the sensor of MHV-68 in MSCs for the first time. Moreover, requests for materials the cytosolic DNA sensing pathway mediated a potent anti-herpesviral effect through the adaptor STING should be addressed to and downstream kinase TBK1. Furthermore, blockade of IFN signaling suggested that cytosolic DNA X.H. (huangxi6@mail. sensing triggered both IFN-dependent and -independent anti-herpesviral responses. Our findings sysu.edu.cn) demonstrate that cGAS-STING mediates innate immunity to gammaherpesvirus infection in MSCs, which may provide a clue to develop therapeutic strategy. ultipotent mesenchymal stem cells (MSCs) are a heterogeneous population of stromal cells that exist in almost all adult tissues . They can be readily isolated from several tissues, such as bone marrow, adipose M tissue and umbilical cord. Due to their tissue regenerative capacity and immunoregulatory property, MSCs recently have attracted considerable attention for potential clinical applications. They have been success- fully used to enhance the efficiency of hematopoietic stem cell engraftment , and to treat acute graft-versus-host 3 4 disease (GvHD) as well as autoimmune disorders . Although MSCs are widely used clinically, long-term observations reveal several complications after MSCs infusion, especially infectious complications . Herpesviral infection is a major cause of morbidity and mortality after stem cell transplantation . Recently, increasing experimental evidence shows that MSCs are highly suscept- ible to herpesviruses. Herpes simplex virus type 1 (HSV-1) and cytomegalovirus (CMV) can infect MSCs and induce obvious cytopathic effect (CPE) . A recent study shows that placenta-derived MSCs are fully permissive to infection with HSV-1, HSV-2, Varicella-zoster virus (VZV) and CMV . In addition, human fetal MSCs are susceptible to Kaposi sarcoma-associated herpesvirus (KSHV) in culture, and the infection persists within half of the cells for up to six weeks . Thus, it is possible that MSCs carrying herpesviruses lead to horizontal trans- mission of pathogens to recipients after cells infusion. Moreover, KSHV efficiently infects and transforms MSCs to induce tumors . These observations raise a safety concern with ex vitro expansion and subsequent clinical transplantation of MSCs. Besides, CMV-infected MSCs show impaired immunosuppressive and antimicrobial functions, which may undermine the clinical efficacy of MSC-based therapies . Therefore, it is important to investigate the mechanism by which MSCs recognize and defend against invading herpesviruses to develop a novel strategy to eliminate viruses in MSCs. As a large family of double-stranded DNA (dsDNA) viruses, herpesviruses can cause lytic infection in per- missive cells, and establish life-long latency in specific cell types. These viruses cause diseases during both primary infection (e.g. infectious mononucleosis, chickenpox) and reactivation from a latent infection (e.g. shingles). Moreover, gammaherpesviral latency proteins could drive virus-associated carcinogenesis in genetically predis- posed individuals, and result in several cancers, such as Kaposi’s sarcoma, primary effusion lymphoma , Burkitt’s lymphoma, Hodgkin’s lymphoma and nasopharyngeal carcinoma . The innate immune system is an important arm in control of herpesviruses infection. Distinct classes of pattern recognition receptors (PRRs) detect invading SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 1 www.nature.com/scientificreports pathogens on the cell surface or in cytosolic compartments . DNA was detected in primary isolated MSCs, as well as in lung and Genomic DNA is the most potent immune-stimulating component spleen, which are well-characterized sites of acute infection and of herpesviruses. Substantial evidence suggests that human herpes- latency of MHV-68 (Fig. 1d). viruses can be recognized by Toll-like receptor (TLR) 9 located in endosomes in plasmacytoid dendritic cells or primary mono- The cGAS-STING cytosolic DNA sensing pathway mediates 15–17 cytes , while other studies demonstrate the existence of TLR9- recognition of MHV-68 in MSCs. To investigate the innate independent recognition of herpesviruses . Most recently, several immune response to MHV-68 in MSCs, cells were infected with cytosolic receptors have been proposed for recognition of foreign MHV-68, and induction of the downstream gene IFN-b was 19,20 DNA in the cytosol , which may also contribute to innate immune examined. We found that IFN-b was not induced in MSCs after 21,22 response to herpesviruses . infection (Fig. 2a), suggesting that MHV-68 may inhibit the IFN To date, several cytosolic DNA sensors have been identified, response. To explore how MSCs detected foreign nucleic acid of including DNA-dependent activator of IFN-regulatory factors invading MHV-68, we stimulated cells with viral DNA by 23 24 (DAI) , absent in melanoma 2 (AIM2) , IFN-c-inducible protein transfection. Real-time PCR data showed that viral DNA induced 16 (IFI16, also called p204 in the mouse) and DEAD box polypep- the expression of IFN-b (Fig. 2b), indicating activation of the innate tide 41 (DDX41) . Recent studies report that cyclic GMP-AMP immune response. Next, we examined which receptors detected viral synthase (cGAS) also functions as a cytosolic DNA sensor to induce DNA in MSCs. Since MHV-68 is a dsDNA virus, we first tested 27,28 IFN by producing the second messenger cyclic GMP-AMP . whether TLR9 was involved in detection of MHV-68. The Although cytosolic DNA can be detected by distinct sensors, expression of TLR9 was examined by RT-PCR in MSCs. While STING is a central adaptor protein shared by these cytosolic DNA BMDM expressed TLR9, mRNA of TLR9 was not detectable in sensing pathways . In the presence of cytosolic dsDNA or cyclic MSCs (Fig. 2c). We further stimulated MSCs with TLR9 ligand dinucleotides, STING recruits and phosphorylates TANK-binding CpG DNA, and examined the expression of the downstream gene kinase 1 (TBK1). The activated TBK1 phosphorylates IFN-regula- IFN-b. While CpG DNA induced the expression of IFN-b in murine tory factor 3 (IRF3), which is a key transcription factor required for macrophage-like RAW264.7 cells, MSCs failed to respond to CpG the expression of type I IFNs . Subsequently, type I IFNs induce DNA (Fig. 2d). These results indicated that mouse MSCs did not various interferon-stimulated genes (ISGs) via the Janus kinase express functional TLR9, thus ruling out the possibility of TLR9- (JAK)-signal transducer and activator of transcription (STAT) path- mediated recognition of MHV-68 in MSCs. In addition to way to mount an efficient antiviral response . Therefore, the cyto- endosomal TLR9, foreign dsDNA can also be detected by cytosolic solic DNA sensing pathway is critical for host defense against DNA sensors. Therefore, we tested the hypothesis that cytosolic cytosolic bacteria and DNA viruses in innate immune cells . DNA sensors may recognize MHV-68 in MSCs. The expressions Several studies reveal that MSCs express some PRRs, including of well-characterized cytosolic DNA sensors including cGAS, TLRs (TLR3 and TLR4) , nucleotide binding and oligomerization DDX41, p204, AIM2, DAI and the adaptor STING were detected domain (NOD)-like receptors (NLRs) and retinoic acid inducible with RT-PCR. BMDM were used as positive control, which gene I (RIG-I)-like receptors (RLRs) , which regulate differenti- expressed the receptors above (Fig. 2e). Similarly, all of the ation, immunomodulation and survival of MSCs. Nonetheless, little receptors were expressed in MSCs, though at different levels is known regarding the expression and function of cytosolic DNA (Fig. 2e). Furthermore, we knocked down each DNA sensor with a sensors in MSCs. small interfering RNA (siRNA) to determine which sensor was The present study explores a novel mechanism by which murine responsible for detection of MHV-68 (Fig. 2f). Notably, MHV- MSCs recognize and defend against invading herpesviruses. Our 68 DNA-induced IFN-b expression in MSCs was impaired by results indicate that the cytosolic cGAS-STING pathway but not cGAS-specific siRNA, whereas siRNAs targeting other DNA endosomal TLR9 is responsible for sensing murine gammaherpes- sensors did not reduce IFN-b expression (Fig. 2g). During virus-68 (MHV-68). Activation of the cytosolic DNA sensing path- cytosolic DNA sensing, STING is a central adaptor protein. Thus, way triggers a robust antiviral response via STING-TBK1 signaling we knocked down STING to examine whether STING mediated axis, and restricts the replication of MHV-68 in both IFN-dependent recognition of MHV-68 in MSC. The knockdown efficacy was and -independent manners. Our findings provide insight into both confirmed by Western blot (Fig. 2h). Real-time data showed that the mechanism of innate immunity against herpesviruses in MSCs knockdown of STING attenuated the expression of IFN-b in MSCs and the antiviral function of the cytosolic DNA sensing pathway. stimulated with viral DNA (Fig. 2i). These results suggest that the cGAS-STING cytosolic DNA sensing pathway recognized MHV-68 Results in MSCs. MHV-68 infects MSCs both in vitro and in vivo. To explore the Activation of the cytosolic DNA sensing pathway restricts the mechanism of innate recognition and host defense against replication of MHV-68 in MSCs. To further explore whether the herpesviruses in MSCs, we established a cellular infection model of cytosolic DNA sensing pathway mediated anti-herpesviral response murine gammaherpesvirus MHV-68, which is genetically and in MSCs, we stimulated MSCs with synthetic dsDNA poly(dA:dT) or biologically similar to human gammaherpesviruses. We challenged interferon stimulatory DNA (ISD, a synthetic 45 bp dsDNA) to MSCs with MHV-68 at an MOI 0.1, and typical CPE was detected at activate the cytosolic DNA sensing pathway. Western blot data 24 hr post-infection (Fig. 1a). Most of MSCs lysed or detached from showed that both poly(dA:dT) (Fig. 3a) and ISD (Fig. 3b) induced the culture dish at 72 hr after exposure to MHV-68 (Fig. 1a). We phosphorylation of IRF3 in a time-dependent manner in MSCs, further detected viral DNA in MSCs by real-time PCR, and found suggesting activation of the cytosolic DNA sensing pathway. Next, that MHV-68 DNA copies increased in a time-dependent manner, we examined the replication of MHV-68 in MSCs after dsDNA peaking at 36 hr post-infection (Fig. 1b). Extracellular virion yield of stimulation. Pretreatment with poly(dA:dT) dramatically inhibited infected MSCs was examined by plaque assay. As shown in Fig. 1c, virus titers in the supernatant of MSCs increased markedly post- the replication of viral DNA (Fig. 3c). Plaque assay also showed a marked decrease in infectious viral particle yield of poly(dA:dT)- infection, indicating that cultured MSCs were permissive to MHV- 68 infection. To further investigate whether MHV-68 infects MSCs in pretreated MSCs (Fig. 3d). Similarly, ISD stimulation led to vivo, MSCs were isolated from mice intranasally infected with MHV- inhibition of MHV-68 DNA replication (Fig. 3e) and viral particle 68, and the existence of viral DNA was detected by using nested PCR. yield (Fig. 3f). These observations suggest an anti-herpesviral At all the indicated times (from 1 to 4 weeks) post-infection, viral response upon activation of cytosolic DNA sensing pathway. SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 2 www.nature.com/scientificreports Figure 1 | MHV-68 infects MSCs both in vitro and in vivo. MSCs were infected with MHV-68 (MOI 0.1) for the indicated time, and the cytopathic effect was examined microscopically (a). The replication of viral DNA was detected by real-time PCR (b). The virus titers in the supernatant were determined by plaque assay (c). Data are shown as mean 6 SEM of three independent experiments. (d) C57BL/6 mice were intranasally inoculated with MHV-68. Viral DNA in lung, spleen or bone-marrow-derived MSCs was detected with nested PCR of ORF50 gene at the indicated time post-infection. Data are representative of three experiments with similar results. STING-TBK1 signaling axis is required for the anti-herpesviral the adaptor STING mediated the antiviral response of cytosolic response of cytosolic DNA sensing. During cytosolic DNA sensing, DNA sensing pathway. the adaptor STING recruits and phosphorylates TBK1 kinase To further test the involvement of TBK1 in the cytosolic DNA to activate downstream signaling. To examine STING-TBK1 sensing-mediated antiviral response, small molecule kinase inhibitor signaling, MSCs were stimulated with poly(dA:dT), and the BX795 was used to inhibit TBK1 activity. When stimulated with subcellular distribution of STING and phosphorylated TBK1 was poly(dA:dT), TBK1-inhibited MSCs showed less phosphorylation visualized with immunofluorescence microscopy. In mock-treated of IRF3 (Fig. 4f). When TBK1 kinase was inhibited, poly(dA:dT)- MSCs, STING distributed diffusely in the cytosol, and treated MSCs showed increased viral DNA replication (Fig. 4g) and phosphorylation of TBK1 was not observed (Fig. 4a). However, in virion production (Fig. 4h). Thus, TBK1 kinase was required for the response to dsDNA transfection, STING aggregated perinuclearly, cytosolic DNA sensing-mediated antiviral effect. and phosphorylated TBK1 was found to co-localize with STING (Fig. 4a). Moreover, Western blot showed that phosphorylation of Cytosolic DNA sensing mediates both IFN-dependent and - TBK1 in MSCs after poly(dA:dT) transfection was time-dependent independent antiviral effects. Activation of STING-TBK1 (Fig. 4b). These observations indicated activation of the STING- signaling axis after cytosolic dsDNA stimulation leads to the TBK1 signaling in dsDNA-stimulated MSCs. To elucidate whether production of type I IFNs, which initiate an innate antiviral the adaptor STING mediated the cytosolic DNA sensing-induced response by inducing hundreds of ISGs through the JAK-STAT antiviral response, we silenced endogenous STING with siRNA in pathway. To determine whether cytosolic DNA sensing-mediated MSCs, and stimulated the cells with poly(dA:dT). Western blot antiviral effect depended on an autocrine effect of type I IFNs, JAK showed that phosphorylation of downstream transcription factor inhibitor Ruxolitinib was used to block IFN-JAK-STAT signaling in IRF3 was dramatically attenuated in poly(dA:dT)-stimulated MSCs dsDNA-stimulated MSCs. Western blot showed that at the in which STING was knocked down (Fig. 4c), suggesting a critical concentration of 1.0 mM, Ruxolitinib almost completely blocked role of STING in cytosolic DNA sensing. Furthermore, viral DNA dsDNA-induced phosphorylation of STAT1 downstream of IFN- replication and virion yield were examined in STING-silenced JAK-STAT pathway (Fig. 5a). Furthermore, we found that MSCs. Both real-time PCR (Fig. 4d) and plaque assay (Fig. 4e) blocking of the JAK-STAT pathway partially reduced the DNA data showed that dsDNA stimulation decreased viral replication in sensing-mediated antiviral activity, as indicated by both viral DNA siNC-treated MSCs, while the antiviral effect was abolished in (Fig. 5b) and plaque assay data (Fig. 5c). These results suggest that the STING-silenced MSCs (Fig. 4d, 4e). These results indicated that DNA-sensing pathway could mediate antiviral effects in the absence SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 3 www.nature.com/scientificreports Figure 2 | The cGAS-STING cytosolic DNA sensing pathway mediates recognition of MHV-68 in MSCs. MSCs were infected with MHV-68 (MOI 0.1) (a) or transfected with MHV-68 DNA (0.5 mg/ml) (b) for the indicated time, and then analyzed for IFN-b expression by real-time PCR. The expressions of TLR9 and MyD88 in MSCs or BMDM were detected with RT-PCR (c). MSCs and RAW264.7 cells were stimulated with CpG DNA (2 mM) for the indicated time, and then analyzed for IFN-b mRNA expression (d). The expressions of cytosolic DNA sensors and adaptor STING in MSCs or BMDM were detected with RT-PCR (e). MSCs were transfected with indicated siRNA for 48 hr, and then stimulated with MHV-68 DNA (0.5 mg/ml) for 6 hr (f)–(i). The knockdown efficacy was confirmed by real-time PCR (f) or Western blot (h), and the expressions of IFN-b were detected by real-time PCR (g), (i). RT-PCR and Western blot data are representative of three experiments with similar results. Real-time PCR data are shown as mean 6 SEM of three independent experiments. *, p , 0.05; ***, p , 0.001. of canonical IFN-JAK-STAT signaling. Moreover, we examined Discussion whether the DNA-sensing pathway can mediate antiviral ISGs Recently, MSCs infusion is a plausible strategy in clinical treatment 36,37 expression independently of IFN signaling. Real-time PCR data of tissue injury and immune-related disorders , due to the multi- showed that when IFN-JAK-STAT pathway was blocked by potentiality and immunomodulatory properties of MSCs. Never- Ruxolitinib, transfection with poly(dA:dT) still induced expres- theless, increasing clinical reports reveal that allogeneic stem cell 38–40 sions of ISGs, including IFIT1-3, ISG15 and Mx1, though the ex- transplantation is often complicated by herpesviral infection , pression levels were lower than that in MSCs without Ruxolitinib thus raising the safety concerns . However, the mechanism of host treatment (Fig. 5d). Together, these data imply that cytosolic DNA defense against herpesviruses in MSCs remains elusive. In this study, sensing mediated both IFN-dependent and -independent antiviral for the first time, we identify functional cytosolic DNA sensors in effects. MSCs, and demonstrate that the cGAS-STING cytosolic DNA sens- SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 4 www.nature.com/scientificreports Figure 3 | Activation of the cytosolic DNA sensing pathway restricts the replication of MHV-68 in MSCs. MSCs were transfected with poly (dA:dT) (a) or ISD (b) (0.5 mg/ml), and phosphorylation of IRF3 was detected by Western blot. Data are representative of three experiments with similar results. MSCs were transfected with poly (dA:dT) (c), (d) or ISD (e), (f) at the indicated concentration for 6 hr, then infected with MHV-68 (MOI 0.1). The replication of viral DNA was detected by real-time PCR at 6 hr post-infection (c and e). The virus titers in the supernatant were determined by plaque assay at 24 hr post-infection (d), (f). Data are shown as mean 6 SD. of three independent experiments. ing pathway is responsible for detecting murine gammaherpesvirus Upon detection of viral dsDNA, cytosolic DNA sensing pathway MHV-68, and mediates both IFN-dependent and independent anti- plays a critical role in host antiviral response. For example, AIM2- herpesviral responses in MSCs. knockout mice have a higher viral load in spleens after exposure to mouse cytomegalovirus than wild-type mice . A recent study reveals Previous studies suggest that human MSCs are highly susceptible 7 9 to several herpesviruses, including HSV, CMV and KSHV . In the that cGAS is essential for immune defense against HSV-1 infection in present study, we find that cultured MSCs are lytically infected by vivo . IFI16 acts as a restriction factor against HCMV replication in human embryonic lung fibroblasts . We find that activation of cyto- murine gammaherpesvirus MHV-68. Moreover, viral DNA is detected in MSCs from MHV-68-infected mice, suggesting that solic DNA sensing pathway restricts the replication of MHV-68. In MSCs may be latently infected with gammaherpesvirus in vivo and addition, previous studies show that the deficiency of adaptor STING renders mice more susceptible to lethal infection with HSV-1 , and serve as viral reservoirs. This observation supports a general belief that horizontal transmission of herpesviruses from grafts to recipi- that downstream TBK1 kinase is required for host defense against ents results in serious complication in patients receiving allogeneic DNA viruses infection, including MHV-68 . Consistently, we dem- onstrate that cytosolic DNA sensing mediates an anti-herpesviral stem cell transplantation. Herpesviruses can be sensed via both TLR-dependent and -inde- effect, and that this requires the STING-TBK1 signaling axis. 18,42 pendent pathways . In plasmacytoid dendritic cells (pDCs), endo- Previous studies demonstrate that MHV-68 develops several strat- 43–45 egies to evade host antiviral defense at multiple stages, such as somal TLR9 mediates recognition of HSV and KSHV . Here, we 49 39 50 find that murine MSCs do not express functional TLR9, which is TBK1 , IRF3 and IFNAR . Here, we find that MHV-68 infection consistent with a previous report . Other studies reveal that cytosolic does not induce an IFN response. It is possible that MHV-68 antag- onizes the cytosolic DNA sensing-mediated IFN response in MSCs DNA sensors are also responsible for recognition of herpesviruses, such as IFI16 detecting KSHV DNA in endothelial cells , DAI sens- after infection. It may explain why knockdown of STING or inhibi- ing human cytomegalovirus (HCMV) in fibroblasts, as well as DAI , tion of TBK1 in MSCs without exogenous dsDNA stimulation does 25 26 32 not affect MHV-68 replication. Therefore, activation of the cytosolic IFI16 , DDX41 and AIM2 all of which recognize HSV-1 in macrophages. These studies reveal redundant cytosolic DNA sen- DNA sensing pathway with synthetic dsDNA may provide a novel sors, and cell type-specific DNA sensing pathways. However, a recent strategy to elicit host antiviral response to inhibit MHV-68 replication. study demonstrates a non-redundant role of newly-discovered cyto- solic sensor cGAS for DNA sensing in macrophages, dendritic cells Cytosolic DNA sensing activates STING-TBK1-IRF3 signaling and fibroblasts . These cytosolic DNA sensors have not been axis that triggers the expression of type I IFNs . It is generally thought that PRRs induce the expression of type I IFNs that act in reported in MSCs before. We show here that all of the sensors above are expressed in MSCs, and cGAS is indispensible for recognition of an autocrine manner to amplify ISGs expression and direct a multi- MHV-68 in MSCs. Previous studies show that AIM2 recognizes faceted antiviral response. However, ISGs can also be induced cytosolic DNA and assembles the inflammasome to mediate an directly without need for canonical IFN signaling. For example, inflammatory response . Nevertheless, upon binding to dsDNA, RIG-I-like receptor (RLR) adaptor protein IPS-I located on the per- AIM2 does not induce an IFN response, and rather serves as a nega- oxisome induces rapid IFN-independent expression of ISGs upon 24,32 51 RNA virus infection, and provides short-term protection . tive regulator . Here, we also observe enhanced IFN-b expression in AIM2-knocked down MSCs after viral DNA stimulation. Whether Knockout of cytosolic exonuclease Trex1 induces high expression AIM2 triggers the inflammasome in MSCs after MHV-68 infection of antiviral ISGs genes in type I IFN receptor deficient cells . The 2/2 IFN-independent activation of antiviral genes in Trex1 cells may be possible, but needs further investigation. SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 5 www.nature.com/scientificreports Figure 4 | STING adaptor and TBK1 kinase are required for the antiviral response of cytosolic DNA sensing pathway. MSCs were transfected with poly(dA:dT) (0.5 mg/ml) for 1 hr, and the subcellular distribution of STING and phosphorylated TBK1 were analyzed by immunofluorescence microscopy (a). Phosphorylation of TBK1 kinase was detected by Western blot (b). MSCs were transfected with siSTING for 48 hr (c)-(e) or pretreated with BX795 for 1 hr (f)-(h), and then transfected with poly(dA:dT) (0.5 mg/ml), followed by MHV-68 infection (MOI 0.1). Protein levels of STING and phosphorylated IRF3 were analyzed by Western blot (c), (f). Data are representative of three experiments with similar results. The replication of viral DNA was detected by real-time PCR at 6 hr post-infection (d), (g). The virus titers in the supernatant were determined by plaque assay at 24 hr post-infection (e), (h). Real-time PCR data are shown as mean 6 SEM of three independent experiments. **, p , 0.01; ***, p , 0.001. requires the adaptor STING, the kinase TBK1 and the transcription findings give a better understanding of not only host defense against factors IRF3 . Most recently, Schoggins et al. report that ectopic gammaherpesvirus infection in MSCs but also the antiviral function 2/2 expression of cGAS in STAT1 fibroblasts which are deficient in of the cGAS-STING pathway. Therefore, our study may provide a IFN signaling, induces many ISGs via the STING-IRF3 pathway . novel strategy for clinical treatment of gammaherpesvirus infections. This study indicates that cytosolic DNA sensing can also mediate an antiviral program independent of canonical IFN signaling. In this Methods study, we find that cytosolic DNA sensing mediates an antiviral Ethics statement. The methods used were carried out in accordance with the response in MSCs via STING-TBK1 signaling axis, and blockade of approved guidelines. All experimental protocols were approved by Sun Yat-sen IFN signaling with JAK inhibitor can only partially reduce cytosolic University. All animal experiments were approved by the Animal Ethics Committee of Sun Yat-sen University and performed in accordance with the guidelines of Animal DNA sensing-mediated antiviral activity. The result implies an IFN/ Care and Use of Sun Yat-sen University. JAK/STAT-independent antiviral response. However, further invest- 2/2 igation using MSCs isolated from STAT1 mice is needed to pro- Reagents. Poly(dA:dT) was purchased from Sigma (St. Louis, MO). CpG vide convincing evidence to demonstrate the IFN-independent oligodeoxynucleotide (CpG DNA, TLR9 ligand) and BX795 (TBK1 inhibitor) were mechanism. from Invivogen (San Diego, CA). Ruxolitinib (JAK inhibitor) was obtained from In summary, we demonstrate that MSCs recognize gammaherpes- Selleck Chemicals (Houston, TX). Anti-STING (3337S), anti-phosphorylated IRF3 (4947S), anti-phosphorylated TBK1 (5483S), anti-phosphorylated STAT1 (Tyr701) virus MHV-68 via cytosolic DNA sensor cGAS. Activation of the (9171S) and (for Western blot) antibodies were obtained from Cell Signaling cytosolic DNA sensing pathway by dsDNA limits the replication of Technology (Beverly, MA). Anti-IRF3 (sc-9082), anti-STAT1 (sc-346) and anti- MHV-68 via STING-TBK1 signaling axis. Furthermore, our data STING antibody (sc-241049) (for immunofluorescence microscopy) were from Santa suggest that the cytosolic DNA sensing pathway mediates antiviral Cruz Biotechnology (Santa Cruz, CA). Anti-b-actin antibody (A1978) was from defense in both IFN-dependent and -independent manners. These Sigma (St. Louis, MO). SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 6 www.nature.com/scientificreports Figure 5 | Cytosolic DNA sensing pathway mediates both IFN-dependent and -independent antiviral responses. MSCs were pretreated with JAK inhibitor Ruxolitinib (Rux) for 1 hr, then transfected with poly(dA:dT) (0.5 mg/ml), followed by MHV-68 infection (MOI 0.1). The phosphorylation of STAT1 was examined by Western blot at 2 hr post-tranfection (a). The replication of viral DNA was detected by real-time PCR at 6 hr post-infection (b). The virus titers in supernatant were determined by plaque assay at 24 hr post-infection (c). The mRNA expressions of selected ISGs were analyzed by real- time PCR at 6 hr post-tranfection (d). Data are shown as mean 6 SEM of three independent experiments. **, p , 0.01; ***, p , 0.001. Cell culture. MSCs were obtained from bone marrow of tibia and femur of 6- to 8- cells were then overlaid with culture medium containing 0.5% agarose. After one 35,54 week-old female C57BL/6 mice as described previously . Cells were maintained in week incubation, plaques were visualized with 0.03% neutral red staining and counted DMEM low glucose medium supplemented with 10% FBS, 2 mM glutamine, 100 U/ at the optimum dilution to calculate virus titer. ml penicillin, and 100 mg/ml streptomycin (all from Invitrogen, Carlsbad, CA). The isolated MSCs were immunophenotyped by flow cytometry as reported previously . Mice infection and organ harvesting. C57BL/6 mice were anesthetized and MSCs from passage 5 to 20 were used in all experiments. Macrophage-like RAW264.7 intranasally inoculated with 5 000 PFU of MHV-68. The infected mice were sacrificed cells were maintained in DMEM supplemented with 10% FBS as reported at indicated time post-infection, and lung and spleen tissues were harvested and previously . Bone marrow-derived macrophages (BMDMs) were isolated and homogenized for DNA isolation. MSCs were isolated as described above. All mice cultured as described previously . All experiments involving animals were approved procedures here were performed according to the Animal Ethics Committee guides of by the Animal Ethics Committee of Sun Yat-sen University. Sun Yat-sen University. MHV68 DNA was determined by using nested PCR of viral ORF50 gene sequence as described previously . Nucleic acids transfection. To activate cytosolic DNA sensing pathway or stimulate MSCs with viral DNA, poly(dA:dT), interferon stimulatory DNA (ISD, a synthetic Western blot. Western blot was performed as described previously . Briefly, the 45 bp dsDNA) or MHV-68 DNA was transfected into the cytosol of MSCs by using whole-cell extract was resolved by SDS-polyacrylamide gel electrophoresis and Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. transferred to nitrocellulose membranes. The membranes were blocked in 5% bovine serum albumin and then incubated with diluted primary antibodies overnight at 4uC. Virus and plaque assay. MHV-68 was kindly provided by Prof. Yan Yuan (University Western blot detection was performed with IRDye 800 CW conjugated anti-rabbit of Pennsylvania School of Dental Medicine, Philadelphia), and propagated in Vero IgG or IRDye 680 CW conjugated anti-mouse IgG secondary antibodies according to cells. Viral titer was determined by plaque assay and viral stocks were stored at the manufacturer’s protocols (LI-COR Biosciences, Lincoln, NE). The blots were 280uC. For plaque assay, ten-fold serial dilutions of each cell-free supernatant were visualized using an Odyssey infrared imaging system (LI-COR Biosciences, Lincoln, incubated on a monolayer of Vero cells for 1 hr with occasional rocking. The infected NE). SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 7 www.nature.com/scientificreports 5. von Bahr, L. et al. Long-term complications, immunologic effects, and role of passage for outcome in mesenchymal stromal cell therapy. Biol. Blood Marrow Table 1 | Sequence of primers used in PCR amplification Transplant. 18, 557–564 (2012). Gene Primer Sequence (59 -39) 6. Forslow, U. et al. Treatment with mesenchymal stromal cells is a risk factor for pneumonia-related death after allogeneic hematopoietic stem cell cGAS Fwd:ACCGGACAAGCTAAAGAAGGTGCT transplantation. Eur. J. Haematol. 89, 220–227 (2012). Rev: GCAGCAGGCGTTCCACAACTTTAT 7. Sundin, M. et al. Mesenchymal stem cells are susceptible to human herpesviruses, DDX41 Fwd: TGAAGCTGACCGCATGATTGAC but viral DNA cannot be detected in the healthy seropositive individual. Bone Marrow Transplant. 37, 1051–1059 (2006). Rev: TCCAGCACGACCCACATTGA 8. Avanzi, S. et al. Susceptibility of human placenta derived mesenchymal stromal/ p204 Fwd: ACCAAGAGCAATACACCACG stem cells to human herpesviruses infection. PLoS One 8, e71412 (2013). Rev: TCTCGCCTCTTTCAGATGCT 9. Parsons, C. H., Szomju, B. & Kedes, D. H. Susceptibility of human fetal AIM2 Fwd: GTTATTAAGACTGCCCAACCTG mesenchymal stem cells to Kaposi sarcoma-associated herpesvirus. Blood 104, Rev: CATCCAATAGATGACTGTGAGC 2736–2738 (2004). DAI Fwd: AATCAAGTCCTTTACCGCCTG 10. Jones, T. et al. Direct and efficient cellular transformation of primary rat Rev: TTTCATCAAGGCTAGGCTGG mesenchymal precursor cells by KSHV. J. Clin. Invest. 122, 1076–1081 (2012). STING Fwd: ATTCCAACAGCGTCTACGAG 11. Meisel, R. et al. Cytomegalovirus infection impairs immunosuppressive and Rev: GCAGAAGAGTTTAGCCTGCT antimicrobial effector functions of human multipotent mesenchymal stromal Mx1 Fwd: ACAGGACACCAGTAAGTGCAGC cells. Mediators Inflamm. 2014, 898630 (2014). 12. Mesri, E. A., Cesarman, E. & Boshoff, C. Kaposi’s sarcoma and its associated Rev: AGCGACCAGGAAAGCCACATAG herpesvirus. Nat. Rev. Cancer 10, 707–719 (2010). ISG15 Fwd: ACTAACTCCATGACGGTGTCAG 13. Thompson, M. P. & Kurzrock, R. Epstein-Barr virus and cancer. Clin. Cancer Res. Rev: GTTCCTCACCAGGATGCTCAG 10, 803–821 (2004). IFIT1 Fwd: CGCGTAGACAAAGCTCTTCATC 14. Akira, S., Uematsu, S. & Takeuchi, O. Pathogen recognition and innate immunity. Rev: ATGGCCTGTTGTGCCAATTC Cell 124, 783–801 (2006). IFIT2 Fwd: ATGAGTTTCAGAACAGTGAGTTTAA 15. Lund, J., Sato, A., Akira, S., Medzhitov, R. & Iwasaki, A. Toll-like receptor 9- Rev: AACTGGCCCATGTGATAGTAGACCC mediated recognition of Herpes simplex virus-2 by plasmacytoid dendritic cells. IFIT3 Fwd: TGGCCTACATAAAGCACCTAGATGG J. Exp. Med. 198, 513–520 (2003). Rev: CGCAAACTTTTGGCAAACTTGTCT 16. Varani, S. et al. Human cytomegalovirus differentially controls B cell and T cell responses through effects on plasmacytoid dendritic cells. J. Immunol. 179, 7767–7776 (2007). siRNA knockdown. siRNAs were chemically synthesized by Invitrogen, and 17. Fiola, S., Gosselin, D., Takada, K. & Gosselin, J. TLR9 contributes to the scrambled siRNA (siNC) was used as negative control. The target sequences of recognition of EBV by primary monocytes and plasmacytoid dendritic cells. 27,28 siRNAs used were as following: STING, 59-GAGCTTGACTCCAGCGGAA-39 ; J. Immunol. 185, 3620–3631 (2010). cGAS, 59-GGATTGAGCTACAAGAATA-39 ; DDX41, 59- 18. Hochrein, H. et al. Herpes simplex virus type-1 induces IFN-alpha production via TGACATGCCTGAAGAGATA-39 ; p204, 59-AGAAAACAGTGAACCGAAA- Toll-like receptor 9-dependent and -independent pathways. Proc. Natl. Acad. Sci. 27 58 39 ; AIM2, 59-ACATAGACACTGAGGGTAT-39 ; DAI, 59- U. S. A. 101, 11416–11421 (2004). GGTCAAAGGGTGAAGTCAT-39 ; For knockdown experiments, cells were 19. Hornung, V. & Latz, E. Intracellular DNA recognition. Nat. Rev. Immunol. 10, transfected with siRNA using Lipofectamine 2000 (Invitrogen) following the 123–130 (2010). manufacturer’s protocol. 20. Paludan, S. R. & Bowie, A. G. Immune sensing of DNA. Immunity 38, 870–880 (2013). Quantitative nucleic acid analysis. Total RNA was extracted from cells with TRIzol 21. DeFilippis, V. R., Alvarado, D., Sali, T., Rothenburg, S. & Fruh, K. Human Reagent (Life Technologies, Carlsbad, CA) and reverse transcribed into cDNA by cytomegalovirus induces the interferon response via the DNA sensor ZBP1. TM RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, J. Virol. 84, 585–598 (2010). MA). For RT-PCR, the expression of various transcripts was assessed by PCR 22. Kerur, N. et al. IFI16 acts as a nuclear pathogen sensor to induce the amplification using a standard protocol. Amplified products were fractionated by inflammasome in response to Kaposi Sarcoma-associated herpesvirus infection. 1.0% agarose gel electrophoresis and visualized by ethidium bromide staining. Cell Host Microbe 9, 363–375 (2011). Quantitative real-time PCR analysis of transcripts was performed on Bio-Rad CFX96 23. Takaoka, A. et al. DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator real-time detection system using SYBR Green Master Mix (Applied Biosystems, of innate immune response. Nature 448, 501–505 (2007). Foster City, CA). Sequences of primer pairs used were listed in Table 1. Other primers 24. Hornung, V. et al. AIM2 recognizes cytosolic dsDNA and forms a caspase-1- used in the present study were described previously . For cytosolic MHV-68 DNA activating inflammasome with ASC. Nature 458, 514–518 (2009). quantification, DNA was isolated from MHV-68-infected MSCs using TRIzol 25. Unterholzner, L. et al. IFI16 is an innate immune sensor for intracellular DNA. Reagent (Life Technologies, Carlsbad, CA) per manufacturer’s protocol. Viral DNA Nat. Immunol. 11, 997–1004 (2010). (ORF56) and cellular b-actin were quantified by real-time PCR . Viral genomic DNA 26. Zhang, Z. et al. The helicase DDX41 senses intracellular DNA mediated by the in infected cells was calculated as compared to internal control b-actin. adaptor STING in dendritic cells. Nat. Immunol. 12, 959–965 (2011). 27. Sun, L., Wu, J., Du, F., Chen, X. & Chen, Z. J. Cyclic GMP-AMP synthase is a Immunofluorescence microscopy. Cells were grown on glass coverslips and treated cytosolic DNA sensor that activates the type I interferon pathway. Science 339, as indicated, and then fixed with 4% paraformaldehyde, permeabilized with 0.2% 786–791 (2013). Triton X-100 and blocked with 5% BSA. Samples were incubated with primary 28. Wu, J. et al. Cyclic GMP-AMP is an endogenous second messenger in innate antibody at 4uC overnight, and then with secondary antibody for 1 hr at room immune signaling by cytosolic DNA. Science 339, 826–830 (2013). temperature. Nuclei were labeled with 4, 6-diamidino-2-phenylindole (DAPI) 29. Ishikawa, H., Ma, Z. & Barber, G. N. STING regulates intracellular DNA- staining. Coverslips were mounted with ProLong Gold antifade reagent (Invitrogen) mediated, type I interferon-dependent innate immunity. Nature 461, 788–792 and visualized using Olympus BX53 fluorescence microscope (Olympus (2009). Corporation, Tokyo, Japan). 30. Tanaka, Y. & Chen, Z. J. STING specifies IRF3 phosphorylation by TBK1 in the cytosolic DNA signaling pathway. Sci. Signal. 5, ra20 (2012). 31. Schneider, W. M., Chevillotte, M. D. & Rice, C. M. Interferon-stimulated genes: a Statistical analysis. Experiments were performed for at least three times independently. GraphPad Prism 4.0 (GraphPad Software, San Diego, CA) was used complex web of host defenses. Annu. Rev. Immunol. 32, 513–545 (2014). 32. Rathinam, V. A. et al. The AIM2 inflammasome is essential for host defense for statistical analysis. Differences between two groups were compared by using an unpaired Student’s t-test. Differences between three groups or more were compared against cytosolic bacteria and DNA viruses. Nat. Immunol. 11, 395–402 (2010). by using a one-way analysis of variance with Bonferroni’s post-test. Differences were 33. Pevsner-Fischer, M. et al. Toll-like receptors and their ligands control considered statistically significant with a p value less than 0.05. mesenchymal stem cell functions. Blood 109, 1422–1432 (2007). 34. Kim, H. S. et al. Implication of NOD1 and NOD2 for the differentiation of multipotent mesenchymal stem cells derived from human umbilical cord blood. 1. Uccelli, A., Moretta, L. & Pistoia, V. Mesenchymal stem cells in health and disease. PLoS One 5, e15369 (2010). Nat. Rev. Immunol. 8, 726–736 (2008). 35. Yang, K. et al. Functional RIG-I-like receptors control the survival of 2. Chou, S. H. et al. Mesenchymal stem cell insights: prospects in hematological mesenchymal stem cells. Cell Death Dis. 4, e967 (2013). transplantation. Cell Transplant. 22, 711–721 (2013). 36. Marigo, I. & Dazzi, F. The immunomodulatory properties of mesenchymal stem 3. Le Blanc, K. et al. Treatment of severe acute graft-versus-host disease with third cells. Semin. Immunopathol. 33, 593–602 (2011). party haploidentical mesenchymal stem cells. Lancet 363, 1439–1441 (2004). 37. Bernardo, M. E., Pagliara, D. & Locatelli, F. Mesenchymal stromal cell therapy: a 4. Bernardo, M. E. & Fibbe, W. E. Safety and efficacy of mesenchymal stromal cell revolution in Regenerative Medicine? Bone Marrow Transplant. 47, 164–171 therapy in autoimmune disorders. Ann. N. Y. Acad. Sci. 1266, 107–117 (2012). (2012). SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 8 www.nature.com/scientificreports 38. Allain, J. P. Emerging viral infections relevant to transfusion medicine. Blood Rev. 57. Gargano, L. M., Forrest, J. C. & Speck, S. H. Signaling through Toll-like receptors 14, 173–181 (2000). induces murine gammaherpesvirus 68 reactivation in vivo. J. Virol. 83, 1474–1482 39. Luppi, M. et al. Bone marrow failure associated with human herpesvirus 8 (2009). infection after transplantation. N. Engl. J. Med. 343, 1378–1385 (2000). 58. Fernandes-Alnemri, T., Yu, J. W., Datta, P., Wu, J. & Alnemri, E. S. AIM2 activates 40. Dulery, R. et al. Early human herpesvirus type 6 reactivation after allogeneic stem the inflammasome and cell death in response to cytoplasmic DNA. Nature 458, cell transplantation: a large-scale clinical study. Biol. Blood Marrow Transplant. 509–513 (2009). 18, 1080–1089 (2012). 59. Hwang, S. et al. Conserved herpesviral kinase promotes viral persistence by 41. Behzad-Behbahani, A. et al. Risk of viral transmission via bone marrow progenitor inhibiting the IRF-3-mediated type I interferon response. Cell Host Microbe 5, cells versus umbilical cord blood hematopoietic stem cells in bone marrow 166–178 (2009). transplantation. Transplant. Proc. 37, 3211–3212 (2005). 42. Malmgaard, L., Melchjorsen, J., Bowie, A. G., Mogensen, S. C. & Paludan, S. R. Viral activation of macrophages through TLR-dependent and -independent pathways. J. Immunol. 173, 6890–6898 (2004). Acknowledgments 43. Krug, A. et al. Herpes simplex virus type 1 activates murine natural interferon- This work was supported by grants National Natural Science Foundation of China producing cells through toll-like receptor 9. Blood 103, 1433–1437 (2004). (31470877, 81261160323, 81172811, 30972763, U0832006, 31200662), Guangdong 44. West, J. A., Gregory, S. M., Sivaraman, V., Su, L. & Damania, B. Activation of Innovative Research Team Program (No. 2009010058), Guangdong Natural Science plasmacytoid dendritic cells by Kaposi’s sarcoma-associated herpesvirus. J. Virol. Foundation (10251008901000013, S2012040006680), Guangdong Province Universities 85, 895–904 (2011). and Colleges Pearl River Scholar Funded Scheme (No. 2009), National Science and 45. Guggemoos, S. et al. TLR9 contributes to antiviral immunity during Technology Key Projects for Major Infectious Diseases (2013ZX10003001), The 111 Project gammaherpesvirus infection. J. Immunol. 180, 438–443 (2008). (No. B13037). The authors wish to thank Dr. Linda D. Hazlett from Wayne State University 46. Li, X. D. et al. Pivotal roles of cGAS-cGAMP signaling in antiviral defense and School of Medicine for her useful comments and in-depth language editing. immune adjuvant effects. Science 341, 1390–1394 (2013). 47. Gariano, G. R. et al. The intracellular DNA sensor IFI16 gene acts as restriction factor for human cytomegalovirus replication. PLoS Pathog. 8, e1002498 (2012). Author contributions 48. Miyahira, A. K., Shahangian, A., Hwang, S., Sun, R. & Cheng, G. TANK-binding X.H. conceived and supervised the project; X.H., M.W. and K.Y. designed the experiments; kinase-1 plays an important role during in vitro and in vivo type I IFN responses K.Y. performed most of the experiments; J.W. performed Western blot analysis; Y.W. to DNA virus infections. J. Immunol. 182, 2248–2257 (2009). performed some plaque-forming assays; M.L. provided key reagents; X.H., K.Y. and M.W. 49. Kang, H. R. et al. Murine gammaherpesvirus 68 encoding open reading frame 11 analyzed the data and wrote the manuscript. targets TANK binding kinase 1 to negatively regulate the host type I interferon response. J. Virol. 88, 6832–6846 (2014). 50. Leang, R. S. et al. The anti-interferon activity of conserved viral dUTPase ORF54 is Additional information essential for an effective MHV-68 infection. PLoS Pathog. 7, e1002292 (2011). Competing financial interests: The authors declare no competing financial interests. 51. Dixit, E. et al. Peroxisomes are signaling platforms for antiviral innate immunity. How to cite this article: Yang, K. et al. Mesenchymal stem cells detect and defend against Cell 141, 668–681 (2010). gammaherpesvirus infection via the cGAS-STING pathway. Sci. Rep. 5, 7820; DOI:10.1038/ 52. Hasan, M. et al. Trex1 regulates lysosomal biogenesis and interferon-independent srep07820 (2015). activation of antiviral genes. Nat. Immunol. 14, 61–71 (2013). 53. Schoggins, J. W. et al. Pan-viral specificity of IFN-induced genes reveals new roles This work is licensed under a Creative Commons Attribution-NonCommercial- for cGAS in innate immunity. Nature 505, 691–695 (2014). 54. Lei, J. et al. Ligation of TLR2 and TLR4 on murine bone marrow-derived NoDerivs 4.0 International License. The images or other third party material in mesenchymal stem cells triggers differential effects on their immunosuppressive this article are included in the article’s Creative Commons license, unless indicated activity. Cell. Immunol. 271, 147–156 (2011). otherwise in the credit line; if the material is not included under the Creative 55. Wang, J. et al. MicroRNA-155 promotes autophagy to eliminate intracellular Commons license, users will need to obtain permission from the license holder mycobacteria by targeting Rheb. PLoS Pathog. 9, e1003697 (2013). in order to reproduce the material. To view a copy of this license, visit http:// 56. Yang, K. et al. miR-155 suppresses bacterial clearance in Pseudomonas creativecommons.org/licenses/by-nc-nd/4.0/ aeruginosa-induced keratitis by targeting Rheb. J. Infect. Dis. 210, 89–98 (2014). SCIENTIFIC REPORTS | 5 : 7820 | DOI: 10.1038/srep07820 9

Journal

Scientific Reports – Springer Journals

Published: Jan 16, 2015

There are no references for this article.