Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Formation of stacked ER cisternae by low affinity protein interactions

Formation of stacked ER cisternae by low affinity protein interactions JCB Article Formation of stacked ER cisternae by low affinity protein interactions 1 1 2 2 3 Erik L. Snapp, Ramanujan S. Hegde, Maura Francolini, Francesca Lombardo, Sara Colombo, 4 2,5 1 Emanuela Pedrazzini, Nica Borgese, and Jennifer Lippincott-Schwartz Cell Biology and Metabolism Branch, National Institutes of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892 2 3 Consiglio Nazionale delle Ricerche Institute of Neuroscience, Cellular and Molecular Pharmacology Section, and Department of Medical Pharmacology, University of Milan, 20129 Milano, Italy Consiglio Nazionale delle Ricerche Istituto Biologia e Biotecnologia Agraria, 20133 Milano, Italy Department of Pharmacobiology, University of Catanzaro, 88021 Roccelletta di Borgia, Catanzaro, Italy he endoplasmic reticulum (ER) can transform from a binding interactions between proteins on apposing stacked network of branching tubules into stacked membrane membranes of OSER structures were not of high affinity. arrays (termed organized smooth ER [OSER]) in re- Addition of GFP, which undergoes low affinity, antiparallel sponse to elevated levels of specific resident proteins, such dimerization, to the cytoplasmic domains of non–OSER- as cytochrome b(5). Here, we have tagged OSER-inducing inducing resident ER proteins was sufficient to induce proteins with green fluorescent protein (GFP) to study OSER OSER structures when overexpressed, but addition of a biogenesis and dynamics in living cells. Overexpression of nondimerizing GFP variant was not. These results point to a these proteins induced formation of karmellae, whorls, and molecular mechanism for OSER biogenesis that involves crystalloid OSER structures. Photobleaching experiments weak homotypic interactions between cytoplasmic domains revealed that OSER-inducing proteins were highly mobile of proteins. This mechanism may underlie the formation of within OSER structures and could exchange between OSER other stacked membrane structures within cells. structures and surrounding reticular ER. This indicated that Introduction such as plasma or exocrine pancreatic cells, are filled with Eukaryotic cells are capable of adjusting the size, molecular composition, and architecture of their membranous or- tightly packed, ribosome-covered ER cisternae (rough ER), whereas in cells specialized for lipid metabolism (e.g., ganelles to adapt to changes in the environment. A classic example of organelle plasticity is the highly dynamic adrenocortical cells), the ER is developed as an abundant smooth-surface tubular network (anastomosing smooth ER; and interconnected network that constitutes the ER (Lee and Chen, 1988; Baumann and Walz, 2001). The size and Fawcett, 1981; Baumann and Walz, 2001). Changes in the organization of the ER can occur quickly in response to structure of this compartment varies enormously in different cells. In cultured cells, the ER typically exists as a network of external cues. For example, the smooth ER domains can expand rapidly and dramatically in response to the expression branching trijunctional tubules organized as polygons in which rough (ribosome covered) and smooth (ribosome of xenobiotic metabolizing enzymes residing in the ER (Orrenius and Ericsson, 1966). free) domains are spatially interconnected. In certain tissues, the ER differentiates into smooth and rough domains that A striking example of ER differentiation is the conversion of reticular ER into sheets of smooth ER that become tightly display different architectures. Professional protein secretors, stacked into arrays. These can be arranged as stacked cisternae Address correspondence to Jennifer Lippincott-Schwartz, Cell Biology and Metabolism Branch, National Institutes of Child Health and Hu- Abbreviations used in this paper: b(5), cytochrome b(5); b(5) tail, truncated man Development, National Institutes of Health, 18 Library Dr., cytochrome b(5) containing amino acids 94–134; C1(1-29)P450, Bldg. 18T, Rm. 101, Bethesda, MD 20892. Tel.: (301) 402-1010. Fax: truncated cytochrome P450 containing amino acids 1–29; D , effective eff (301) 402-0078. email: [email protected] diffusion coefficient; IP R, inositol 1,4,5-trisphosphate receptor; mGFP, Key words: endoplasmic reticulum; photobleaching; cytochrome b5; monomeric GFP; NE, nuclear envelope; OSER, organized smooth ER; GFP; FRAP TMD, transmembrane domain. The Journal of Cell Biology, Volume 163, Number 2, October 27, 2003 257–269 http://www.jcb.org/cgi/doi/10.1083/jcb.200306020 257 The Journal of Cell Biology 258 The Journal of Cell Biology | Volume 163, Number 2, 2003 on the outer nuclear envelope (NE; called karmellae; Smith and Blobel, 1994; Parrish et al., 1995; Koning et al., 1996) or be distributed elsewhere in the cell (called lamellae; Porter and Yamada, 1960; Abran and Dickson, 1992; Koning et al., 1996). Alternatively, they can take the form of com- pressed bodies of packed sinusoidal ER (Anderson et al., 1983), concentric membrane whorls (also called z-mem- branes in plants; Gong et al., 1996; Koning et al., 1996) or ordered arrays of membrane tubules/sheets with hexagonal or cubic symmetry (called crystalloid ER; Chin et al., 1982; Yamamoto et al., 1996). In all cases, the tripartite junctions of branching ER are scanty or lacking, and the cytoplasmic faces of the proliferated membranes are tightly apposed. EM studies have established that these structures connect to the rest of the ER (Chin et al., 1982; Gong et al., 1996; Yama- moto et al., 1996). Because the structures often appear adja- cent to and segueing into each other in the same cell, the structures may represent different stages of smooth ER dif- ferentiation (Pathak et al., 1986; Takei et al., 1994). Given that all of these ER structures contain highly ordered Figure 1. Cells expressing b(5) or GFP-b(5) contain similar smooth ER membranes we refer to them as organized membrane structures. COS-7 cells transiently transfected with smooth ER (OSER). (a and b) b(5) or (c and d) GFP-b(5) overnight were imaged by (a–d) OSER structures have been reported in a variety of cells, confocal microscopy. Fixed cells were labeled with (a and c) anti-b(5) tissues, and organisms including plants, fungi, and animals and anti–rabbit Alexa 546 or observed (c and d) alive. At low levels under physiological conditions (Porter and Yamada, 1960; of expression, b(5) and GFP-b(5) localize to a branching network of tubules (a and c). In cells expressing higher levels of protein, a Tabor and Fisher, 1983; Yorke and Dickson, 1985; Bassot number of intensely fluorescent nonbranching structures including and Nicola, 1987; Abran and Dickson, 1992; Wolf and whorls, open loops, accumulations on the NE, and nonbranching Motzko, 1995; Gong et al., 1996), during drug treatments membrane accumulations are observed (b and d). Bars, 5 m. (Chin et al., 1982; Singer et al., 1988; Berciano et al., 2000), or by overexpression of resident ER transmembrane proteins (Wright et al., 1990; Vergeres et al., 1993; Smith and Blo- Figure 2. High resolution images of OSER. CV-1 cells transiently transfected with b(5) (a and d) or with GFP-b(5) (b, c, and e) were imaged by transmission EM. In panel a, a low power view of a transfected cells shows a whorl (W), and two areas of sinusoidal ER (S), of which one is in continuity with lamellar ER (L). Continuity between lamellar and sinusoidal ER is clearly visible in the inset, which shows an enlargement of the boxed area. Clusters of mito- chondria (M) surround the whorl, the sinusoidal and the lamellar ER. In panel b, stacks of packed cisternae surround part of the nucleus (karmellae). Whorls appear to be peeling away from the juxta- nuclear cisternae. N, nucleus. The arrow indicates an intranuclear whorl. Panel c shows a higher magnification of sinusoidal ER. An electron-dense cytoplasm of constant width (11 nm in the case of GFP-b(5)) separates pairs of apposed membranes. The arrows indicate points where the continuity between the electron-dense space and the cytoplasm (Cy) are apparent. The asterisks indicate the lumenal space. Ex, extracellular space; t, tangential view of membranes. In some areas of the cell, sinusoidal ER assumes a highly ordered arrangement with square symmetry (panel d). (e) A high magnification of lamellar ER, illustrating the regular succession of lumena (asterisk) and electron-dense cytoplasm of constant (11 nm) width (Cy). Bars: (a) 1 m; (b) 0.5 m; (c) 0.1 m; (d) 0.2 m; (e) 0.05 m. The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 259 Figure 3. OSER structures do not exclude other resident ER proteins. COS-7 cells were transfected with GFP-b(5), fixed, and labeled with anticalreticulin, antiprotein disulfide isomerase, anticalnexin antibodies, and anti–rabbit Alexa 546. Untransfected cells or cells lacking OSER structures contain branching reticular ER tubules, which were readily labeled with the antibodies (not depicted). The merged images show strong colocalization (yellow) of the resident ER proteins and GFP-b(5). In contrast, cells labeled with anti-COP, a Golgi marker protein, contain no colocalized structures. Bars, 5 m. bel, 1994; Takei et al., 1994; Ohkuma et al., 1995; Gong et that these structures formed relatively quickly once a thresh- al., 1996; Yamamoto et al., 1996; Sandig et al., 1999). The old level of OSER-inducing proteins was present within cells basis for OSER formation under these conditions is not and such formation involved gross remodeling of surround- clear. Protein mutagenesis studies of OSER-inducing pro- ing reticular ER. Finally, attachment of a protein capable of teins, such as HMG CoA reductase, have suggested that the low affinity, head to tail dimerization (i.e., GFP) to the cyto- cytoplasmic domain of the protein is important for OSER plasmic domain of different resident ER membrane proteins formation (Profant et al., 1999). Furthermore, the OSER- was sufficient to induce OSER formation upon overexpres- inducing protein must be anchored to the ER via a trans- sion of the modified proteins in living cells. This suggested membrane domain (TMD; Vergeres et al., 1993; Takei et that homotypic low affinity interactions between cytoplas- al., 1994; Gong et al., 1996; Yamamoto et al., 1996; Fukuda mic domains of proteins can differentiate reticular ER into et al., 2001). Therefore, one model for OSER biogenesis is stacked lamellae or crystalloid structures. Such a mechanism that the cytoplasmic domains of OSER-inducing proteins on may underlie the reorganization of other organelles into apposing membranes bind tightly to each other and “zipper” stacked structures. the apposing membranes together (Takei et al., 1994; Gong et al., 1996; Yamamoto et al., 1996; Fukuda et al., 2001). Results This model predicts that OSER-inducing proteins residing Overexpressed b(5) or GFP-b(5) induces within OSER structures are tightly bound to each other and OSER formation do not readily diffuse in and out of these structures. Here, we have used OSER-inducing proteins, including When the resident ER enzyme b(5) is overexpressed in yeast or mammalian cells, OSER structures comprised of whorls cytochrome b(5) [b(5)], tagged with GFP to investigate as- pects of OSER formation and dynamics in living cells. Our of membrane and NE associated “karmellae” are formed (Vergeres et al., 1993; Koning et al., 1996; Pedrazzini et al., results reveal, contrary to predictions of existing models, that OSER-inducing proteins are not tightly bound to each other 2000). To establish a system for studying OSER formation and dynamics in vivo we tested whether such structures within OSER structures and they can readily diffuse in and out of these structures into surrounding reticular ER. Fur- formed in COS-7 cells expressing either b(5) or GFP-b(5) (Fig. 1). At low expression levels of either protein, the ER thermore, time-lapse imaging of OSER biogenesis revealed The Journal of Cell Biology 260 The Journal of Cell Biology | Volume 163, Number 2, 2003 Figure 4. GFP-b(5) is mobile within and between OSER and branching reticular ER. Two different models are proposed to describe OSER formation. (a) OSER-inducing proteins zipper together apposing membranes by tight interactions between their cytoplasmic domains. In a related model, OSER- inducing proteins are restricted to and accumulate in discrete regions of the ER. In both cases, the OSER-inducing proteins would be predicted to be either immobile (as indicated by an absence of mobility arrows) or incapable of exchanging between OSER and branching reticular ER. (b) In an alternative model, OSER- inducing proteins partition dynamically. The OSER-inducing proteins would remain mobile (as indicated by mobility arrows in the branching ER and within OSER) and be capable of exchanging between OSER and branching reticular ER. To distinguish between the two models, cells expressing GFP-b(5) were photobleached in discrete regions of interest (yellow outline boxes), which were then monitored for fluorescence recovery. (c) GFP-b(5) is highly mobile within a whorl structure and recovers at a rate comparable to GFP-b(5) in branching ER. (d) GFP-b(5) is highly mobile within branching reticular ER and recovers rapidly. (e) When a whole whorl is photobleached, fluorescence recovery is observed, but much more slowly than within a whorl. (f and g) Fluorescence intensity recovery rates are plotted for (f) short and (g) longer times. Branching reticular ER (closed black circles), whole whorl (open blue squares), and strip within the whorl (red Xs). Bars: (c) 3 m; (d and e) 5 m. appeared as a network of branching tubules, typical of ER in lating sinusoidal membranes (Fig. 2, a–d). The stacked tissue culture cells, with b(5) and GFP-b(5) distributed uni- cisternae were in continuity with sinusoidal ER (Fig. 2 a) formly throughout this system (Fig. 1, a and c). This label- and in some regions the membranes were organized into a ing pattern changed dramatically for cells expressing at least lattice with square symmetry called crystalloid ER (Fig. 2 d; three times more protein (as judged by mean fluorescence Chin et al., 1982; Pathak et al., 1986; Yamamoto et al., intensity). Now, embedded within the reticular ER were 1996). Frequently, mitochondria clustered around these bright oval or elongated objects distributed adjacent to the OSER structures (Fig. 2 a). Adjacent cisternae were sepa- NE or out in the cell periphery (Fig. 1, b and d). Similar rated by a characteristic narrow cytoplasmic space (8 nm structures were observed in other cell types in which GFP- for b(5) and 11 nm for GFP-b(5)) that extended through- b(5) was overexpressed, including CV-1, MDCK, and 3T3 out the three-dimensional configuration of an OSER, simi- cells (unpublished data). lar to that reported in previous OSER studies (Vergeres et Transmission EM demonstrated that these bright struc- al., 1993; Takei et al., 1994). Based on these results, we con- tures corresponded to different forms of OSER (Fig. 2). cluded that overexpression of b(5) or GFP-b(5) was suffi- They included stacks of cisternae apposed to the NE (short cient to induce the formation of OSER structures. karmellae; Fig. 2 b), whorls, loops (partially open noncircu- Immunofluorescent staining of the cells overexpressing larized whorls), lamellar arrays of stacked cisternae in pe- GFP-b(5) revealed that the proteins residing within OSER ripheral locations (Fig. 2 a), and accumulations of undu- structures were not restricted to GFP-b(5) but included typi- The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 261 Figure 5. The b(5) catalytic domain of GFP-b(5) is not required to induce OSER formation. (a) The different domains of each b(5) derived construct are illustrated. The rectangle represents the tail domain of the rat ER isoform of b(5) (residues Pro94–Asp134), which includes the TMD. The oval represents the catalytic domain of b(5) (residues 1–93). In the GFP-b(5) construct, GFP is linked to the catalytic domain of b(5) via a synthetic linker comprising the myc epitope followed by a repeated Gly-Ser sequence. In the GFP-b(5) tail construct, GFP is connected via the same synthetic linker to the tail domain of b(5). The barrel structure represents GFP. Cells expressing high levels of GFP-b(5) tail contain OSER structures, which can be observed by confocal microscopy (b) and EM (c and d). (d) Several cells were observed to contain anastomosing smooth ER (shown at higher magnification in the inset) in continuity with stacked cisternae. Note, too, the tight apposition of the mitochondria with the stacked cisternae. Bars: (b) 5; (c) 0.5; (d) 0.2 m. cal resident ER proteins, including the lumenal chaperone dicated that GFP-b(5) molecules were not immobilized within proteins, calreticulin and protein disulfide isomerase, and the OSER structures by tight cross-linking between proteins on transmembrane chaperone protein, calnexin (Fig. 3). The rel- adjacent membranes. ative staining intensity patterns of these proteins in OSER Next, we examined whether OSER-inducing proteins like structures and in the surrounding reticular ER was similar to GFP-b(5) were capable of moving into and out of OSER that observed for GFP-b(5). This suggested that GFP-b(5) structures. First, we established that GFP-b(5) could diffuse was not significantly enriched in OSER structures compared freely in the ER adjacent to an OSER. A 4-m-wide box was with other resident ER proteins even though GFP-b(5) was photobleached in an area of ER outside of an OSER in GFP- responsible for inducing the formation of these structures. b(5) expressing cells. Analysis of the recovery kinetics revealed Consistent with their being of ER origin and function, OSER GFP-b(5) diffused with an effective diffusion coefficient (D ) eff structures did not contain the Golgi marker COP (Fig. 3). of 0.47  0.09 m /s (n  8) and that 93.5  1.9% of the molecules were mobile, similar to that reported for other GFP-b(5) is highly mobile within OSER structures and highly mobile ER resident proteins (Lippincott-Schwartz et al., diffuses rapidly in and out of these structures 2001). Next, we tested if GFP-b(5) could freely diffuse into Previous models of OSER biogenesis have suggested that tight and out of OSER structures. Upon photobleaching an entire binding of the cytoplasmic domains of OSER-inducing pro- OSER, fluorescence recovered within 6 min (Fig. 4 e), indi- teins on apposing membranes leads to the zippering of these cating that GFP-b(5) readily diffuses into OSER structures membranes into stacked structures (Takei et al., 1994; Gong from surrounding ER membranes. When all cellular fluores- et al., 1996; Yamamoto et al., 1996; Fukuda et al., 2001; Fig. cence outside an OSER was photobleached, subsequent imag- 4 a). A prediction of this model is that bound OSER-inducing ing with nonbleaching irradiation revealed the fluorescence proteins should experience significantly restricted mobility. To within nonbleached OSER structures redistributed into sur- test this prediction in GFP-b(5) expressing cells, we pho- rounding branching ER over time (unpublished data), which is tobleached half of the area of a typical OSER structure (0.5– consistent with free diffusion of GFP-b(5) in and out of OSER 3-m diam) using intense laser light (Fig. 4 c). Fluorescence structures. Comparable results were observed upon photo- recovery by exchange of bleached for nonbleached protein was bleaching other types of OSER structures expressing GFP-b(5), monitored using an attenuated laser beam. Notably, fluores- including short karmellae, open loops, and intensely fluores- cence recovered extremely rapidly into the bleached area at the cent clustered nonpolygonal branching ER structures corre- expense of fluorescence in the nonbleached area of the OSER, sponding to sinusoidal or crystalloid ER (unpublished data). as shown in the fluorescent images (Fig. 4 c) or as quantified We found that the rate of fluorescence recovery into in a plot of fluorescence recovery (Fig. 4, f and g). Because the photobleached OSER structures was slower than for pho- prebleach ratio of fluorescence between bleached and non- tobleached reticular ER of similar size (Fig. 4, f and g, compare bleached OSER sectors was reestablished, all GFP-b(5) mole- curves d and e). This can be explained by the fact that there are cules were highly mobile in OSER structures. These results in- substantially fewer branching connections between OSER The Journal of Cell Biology 262 The Journal of Cell Biology | Volume 163, Number 2, 2003 Figure 6. Resident ER membrane proteins tagged with GFP on their cytoplasmic domains can induce OSER formation. (a) Illustration of constructs and their orientations. The differently shaded rectangles represent the distinct single TMD resident ER proteins and the barrel structure represents GFP. (b) Representative confocal micrographs of cells expressing the GFP chimeras. (c) To visualize the mobility of the GFP chimeras within whorls a small region of interest (yellow outlined square) was photobleached and monitored for recovery (c). To compare the mobility of GFP chimeras between branching reticular ER (d) and exchange into and out of whorls (e), regions of interest (yellow outlined squares) of identical size were photobleached and monitored for recovery in cells expressing GFP- Sec61. Bars, 5 m. (f and g) Fluorescence intensity recovery plots compare the rates of recovery of GFP-Sec61 within the whorl (black diamonds), branching reticular ER (open red circle), and into the whole whorl (open green squares) for the image series in c, d, and e, respectively. membranes compared with reticular ER membranes (Fig. 2). stituted the cytoplasmic domain. Overexpression of the con- Thus, once a protein enters an OSER, it dwells as a freely mo- struct in COS-7 cells resulted in the appearance of numerous bile protein within this structure for significantly longer peri- brightly labeled circular and elongated masses that by EM ap- ods than within other areas of surrounding reticular ER. peared as membrane whorls and short karmellae, consistent with their being OSER structures (Fig. 5, b–d). In addition, The role of protein interactions in OSER formation another form of smooth ER, anastomosing smooth ER, was sometimes observed in continuity with lamellar ER stacks These findings prompted us to explore models for OSER bio- (Fig. 5 d, inset). These results indicated that the GFP-b(5) tail genesis that did not involve tight cross-linking and zippering chimera could function as an OSER-inducing protein. of membrane proteins. The first clue favoring an alternative model (Fig. 4 b) was our finding that OSER structures could GFP fused to the cytoplasmic domain of resident be generated in cells expressing elevated levels of GFP fused to ER membrane proteins is sufficient to induce b(5)’s TMD via a short linker region (GFP-truncated cyto- OSER formation chrome b(5) containing amino acids 94–134 [b(5) tail]). In this chimera, b(5)’s cytoplasmic, enzymatic domain was re- Given that the complete replacement of the cytoplasmic do- moved (Fig. 5 a, GFP-b(5) tail) and GFP and the linker con- main of b(5) with GFP was sufficient to induce OSER struc- The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 263 Figure 7. Unmutated GFP and mGFP-fusion proteins induce the formation of distinct forms of smooth ER. Ultrastructure of ER in COS-7 cells expressing unmutated or mGFP-Sec61. (a–d) GFP- Sec61; (e and f) mGFP-Sec61. (a) An image of the lamellar organization. The uniform width (8 nm) of the cytoplasmic layer separating the lamellae is apparent. (b) An image of the organization of sinusoidal ER. The arrowhead indicates an area in which the square symmetry of sinusoidal ER is apparent. (c) An image showing that both lamellar and sinusoidal structures coexist in the same cells and are often contiguous. It also illustrates how the spacing between membranes is the same in the two types of organization. (d) The 8-nm, electron-dense space between membranes is continuous with the cytoplasm (arrows). (e) Transfection with mGFP- Sec61 results in the appearance of large areas of typical anastomosing tubules of smooth ER, segre- gated from rough cisternae (arrow). Stacked cisternal membranes were never observed. (f) A higher magnification of the tubular smooth ER is shown. M, mitochondrion; SER, anastomosing smooth ER. Asterisks ( in a and c) indicate the lumenal space. Bars: (a–f) 160 nm; (inset in a) 56 nm. tures upon overexpression of the modified protein within structures were stacked lamellar cisternae exhibiting a nar- cells, we asked whether overexpression of other ER resident row cytoplasmic space (8 nm; Fig. 7). They included sinuso- proteins with GFP attached to their cytoplasmic domains idal and crystalloid ER (with square symmetry) and short could do likewise. To test this, we fused GFP or YFP to the karmellae, loops, and whorls. The different types of OSER cytoplasmic domains of three resident ER membrane proteins structures were present regardless of the type of OSER- with minimal cytoplasmic domains: two rough ER com- inducing protein being expressed (Table I). Importantly, no ponents of the translocon, Sec61 and Sec61, and a trun- OSER-like structures were observed when cytoplasmic GFP cated cytochrome P450 containing amino acids 1–29 (C1(1- alone was overexpressed in cells or when GFP was attached 29)P450; Szczesna-Skorupa et al., 1998; Fig. 6 a). The two to Sec61 in the lumenal position (unpublished data). Sec61 components are, like b(5), “tail-anchored” proteins These findings indicated that fusion of GFP to the cytoplas- that are posttranslationally inserted into the ER membrane mic domain of different ER resident proteins could lead to with the COOH terminus in the ER lumen. Note that when OSER formation in cells overexpressing the chimera. overexpressed in cells, neither chimera was found to incorpo- To test if OSER-inducing, GFP-tagged ER proteins rate into translocons (unpublished data). The C1(1-29)P450 were highly mobile within OSER structures, as found for is co-translationally inserted with the NH terminus inserted GFP-b(5), we performed photobleaching experiments in into the ER lumen. Its signal sequence is not cleaved and cells overexpressing GFP-Sec61. GFP-Sec61 was found serves as a TMD (Szczesna-Skorupa et al., 1998). to be highly mobile within an OSER (Fig. 6 c), as well as Confocal microscopy of transiently transfected living cells within surrounding reticular ER (Fig. 6 d). Moreover, the expressing these fusion proteins revealed two distribution chimera could readily diffuse into and out of OSER struc- patterns. One pattern, observed at low expression levels, was tures (Fig. 6, e–g). Thus, after OSER induction, neither that characteristic of branching reticular ER (unpublished GFP-b(5) nor GFP-Sec61 exhibits restricted mobility data). The second pattern, observed at high expression lev- within membranes comprising OSER structures. Similar els, was that of reticular ER in combination with different results were observed for YFP-Sec61 and C1(1-29)P450- types of OSER structures (Fig. 6 b). EM revealed that these GFP (unpublished data). The Journal of Cell Biology 264 The Journal of Cell Biology | Volume 163, Number 2, 2003 Table I. Quantitative analysis of different ER structures in unmutated GFP-Sec61– and mGFP-Sec61–expressing cells Structure GFP-Sec61 mGFP-Sec61 %% Whorl or loop 7.8 0 Short karmellae 14.6 0 Whorl, loop, or short 17.5 0 karmellae b b Nonpolygonal branching 54.8 80.1 ER membrane cluster No clustered ER structures 27.7 19.9 Total 100 100 For each construct, 100 fields of live cells, 143.4 m  143.4 m were counted. A total of 206 cells transfected with unmutated GFP-Sec61 and 196 cells transfected with mGFP-Sec61 were counted. Cells were imaged at a standard gain setting and, when necessary, at one of two reduced gain settings to resolve structure identity. A total of 3.9% of unmutated GFP-Sec61–expressing cells contained at least one whorl or loop and at least one short karmellae. Figure 9. A point mutation that converts GFP to mGFP inhibits Nonpolygonal branching ER clusters were defined as structures ranging formation of OSER structures. (a) Immunoblot analysis of cells from puncta to 4 m in diameter of varying fluorescence intensities that expressing unmutated or mGFP-Sec61 lysates of equal amounts of were consistently more intense than surrounding ER. cells untransfected (no DNA) or expressing either construct were loaded on the same gel and probed with anti-GFP or an antibody against native Sec61 as a control for equal loading. (b–d) Repre- To address what levels of GFP-Sec61 overexpression sentative confocal micrographs of transiently transfected COS-7 cells were necessary for OSER structures to be generated, we expressing (b) mYFP-Sec61, (c) mGFP-Sec61, and (d) C1(1-29)P450- quantified the mean fluorescence intensities of expressing mGFP reveal the absence of whorls, short karmellae, and loop cells in which OSER structures were or were not present structures. Other amorphous, often perinuclear, structures that are (100 cells each; Fig. 8). OSER formation occurred in cells generally of much lower fluorescence intensity than cells expressing the unmutated GFP counterparts are visible. Bar, 5 m. with mean fluorescence intensities between three- and nine- fold higher than the dimmest visibly expressing cells. There- fore, OSER-inducing proteins must be present at relatively high levels within ER membranes before OSER structures GFP’s ability to form low affinity dimers. The crystallo- will form within a cell. graphic structure of GFP has revealed that GFP can dimerize into an antiparallel orientation (Yang et al., 1996). Further- Fusion proteins containing monomeric GFP (mGFP) more, GFP and its variants can undergo weak dimerization both in solution (K  0.11 mM) and within cells (Zachar- do not induce OSER formation d ias et al., 2002). Importantly, GFP dimerization can be dis- Next, we considered how GFP attached to the cytoplasmic rupted with any one of three point mutations of amino acids domain of an ER membrane protein could act to induce on the dimerizing face of GFP without significantly altering OSER structures. One possible mechanism was through the fluorescent properties of GFP (Zacharias et al., 2002). To investigate whether OSER induction by the GFP-tagged resident ER proteins resulted from low affinity dimerization of GFP, we mutated leucine 221 to a lysine to create GFP mutants (called mGFP) of Sec61 (mGFP-Sec61) Sec61 (mGFP-Sec61) and C1(1-29)P450 (C1(1-29)P450–mGFP) that could not dimerize. First, we checked whether expression levels of the unmu- tated, dimerizing GFP and mGFP constructs were compa- rable. Results from immuno-blotting with anti-GFP anti- bodies confirmed that the mGFP and GFP fusion proteins were indeed expressed at comparable levels in transiently transfected cells (Fig. 9 a). Similar results were obtained for Figure 8. OSER formation correlates with a threshold level of the C1(1-29)P450-GFP and YFP-Sec61 fusion proteins protein expression. A comparison of relative fluorescence intensities of cells lacking (blue squares) or containing (pink squares) OSER (unpublished data). structures is plotted. Over 200 COS-7 cells expressing dimerizing Next, we examined by confocal microscopy the distri- GFP-Sec61 were imaged using the same settings for all cells. The bution of mGFP-Sec61, mGFP-Sec61, and C1(1-29) mean fluorescence intensity of each cell was quantified and converted P450-mGFP upon expression of the proteins in cells (Fig. 9, from a 0–255% gray scale to 0–100%. The results are plotted and b-d, and Table I). At both high and low expression levels, no each square represents the mean fluorescence intensity of one cell. OSER-like structures were observed. Instead, these proteins Similar results were observed for other ER resident proteins with GFP attached to their cytoplasmic domains. were distributed primarily in a normal reticular ER pattern. The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 265 Figure 10. OSER formation in living cells. (a) A COS-7 cell transiently transfected with GFP-b(5) tail was imaged hourly by confocal microscopy, 12 h after transfection. Initially, the ER appears spread out as a branching reticulum. After 1 h, the area of ER distribution has decreased, whereas the overall fluorescence intensity has increased. Between 1 and 3 h, OSER structures begin to appear. Between 3 and 7 h, the structures became brighter and larger, whereas the distribution of branching ER decreased substantially. (b) A short karmellae structure in a living cell expressing GFP-Sec61 was imaged by confocal microscopy over time. From 110 to 300 s, the short karmellae becomes distorted by a combination of the left side either pushing or being pulled away from the nucleus, while the right half remains relatively stable. By 470 s, the ends of the short karmellae come together and the majority of the structure has pulled away from the nucleus. From 530 to 620 s, the structure dissociates from the nucleus entirely and circularizes into a whorl. Bars, 5 m. Often, clustered ER structures of variable fluorescence in- formation, only a fine reticular ER pattern containing GFP- tensity and size were observed in the highly overexpressing b(5) tail was observed. During the time course of the experi- cells (Fig. 9 b, and Table I), but these structures were never ment, the levels of GFP-b(5) tail fluorescence within cells organized into stacks or polygonal arrays of tubules. Rather, continually increased due to new protein synthesis. When as shown by EM, these structures consisted of disorganized the concentration of GFP-b(5) tail in the cell reached high ribosome-free membrane clusters (Fig. 7, e and f), similar to enough levels, distinct OSER structures emerged overtime the anastomosing smooth ER of hepatocytes and steroid- periods as short as 1 h (Fig. 10 a). Once their formation was secreting cells (Fawcett, 1981). In addition, the absence of initiated, OSER structures grew brighter and larger with OSER structures in cells expressing mGFP attached to ER time. This increase in OSER fluorescence intensity was not resident proteins was not due to a difference in the mobility solely due to new protein synthesis. Concomitant with of the unmutated GFP and mGFP chimeras because the D OSER proliferation, the surface area of branching ER de- eff (0.53  0.13 m /s, n  8) of mGFP-Sec61 was not sig- creased (Fig. 10 a). Similar results were observed for cells ex- nificantly different from that of GFP-Sec61 (D  0.6  pressing other OSER-inducing proteins (unpublished data). eff 0.08 m /s, n  8). These combined results suggested that These results suggested that the process of OSER formation dimerizing interactions between GFPs attached to the cyto- involves incorporation of preexisting branching ER into plasmic domains of ER resident proteins are responsible for stacked structures. OSER biogenesis in cells overexpressing these proteins. Next, we focused on whether OSER structures originated at specific sites within the cell and whether OSER structures OSER formation and dynamics in living cells were stable or dynamic structures. Our time-lapse observa- To clarify the morphological pathway by which OSER tions of OSER biogenesis in single cells suggested that most structures are formed, we studied individual COS-7 cells ex- OSER structures initially arose either as short karmellae next pressing GFP-b(5) tail by time-lapse confocal microscopy to the NE or within the dense ER membranes of the juxta- from the time the cells had no OSER structures to when nuclear area (Fig. 10, a and b). Once formed, OSER struc- they had produced these structures (Fig. 10 a). Before OSER tures were not static but were capable of distorting and mov- The Journal of Cell Biology 266 The Journal of Cell Biology | Volume 163, Number 2, 2003 ing away from their site of origin. As an example, Fig. 10 b sufficient for generating OSER structures. However, the shows a short karmellae detaching from the NE and closing OSER-inducing GFP-tagged proteins need to be abundant off into a whorl shape during a period of 5 min. In cells con- enough for their interactions to cause ER membranes to re- taining an extensive branching ER network, such whorls and arrange into OSER structures, consisting of stacks with nar- loops undulated, opened and closed, or moved through the row cytoplasmic spacing and few interconnections. Our cell on a time scale of seconds (unpublished data). There- measurements comparing the fluorescent intensities of cells fore, OSER structures that initially arose next to the NE expressing ER resident proteins with GFP attached to their could dissociate and move to more peripheral regions of the cytoplasmic domains revealed that cells containing OSER cell. By contrast, in cells containing less branching reticular structures typically had three to nine times higher levels of ER and a larger proportion of OSER, whorls and other the chimera relative to cells that had no OSER structures. structures were relatively immobile (unpublished data). This suggested that a critical level of OSER-inducing pro- teins in ER membranes must be reached before OSER struc- tures can form within a cell. Discussion The degree of affinity between cytoplasmic domains of There has been a long tradition of research into the molecu- OSER-inducing proteins could explain the diversity of lar mechanisms underlying the architecture and dynamics OSER structures, with higher affinities leading to the forma- of membrane-bound organelles. Roles of motor proteins, tion of different OSER structures, such as the hexagonal which extend membrane elements out along cytoskeletal ele- crystalloid ER observed in cells overexpressing HMG-CoA ments; coat proteins, which help segregate and bud off reductase (Chin et al., 1982). Modulation of the affinity be- membrane components; and matrix proteins, which stabilize tween OSER-inducing proteins may also affect the rate of membrane structures, have been described previously (See- OSER formation. For example, the inositol 1,4,5-trisphos- mann et al., 2000; Bonifacino and Lippincott-Schwartz, phate receptor (IP R; Takei et al., 1994) in Purkinje neu- 2003; Vale, 2003). Here, we provide evidence for an addi- rons mediates a strikingly rapid formation of lamellar stacks tional, unexpected mechanism for the regulation of or- of ER cisternae within minutes of induction of hypoxia. Be- ganelle architecture involving weak homotypic interactions cause IP R is normally present at high densities in these between cytoplasmic domains of membrane proteins on ap- cells, hypoxia-induced OSER biogenesis may result from an posing membranes. Such interactions were found to mediate increase in affinity between IP R molecules due to modifica- the formation of regular arrays of stacked ER membranes. tions of IP R or of other ER-associated proteins. Below, we discuss how such weak interactions lead to this Not all ER proteins with GFP on their cytoplasmic do- type of organelle remodeling, the effects they have on global main may induce OSER structures, because for a given pro- ER structure, their potential functions, and whether weak tein its adjacent protein domains or the rotational mobility protein–protein interactions underlie the formation of other of the fused GFP could interfere with dimerization. This stacked organelles within cells. would explain why in some studies examining overexpres- sion of ER membrane proteins with cytoplasmically at- tached GFP, OSER structures were not observed (Li et al., The role of transient weak protein interactions 2003). Furthermore, the added requirement of being at high OSER biogenesis has been viewed up until now as involving expression levels and in membranes capable of close apposi- tight binding interactions between cytoplasmic domains of ER tion could explain why other organelles (i.e., plasma mem- resident proteins (Takei et al., 1994; Yamamoto et al., 1996; brane and endosomes) have not been reported to change Fukuda et al., 2001). Through such interactions, membranes their morphology upon expression of resident proteins with are thought to zipper up into highly compacted, stacked struc- cytoplasmically attached GFP. tures with stable, immobilized components. Evidence against The fact that GFP’s dimerizing properties can result in this mechanism came from several findings in our paper. First, low affinity interactions between proteins that normally do photobleaching experiments revealed that OSER-inducing not interact, and such interactions (when frequent enough) proteins could readily diffuse in and out of OSER structures, can lead to stacking of ER membranes (shown here) or fluo- so they were not tightly cross-linked to each other or to some rescence energy transfer at the plasma membrane (Zacharias type of scaffold. Second, OSER-inducing proteins were not et al., 2002) should serve as a cautionary note for studies us- noticeably more enriched than other ER proteins in OSER ing GFP chimeras. To avoid these effects, the use of GFP structures, as would be expected if they formed an immobi- variants that do not dimerize (Zacharias et al., 2002) is rec- lized array and excluded other membrane proteins. Third, and ommended. If dimerizing forms of GFP attached to a pro- most significantly, OSER structures were induced in cells tein are used in an experiment, then the fusion protein overexpressing chimeras in which GFP, known to undergo should only be expressed at low levels. Under these condi- weak homodimerization (Zacharias et al., 2002), was attached tions, there is usually no significant difference in the distri- to the cytoplasmic domains of different ER-retained proteins, bution or dynamics of proteins with dimeric GFP versus including b(5)-tail, Sec61, Sec61, and C1(1-29)P450. mGFP attached to their cytoplasmic tail (unpublished data). And, no OSER structures formed in cells expressing chimeras with an attached GFP containing a mutation abolishing Effects of OSER on global ER structure GFP’s homodimerizing potential or when dimer-forming GFP was attached to the lumenal domain of a chimera. Within only a few hours after OSER structures began to These data suggest that weak homodimeric interactions form in cells overexpressing ER proteins with cytoplasmically between cytoplasmic domains of ER resident proteins are attached GFP, we observed that a significant proportion of The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 267 reticular ER membranes became incorporated into highly of the ER can convert into stacked ER cisternae through tran- compacted OSER membranes (Fig. 10 a). Initially, OSER sient low affinity interactions between the cytoplasmic structures formed at sites adjacent to the NE rather than in domains of proteins on apposing ER membranes raises the other areas of the reticular ER, as found when OSER struc- possibility that the stacking of Golgi membranes or other tures are induced by overexpression of HMG-CoA reductase organelles occurs by a similar mechanism. Consistent with (Pathak et al., 1986). This could result from the relative sta- this, several features of Golgi morphology resemble OSER bility of ER membranes adjacent to the NE compared with structures. First, certain Golgi proteins (i.e., GRASP65) form surrounding reticular ER membranes, which are continually transoligomers in the cytoplasm that appear to be sufficient remodeling through dynamic tubulation and fusion events. for mediating Golgi stacking (Wang et al., 2003). Second, The stability of ER membranes next to the NE would allow Golgi cisternae are separated by a uniformly narrow cytoplas- surrounding ER cisternae to arrange themselves over time mic space (Cluett and Brown, 1992) and are not connected next to this surface due to multiple, transient protein–pro- along their surface (Ladinsky et al., 1999). Finally, Golgi resi- tein interactions between these membranes. Once lamellar dent components undergo rapid lateral diffusion (Cole et al., ER arrays are initiated in this fashion, they could then move 1996). These similarities with OSER structures raise the pos- away from this surface and serve as their own stable template sibility that weak transient interactions between proteins on for further growth of OSER lamellar sheets. This scenario is apposing membranes provide a general mechanism for the supported by our live cell imaging of the formation and dy- formation of stacked organelle structures. namics of individual OSER structures (Fig. 10 b). The dynamic process of OSER biogenesis and differentia- Materials and methods tion, as described in the Results, would not necessarily require Plasmid constructions the induction of specialized ER stress or lipid biosynthetic GFP-Sec61 and YFP-Sec61 were derived from the ORF for human pathways, as suggested in previous studies (Block-Alper et Sec61 and Sec61 amplified from a human brain cDNA library (CLON- al., 2002). Rather, it would require only an abundance of TECH Laboratories, Inc.) and inserted into the pCR cloning vector (Invitro- proteins containing a cytoplasmic domain capable of low af- gen) and verified by automated sequencing. The Sec61 ORF was excised from the pCR cloning vector and inserted into pEGFP-C1 (CLONTECH finity, antiparallel binding. Consistent with this, we found Laboratories, Inc.). The excised Sec61 fragment was ligated to the vector that overexpressing mGFP attached to the cytoplasmic do- to produce the GFP-Sec61 fusion. Sec61 was excised from pCR and in- main of a nondimerizing ER protein did not induce OSER serted into pEYFP-C1 to produce the YFP-Sec61 fusion. The cDNA coding for rabbit b(5) in the mammalian expression vector production. Instead, it led to anastomosing smooth ER pro- pCB6 has been described previously (Pedrazzini et al., 1996). The GFP- liferation reminiscent of ER specialized for steroid synthesis b(5) tail construct is also described in previous publications (referred to as (i.e., adrenocortical and Leydig cells). GFP-ER [Borgese et al., 2001] and as GFP-17 [Bulbarelli et al., 2002]). C1(1-29)P450 GFP has been described previously (Szczesna-Skorupa et al., 1998) and was a gift from B. Kemper (College of Medicine at Urbana- Potential OSER functions Champaign, University of Illinois, Urbana, IL). The function of OSER within cells remains to be clarified. For GFP-b(5), EGFP was fused at its COOH terminus via the same linker Both OSER-forming proteins (Figs. 4 and 6) and non- as above to the sequence coding for the entire ER isoform (minus the first two residues) of rabbit b(5) (GFP-b(5)). The EGFP plus linker fragment was OSER-forming proteins (unpublished data) dwell for rela- derived from GFP-b(5) tail. The coding sequence of b(5) was obtained by tively long periods within OSER structures compared with digestion of pGb(5)AX (Pedrazzini et al., 2000). The GFP-linker fragment similar sized areas of branching ER due to the limited num- was ligated with the b(5) fragment into the modified pCB6 vector (De Sil- ber of connections between OSER and branching ER. vestris et al., 1995). mGFP forms of the fusion proteins were created by site-directed mu- Therefore, reorganization of branching ER into OSER re- tagenesis using reverse (GGTCACGAACTCCTTAAGGACCATGTGATC) sults in the effective compartmentalization of the ER. This and forward primers (GATCACATGGTCCTTAAGGAGTTCGTGACC). Mu- could play an important role in sequestering lipophilic drugs tagenesis was performed using the Quickchange kit from Stratagene as rec- ommended by the manufacturer. The primers convert leucine 221 to away from other organelles or regions of the cytoplasm dur- lysine and introduce a new restriction site, Afl2, with a silent mutation for ing detoxification. Furthermore, a potential role for OSER ease of screening mutants. in pathogenesis is raised by the observation that OSER We confirmed that the constructs in this work localized to the ER by structures can form when mutant membrane proteins accu- performing immunofluorescence with antibodies against several different ER marker proteins. mulate in the ER due to defects in their ability to be ex- ported out of the ER. Examples of this are the pathogenic Cell culture and transfection phenotype observed in a mouse model of Charcot-Marie- COS-7 and CV-1 cells were grown in DME (Biofluids, Inc.) supplemented with FBS, glutamate, penicillin, and streptomycin. Transient transfections Tooth syndrome (Dickson et al., 2002), as well as for early were performed using FuGENE 6 transfection reagent according to the onset torsion dystonia (Hewett et al., 2000). manufacturer’s instructions (Roche) or by the Ca PO method (Graham 2 4 and van der Eb, 1973). Cells were analyzed 16–48 h after transfection. Implications for biogenesis of other stacked organelles Antibodies Our results have implications for mechanisms underlying the The polyclonal rabbit antibody against Sec61 was prepared (Lampire Bio- stacked morphology of other organelles within cells, such as logical Laboratories) against the synthetic peptide PGPTPSGTNC (residues the Golgi apparatus, thylakoids in chloroplasts, or the myelin 2–10 plus a cysteine) of canine Sec61 conjugated to keyhole limpet sheath formed by Schwann cells around axons. Traditionally, hemocyanin using standard protocols. Other antibodies used include poly- clonal anti–rat b(5) (Borgese et al., 2001), monoclonal anti-GFP (JL-8) the stacked elements of such structures, in particular the Golgi (CLONTECH Laboratories, Inc.), polyclonal anticalreticulin and antipro- apparatus, has been viewed as requiring a specific matrix or tein disulfide isomerase (Affinity BioReagents, Inc.), polyclonal antibody glue for holding them together (Cluett and Brown, 1992; anticalnexin (StressGen Biotechnologies) and anti–rabbit IgG labeled with Barr et al., 1997). Our finding that dynamic tubular elements Alexa 546 (Molecular Probes). The Journal of Cell Biology 268 The Journal of Cell Biology | Volume 163, Number 2, 2003 Immunoblotting Rey, and M. Lafarga. 2000. Formation of intranuclear crystalloids and pro- Separation of proteins by SDS-PAGE was on 12% Tris-tricine gels. Immu- liferation of the smooth endoplasmic reticulum in Schwann cells induced by noblotting was performed after transfer to nitrocellulose. The blot was tellurium treatment: association with overexpression of HMG CoA reduc- developed with SuperSignal ECL reagents from Pierce Chemical Co. Au- tase and HMG CoA synthase mRNA. Glia. 29:246–259. toradiographs made on film (BioMax; Kodak) were digitized for display Block-Alper, L., P. Webster, X. Zhou, L. Supekova, W.H. Wong, P.G. Schultz, in the figures (prepared using Photoshop and Illustrator software from and D.I. Meyer. 2002. INO2, a positive regulator of lipid biosynthesis, is es- Adobe Systems Inc.). sential for the formation of inducible membranes in yeast. Mol. Biol. Cell. 13:40–51. EM Bonifacino, J., and J. Lippincott-Schwartz. 2003. Coat proteins: shaping mem- For EM, cells were fixed as a monolayer in 2% glutaraldehyde in 0.1 M ca- brane transport. Nat. Rev. Mol. Cell Biol. 4:409–414. codylate buffer, pH 7.4, for 30 min, scraped, and collected as a pellet, sup- Borgese, N., I. Gazzoni, M. Barberi, S. Colombo, and E. Pedrazzini. 2001. Target- plemented with fresh fixative and left overnight at 4C. The cells were fur- ing of a tail-anchored protein to endoplasmic reticulum and mitochondrial ther fixed with osmium tetroxide and embedded in epon by standard outer membrane by independent but competing pathways. Mol. Biol. Cell. procedures. Lead citrate stained thin sections were observed under a trans- 12:2482–2496. mission electron microscope (model CM10; Philips). Bulbarelli, A., T. Sprocati, M. Barberi, E. Pedrazzini, and N. Borgese. 2002. Traf- ficking of tail-anchored proteins: transport from the endoplasmic reticulum Immunofluorescence and photobleaching experiments to the plasma membrane and sorting between surface domains in polarised For immunofluorescence experiments, cells were fixed with formaldehyde, epithelial cells. J. Cell Sci. 115:1689–1702. permeabilized with 0.2% Triton X-100, and incubated with antibodies as Chin, D.J., K.L. Luskey, R.G. Anderson, J.R. Faust, J.L. Goldstein, and M.S. described in previous publications (Cole et al., 1998). Fixed and live cells Brown. 1982. Appearance of crystalloid endoplasmic reticulum in compac- were imaged on a temperature controlled stage of a confocal microscope tin-resistant Chinese hamster cells with a 500-fold increase in 3-hydroxy- system (model LSM 510; Carl Zeiss MicroImaging, Inc.) using the 488-nm 3-methylglutaryl-coenzyme A reductase. Proc. Natl. Acad. Sci. USA. 79: line of a 40-mW Ar/Kr laser for GFP or the 514-nm line of the same laser 1185–1189. for YFP with either a 63 1.2 NA water or a 63 1.4 NA oil objective. Cluett, E., and W. Brown. 1992. Adhesion of Golgi cisternae by proteinaceous in- Qualitative FRAP experiments were performed by photobleaching a re- teractions: intercisternal bridges as putative adhesive structures. J. Cell Sci. gion of interest at full laser power and monitoring fluorescence recovery 103:773–784. by scanning the whole cell at low laser power. No photobleaching of the cell or adjacent cells during fluorescence recovery was observed. Cole, N.B., C.L. Smith, N. Sciaky, M. Terasaki, M. Edidin, and J. Lippincott- ) measurements were ob- Fluorescence recovery plots and diffusion (D Schwartz. 1996. Diffusional mobility of Golgi proteins in membranes of liv- eff tained by photobleaching a 4-m-wide strip as described previously (Ellen- ing cells. Science. 273:797–801. was determined using an inhomo- berg et al., 1997; Siggia et al., 2000). D eff Cole, N.B., J. Ellenberg, J. Song, D. DiEuliis, and J. Lippincott-Schwartz. 1998. geneous diffusion simulation program written by Eric Siggia (Siggia et al., Retrograde transport of Golgi-localized proteins to the ER. J. Cell Biol. 140: 2000). To create the fluorescence recovery curves, the fluorescence intensi- 1–15. ties were transformed into a 0–100% scale in which the first postbleach De Silvestris, M., A. D’Arrigo, and N. Borgese. 1995. The targeting information of time point equals 0% recovery and the recovery plateau equals 100% re- the mitochondrial outer membrane isoform of cytochrome b5 is contained covery. The plots do not represent the mobile fraction of the GFP chimeras. within the carboxyl-terminal region. FEBS Lett. 370:69–74. The mobile fraction was calculated by comparing the photobleach cor- Dickson, K.M., J.J. Bergeron, I. Shames, J. Colby, D.T. Nguyen, E. Chevet, D.Y. rected prebleach and postbleach recovery fluorescence intensity values in Thomas, and G.J. Snipes. 2002. Association of calnexin with mutant pe- the photobleached region of interest as described previously (Ellenberg et ripheral myelin protein-22 ex vivo: a basis for “gain-of-function” ER dis- al., 1997). Image analysis was performed using NIH Image 1.62 and LSM eases. Proc. Natl. Acad. Sci. USA. 99:9852–9857. image examiner software. Composite figures were prepared using Photo- Ellenberg, J., E.D. Siggia, J.E. Moreira, C.L. Smith, J.F. Presley, H.J. Worman, shop 5.5 and Illustrator 9.0 software (both from Adobe). Fluorescence re- and J. Lippincott-Schwartz. 1997. Nuclear membrane dynamics and reas- covery curves were plotted using Kaleidagraph 3.5 (Synergy Software). sembly in living cells: targeting of an inner nuclear membrane protein in in- terphase and mitosis. J. Cell Biol. 138:1193–1206. We would like to thank Devarati Mitra and Kelly Shaffer for generating and Fawcett, D.W. 1981. The Cell. W.B. Saunders Co., Philadelphia. 827 pp. characterizing the Sec61 constructs containing a lumenal GFP. We are Fukuda, M., A. Yamamoto, and K. Mikoshiba. 2001. Formation of crystalloid en- grateful to Teresa Sprocati for technical assistance. doplasmic reticulum induced by expression of synaptotagmin lacking the Work in the laboratory of Nica Borgese was supported by grants from conserved WHXL motif in the C terminus. J. Biol. Chem. 276:41112–41119. the Associazione Italiana per la Ricerca sul Cancro, the Ministero per la Gong, F.C., T.H. Giddings, J.B. Meehl, and L.A. Staehelin. 1996. Z-membranes: Università e Ricerca (COFIN 2001), and the Ministero per la Sanità (Amyo- artificial organelles for overexpressing recombinant integral membrane pro- trophic Lateral Sclerosis grant 2002). Erik Snapp was a Pharmacology and teins. Proc. Natl. Acad. Sci. USA. 93:2219–2223. Research Training Fellow during the course of these studies. Graham, F.L., and A.J. van der Eb. 1973. A new technique for the assay of infectiv- Submitted: 4 June 2003 ity of human adenovirus 5 DNA. Virology. 52:456–467. Accepted: 27 August 2003 Hewett, J., C. Gonzalez-Agosti, D. Slater, P. Ziefer, S. Li, D. Bergeron, D.J. Ja- coby, L.J. Ozelius, V. Ramesh, and X.O. Breakefield. 2000. Mutant torsinA, responsible for early-onset torsion dystonia, forms membrane inclusions in cultured neural cells. Hum. Mol. Genet. 9:1403–1413. References Koning, A.J., C.J. Roberts, and R.L. Wright. 1996. Different subcellular localiza- Abran, D., and D.H. Dickson. 1992. Biogenesis of myeloid bodies in regenerating tion of Saccharomyces cerevisiae HMG-CoA reductase isozymes at elevated newt (Notophthalmus viridescens) retinal pigment epithelium. Cell Tissue Res. levels corresponds to distinct endoplasmic reticulum membrane prolifera- tions. Mol. Biol. Cell. 7:769–789. 268:531–538. Anderson, R.G., L. Orci, M.S. Brown, L.M. Garcia-Segura, and J.L. Goldstein. Ladinsky, M., D. Mastronarde, J. McIntosh, K. Howell, and L.A. Staehelin. 1999. Golgi structure in three dimensions: functional insights from the normal rat 1983. Ultrastructural analysis of crystalloid endoplasmic reticulum in UT-1 cells and its disappearance in response to cholesterol. J. Cell Sci. 63:1–20. kidney cell. J. Cell Biol. 144:1135–1149. Lee, C., and L.B. Chen. 1988. Dynamic behavior of endoplasmic reticulum in liv- Barr, F., M. Puype, J. Vandekerckhove, and G. Warren. 1997. GRASP65, a pro- tein involved in the stacking of Golgi cisternae. Cell. 91:253–262. ing cells. Cell. 54:37–46. Li, Y., D. Dinsdale, and P. Glynn. 2003. Protein domains, catalytic activity, and Bassot, J.M., and G. Nicola. 1987. An optional dyadic junctional complex revealed by fast-freeze fixation in the bioluminescent system of the scale worm. J. Cell subcellular distribution of neuropathy target esterase in mammalian cells. J. Biol. Chem. 278:8820–8825. Biol. 105:2245–2256. Baumann, O., and B. Walz. 2001. Endoplasmic reticulum of animal cells and its Lippincott-Schwartz, J., E.L. Snapp, and A. Kenworthy. 2001. Studying protein dynamics in living cells. Nat. Rev. Mol. Cell Biol. 2:444–456. organization into structural and functional domains. Int. Rev. Cytol. 205: 149–214. Ohkuma, M., S.M. Park, T. Zimmer, R. Menzel, F. Vogel, W.H. Schunck, A. Ohta, and M. Takagi. 1995. Proliferation of intranuclear membrane struc- Berciano, M.T., R. Fenandez, E. Pena, E. Calle, N.T. Villagra, J.C. Rodriguez- The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 269 tures upon homologous overproduction of cytochrome P-450 in Candida Smith, S., and G. Blobel. 1994. Colocalization of vertebrate lamin B and lamin maltosa. Biochim. Biophys. Acta. 1236:163–169. B receptor (LBR) in nuclear envelopes and in LBR-induced membrane Orrenius, S., and J.L. Ericsson. 1966. Enzyme-membrane relationship in phe- stacks of the yeast Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA. 91: nobarbital induction of synthesis of drug-metabolizing enzyme system and 10124–10128. proliferation of endoplasmic reticulum. J. Cell Biol. 28:181–198. Szczesna-Skorupa, E., C. Chen, S. Rogers, and B. Kemper. 1998. Mobility of cyto- Parrish, M.L., C. Sengstag, J.D. Rine, and R.L. Wright. 1995. Identification of the chrome P450 in the endoplasmic reticulum membrane. Proc. Natl. Acad. sequences in HMG-CoA reductase required for karmellae assembly. Mol. Sci. USA. 95:14793–14798. Biol. Cell. 6:1535–1547. Tabor, G.A., and S.K. Fisher. 1983. Myeloid bodies in the mammalian retinal pig- Pathak, R.K., K.L. Luskey, and R.G.W. Anderson. 1986. Biogenesis of the crystal- ment epithelium. Invest. Ophthalmol. Vis. Sci. 24:388–391. loid endoplasmic reticulum in UT-1 cells: evidence that newly formed endo- Takei, K., G.A. Mignery, E. Mugnaini, T.C. Sudhof, and P. De Camilli. 1994. Ino- plasmic reticulum emerges from the nuclear envelope. J. Cell Biol. 102: sitol 1,4,5-trisphosphate receptor causes formation of ER cisternal stacks in 2158–2168. transfected fibroblasts and in cerebellar Purkinje cells. Neuron. 12:327–342. Pedrazzini, E., A. Villa, and N. Borgese. 1996. A mutant cytochrome b5 with a Vale, R. 2003. The molecular motor toolbox for intracellular transport. Cell. 112: lengthened membrane anchor escapes from the endoplasmic reticulum and 467–480. reaches the plasma membrane. Proc. Natl. Acad. Sci. USA. 93:4207–4212. Vergeres, G., T.S. Benedict Yen, J. Aggeler, J. Lausier, and L. Waskell. 1993. A Pedrazzini, E., A. Villa, R. Longhi, A. Bulbarelli, and N. Borgese. 2000. Mecha- model system for studying membrane biogenesis: overexpression of cyto- in yeast results in marked proliferation of the intracellular mem- nism of residence of cytochrome b(5), a tail-anchored protein, in the endo- chrome b plasmic reticulum. J. Cell Biol. 148:899–913. brane. J. Cell Sci. 106:249–259. Porter, K.R., and E. Yamada. 1960. Studies on the endoplasmic reticulum: V. Its Wang, Y., J. Seemann, M. Pypaert, J. Shorter, and G. Warren. 2003. A direct role form and differentiation in pigment epithelial cells of the frog retina. J. Bio- for GRASP65 as a mitotically regulated Golgi stacking factor. EMBO J. 22: phys. Biochem. Cyt. 8:181–205. 3279–3290. Profant, D.A., C.J. Roberts, A.J. Koning, and R.L. Wright. 1999. The role of the Wolf, K.W., and D. Motzko. 1995. Paracrystalline endoplasmic reticulum is typi- 3-hydroxy 3-methylglutaryl coenzyme A reductase cytosolic domain in cal of gametogenesis in hemiptera species. J. Struct. Biol. 114:105–114. karmellae biogenesis. Mol. Biol. Cell. 10:3409–3423. Wright, R., G. Keller, S.J. Gould, S. Subramani, and J. Rine. 1990. Cell-type con- Sandig, G., E. Kargel, R. Menzel, F. Vogel, T. Zimmer, and W.H. Schunck. 1999. trol of membrane biogenesis induced by HMG-CoA reductase. New Biol. Regulation of endoplasmic reticulum biogenesis in response to cytochrome 2:915–921. P450 overproduction. Drug Metab. Rev. 31:393–410. Yamamoto, A., R. Masaki, and Y. Tashiro. 1996. Formation of crystalloid endo- Seemann, J., E. Jokitalo, M. Pypaert, and G. Warren. 2000. Matrix proteins can plasmic reticulum in COS cells upon overexpression of microsomal aldehyde generate the higher order architecture of the Golgi apparatus. Nature. 407: dehydrogenase by cDNA transfection. J. Cell Sci. 109:1727–1738. 1022–1026. Yang, F., L.G. Moss, and G.N.J. Phillips. 1996. The molecular structure of green Siggia, E.D., J. Lippincott-Schwartz, and S. Bekiranov. 2000. Diffusion in a inho- fluorescent protein. Nat. Biotechnol. 14:1246–1251. mogeneous media: theory and simulations applied to a whole cell pho- Yorke, M.A., and D.H. Dickson. 1985. Lamellar to tubular conformational tobleach recovery. Biophys. J. 79. changes in the endoplasmic reticulum of the retinal pigment epithelium of Singer, I.I., S. Scott, D.M. Kazazis, and J.W. Huff. 1988. Lovastatin, an inhibitor the newt, Notophthalmus viridescens. Cell Tissue Res. 241:629–637. of cholesterol synthesis, induces hydroxymethylglutaryl-coenzyme A reduc- Zacharias, D.A., J.D. Violin, A.C. Newton, and R.Y. Tsien. 2002. Partitioning of tase directly on membranes of expanded smooth endoplasmic reticulum in lipid-modified monomeric GFPs into membrane microdomains of live cells. rat hepatocytes. Proc. Natl. Acad. Sci. USA. 85:5264–5268. Science. 296:913–916. The Journal of Cell Biology http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The Journal of Cell Biology Pubmed Central

Formation of stacked ER cisternae by low affinity protein interactions

Download PDF
13 pages

Loading next page...
 
/lp/pubmed-central/formation-of-stacked-er-cisternae-by-low-affinity-protein-interactions-aQOzZOUoPE

References (55)

Publisher
Pubmed Central
Copyright
Copyright © 2003, The Rockefeller University Press
ISSN
0021-9525
eISSN
1540-8140
DOI
10.1083/jcb.200306020
Publisher site
See Article on Publisher Site

Abstract

JCB Article Formation of stacked ER cisternae by low affinity protein interactions 1 1 2 2 3 Erik L. Snapp, Ramanujan S. Hegde, Maura Francolini, Francesca Lombardo, Sara Colombo, 4 2,5 1 Emanuela Pedrazzini, Nica Borgese, and Jennifer Lippincott-Schwartz Cell Biology and Metabolism Branch, National Institutes of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892 2 3 Consiglio Nazionale delle Ricerche Institute of Neuroscience, Cellular and Molecular Pharmacology Section, and Department of Medical Pharmacology, University of Milan, 20129 Milano, Italy Consiglio Nazionale delle Ricerche Istituto Biologia e Biotecnologia Agraria, 20133 Milano, Italy Department of Pharmacobiology, University of Catanzaro, 88021 Roccelletta di Borgia, Catanzaro, Italy he endoplasmic reticulum (ER) can transform from a binding interactions between proteins on apposing stacked network of branching tubules into stacked membrane membranes of OSER structures were not of high affinity. arrays (termed organized smooth ER [OSER]) in re- Addition of GFP, which undergoes low affinity, antiparallel sponse to elevated levels of specific resident proteins, such dimerization, to the cytoplasmic domains of non–OSER- as cytochrome b(5). Here, we have tagged OSER-inducing inducing resident ER proteins was sufficient to induce proteins with green fluorescent protein (GFP) to study OSER OSER structures when overexpressed, but addition of a biogenesis and dynamics in living cells. Overexpression of nondimerizing GFP variant was not. These results point to a these proteins induced formation of karmellae, whorls, and molecular mechanism for OSER biogenesis that involves crystalloid OSER structures. Photobleaching experiments weak homotypic interactions between cytoplasmic domains revealed that OSER-inducing proteins were highly mobile of proteins. This mechanism may underlie the formation of within OSER structures and could exchange between OSER other stacked membrane structures within cells. structures and surrounding reticular ER. This indicated that Introduction such as plasma or exocrine pancreatic cells, are filled with Eukaryotic cells are capable of adjusting the size, molecular composition, and architecture of their membranous or- tightly packed, ribosome-covered ER cisternae (rough ER), whereas in cells specialized for lipid metabolism (e.g., ganelles to adapt to changes in the environment. A classic example of organelle plasticity is the highly dynamic adrenocortical cells), the ER is developed as an abundant smooth-surface tubular network (anastomosing smooth ER; and interconnected network that constitutes the ER (Lee and Chen, 1988; Baumann and Walz, 2001). The size and Fawcett, 1981; Baumann and Walz, 2001). Changes in the organization of the ER can occur quickly in response to structure of this compartment varies enormously in different cells. In cultured cells, the ER typically exists as a network of external cues. For example, the smooth ER domains can expand rapidly and dramatically in response to the expression branching trijunctional tubules organized as polygons in which rough (ribosome covered) and smooth (ribosome of xenobiotic metabolizing enzymes residing in the ER (Orrenius and Ericsson, 1966). free) domains are spatially interconnected. In certain tissues, the ER differentiates into smooth and rough domains that A striking example of ER differentiation is the conversion of reticular ER into sheets of smooth ER that become tightly display different architectures. Professional protein secretors, stacked into arrays. These can be arranged as stacked cisternae Address correspondence to Jennifer Lippincott-Schwartz, Cell Biology and Metabolism Branch, National Institutes of Child Health and Hu- Abbreviations used in this paper: b(5), cytochrome b(5); b(5) tail, truncated man Development, National Institutes of Health, 18 Library Dr., cytochrome b(5) containing amino acids 94–134; C1(1-29)P450, Bldg. 18T, Rm. 101, Bethesda, MD 20892. Tel.: (301) 402-1010. Fax: truncated cytochrome P450 containing amino acids 1–29; D , effective eff (301) 402-0078. email: [email protected] diffusion coefficient; IP R, inositol 1,4,5-trisphosphate receptor; mGFP, Key words: endoplasmic reticulum; photobleaching; cytochrome b5; monomeric GFP; NE, nuclear envelope; OSER, organized smooth ER; GFP; FRAP TMD, transmembrane domain. The Journal of Cell Biology, Volume 163, Number 2, October 27, 2003 257–269 http://www.jcb.org/cgi/doi/10.1083/jcb.200306020 257 The Journal of Cell Biology 258 The Journal of Cell Biology | Volume 163, Number 2, 2003 on the outer nuclear envelope (NE; called karmellae; Smith and Blobel, 1994; Parrish et al., 1995; Koning et al., 1996) or be distributed elsewhere in the cell (called lamellae; Porter and Yamada, 1960; Abran and Dickson, 1992; Koning et al., 1996). Alternatively, they can take the form of com- pressed bodies of packed sinusoidal ER (Anderson et al., 1983), concentric membrane whorls (also called z-mem- branes in plants; Gong et al., 1996; Koning et al., 1996) or ordered arrays of membrane tubules/sheets with hexagonal or cubic symmetry (called crystalloid ER; Chin et al., 1982; Yamamoto et al., 1996). In all cases, the tripartite junctions of branching ER are scanty or lacking, and the cytoplasmic faces of the proliferated membranes are tightly apposed. EM studies have established that these structures connect to the rest of the ER (Chin et al., 1982; Gong et al., 1996; Yama- moto et al., 1996). Because the structures often appear adja- cent to and segueing into each other in the same cell, the structures may represent different stages of smooth ER dif- ferentiation (Pathak et al., 1986; Takei et al., 1994). Given that all of these ER structures contain highly ordered Figure 1. Cells expressing b(5) or GFP-b(5) contain similar smooth ER membranes we refer to them as organized membrane structures. COS-7 cells transiently transfected with smooth ER (OSER). (a and b) b(5) or (c and d) GFP-b(5) overnight were imaged by (a–d) OSER structures have been reported in a variety of cells, confocal microscopy. Fixed cells were labeled with (a and c) anti-b(5) tissues, and organisms including plants, fungi, and animals and anti–rabbit Alexa 546 or observed (c and d) alive. At low levels under physiological conditions (Porter and Yamada, 1960; of expression, b(5) and GFP-b(5) localize to a branching network of tubules (a and c). In cells expressing higher levels of protein, a Tabor and Fisher, 1983; Yorke and Dickson, 1985; Bassot number of intensely fluorescent nonbranching structures including and Nicola, 1987; Abran and Dickson, 1992; Wolf and whorls, open loops, accumulations on the NE, and nonbranching Motzko, 1995; Gong et al., 1996), during drug treatments membrane accumulations are observed (b and d). Bars, 5 m. (Chin et al., 1982; Singer et al., 1988; Berciano et al., 2000), or by overexpression of resident ER transmembrane proteins (Wright et al., 1990; Vergeres et al., 1993; Smith and Blo- Figure 2. High resolution images of OSER. CV-1 cells transiently transfected with b(5) (a and d) or with GFP-b(5) (b, c, and e) were imaged by transmission EM. In panel a, a low power view of a transfected cells shows a whorl (W), and two areas of sinusoidal ER (S), of which one is in continuity with lamellar ER (L). Continuity between lamellar and sinusoidal ER is clearly visible in the inset, which shows an enlargement of the boxed area. Clusters of mito- chondria (M) surround the whorl, the sinusoidal and the lamellar ER. In panel b, stacks of packed cisternae surround part of the nucleus (karmellae). Whorls appear to be peeling away from the juxta- nuclear cisternae. N, nucleus. The arrow indicates an intranuclear whorl. Panel c shows a higher magnification of sinusoidal ER. An electron-dense cytoplasm of constant width (11 nm in the case of GFP-b(5)) separates pairs of apposed membranes. The arrows indicate points where the continuity between the electron-dense space and the cytoplasm (Cy) are apparent. The asterisks indicate the lumenal space. Ex, extracellular space; t, tangential view of membranes. In some areas of the cell, sinusoidal ER assumes a highly ordered arrangement with square symmetry (panel d). (e) A high magnification of lamellar ER, illustrating the regular succession of lumena (asterisk) and electron-dense cytoplasm of constant (11 nm) width (Cy). Bars: (a) 1 m; (b) 0.5 m; (c) 0.1 m; (d) 0.2 m; (e) 0.05 m. The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 259 Figure 3. OSER structures do not exclude other resident ER proteins. COS-7 cells were transfected with GFP-b(5), fixed, and labeled with anticalreticulin, antiprotein disulfide isomerase, anticalnexin antibodies, and anti–rabbit Alexa 546. Untransfected cells or cells lacking OSER structures contain branching reticular ER tubules, which were readily labeled with the antibodies (not depicted). The merged images show strong colocalization (yellow) of the resident ER proteins and GFP-b(5). In contrast, cells labeled with anti-COP, a Golgi marker protein, contain no colocalized structures. Bars, 5 m. bel, 1994; Takei et al., 1994; Ohkuma et al., 1995; Gong et that these structures formed relatively quickly once a thresh- al., 1996; Yamamoto et al., 1996; Sandig et al., 1999). The old level of OSER-inducing proteins was present within cells basis for OSER formation under these conditions is not and such formation involved gross remodeling of surround- clear. Protein mutagenesis studies of OSER-inducing pro- ing reticular ER. Finally, attachment of a protein capable of teins, such as HMG CoA reductase, have suggested that the low affinity, head to tail dimerization (i.e., GFP) to the cyto- cytoplasmic domain of the protein is important for OSER plasmic domain of different resident ER membrane proteins formation (Profant et al., 1999). Furthermore, the OSER- was sufficient to induce OSER formation upon overexpres- inducing protein must be anchored to the ER via a trans- sion of the modified proteins in living cells. This suggested membrane domain (TMD; Vergeres et al., 1993; Takei et that homotypic low affinity interactions between cytoplas- al., 1994; Gong et al., 1996; Yamamoto et al., 1996; Fukuda mic domains of proteins can differentiate reticular ER into et al., 2001). Therefore, one model for OSER biogenesis is stacked lamellae or crystalloid structures. Such a mechanism that the cytoplasmic domains of OSER-inducing proteins on may underlie the reorganization of other organelles into apposing membranes bind tightly to each other and “zipper” stacked structures. the apposing membranes together (Takei et al., 1994; Gong et al., 1996; Yamamoto et al., 1996; Fukuda et al., 2001). Results This model predicts that OSER-inducing proteins residing Overexpressed b(5) or GFP-b(5) induces within OSER structures are tightly bound to each other and OSER formation do not readily diffuse in and out of these structures. Here, we have used OSER-inducing proteins, including When the resident ER enzyme b(5) is overexpressed in yeast or mammalian cells, OSER structures comprised of whorls cytochrome b(5) [b(5)], tagged with GFP to investigate as- pects of OSER formation and dynamics in living cells. Our of membrane and NE associated “karmellae” are formed (Vergeres et al., 1993; Koning et al., 1996; Pedrazzini et al., results reveal, contrary to predictions of existing models, that OSER-inducing proteins are not tightly bound to each other 2000). To establish a system for studying OSER formation and dynamics in vivo we tested whether such structures within OSER structures and they can readily diffuse in and out of these structures into surrounding reticular ER. Fur- formed in COS-7 cells expressing either b(5) or GFP-b(5) (Fig. 1). At low expression levels of either protein, the ER thermore, time-lapse imaging of OSER biogenesis revealed The Journal of Cell Biology 260 The Journal of Cell Biology | Volume 163, Number 2, 2003 Figure 4. GFP-b(5) is mobile within and between OSER and branching reticular ER. Two different models are proposed to describe OSER formation. (a) OSER-inducing proteins zipper together apposing membranes by tight interactions between their cytoplasmic domains. In a related model, OSER- inducing proteins are restricted to and accumulate in discrete regions of the ER. In both cases, the OSER-inducing proteins would be predicted to be either immobile (as indicated by an absence of mobility arrows) or incapable of exchanging between OSER and branching reticular ER. (b) In an alternative model, OSER- inducing proteins partition dynamically. The OSER-inducing proteins would remain mobile (as indicated by mobility arrows in the branching ER and within OSER) and be capable of exchanging between OSER and branching reticular ER. To distinguish between the two models, cells expressing GFP-b(5) were photobleached in discrete regions of interest (yellow outline boxes), which were then monitored for fluorescence recovery. (c) GFP-b(5) is highly mobile within a whorl structure and recovers at a rate comparable to GFP-b(5) in branching ER. (d) GFP-b(5) is highly mobile within branching reticular ER and recovers rapidly. (e) When a whole whorl is photobleached, fluorescence recovery is observed, but much more slowly than within a whorl. (f and g) Fluorescence intensity recovery rates are plotted for (f) short and (g) longer times. Branching reticular ER (closed black circles), whole whorl (open blue squares), and strip within the whorl (red Xs). Bars: (c) 3 m; (d and e) 5 m. appeared as a network of branching tubules, typical of ER in lating sinusoidal membranes (Fig. 2, a–d). The stacked tissue culture cells, with b(5) and GFP-b(5) distributed uni- cisternae were in continuity with sinusoidal ER (Fig. 2 a) formly throughout this system (Fig. 1, a and c). This label- and in some regions the membranes were organized into a ing pattern changed dramatically for cells expressing at least lattice with square symmetry called crystalloid ER (Fig. 2 d; three times more protein (as judged by mean fluorescence Chin et al., 1982; Pathak et al., 1986; Yamamoto et al., intensity). Now, embedded within the reticular ER were 1996). Frequently, mitochondria clustered around these bright oval or elongated objects distributed adjacent to the OSER structures (Fig. 2 a). Adjacent cisternae were sepa- NE or out in the cell periphery (Fig. 1, b and d). Similar rated by a characteristic narrow cytoplasmic space (8 nm structures were observed in other cell types in which GFP- for b(5) and 11 nm for GFP-b(5)) that extended through- b(5) was overexpressed, including CV-1, MDCK, and 3T3 out the three-dimensional configuration of an OSER, simi- cells (unpublished data). lar to that reported in previous OSER studies (Vergeres et Transmission EM demonstrated that these bright struc- al., 1993; Takei et al., 1994). Based on these results, we con- tures corresponded to different forms of OSER (Fig. 2). cluded that overexpression of b(5) or GFP-b(5) was suffi- They included stacks of cisternae apposed to the NE (short cient to induce the formation of OSER structures. karmellae; Fig. 2 b), whorls, loops (partially open noncircu- Immunofluorescent staining of the cells overexpressing larized whorls), lamellar arrays of stacked cisternae in pe- GFP-b(5) revealed that the proteins residing within OSER ripheral locations (Fig. 2 a), and accumulations of undu- structures were not restricted to GFP-b(5) but included typi- The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 261 Figure 5. The b(5) catalytic domain of GFP-b(5) is not required to induce OSER formation. (a) The different domains of each b(5) derived construct are illustrated. The rectangle represents the tail domain of the rat ER isoform of b(5) (residues Pro94–Asp134), which includes the TMD. The oval represents the catalytic domain of b(5) (residues 1–93). In the GFP-b(5) construct, GFP is linked to the catalytic domain of b(5) via a synthetic linker comprising the myc epitope followed by a repeated Gly-Ser sequence. In the GFP-b(5) tail construct, GFP is connected via the same synthetic linker to the tail domain of b(5). The barrel structure represents GFP. Cells expressing high levels of GFP-b(5) tail contain OSER structures, which can be observed by confocal microscopy (b) and EM (c and d). (d) Several cells were observed to contain anastomosing smooth ER (shown at higher magnification in the inset) in continuity with stacked cisternae. Note, too, the tight apposition of the mitochondria with the stacked cisternae. Bars: (b) 5; (c) 0.5; (d) 0.2 m. cal resident ER proteins, including the lumenal chaperone dicated that GFP-b(5) molecules were not immobilized within proteins, calreticulin and protein disulfide isomerase, and the OSER structures by tight cross-linking between proteins on transmembrane chaperone protein, calnexin (Fig. 3). The rel- adjacent membranes. ative staining intensity patterns of these proteins in OSER Next, we examined whether OSER-inducing proteins like structures and in the surrounding reticular ER was similar to GFP-b(5) were capable of moving into and out of OSER that observed for GFP-b(5). This suggested that GFP-b(5) structures. First, we established that GFP-b(5) could diffuse was not significantly enriched in OSER structures compared freely in the ER adjacent to an OSER. A 4-m-wide box was with other resident ER proteins even though GFP-b(5) was photobleached in an area of ER outside of an OSER in GFP- responsible for inducing the formation of these structures. b(5) expressing cells. Analysis of the recovery kinetics revealed Consistent with their being of ER origin and function, OSER GFP-b(5) diffused with an effective diffusion coefficient (D ) eff structures did not contain the Golgi marker COP (Fig. 3). of 0.47  0.09 m /s (n  8) and that 93.5  1.9% of the molecules were mobile, similar to that reported for other GFP-b(5) is highly mobile within OSER structures and highly mobile ER resident proteins (Lippincott-Schwartz et al., diffuses rapidly in and out of these structures 2001). Next, we tested if GFP-b(5) could freely diffuse into Previous models of OSER biogenesis have suggested that tight and out of OSER structures. Upon photobleaching an entire binding of the cytoplasmic domains of OSER-inducing pro- OSER, fluorescence recovered within 6 min (Fig. 4 e), indi- teins on apposing membranes leads to the zippering of these cating that GFP-b(5) readily diffuses into OSER structures membranes into stacked structures (Takei et al., 1994; Gong from surrounding ER membranes. When all cellular fluores- et al., 1996; Yamamoto et al., 1996; Fukuda et al., 2001; Fig. cence outside an OSER was photobleached, subsequent imag- 4 a). A prediction of this model is that bound OSER-inducing ing with nonbleaching irradiation revealed the fluorescence proteins should experience significantly restricted mobility. To within nonbleached OSER structures redistributed into sur- test this prediction in GFP-b(5) expressing cells, we pho- rounding branching ER over time (unpublished data), which is tobleached half of the area of a typical OSER structure (0.5– consistent with free diffusion of GFP-b(5) in and out of OSER 3-m diam) using intense laser light (Fig. 4 c). Fluorescence structures. Comparable results were observed upon photo- recovery by exchange of bleached for nonbleached protein was bleaching other types of OSER structures expressing GFP-b(5), monitored using an attenuated laser beam. Notably, fluores- including short karmellae, open loops, and intensely fluores- cence recovered extremely rapidly into the bleached area at the cent clustered nonpolygonal branching ER structures corre- expense of fluorescence in the nonbleached area of the OSER, sponding to sinusoidal or crystalloid ER (unpublished data). as shown in the fluorescent images (Fig. 4 c) or as quantified We found that the rate of fluorescence recovery into in a plot of fluorescence recovery (Fig. 4, f and g). Because the photobleached OSER structures was slower than for pho- prebleach ratio of fluorescence between bleached and non- tobleached reticular ER of similar size (Fig. 4, f and g, compare bleached OSER sectors was reestablished, all GFP-b(5) mole- curves d and e). This can be explained by the fact that there are cules were highly mobile in OSER structures. These results in- substantially fewer branching connections between OSER The Journal of Cell Biology 262 The Journal of Cell Biology | Volume 163, Number 2, 2003 Figure 6. Resident ER membrane proteins tagged with GFP on their cytoplasmic domains can induce OSER formation. (a) Illustration of constructs and their orientations. The differently shaded rectangles represent the distinct single TMD resident ER proteins and the barrel structure represents GFP. (b) Representative confocal micrographs of cells expressing the GFP chimeras. (c) To visualize the mobility of the GFP chimeras within whorls a small region of interest (yellow outlined square) was photobleached and monitored for recovery (c). To compare the mobility of GFP chimeras between branching reticular ER (d) and exchange into and out of whorls (e), regions of interest (yellow outlined squares) of identical size were photobleached and monitored for recovery in cells expressing GFP- Sec61. Bars, 5 m. (f and g) Fluorescence intensity recovery plots compare the rates of recovery of GFP-Sec61 within the whorl (black diamonds), branching reticular ER (open red circle), and into the whole whorl (open green squares) for the image series in c, d, and e, respectively. membranes compared with reticular ER membranes (Fig. 2). stituted the cytoplasmic domain. Overexpression of the con- Thus, once a protein enters an OSER, it dwells as a freely mo- struct in COS-7 cells resulted in the appearance of numerous bile protein within this structure for significantly longer peri- brightly labeled circular and elongated masses that by EM ap- ods than within other areas of surrounding reticular ER. peared as membrane whorls and short karmellae, consistent with their being OSER structures (Fig. 5, b–d). In addition, The role of protein interactions in OSER formation another form of smooth ER, anastomosing smooth ER, was sometimes observed in continuity with lamellar ER stacks These findings prompted us to explore models for OSER bio- (Fig. 5 d, inset). These results indicated that the GFP-b(5) tail genesis that did not involve tight cross-linking and zippering chimera could function as an OSER-inducing protein. of membrane proteins. The first clue favoring an alternative model (Fig. 4 b) was our finding that OSER structures could GFP fused to the cytoplasmic domain of resident be generated in cells expressing elevated levels of GFP fused to ER membrane proteins is sufficient to induce b(5)’s TMD via a short linker region (GFP-truncated cyto- OSER formation chrome b(5) containing amino acids 94–134 [b(5) tail]). In this chimera, b(5)’s cytoplasmic, enzymatic domain was re- Given that the complete replacement of the cytoplasmic do- moved (Fig. 5 a, GFP-b(5) tail) and GFP and the linker con- main of b(5) with GFP was sufficient to induce OSER struc- The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 263 Figure 7. Unmutated GFP and mGFP-fusion proteins induce the formation of distinct forms of smooth ER. Ultrastructure of ER in COS-7 cells expressing unmutated or mGFP-Sec61. (a–d) GFP- Sec61; (e and f) mGFP-Sec61. (a) An image of the lamellar organization. The uniform width (8 nm) of the cytoplasmic layer separating the lamellae is apparent. (b) An image of the organization of sinusoidal ER. The arrowhead indicates an area in which the square symmetry of sinusoidal ER is apparent. (c) An image showing that both lamellar and sinusoidal structures coexist in the same cells and are often contiguous. It also illustrates how the spacing between membranes is the same in the two types of organization. (d) The 8-nm, electron-dense space between membranes is continuous with the cytoplasm (arrows). (e) Transfection with mGFP- Sec61 results in the appearance of large areas of typical anastomosing tubules of smooth ER, segre- gated from rough cisternae (arrow). Stacked cisternal membranes were never observed. (f) A higher magnification of the tubular smooth ER is shown. M, mitochondrion; SER, anastomosing smooth ER. Asterisks ( in a and c) indicate the lumenal space. Bars: (a–f) 160 nm; (inset in a) 56 nm. tures upon overexpression of the modified protein within structures were stacked lamellar cisternae exhibiting a nar- cells, we asked whether overexpression of other ER resident row cytoplasmic space (8 nm; Fig. 7). They included sinuso- proteins with GFP attached to their cytoplasmic domains idal and crystalloid ER (with square symmetry) and short could do likewise. To test this, we fused GFP or YFP to the karmellae, loops, and whorls. The different types of OSER cytoplasmic domains of three resident ER membrane proteins structures were present regardless of the type of OSER- with minimal cytoplasmic domains: two rough ER com- inducing protein being expressed (Table I). Importantly, no ponents of the translocon, Sec61 and Sec61, and a trun- OSER-like structures were observed when cytoplasmic GFP cated cytochrome P450 containing amino acids 1–29 (C1(1- alone was overexpressed in cells or when GFP was attached 29)P450; Szczesna-Skorupa et al., 1998; Fig. 6 a). The two to Sec61 in the lumenal position (unpublished data). Sec61 components are, like b(5), “tail-anchored” proteins These findings indicated that fusion of GFP to the cytoplas- that are posttranslationally inserted into the ER membrane mic domain of different ER resident proteins could lead to with the COOH terminus in the ER lumen. Note that when OSER formation in cells overexpressing the chimera. overexpressed in cells, neither chimera was found to incorpo- To test if OSER-inducing, GFP-tagged ER proteins rate into translocons (unpublished data). The C1(1-29)P450 were highly mobile within OSER structures, as found for is co-translationally inserted with the NH terminus inserted GFP-b(5), we performed photobleaching experiments in into the ER lumen. Its signal sequence is not cleaved and cells overexpressing GFP-Sec61. GFP-Sec61 was found serves as a TMD (Szczesna-Skorupa et al., 1998). to be highly mobile within an OSER (Fig. 6 c), as well as Confocal microscopy of transiently transfected living cells within surrounding reticular ER (Fig. 6 d). Moreover, the expressing these fusion proteins revealed two distribution chimera could readily diffuse into and out of OSER struc- patterns. One pattern, observed at low expression levels, was tures (Fig. 6, e–g). Thus, after OSER induction, neither that characteristic of branching reticular ER (unpublished GFP-b(5) nor GFP-Sec61 exhibits restricted mobility data). The second pattern, observed at high expression lev- within membranes comprising OSER structures. Similar els, was that of reticular ER in combination with different results were observed for YFP-Sec61 and C1(1-29)P450- types of OSER structures (Fig. 6 b). EM revealed that these GFP (unpublished data). The Journal of Cell Biology 264 The Journal of Cell Biology | Volume 163, Number 2, 2003 Table I. Quantitative analysis of different ER structures in unmutated GFP-Sec61– and mGFP-Sec61–expressing cells Structure GFP-Sec61 mGFP-Sec61 %% Whorl or loop 7.8 0 Short karmellae 14.6 0 Whorl, loop, or short 17.5 0 karmellae b b Nonpolygonal branching 54.8 80.1 ER membrane cluster No clustered ER structures 27.7 19.9 Total 100 100 For each construct, 100 fields of live cells, 143.4 m  143.4 m were counted. A total of 206 cells transfected with unmutated GFP-Sec61 and 196 cells transfected with mGFP-Sec61 were counted. Cells were imaged at a standard gain setting and, when necessary, at one of two reduced gain settings to resolve structure identity. A total of 3.9% of unmutated GFP-Sec61–expressing cells contained at least one whorl or loop and at least one short karmellae. Figure 9. A point mutation that converts GFP to mGFP inhibits Nonpolygonal branching ER clusters were defined as structures ranging formation of OSER structures. (a) Immunoblot analysis of cells from puncta to 4 m in diameter of varying fluorescence intensities that expressing unmutated or mGFP-Sec61 lysates of equal amounts of were consistently more intense than surrounding ER. cells untransfected (no DNA) or expressing either construct were loaded on the same gel and probed with anti-GFP or an antibody against native Sec61 as a control for equal loading. (b–d) Repre- To address what levels of GFP-Sec61 overexpression sentative confocal micrographs of transiently transfected COS-7 cells were necessary for OSER structures to be generated, we expressing (b) mYFP-Sec61, (c) mGFP-Sec61, and (d) C1(1-29)P450- quantified the mean fluorescence intensities of expressing mGFP reveal the absence of whorls, short karmellae, and loop cells in which OSER structures were or were not present structures. Other amorphous, often perinuclear, structures that are (100 cells each; Fig. 8). OSER formation occurred in cells generally of much lower fluorescence intensity than cells expressing the unmutated GFP counterparts are visible. Bar, 5 m. with mean fluorescence intensities between three- and nine- fold higher than the dimmest visibly expressing cells. There- fore, OSER-inducing proteins must be present at relatively high levels within ER membranes before OSER structures GFP’s ability to form low affinity dimers. The crystallo- will form within a cell. graphic structure of GFP has revealed that GFP can dimerize into an antiparallel orientation (Yang et al., 1996). Further- Fusion proteins containing monomeric GFP (mGFP) more, GFP and its variants can undergo weak dimerization both in solution (K  0.11 mM) and within cells (Zachar- do not induce OSER formation d ias et al., 2002). Importantly, GFP dimerization can be dis- Next, we considered how GFP attached to the cytoplasmic rupted with any one of three point mutations of amino acids domain of an ER membrane protein could act to induce on the dimerizing face of GFP without significantly altering OSER structures. One possible mechanism was through the fluorescent properties of GFP (Zacharias et al., 2002). To investigate whether OSER induction by the GFP-tagged resident ER proteins resulted from low affinity dimerization of GFP, we mutated leucine 221 to a lysine to create GFP mutants (called mGFP) of Sec61 (mGFP-Sec61) Sec61 (mGFP-Sec61) and C1(1-29)P450 (C1(1-29)P450–mGFP) that could not dimerize. First, we checked whether expression levels of the unmu- tated, dimerizing GFP and mGFP constructs were compa- rable. Results from immuno-blotting with anti-GFP anti- bodies confirmed that the mGFP and GFP fusion proteins were indeed expressed at comparable levels in transiently transfected cells (Fig. 9 a). Similar results were obtained for Figure 8. OSER formation correlates with a threshold level of the C1(1-29)P450-GFP and YFP-Sec61 fusion proteins protein expression. A comparison of relative fluorescence intensities of cells lacking (blue squares) or containing (pink squares) OSER (unpublished data). structures is plotted. Over 200 COS-7 cells expressing dimerizing Next, we examined by confocal microscopy the distri- GFP-Sec61 were imaged using the same settings for all cells. The bution of mGFP-Sec61, mGFP-Sec61, and C1(1-29) mean fluorescence intensity of each cell was quantified and converted P450-mGFP upon expression of the proteins in cells (Fig. 9, from a 0–255% gray scale to 0–100%. The results are plotted and b-d, and Table I). At both high and low expression levels, no each square represents the mean fluorescence intensity of one cell. OSER-like structures were observed. Instead, these proteins Similar results were observed for other ER resident proteins with GFP attached to their cytoplasmic domains. were distributed primarily in a normal reticular ER pattern. The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 265 Figure 10. OSER formation in living cells. (a) A COS-7 cell transiently transfected with GFP-b(5) tail was imaged hourly by confocal microscopy, 12 h after transfection. Initially, the ER appears spread out as a branching reticulum. After 1 h, the area of ER distribution has decreased, whereas the overall fluorescence intensity has increased. Between 1 and 3 h, OSER structures begin to appear. Between 3 and 7 h, the structures became brighter and larger, whereas the distribution of branching ER decreased substantially. (b) A short karmellae structure in a living cell expressing GFP-Sec61 was imaged by confocal microscopy over time. From 110 to 300 s, the short karmellae becomes distorted by a combination of the left side either pushing or being pulled away from the nucleus, while the right half remains relatively stable. By 470 s, the ends of the short karmellae come together and the majority of the structure has pulled away from the nucleus. From 530 to 620 s, the structure dissociates from the nucleus entirely and circularizes into a whorl. Bars, 5 m. Often, clustered ER structures of variable fluorescence in- formation, only a fine reticular ER pattern containing GFP- tensity and size were observed in the highly overexpressing b(5) tail was observed. During the time course of the experi- cells (Fig. 9 b, and Table I), but these structures were never ment, the levels of GFP-b(5) tail fluorescence within cells organized into stacks or polygonal arrays of tubules. Rather, continually increased due to new protein synthesis. When as shown by EM, these structures consisted of disorganized the concentration of GFP-b(5) tail in the cell reached high ribosome-free membrane clusters (Fig. 7, e and f), similar to enough levels, distinct OSER structures emerged overtime the anastomosing smooth ER of hepatocytes and steroid- periods as short as 1 h (Fig. 10 a). Once their formation was secreting cells (Fawcett, 1981). In addition, the absence of initiated, OSER structures grew brighter and larger with OSER structures in cells expressing mGFP attached to ER time. This increase in OSER fluorescence intensity was not resident proteins was not due to a difference in the mobility solely due to new protein synthesis. Concomitant with of the unmutated GFP and mGFP chimeras because the D OSER proliferation, the surface area of branching ER de- eff (0.53  0.13 m /s, n  8) of mGFP-Sec61 was not sig- creased (Fig. 10 a). Similar results were observed for cells ex- nificantly different from that of GFP-Sec61 (D  0.6  pressing other OSER-inducing proteins (unpublished data). eff 0.08 m /s, n  8). These combined results suggested that These results suggested that the process of OSER formation dimerizing interactions between GFPs attached to the cyto- involves incorporation of preexisting branching ER into plasmic domains of ER resident proteins are responsible for stacked structures. OSER biogenesis in cells overexpressing these proteins. Next, we focused on whether OSER structures originated at specific sites within the cell and whether OSER structures OSER formation and dynamics in living cells were stable or dynamic structures. Our time-lapse observa- To clarify the morphological pathway by which OSER tions of OSER biogenesis in single cells suggested that most structures are formed, we studied individual COS-7 cells ex- OSER structures initially arose either as short karmellae next pressing GFP-b(5) tail by time-lapse confocal microscopy to the NE or within the dense ER membranes of the juxta- from the time the cells had no OSER structures to when nuclear area (Fig. 10, a and b). Once formed, OSER struc- they had produced these structures (Fig. 10 a). Before OSER tures were not static but were capable of distorting and mov- The Journal of Cell Biology 266 The Journal of Cell Biology | Volume 163, Number 2, 2003 ing away from their site of origin. As an example, Fig. 10 b sufficient for generating OSER structures. However, the shows a short karmellae detaching from the NE and closing OSER-inducing GFP-tagged proteins need to be abundant off into a whorl shape during a period of 5 min. In cells con- enough for their interactions to cause ER membranes to re- taining an extensive branching ER network, such whorls and arrange into OSER structures, consisting of stacks with nar- loops undulated, opened and closed, or moved through the row cytoplasmic spacing and few interconnections. Our cell on a time scale of seconds (unpublished data). There- measurements comparing the fluorescent intensities of cells fore, OSER structures that initially arose next to the NE expressing ER resident proteins with GFP attached to their could dissociate and move to more peripheral regions of the cytoplasmic domains revealed that cells containing OSER cell. By contrast, in cells containing less branching reticular structures typically had three to nine times higher levels of ER and a larger proportion of OSER, whorls and other the chimera relative to cells that had no OSER structures. structures were relatively immobile (unpublished data). This suggested that a critical level of OSER-inducing pro- teins in ER membranes must be reached before OSER struc- tures can form within a cell. Discussion The degree of affinity between cytoplasmic domains of There has been a long tradition of research into the molecu- OSER-inducing proteins could explain the diversity of lar mechanisms underlying the architecture and dynamics OSER structures, with higher affinities leading to the forma- of membrane-bound organelles. Roles of motor proteins, tion of different OSER structures, such as the hexagonal which extend membrane elements out along cytoskeletal ele- crystalloid ER observed in cells overexpressing HMG-CoA ments; coat proteins, which help segregate and bud off reductase (Chin et al., 1982). Modulation of the affinity be- membrane components; and matrix proteins, which stabilize tween OSER-inducing proteins may also affect the rate of membrane structures, have been described previously (See- OSER formation. For example, the inositol 1,4,5-trisphos- mann et al., 2000; Bonifacino and Lippincott-Schwartz, phate receptor (IP R; Takei et al., 1994) in Purkinje neu- 2003; Vale, 2003). Here, we provide evidence for an addi- rons mediates a strikingly rapid formation of lamellar stacks tional, unexpected mechanism for the regulation of or- of ER cisternae within minutes of induction of hypoxia. Be- ganelle architecture involving weak homotypic interactions cause IP R is normally present at high densities in these between cytoplasmic domains of membrane proteins on ap- cells, hypoxia-induced OSER biogenesis may result from an posing membranes. Such interactions were found to mediate increase in affinity between IP R molecules due to modifica- the formation of regular arrays of stacked ER membranes. tions of IP R or of other ER-associated proteins. Below, we discuss how such weak interactions lead to this Not all ER proteins with GFP on their cytoplasmic do- type of organelle remodeling, the effects they have on global main may induce OSER structures, because for a given pro- ER structure, their potential functions, and whether weak tein its adjacent protein domains or the rotational mobility protein–protein interactions underlie the formation of other of the fused GFP could interfere with dimerization. This stacked organelles within cells. would explain why in some studies examining overexpres- sion of ER membrane proteins with cytoplasmically at- tached GFP, OSER structures were not observed (Li et al., The role of transient weak protein interactions 2003). Furthermore, the added requirement of being at high OSER biogenesis has been viewed up until now as involving expression levels and in membranes capable of close apposi- tight binding interactions between cytoplasmic domains of ER tion could explain why other organelles (i.e., plasma mem- resident proteins (Takei et al., 1994; Yamamoto et al., 1996; brane and endosomes) have not been reported to change Fukuda et al., 2001). Through such interactions, membranes their morphology upon expression of resident proteins with are thought to zipper up into highly compacted, stacked struc- cytoplasmically attached GFP. tures with stable, immobilized components. Evidence against The fact that GFP’s dimerizing properties can result in this mechanism came from several findings in our paper. First, low affinity interactions between proteins that normally do photobleaching experiments revealed that OSER-inducing not interact, and such interactions (when frequent enough) proteins could readily diffuse in and out of OSER structures, can lead to stacking of ER membranes (shown here) or fluo- so they were not tightly cross-linked to each other or to some rescence energy transfer at the plasma membrane (Zacharias type of scaffold. Second, OSER-inducing proteins were not et al., 2002) should serve as a cautionary note for studies us- noticeably more enriched than other ER proteins in OSER ing GFP chimeras. To avoid these effects, the use of GFP structures, as would be expected if they formed an immobi- variants that do not dimerize (Zacharias et al., 2002) is rec- lized array and excluded other membrane proteins. Third, and ommended. If dimerizing forms of GFP attached to a pro- most significantly, OSER structures were induced in cells tein are used in an experiment, then the fusion protein overexpressing chimeras in which GFP, known to undergo should only be expressed at low levels. Under these condi- weak homodimerization (Zacharias et al., 2002), was attached tions, there is usually no significant difference in the distri- to the cytoplasmic domains of different ER-retained proteins, bution or dynamics of proteins with dimeric GFP versus including b(5)-tail, Sec61, Sec61, and C1(1-29)P450. mGFP attached to their cytoplasmic tail (unpublished data). And, no OSER structures formed in cells expressing chimeras with an attached GFP containing a mutation abolishing Effects of OSER on global ER structure GFP’s homodimerizing potential or when dimer-forming GFP was attached to the lumenal domain of a chimera. Within only a few hours after OSER structures began to These data suggest that weak homodimeric interactions form in cells overexpressing ER proteins with cytoplasmically between cytoplasmic domains of ER resident proteins are attached GFP, we observed that a significant proportion of The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 267 reticular ER membranes became incorporated into highly of the ER can convert into stacked ER cisternae through tran- compacted OSER membranes (Fig. 10 a). Initially, OSER sient low affinity interactions between the cytoplasmic structures formed at sites adjacent to the NE rather than in domains of proteins on apposing ER membranes raises the other areas of the reticular ER, as found when OSER struc- possibility that the stacking of Golgi membranes or other tures are induced by overexpression of HMG-CoA reductase organelles occurs by a similar mechanism. Consistent with (Pathak et al., 1986). This could result from the relative sta- this, several features of Golgi morphology resemble OSER bility of ER membranes adjacent to the NE compared with structures. First, certain Golgi proteins (i.e., GRASP65) form surrounding reticular ER membranes, which are continually transoligomers in the cytoplasm that appear to be sufficient remodeling through dynamic tubulation and fusion events. for mediating Golgi stacking (Wang et al., 2003). Second, The stability of ER membranes next to the NE would allow Golgi cisternae are separated by a uniformly narrow cytoplas- surrounding ER cisternae to arrange themselves over time mic space (Cluett and Brown, 1992) and are not connected next to this surface due to multiple, transient protein–pro- along their surface (Ladinsky et al., 1999). Finally, Golgi resi- tein interactions between these membranes. Once lamellar dent components undergo rapid lateral diffusion (Cole et al., ER arrays are initiated in this fashion, they could then move 1996). These similarities with OSER structures raise the pos- away from this surface and serve as their own stable template sibility that weak transient interactions between proteins on for further growth of OSER lamellar sheets. This scenario is apposing membranes provide a general mechanism for the supported by our live cell imaging of the formation and dy- formation of stacked organelle structures. namics of individual OSER structures (Fig. 10 b). The dynamic process of OSER biogenesis and differentia- Materials and methods tion, as described in the Results, would not necessarily require Plasmid constructions the induction of specialized ER stress or lipid biosynthetic GFP-Sec61 and YFP-Sec61 were derived from the ORF for human pathways, as suggested in previous studies (Block-Alper et Sec61 and Sec61 amplified from a human brain cDNA library (CLON- al., 2002). Rather, it would require only an abundance of TECH Laboratories, Inc.) and inserted into the pCR cloning vector (Invitro- proteins containing a cytoplasmic domain capable of low af- gen) and verified by automated sequencing. The Sec61 ORF was excised from the pCR cloning vector and inserted into pEGFP-C1 (CLONTECH finity, antiparallel binding. Consistent with this, we found Laboratories, Inc.). The excised Sec61 fragment was ligated to the vector that overexpressing mGFP attached to the cytoplasmic do- to produce the GFP-Sec61 fusion. Sec61 was excised from pCR and in- main of a nondimerizing ER protein did not induce OSER serted into pEYFP-C1 to produce the YFP-Sec61 fusion. The cDNA coding for rabbit b(5) in the mammalian expression vector production. Instead, it led to anastomosing smooth ER pro- pCB6 has been described previously (Pedrazzini et al., 1996). The GFP- liferation reminiscent of ER specialized for steroid synthesis b(5) tail construct is also described in previous publications (referred to as (i.e., adrenocortical and Leydig cells). GFP-ER [Borgese et al., 2001] and as GFP-17 [Bulbarelli et al., 2002]). C1(1-29)P450 GFP has been described previously (Szczesna-Skorupa et al., 1998) and was a gift from B. Kemper (College of Medicine at Urbana- Potential OSER functions Champaign, University of Illinois, Urbana, IL). The function of OSER within cells remains to be clarified. For GFP-b(5), EGFP was fused at its COOH terminus via the same linker Both OSER-forming proteins (Figs. 4 and 6) and non- as above to the sequence coding for the entire ER isoform (minus the first two residues) of rabbit b(5) (GFP-b(5)). The EGFP plus linker fragment was OSER-forming proteins (unpublished data) dwell for rela- derived from GFP-b(5) tail. The coding sequence of b(5) was obtained by tively long periods within OSER structures compared with digestion of pGb(5)AX (Pedrazzini et al., 2000). The GFP-linker fragment similar sized areas of branching ER due to the limited num- was ligated with the b(5) fragment into the modified pCB6 vector (De Sil- ber of connections between OSER and branching ER. vestris et al., 1995). mGFP forms of the fusion proteins were created by site-directed mu- Therefore, reorganization of branching ER into OSER re- tagenesis using reverse (GGTCACGAACTCCTTAAGGACCATGTGATC) sults in the effective compartmentalization of the ER. This and forward primers (GATCACATGGTCCTTAAGGAGTTCGTGACC). Mu- could play an important role in sequestering lipophilic drugs tagenesis was performed using the Quickchange kit from Stratagene as rec- ommended by the manufacturer. The primers convert leucine 221 to away from other organelles or regions of the cytoplasm dur- lysine and introduce a new restriction site, Afl2, with a silent mutation for ing detoxification. Furthermore, a potential role for OSER ease of screening mutants. in pathogenesis is raised by the observation that OSER We confirmed that the constructs in this work localized to the ER by structures can form when mutant membrane proteins accu- performing immunofluorescence with antibodies against several different ER marker proteins. mulate in the ER due to defects in their ability to be ex- ported out of the ER. Examples of this are the pathogenic Cell culture and transfection phenotype observed in a mouse model of Charcot-Marie- COS-7 and CV-1 cells were grown in DME (Biofluids, Inc.) supplemented with FBS, glutamate, penicillin, and streptomycin. Transient transfections Tooth syndrome (Dickson et al., 2002), as well as for early were performed using FuGENE 6 transfection reagent according to the onset torsion dystonia (Hewett et al., 2000). manufacturer’s instructions (Roche) or by the Ca PO method (Graham 2 4 and van der Eb, 1973). Cells were analyzed 16–48 h after transfection. Implications for biogenesis of other stacked organelles Antibodies Our results have implications for mechanisms underlying the The polyclonal rabbit antibody against Sec61 was prepared (Lampire Bio- stacked morphology of other organelles within cells, such as logical Laboratories) against the synthetic peptide PGPTPSGTNC (residues the Golgi apparatus, thylakoids in chloroplasts, or the myelin 2–10 plus a cysteine) of canine Sec61 conjugated to keyhole limpet sheath formed by Schwann cells around axons. Traditionally, hemocyanin using standard protocols. Other antibodies used include poly- clonal anti–rat b(5) (Borgese et al., 2001), monoclonal anti-GFP (JL-8) the stacked elements of such structures, in particular the Golgi (CLONTECH Laboratories, Inc.), polyclonal anticalreticulin and antipro- apparatus, has been viewed as requiring a specific matrix or tein disulfide isomerase (Affinity BioReagents, Inc.), polyclonal antibody glue for holding them together (Cluett and Brown, 1992; anticalnexin (StressGen Biotechnologies) and anti–rabbit IgG labeled with Barr et al., 1997). Our finding that dynamic tubular elements Alexa 546 (Molecular Probes). The Journal of Cell Biology 268 The Journal of Cell Biology | Volume 163, Number 2, 2003 Immunoblotting Rey, and M. Lafarga. 2000. Formation of intranuclear crystalloids and pro- Separation of proteins by SDS-PAGE was on 12% Tris-tricine gels. Immu- liferation of the smooth endoplasmic reticulum in Schwann cells induced by noblotting was performed after transfer to nitrocellulose. The blot was tellurium treatment: association with overexpression of HMG CoA reduc- developed with SuperSignal ECL reagents from Pierce Chemical Co. Au- tase and HMG CoA synthase mRNA. Glia. 29:246–259. toradiographs made on film (BioMax; Kodak) were digitized for display Block-Alper, L., P. Webster, X. Zhou, L. Supekova, W.H. Wong, P.G. Schultz, in the figures (prepared using Photoshop and Illustrator software from and D.I. Meyer. 2002. INO2, a positive regulator of lipid biosynthesis, is es- Adobe Systems Inc.). sential for the formation of inducible membranes in yeast. Mol. Biol. Cell. 13:40–51. EM Bonifacino, J., and J. Lippincott-Schwartz. 2003. Coat proteins: shaping mem- For EM, cells were fixed as a monolayer in 2% glutaraldehyde in 0.1 M ca- brane transport. Nat. Rev. Mol. Cell Biol. 4:409–414. codylate buffer, pH 7.4, for 30 min, scraped, and collected as a pellet, sup- Borgese, N., I. Gazzoni, M. Barberi, S. Colombo, and E. Pedrazzini. 2001. Target- plemented with fresh fixative and left overnight at 4C. The cells were fur- ing of a tail-anchored protein to endoplasmic reticulum and mitochondrial ther fixed with osmium tetroxide and embedded in epon by standard outer membrane by independent but competing pathways. Mol. Biol. Cell. procedures. Lead citrate stained thin sections were observed under a trans- 12:2482–2496. mission electron microscope (model CM10; Philips). Bulbarelli, A., T. Sprocati, M. Barberi, E. Pedrazzini, and N. Borgese. 2002. Traf- ficking of tail-anchored proteins: transport from the endoplasmic reticulum Immunofluorescence and photobleaching experiments to the plasma membrane and sorting between surface domains in polarised For immunofluorescence experiments, cells were fixed with formaldehyde, epithelial cells. J. Cell Sci. 115:1689–1702. permeabilized with 0.2% Triton X-100, and incubated with antibodies as Chin, D.J., K.L. Luskey, R.G. Anderson, J.R. Faust, J.L. Goldstein, and M.S. described in previous publications (Cole et al., 1998). Fixed and live cells Brown. 1982. Appearance of crystalloid endoplasmic reticulum in compac- were imaged on a temperature controlled stage of a confocal microscope tin-resistant Chinese hamster cells with a 500-fold increase in 3-hydroxy- system (model LSM 510; Carl Zeiss MicroImaging, Inc.) using the 488-nm 3-methylglutaryl-coenzyme A reductase. Proc. Natl. Acad. Sci. USA. 79: line of a 40-mW Ar/Kr laser for GFP or the 514-nm line of the same laser 1185–1189. for YFP with either a 63 1.2 NA water or a 63 1.4 NA oil objective. Cluett, E., and W. Brown. 1992. Adhesion of Golgi cisternae by proteinaceous in- Qualitative FRAP experiments were performed by photobleaching a re- teractions: intercisternal bridges as putative adhesive structures. J. Cell Sci. gion of interest at full laser power and monitoring fluorescence recovery 103:773–784. by scanning the whole cell at low laser power. No photobleaching of the cell or adjacent cells during fluorescence recovery was observed. Cole, N.B., C.L. Smith, N. Sciaky, M. Terasaki, M. Edidin, and J. Lippincott- ) measurements were ob- Fluorescence recovery plots and diffusion (D Schwartz. 1996. Diffusional mobility of Golgi proteins in membranes of liv- eff tained by photobleaching a 4-m-wide strip as described previously (Ellen- ing cells. Science. 273:797–801. was determined using an inhomo- berg et al., 1997; Siggia et al., 2000). D eff Cole, N.B., J. Ellenberg, J. Song, D. DiEuliis, and J. Lippincott-Schwartz. 1998. geneous diffusion simulation program written by Eric Siggia (Siggia et al., Retrograde transport of Golgi-localized proteins to the ER. J. Cell Biol. 140: 2000). To create the fluorescence recovery curves, the fluorescence intensi- 1–15. ties were transformed into a 0–100% scale in which the first postbleach De Silvestris, M., A. D’Arrigo, and N. Borgese. 1995. The targeting information of time point equals 0% recovery and the recovery plateau equals 100% re- the mitochondrial outer membrane isoform of cytochrome b5 is contained covery. The plots do not represent the mobile fraction of the GFP chimeras. within the carboxyl-terminal region. FEBS Lett. 370:69–74. The mobile fraction was calculated by comparing the photobleach cor- Dickson, K.M., J.J. Bergeron, I. Shames, J. Colby, D.T. Nguyen, E. Chevet, D.Y. rected prebleach and postbleach recovery fluorescence intensity values in Thomas, and G.J. Snipes. 2002. Association of calnexin with mutant pe- the photobleached region of interest as described previously (Ellenberg et ripheral myelin protein-22 ex vivo: a basis for “gain-of-function” ER dis- al., 1997). Image analysis was performed using NIH Image 1.62 and LSM eases. Proc. Natl. Acad. Sci. USA. 99:9852–9857. image examiner software. Composite figures were prepared using Photo- Ellenberg, J., E.D. Siggia, J.E. Moreira, C.L. Smith, J.F. Presley, H.J. Worman, shop 5.5 and Illustrator 9.0 software (both from Adobe). Fluorescence re- and J. Lippincott-Schwartz. 1997. Nuclear membrane dynamics and reas- covery curves were plotted using Kaleidagraph 3.5 (Synergy Software). sembly in living cells: targeting of an inner nuclear membrane protein in in- terphase and mitosis. J. Cell Biol. 138:1193–1206. We would like to thank Devarati Mitra and Kelly Shaffer for generating and Fawcett, D.W. 1981. The Cell. W.B. Saunders Co., Philadelphia. 827 pp. characterizing the Sec61 constructs containing a lumenal GFP. We are Fukuda, M., A. Yamamoto, and K. Mikoshiba. 2001. Formation of crystalloid en- grateful to Teresa Sprocati for technical assistance. doplasmic reticulum induced by expression of synaptotagmin lacking the Work in the laboratory of Nica Borgese was supported by grants from conserved WHXL motif in the C terminus. J. Biol. Chem. 276:41112–41119. the Associazione Italiana per la Ricerca sul Cancro, the Ministero per la Gong, F.C., T.H. Giddings, J.B. Meehl, and L.A. Staehelin. 1996. Z-membranes: Università e Ricerca (COFIN 2001), and the Ministero per la Sanità (Amyo- artificial organelles for overexpressing recombinant integral membrane pro- trophic Lateral Sclerosis grant 2002). Erik Snapp was a Pharmacology and teins. Proc. Natl. Acad. Sci. USA. 93:2219–2223. Research Training Fellow during the course of these studies. Graham, F.L., and A.J. van der Eb. 1973. A new technique for the assay of infectiv- Submitted: 4 June 2003 ity of human adenovirus 5 DNA. Virology. 52:456–467. Accepted: 27 August 2003 Hewett, J., C. Gonzalez-Agosti, D. Slater, P. Ziefer, S. Li, D. Bergeron, D.J. Ja- coby, L.J. Ozelius, V. Ramesh, and X.O. Breakefield. 2000. Mutant torsinA, responsible for early-onset torsion dystonia, forms membrane inclusions in cultured neural cells. Hum. Mol. Genet. 9:1403–1413. References Koning, A.J., C.J. Roberts, and R.L. Wright. 1996. Different subcellular localiza- Abran, D., and D.H. Dickson. 1992. Biogenesis of myeloid bodies in regenerating tion of Saccharomyces cerevisiae HMG-CoA reductase isozymes at elevated newt (Notophthalmus viridescens) retinal pigment epithelium. Cell Tissue Res. levels corresponds to distinct endoplasmic reticulum membrane prolifera- tions. Mol. Biol. Cell. 7:769–789. 268:531–538. Anderson, R.G., L. Orci, M.S. Brown, L.M. Garcia-Segura, and J.L. Goldstein. Ladinsky, M., D. Mastronarde, J. McIntosh, K. Howell, and L.A. Staehelin. 1999. Golgi structure in three dimensions: functional insights from the normal rat 1983. Ultrastructural analysis of crystalloid endoplasmic reticulum in UT-1 cells and its disappearance in response to cholesterol. J. Cell Sci. 63:1–20. kidney cell. J. Cell Biol. 144:1135–1149. Lee, C., and L.B. Chen. 1988. Dynamic behavior of endoplasmic reticulum in liv- Barr, F., M. Puype, J. Vandekerckhove, and G. Warren. 1997. GRASP65, a pro- tein involved in the stacking of Golgi cisternae. Cell. 91:253–262. ing cells. Cell. 54:37–46. Li, Y., D. Dinsdale, and P. Glynn. 2003. Protein domains, catalytic activity, and Bassot, J.M., and G. Nicola. 1987. An optional dyadic junctional complex revealed by fast-freeze fixation in the bioluminescent system of the scale worm. J. Cell subcellular distribution of neuropathy target esterase in mammalian cells. J. Biol. Chem. 278:8820–8825. Biol. 105:2245–2256. Baumann, O., and B. Walz. 2001. Endoplasmic reticulum of animal cells and its Lippincott-Schwartz, J., E.L. Snapp, and A. Kenworthy. 2001. Studying protein dynamics in living cells. Nat. Rev. Mol. Cell Biol. 2:444–456. organization into structural and functional domains. Int. Rev. Cytol. 205: 149–214. Ohkuma, M., S.M. Park, T. Zimmer, R. Menzel, F. Vogel, W.H. Schunck, A. Ohta, and M. Takagi. 1995. Proliferation of intranuclear membrane struc- Berciano, M.T., R. Fenandez, E. Pena, E. Calle, N.T. Villagra, J.C. Rodriguez- The Journal of Cell Biology ER reorganization in living cells | Snapp et al. 269 tures upon homologous overproduction of cytochrome P-450 in Candida Smith, S., and G. Blobel. 1994. Colocalization of vertebrate lamin B and lamin maltosa. Biochim. Biophys. Acta. 1236:163–169. B receptor (LBR) in nuclear envelopes and in LBR-induced membrane Orrenius, S., and J.L. Ericsson. 1966. Enzyme-membrane relationship in phe- stacks of the yeast Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA. 91: nobarbital induction of synthesis of drug-metabolizing enzyme system and 10124–10128. proliferation of endoplasmic reticulum. J. Cell Biol. 28:181–198. Szczesna-Skorupa, E., C. Chen, S. Rogers, and B. Kemper. 1998. Mobility of cyto- Parrish, M.L., C. Sengstag, J.D. Rine, and R.L. Wright. 1995. Identification of the chrome P450 in the endoplasmic reticulum membrane. Proc. Natl. Acad. sequences in HMG-CoA reductase required for karmellae assembly. Mol. Sci. USA. 95:14793–14798. Biol. Cell. 6:1535–1547. Tabor, G.A., and S.K. Fisher. 1983. Myeloid bodies in the mammalian retinal pig- Pathak, R.K., K.L. Luskey, and R.G.W. Anderson. 1986. Biogenesis of the crystal- ment epithelium. Invest. Ophthalmol. Vis. Sci. 24:388–391. loid endoplasmic reticulum in UT-1 cells: evidence that newly formed endo- Takei, K., G.A. Mignery, E. Mugnaini, T.C. Sudhof, and P. De Camilli. 1994. Ino- plasmic reticulum emerges from the nuclear envelope. J. Cell Biol. 102: sitol 1,4,5-trisphosphate receptor causes formation of ER cisternal stacks in 2158–2168. transfected fibroblasts and in cerebellar Purkinje cells. Neuron. 12:327–342. Pedrazzini, E., A. Villa, and N. Borgese. 1996. A mutant cytochrome b5 with a Vale, R. 2003. The molecular motor toolbox for intracellular transport. Cell. 112: lengthened membrane anchor escapes from the endoplasmic reticulum and 467–480. reaches the plasma membrane. Proc. Natl. Acad. Sci. USA. 93:4207–4212. Vergeres, G., T.S. Benedict Yen, J. Aggeler, J. Lausier, and L. Waskell. 1993. A Pedrazzini, E., A. Villa, R. Longhi, A. Bulbarelli, and N. Borgese. 2000. Mecha- model system for studying membrane biogenesis: overexpression of cyto- in yeast results in marked proliferation of the intracellular mem- nism of residence of cytochrome b(5), a tail-anchored protein, in the endo- chrome b plasmic reticulum. J. Cell Biol. 148:899–913. brane. J. Cell Sci. 106:249–259. Porter, K.R., and E. Yamada. 1960. Studies on the endoplasmic reticulum: V. Its Wang, Y., J. Seemann, M. Pypaert, J. Shorter, and G. Warren. 2003. A direct role form and differentiation in pigment epithelial cells of the frog retina. J. Bio- for GRASP65 as a mitotically regulated Golgi stacking factor. EMBO J. 22: phys. Biochem. Cyt. 8:181–205. 3279–3290. Profant, D.A., C.J. Roberts, A.J. Koning, and R.L. Wright. 1999. The role of the Wolf, K.W., and D. Motzko. 1995. Paracrystalline endoplasmic reticulum is typi- 3-hydroxy 3-methylglutaryl coenzyme A reductase cytosolic domain in cal of gametogenesis in hemiptera species. J. Struct. Biol. 114:105–114. karmellae biogenesis. Mol. Biol. Cell. 10:3409–3423. Wright, R., G. Keller, S.J. Gould, S. Subramani, and J. Rine. 1990. Cell-type con- Sandig, G., E. Kargel, R. Menzel, F. Vogel, T. Zimmer, and W.H. Schunck. 1999. trol of membrane biogenesis induced by HMG-CoA reductase. New Biol. Regulation of endoplasmic reticulum biogenesis in response to cytochrome 2:915–921. P450 overproduction. Drug Metab. Rev. 31:393–410. Yamamoto, A., R. Masaki, and Y. Tashiro. 1996. Formation of crystalloid endo- Seemann, J., E. Jokitalo, M. Pypaert, and G. Warren. 2000. Matrix proteins can plasmic reticulum in COS cells upon overexpression of microsomal aldehyde generate the higher order architecture of the Golgi apparatus. Nature. 407: dehydrogenase by cDNA transfection. J. Cell Sci. 109:1727–1738. 1022–1026. Yang, F., L.G. Moss, and G.N.J. Phillips. 1996. The molecular structure of green Siggia, E.D., J. Lippincott-Schwartz, and S. Bekiranov. 2000. Diffusion in a inho- fluorescent protein. Nat. Biotechnol. 14:1246–1251. mogeneous media: theory and simulations applied to a whole cell pho- Yorke, M.A., and D.H. Dickson. 1985. Lamellar to tubular conformational tobleach recovery. Biophys. J. 79. changes in the endoplasmic reticulum of the retinal pigment epithelium of Singer, I.I., S. Scott, D.M. Kazazis, and J.W. Huff. 1988. Lovastatin, an inhibitor the newt, Notophthalmus viridescens. Cell Tissue Res. 241:629–637. of cholesterol synthesis, induces hydroxymethylglutaryl-coenzyme A reduc- Zacharias, D.A., J.D. Violin, A.C. Newton, and R.Y. Tsien. 2002. Partitioning of tase directly on membranes of expanded smooth endoplasmic reticulum in lipid-modified monomeric GFPs into membrane microdomains of live cells. rat hepatocytes. Proc. Natl. Acad. Sci. USA. 85:5264–5268. Science. 296:913–916. The Journal of Cell Biology

Journal

The Journal of Cell Biology – Pubmed Central

Published: Oct 27, 2003

There are no references for this article.