Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene... The EMBO Journal vol.7 no.7 1 - pp. 929 1936, Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia Carmen Castresana' 25, absorbs and the complex light resulting excitation energy Isabel Garcia-Luque1 is 2,3, Elena Alonsol 2, transferred to photosystems I and II (Glazer, 1983; Vedpal S.Malik"'4 and CAB Anthony R.Cashmore2 Thornber, 1985). are encoded proteins by a family of nuclear in all genes examined plant species (Corruzi et al., 'Laboratory of Cell Biology, The Rockefeller 1230 York University, Dunsmuir et Karlin-Neumann 1983; al., 1983; et al., 1985; Avenue, New York, NY 10021, and 2Plant Science Institute, et Leutwiler et Pichersky al., 1985; al., Castresana Department of Biology, 1986; University of Pennsylvania, Philadelphia, PA et 19104, USA are in al., 1987). They the as synthesized cytosol soluble precursors and then into the imported chloroplasts, where Present addresses: 3IATA CSIC Valencia, Spain, 4Phillips Morris are cleaved to their mature Research form and Center, Richmond, VA, they (Apel USA and 5Laboratorium voor Kloppstech, Genetica, Rijksuniversiteit Gent, and B-9000 Gent, Belgium Schmidt et 1978; Cumming Bennett, 1981; al., 1981). of Photoregulated expression CAB has been genes shown Communicated by M.van Montagu to be transcriptionally This is regulated. process mediated We have analyzed promoter via the regulatory elements from photoreceptor phytochrome as indicated by red light photoregulated CAB gene (Cab-E) isolated from induction and reversion far red by light (Apel, 1979; Nicotiana These plumbaginifolia. studies have been and Cumming 198 et Bennett, 1; Thompson al., 1983; Tobin, performed by chimeric introducing gene constructs into Viro and It has 1981; Kloppstech, 1982). been demonstrated tobacco cells via Agrobacterium tumefaciens-mediated that the elements regulatory for these responsible expres- transformation. Expression studies on the sion regenerated characteristics are localized within the 5' non-coding transgenic have plants allowed us to of characterize three region these genes. Chimeric constructs containing positive and one negative cis-acting elements that bacterial reporter genes fused to the 5'-flanking region of influence photoregulated of the expression Cab-E gene. certain CAB have genes been introduced into tobacco and Within the upstream we have sequences identified two petunia plants (Lamppa et al., 1985; Simpson et al., 1985; positive regulatory elements and (PRE1 PRE2) which et In Nagy al., 1986). this manner these constructs have been confer maximum levels of photoregulated expression. shown to confer photoregulated expression. These sequences contain multiple repeated elements The existence of cis-acting regulatory elements localized related to the sequence -ACCGGCCCACTT-. We have in distinct has been promoter regions described for light- also identified within the upstream region a negative regulated genes (Kuhlemeier et al., 1987a). Analysis of two regulatory element (NRE) extremely rich in AT different CAB isolated from genes, pea (AB 8.0) (Simpson sequences, which reduces the level of in et gene expression al., 1986) and wheat (Cab-]) (Nagy et al., 1987), has the light. We have defined a light element revealed the regulatory presence of a positive light regulatory element (LRE) within the promoter from - within the region extending 396 first 400 of the bp promoter. Within this same to -186 which bp confers photoregulated expression promoter a 'silencer' region element has been described for when fused to a constitutive nopaline synthase AB 8.0 et ('nos') (Simpson Further al., 1986). upstream sequences promoter. Within this region there is a 132-bp are to confer element, necessary maximum levels of transcription to from extending -368 to -234 bp, which on deletion the AB 8.0 pea gene (Simpson et al., 1985). However, these from the Cab-E promoter reduces gene expression from upstream sequences have not been characterized in any high levels to undetectable levels. Finally, we have in contrast to detail, the more extensive studies carried out demonstrated for a full Cab-E length promoter with the conferring promoter sequences extending from -500 to high levels of photoregulated expression, that sequences -100 from the site bp cap of these genes. proximal to the Cab-E TATA box are not We replaceable are interested in by defining the different promoter corresponding sequences from a 'nos' promoter. This elements that are involved in mediating the photoregulated contrasts with the of these apparent equivalence Cab-E ofCAB In expression genes. pursuing these interests we have and 'nos' TATA in box-proximal sequences truncated prepared for the Cab-E gene from N.plumbaginifolia promoters conferring low levels of (Castresana et a photoregulated al., 1987) series of 5'-end and internal expression. promoter deletions. Expression studies on transgenic plants words: Key chlorophyll alb binding protein genes/promoter containing chimeric constructs prepared from these deletions analysis/chimeric have allowed us to constructs/transgenic characterize multiple plants/regulatory regulatory elements elements that are in present distinct regions of the promoter. Results Introduction Construction of promoter cloning vectors CAB bind a and b and exist as To polypeptides chlorophyll a facilitate the characterization of promoter regulatory in the membranes of complex thylakoid This sequences, we have constructed two chloroplasts. plasmids designated ©IRL 1 929 Press Limited, Oxford, England C.Castresana et al. BPN R SN NP TATA box tme Nco digeston Bal 31 exonuclease digestion Hind IlIl restricton pLGVneoltO3 Blunt end with Klenow Oct Digest Digest and Religate Sma I/ Sol Smo I/ Sal Set -1554 + 36 Hind III pUC9 pUC9 Eco RI TATA Cob-E 3end promote, box Eco RI restriction Hind Il Linkers ligation Hind Il rostriction Hind III 3.e d GSd NOttr promotor fragment isolation Hind III ligation to pMHl-Nco -1554 + 36 ligt pMH/- ad pNCAT-Ned Hind liI pMHl-Neo Cab.E prorotrr NO$ pMHItNoo So lt 2. Construction of the Cab-E fusion. An Fig. promoter-CAT EcoRl/BamHI DNA 409 of the of the Cab-E fragment containing bp coding region gene 3s ofd Tiod and a to -1554 from the site of 5'-flanking fragment extending bp cap the et was subcloned in The gene (Castresana al., 1987), pUC9. resulting 1. Construction of intermediate cloning vectors. The Fig. plasmid plasmid was linearized at the internal NcoI restriction with site, digested kanaycnreitac marernt h 103 was restrictedStnyalSai. with TheKmISl retrcion the containing pLGVo1 fragment Bal31 exonuclease and then restricted with The ends were HindmH. repaired fused to the and the 3' end NPT(II) gene nopaline synthase promoter with the Klenow fragment of DNA I and then the was polymerase plasmid of the was from an and octopine synthase gene, purified agarose gel recircularized. The plasmids with the HindUI site restored were analyzed to pMH-1 and pNCATM5 restricted with SnaI/Sail ligated (previously for the extent of the 3' deletions by polyacrylamide Plasmids gel sizing. enzymes). were sequenced from the HinduI site to define the end point of the deletion. A plasmid containing a 3' deletion to position +36 from the site of cap the gene was selected, restricted with EcoRI and the ends with repaired and a 1), pMHIe-Neo pNCAT-Neo (Figure by cloning Klenow. After ligation to Hindm linkers followed by restriction with HindLH, kanamycin resistance marker into the SmoaI -Sal restriction the promoter fragment was purified from an agarose and cloned into gel sites of and et al., (Timko plasmids pMHI pNCATM5 the HindllI site of Correct orientation in unique pMHl-Neo. pMHl-Neo contains the of the bacterial was determined by PstIlEcoRI double digest. 1985). pMH1I coding region gene transferase to which we had (CAT) chloramphenicol acetyl fused several from a labeled in the NcoI site (147 bp into the coding region of previously promoter fragments pea RBCS subunit of ribulose 1 The was for 15 h at 450C to (small ,5-bisphosphate Cab-E). fragment hybridized carboxy- lase) and conferred light-regulated expression in 25 of total RNA isolated from N.plumbaginifolia and then gene jAg transformed tissue. As does not contain treated with SI nuclease. A DNA protected of plant pMH1 fragment any marker to select for transformed we isolated a 206 bp was obtained (results not shown) defining the cap plants, under control of the 'nos' promoter site at 59 bp upstream from the first ATG of the kanamycin gene coding from 103 et (nopaline synthase) pLGV1 (Simpson aL., 1985), region. Some SI-resistant of 180- 185 were products bp and cloned this into 1. also obtained. These fragment fragments are presumed to result from pMH The was constructed in a similar of the to pNCAT-Neo plasmid hybridization probe transcripts derived from the manner. It contains a truncated 'nos' other CAB in the genes present N.plumbaginifolia genome. promoter (extending to 145 5' of the mRNA fused to the These CAB genes must diverge from bp cap site) Cab-E in the region coding of the CAT can be used to test 33-38 from the ATG region gene. pNCAT-Neo bp upstream codon. whether a TATA box promoter regulatory sequences lacking can confer to a Construction of a Cab-E promoter-CAT fusion and light-regulated expression heterologous that mediated constitutive promoter normally analysis of transgenic plants expression. We prepared a chimeric construct by fusing the 5 '-flanking Cab-E Mapping region from the transcripts N.plumbaginifolia Cab-E gene to the coding SI were carried out to define protection the region of the CAT gene. experiments cap site for the derived from the Cab-E used To isolate a promoter sequence we carried out Bal31 transcripts gene in this A NcoIIDraI was 5' study. end- digestion from the coding region of Cab-E (Figure 2) and 392-bp fragment 1930 Expression of the CAB gene from N.plumbaginifolia is decreased at least 10-fold when the sequences between S CAT PRE NRE I AI PRtA T -747 to -516 are deleted, suggesting the presence in this region of a second positive regulatory element(s) (PRE2). The deletion to -516 still contains sequences with ability 1o- loo10 to direct low levels of CAT gene expression. Further dele- tions to -234, - 135 or -30, result in a complete loss of 1X575 CAT activity. detectable To assess in more detail the significance of the promoter ~~~~~~~~~~~50 50 identified, we prepared a series of promoter internal elements deletions and analyzed these by plant transformation. Figure 25-25 4C shows that, somewhat independent of the 5' end of the Cab-E promoter fragment utilized, deletion of internal sequences lying from -516 to -234 bp causes almost a -1554 -1182 -973 -747 -516 -234 -135 -30 complete loss of CAT activity (constructs 3 and 7). Even more striking, deletion of sequences located between -368 Fig. 3. 5' End deletion analysis of the Cab-E promoter. Promoter dele- and -234 bp produced a complete loss of CAT activity tions were analyzed by fusion to the coding region of the bacterial CAT 4). In contrast, when upstream sequences and subsequent analyses for CAT activity in transgenic plants. The (construct gene and the promoter strength assigned to each deletion is indicated. 5' end point from -747 to -516 bp are deleted, only a small extending represent the average CAT activity determined for 10 independent The data is observed in the level of activity conferred by reduction and are expressed as a relative percentage of the activity transformed plants, the promoter fragment extending to -973 bp (construct 2). determined for the wild-type promoter (deletion -1554 bp). The percentage We note that construct 2 confers significantly higher levels of AT sequences corresponding to the different promoter deletions are also The regulatory elements PREI, PRE2, NRE and LRE are defined of CAT activity than does construct 8. This result appears presented. in the text. to be a contradiction of our definition of sequences between -973 and -747 as comprising part of a NRE. We suggest that the resolution of this apparent inconsistency is that there a extending from -1554 to +36 bp. A selected fragment resides within the NRE, sequences that act as positive was prepared by inserting this promoter chimeric construct regulatory elements but that the effect of these sequences This was then transferred to fragment into pMH1-Neo. becomes apparent in the absence of both PREI and and introduced into tobacco cells by leaf disc only Agrobacterium 5' deletion studies (Figure 3) clearly indicate PRE2. Our transformation as described in Materials and methods. of PRE2 the overall effect of sequences examined seven independent transgenic plants that in the presence We initially and -747 is that of a NRE element. between -973 to evaluate variability in CAT activity, NPT II activity and copy number (results not shown). We observed that gene Sequence analysis of the Cab-E promoter varied between individual transgenic plants. CAT activity We previously reported the complete sequence of Cab-E in NPT II activity was not so acute, due possibly Variation including its promoter extending to -921 bp upstream from selection. We estimated that the number to the kanamycin the site of the gene (Castresana et al., 1987). We show for both and NPT II) ranged from cap of copies genes (CAT here the sequence of the complete 5'-flanking region used for individual plants. Little correlation was one to 10 extending to -1554 bp from the cap site of CAT activity and either gene copy number in this study, observed between the (Figure 5). H To accommodate the differences in CAT gene or NPT activity. To further characterize DNA sequences which might be 10 independent transformant plants activity, we have assayed responsible for regulatory characteristics of the different and we have reported the average results. for each construct regions defined, we have analyzed the base promoter of the complete 5'-flanking region studied. The composition of regulatory sequences in the 5'-flanking Distribution DNA examined is 62 % AT rich with the complete sequence of Cab-E region nucleotides being very asymmetric (Figure distribution of regulatory sequences within the Cab-E promoter To identify the two upstream regions between It is observed that a series of chimeric constructs by fusing 3). we have prepared -1182 and -747 and -516 containing PREl -1554 to 5' deletions to the CAT gene contained different promoter are the regions within the promoter which and PRE2 only 1-Neo. The deletions were obtained either by Bal3 1 in pMH of GC bases (Figure 3). or convenient restriction sites contain a high percentage exonuclease digestion, by using the promoter region extending from -747 to The nature of the deletion as well as Interestingly, within the promoter. contains the sequence CCCAC repeated six for each construct is shown in Figure 3. -516 (PRE2) the determined activity The same sequence is repeated five times in the com- times. Chimeric constructs which contain promoter fragment strand of the positive element located between either to -1554 or to -747 confer equal levels plementary extending Some of these repeated -1554 and -1182 bp (PREl). to these levels correspond of CAT activity transgenic plants; more extensive homology reaching a share a determined. The activity decreases at least sequences to the maximum of 12 nt in the sequence -ACCGGCCCACTT- maximum the located between -1554 and 5-fold when sequences 5 and Table The heptanucleotide CCGGCCC (Figure I). - deleted. Further deletions from -1182 to -973 1182 are in this is repeated a total of seven times contained sequence result in an increase of strength of and to -747 promoter in the two regulatory elements. 5-fold relative to the -1182 construct. 2.5- and respectively, elements PREI and PRE2, the In contrast to the positive results the presence of a positive regulatory These suggest is extraordinarily rich in element (NRE) upstream negative within the lying from -1554 promoter region element(s) the between -1182 and -973 AT bases with sequences -1182 and a negative regulatory element(s) in to (PREl), 83% containing (Figure 3). from -1182 to -747 Activity (NRE). the region extending 1931 C.Castresana et al. Cab-E promoter confers light-regulated expression transformed either in the or dark plants grown light (Figure To determine whether the various promoter mutants confer 4A). light-regulated expression to the CAT gene, as well as to Plants under a 14 h h growing dark light/lO photoperiod define the point of initiation of SI transcription, mapping were transferred to the dark for 4 and then days placed for analysis was performed on total RNA prepared from 24 h under continuous white No CAT mRNA light. was D L D L D L D L D L D L B D D L D DL -L0 1 2 3 4 6 7 8 9 CAT activity _ _ E 3 6 ~~~~~~~~~~~~~~~4 - n j -r-L _0 5 - 12.5 6 _ _ A 100 Fig. Analysis of light-regulated expression conferred to the CAT the gene by different Cab-E deletion promoter mutants. Panel A. S1 nuclease of 75 digestion of total RNA obtained from transformed for 4 in plants placed days the dark and then returned Ag (D) to the for 24 h A light 5' (L). end-labeled probe containing 240 of the bp CAT and coding region extending to -391 in the Cab-E bp promoter was utilized. The size of the protected fragments was estimated reference to by the of the mobility plasmid pUC18 restricted with Sau3A and end-labeled the Klenow using fragment of DNA polymerase I (first lane on the left). Panel B. SI nuclease of digestion 100 of total RNA obtained from transformed plants icg containing construct number 1. A 5' 748-bp end-labeled DNA fragment containing 565 of the of II bp coding region the NPT gene (neomycin phosphotransferase) and extending to 145 in the bp 'nos' (nopaline synthase) promoter was utilized as a probe. Panel C. of Diagram the deletion mutants. The CAT activity is as expressed described in the to 5. legend Figure -1554 CCAGGTGAACCCGTAACTAGTTTCTTGTATTCGCCTCTGCTGATAGGTGATTATAACCTCCTCAAAAGCAATTTCTACTCCATTTCACCTATAAAATAATCAGAAAACTTAAGTTATATA 1435s CATCAGTAAATAAATTTACACCATAAGATAAAAATTGCTTTCGCAACCGTTAAGGGTGGCATGTGGGCCGGGGCCGGTTCTAAGTGGGCTTTACGGGCCCCGATCCTAAGTAGGCCCAGT - 1315 CCTAAGTGGGC-CGG-TCCTAAGTGGTCCCGGGTTTCGCAGGCTTCTTGTTGTAATCGGCCTrGGATTGGGACCACG CAATACGGTCCCGGGTTAA-GGGTGGGCCG-G-TCCCGGGCCT-AAGT-G-G -119 5 -1182 GCCCAACGMATACTTTCTATTTTTTAAAATAATTTATAGAAGTTAGAGAAAAAAATGAAAATMAAMATATTTAAGGCAATTCCTTGTAAATTATATTATAGAATTGTGACCTAAATTT -107 5 -973 TTTAATTCAAATTAAAGATAAAATATTGTAAAGAGGTATTCAAAGCAATCTGTTATAIATATATATATATATATACTAAGTGTATAGTATATAAGCTATAATTATATATATCTTAAGA - 955S TGTATATATAGTATTATAGTATAGTATAGTAATCTTAACATGTATATATAGCTATAAAAGTATGGGGTTAAMCAAAGTTGGGAAAGGTTATTTTATAAATTGCCAACGGCTATTTTAG - 83 5 -747 CAGGTAAAACCGCCATATTTTAAATGCCATAACGGCTATAATGTGGCACATTTATTTTTTAAAAAbAACTAACCGTTGGGCCCGAATAGGCCTTTTTAGGACCGCTTGAACCGGCCCACTT - 715 CCCAGCCGGTCCCGGTCTCGCGGGCCTCGCCTATGGMACCGACCCACTACCCAGCCCACCTCCCCACGGTCCCGATCCTATTCGGTTAGAACCGTCTAGGCCCACCGCCCATTTGGGCTT - 59 -516 GCGGTCTTGGGCCGCACCTGAACCTAACCGGCCCACATGCCATCCTTACTAACCGTAAATAACTTAGAAGTTATTGTATACGTATGATCGAGCTGTTGGACTTGTAGTATCAMCTTTCA -475 ATGACGCATCAAAATTAATTATGGTAGCTTCGCGTTGGGACACTTGTACATGCATTAACTTGATTTCAATTTCTTTTTTAAAATATTGTCTATTGTCAATTTACCACTCGTACTTGAA - 35 5 GTGGGCCTATTGACAGGTCAGCTAAATACAGAAGTGTATGAACAATGCGTGGCCAAGAGTAACTCTTATGCTAAAGACAAGTGGATATTATATTGCATTAATCCACAATCAGACGTGGC - 23 5 -234 -135 7,AATTTGGATTGGCTATAAGAGAGCAAATCTTCATTAGGTAAGTTTTTTAAACATAAAAAGTATCTAAAAAAATCTTGTCATGTTAACGGTGCTGAACTTTGCCAAATGGACAAGAATG l - l5 -30 CAAAAGGTTAAAATTGCAATCCACCAATTGAAAMGTAGATATAGATACTCAAGGATAMGGGTCTTTGGGCCTGTAAMGCCATTTATATACACTTAGTGCAAAGCCCATGAAMCTCAACCC TCAAATCAACTCTTTCTTTTTGTGCATTCAAGAGTTATCATTTTACTCCTACA 5. Nucleotide of the Fig. of sequence Cab-E Nucleotides are 5'-flanking region numbered with gene. the site + cap 1. TATA designated and CAAT boxes are underlined. Direct and inverted in Table I are repeat sequences also underlined. represented overlined Sequences represent sequences similar to boxes II and III et (Kuhlemeier and the al., G box 5' 1987b) Giuliano et (ACGTGGCA; see text. al., end 1988); of the deletions are points promoter indicated. analyzed 1932 of the CAB Expression gene from N.plumbaginifolia detected after the 4-day dark period. However, when the of is the same in expression approximately dark-grown and plants were returned to the light, CAT mRNA was detected light-grown tissue (Figure 4B). in those plants for which we had previously detected CAT enzymatic activity (Figure 4, panel A and C). The mRNA Fusion of Cab-E promoter sequences to a constitutive increase was in proportion to the level of CAT activity 'nos' promoter previously determined. To evaluate whether the CAB promoter sequences could We observed for all the chimeric CAT constructs exam- confer to a light-regulated expression heterologous promoter ined, the same initiation point for transcription (Figure 4A). that normally mediates constitutive expression, a DNA The SI protection experiments showed the presence of an from -396 to -186 from fragment extending bp the cap SI -resistant product of -287 bp which would correspond site of Cab-E was cloned into the unique HindIfl restriction to a cap site 26 bp downstream from the TATA box, in the site of the plasmid pNCATNeo. This plasmid contains a same region identified for the wild-type Cab-E gene. truncated 'nos' promoter fused to the coding region of the In these studies we included as a control a 5' end-labeled CAT gene. We also fused to the same truncated 'nos' probe for transcripts derived from the NPTII gene. This gene promoter a large Cab-E promoter obtained fragment by is fused to the 'nos' promoter and, as expected, the level Bal3l deletion and extending from -1554 to -112 bp. This large fragment was also fused to a Cab-E truncated promoter extending from -135 to + 36 bp; this construct essentially Table I. Multiple repeated sequences present in the two upstream restores the -1554 wild-type bp Cab-E promoter with the positive regulatory elements (PREI and PRE2) addition of a small duplication of the sequence -135 to C -112 (Figure -1360 - - - - - - - - - A - 6D). -1373 -1354 - - - - - - - - C G G C -1362 Expression in transformed plants was determined by -1339 T A A A - - - - - - - - -1352 assaying for CAT activity and by SI analysis on total RNA. -1298 - - - - - - - - - - - - -1311 Figure 6D shows that no CAT activity is detected when the -1208 - - - - - - - - - - - - - 1221 CAT gene is under the control of either the 'nos' or Cab-E -1187 T T G - - - - - - - - - -1200 truncated promoters (Figure constructs and 6D, 1 4). However, activity is observed when either of the two Cab- A C C -726 G G C C C A C T T -715 E promoter sequences (-396 to and -1554 to -186 -112) -678 - - - - A--- - A -667 were fised to the truncated 'nos' 2 promoter (constructs and 3). -665 C - - A - - C -654 Transformed the to plants containing -396 -186 Cab-E -657 - - - T C---- G -646 T promoter, showed no detectable CAT mRNA -619 C A---- - C when grown G -608 -577 T -----A - G A -590 in the dark. When these plants were placed in the light, -568 - A - -557 significant levels of CAT mRNA were detected (lane 2). These results demonstrated that this Cab-E promoter A dash represents homology. fragment acts as a light regulatory element (LRE) in that A B LD L D L D L D L D L _ _ _ _ _ 4:- *-'48 _ -. _- -633 4 5 r AT activity C- N0S CAT 0 ? M- ------F4fNS csI CAT 1113 7 A B N S A' 14 4 CAT rCASB 0 CAB CABi CAT 54 6. of of chimeric constructs different fusions. Panel A. SI nuclease of Fig. Analysis light-regulated expression 100 containing promoter digestion yg of total RNA isolated from transformed constructs 2 or 3. The utilized contained 240 of the of the plants CAT containing 1, probe bp coding region total RNA isolated from and extended to -145 in the 'nos' Panel B. SI nuclease of gene, bp promoter. transformed digestion plants containing of total RNA isolated from transformed constructs 4 or 5. The utilized was the same as described in A. Panel C. SI nuclease probe digestion plants D. of the fusions The CAT construct 5. The utilized was the same as described in B. Panel containing probe Diagram promoter analyzed. activity was RNA obtained from transformed is as described in the to 5. assigned expressed legend Figure Light-regulated expression assayed using plants in of the was as described the placed for 4 days in the dark and then for 24 h in the The size determined (D), light (L). protected fragments legend to 4. Figure 1933 C.Castresana et al. to the 'nos' truncated it confers photoregulated expression have described here, is similar to the GC-rich box CCGCCC promoter. found in a number of animal viral and cellular promoters, Plants containing the larger Cab-E promoter fragment including the SV40 early promoter, where this sequence is (-1554 to 112) fused to the truncated Cab-E promoter repeated six times (Benoist and Chambon, 1981). This mRNA in the dark (lane similarly showed no detectable CAT sequence is the binding site for the Spl factor which plays were 4), in contrast to the levels found when these plants an important role in activation of transcription (Kadonaga returned to the light (lane 5). Of particular interest, plants et al., 1986). containing the same Cab-E promoter fragment fixed to the PREl is a positive regulatory element which, in our truncated 'nos' promoter, showed significant levels of CAT of we note studies, affects the expression Cab-E. However, mRNA when grown in the dark (lane 3). Equivalent level that in the genome of N.plumbaginifolia from whence these when these were of expression was maintained plants were derived, it is more likely that the primary sequences transferred to the light (lane 3). Thus, whereas the large effect of PREl is on Cab-F (Figure 2). This conclusion is confers the (-1554 to -112) Cab-E promoter fragment based simply on the fact that PREl is closer to Cab-F when fused to the expected photoregulated expression ( - 800 bp) than it is to Cab-E ( - 1400 bp). Thus it is likely truncated CAB promoter, the same fragment confers that PREl and PRE2 are and related structurally functionally constitutive expression when fused to the truncated 'nos' PREs acting on divergently oriented genes. In accordance promoter. with this suggestion, is the divergent orientation of the In these studies we also included as a control a 5' end- repeated sequence found in the two elements. labeled probe for transcripts derived from the NPT II gene Somewhat irrespective of the precise regulatory role of fused to the 'nos' 6C). promoter (Figure PREI and PRE2 in the N.plumbaginifolia genome, in the experiments that we have reported here it is quite clear that both elements affect the level of expression mediated by the Discussion Cab-E promoter. from The 5'-flanking region of the Cab-E promoter N.plum- That PREl and PRE2 contain divergently oriented baginifolia has been used to define promoter elements repeated sequences (Table I) presumed to contribute to the In responsible for photoregulated expression. these studies regulatory characteristics of these elements, is suggestive that we have defined multiple positive and negative regulatory these elements are enhancer We believe this sequences. nature of the elements that determine both the level and the is to be correct and it can be tested. possibility likely readily Cab-E However, in relation to this we note gene expression. suggestion do that at in the content of the Cab-E these least promoter, elements Positive regulatory elements exist far upstream in the not as enhancer are acting general sequences. This conclusion Cab-E promoter is based on the observation that the high level of CAT activity Within we have identified two the upstream sequences observed for the -973 truncated Cab-E promoter containing I which confer positive regulatory elements (PRE and PRE2) PRE2, is totally lost when the LRE fragment between -368 of 5' Promoter maximum levels expression. deletions which to -234 is deleted. Thus in this construct, fusion to PRE2 PREI or both PREI PRE2 eliminate either and produce a to a truncated Cab-E promoter yields an inactive promoter. reduction in gene expression of 5- and 10-fold respectively. Whether or not this dependence of the PRE2 sequences on The existence of upstream sequences that exert an increase the LRE is a characteristic of the Cab-E sequences unique in the level of expression have previously been noticed for promoter is not presently known. This can be tested by fu- a CAB from In gene pea (Simpson et al., 1985). contrast, sion of the positive regulatory elements to other truncated our results differ from those et al. recently reported by Nagy promoters. (1987) using a CAB gene from wheat. Within this gene, to -357 from the promoter sequences extending bp cap site, A element exists far in negative regulatory upstream to maximum of are sufficient confer levels photoregulated the Cab-E promoter in tobacco expression transgenic plants. We have also identified within the upstream promoter region The two elements identified here upstream positive (PRE1 a NRE between the two elements PREl and lying positive are GC-rich contain- and PRE2), relatively sequences PRE2. A 5' deletion to -1182 which extending bp elements related to the ing multiple repeated sequence eliminates a 5-fold reduction in the level PREl, produces In view of their -ACCGGCCCACTT- (Table I). pre- of while deletion of the element gene expression, negative to contribute to the dominance these are sequences likely located between -1182 and -747 bp increases exponen- regulatory characteristics of these positive elements. tially 5-fold, restoring maximum levels of expression. Somewhat related have been in sequences found other NRE in The described for Cab-E is extraordinarly rich promoters in regions known to enhance the level of gene AT AT-rich have been for sequence. sequences described expression. For instance, the embryo-specific gene encoding in yeast promoters (Struhl, 1985). However, this case the the a' subunit of 3-conglycinin from soybean plants contains which exist as were identified as sequences, poly(dA -dT), five 6-bp repeats (AGCCCA) within a 100-bp promoter positive elements necessary for constitutive expression. fragment, the presencce of which raises the level of gene Whether the regulatory characteristics of the Cab-E NRE expression at least 20-fold (Chen et al., 1986). Similarly, are largely a reflection of the high AT content is not known the 35S promoter of the CaMV (cauliflower mosaic virus) at this point. contains the sequence CCAC, and its complement GTGG, Plant NREs have been described for a CAB gene from a total of 10 within a which repeated times region confers a pea (Simpson et al., 1986) and recently for RBCS gene, maximum level of expression (Kay et al., 1987; Ow et al., also from et pea (Kuhlemeier al., 1987b). Both genes are 1987). Furthermore, the GC-rich repeated sequence that we light-regulated, but the negative elements, which are located 1934 gene from N.plumbaginifolia Expression of the CAB between -347 and -100 bp from the cap site of the genes, thought is our observation that the factor that binds to the have been characterized by their ability to silence the G box in the tomato RbcS-3A gene, apparently also binds expression of constitutive promoters either in roots (Simpson to box in the LRE fragment from the Cab-E gene, the G et al., 1986) or in leaf tissue when placed in the dark a synthetic as binding to the Cab-E fragment is competed by (Kuhlemeier et al., 1987b). The negative element that we RbcS-3A G box oligomer (U.Schindler, unpublished obser- describe here for the Cab-E promoter, reduces the level of vation). These data suggest that the G box sequences in the gene expression in leaf tissue in the light, as demonstrated two may indeed be functionally equivalent. genes by an enhancement of expression when this element is deleted. This negative element also differs from previously Sequences proximal to the Cab-E TATA box have described elements, with respect to its far-upstream location. distinct functional characteristics With the NRE, as with the PREs, we have not addressed As discussed, in order to assess whether the element -396 directly the question of whether or not these sequences can to -186 could confer light regulation to a constitutive confer photoregulated expression. However, we believe it promoter, we fused this element to a truncated 'nos' more likely that the far-upstream positive and negative promoter (extending to - 145 bp 5' of the mRNA cap site). regulatory elements simply serve to modulate levels of The fusion promoter gave rise to levels of CAT activity (7% expression. of maximum activity) in light-grown plants which was very near that found for a similarly truncated Cab-E promoter A positive element that mediates light-regulation to -516 bp gave rise to 9% (the Cab-E promoter truncated Positive light regulatory elements (LREs) have previously of maximum CAT activity). Furthermore, the fusion been characterized for light-regulated CAB and RBCS genes promoter conferred photoregulated expression. In these from pea. DNA sequences which promote photoregulated experiments, sequences within the truncated 'nos' promoter expression when fused to constitutive truncated promoters behave in a manner not significantly distinct from the have been localized within promoter regions extending from sequences within the Cab-E promoter. corresponding -400 to -100 bp from the cap site in the genes examined In striking contrast to these results, when a large Cab-E (Fluhr et al., 1986; Simpson et al., 1986; Kuhlemeier et al., promoter element (-1554 to - 112) was fused to the 1987b; Nagy et al., 1987). truncated 'nos' promoter the resulting fusion promoter Several lines of evidence indicated that a similar LRE displayed functional characteristics quite distinct from those resides within the Cab-E promoter. With the 5' deletion element was fused to a observed when the same similarly experiments, we describe a truncated Cab-E promoter 135 to + This Cab -nos truncated Cab-E promoter (- 36). extending to -516 bp which directs low levels (9% of of maximum CAT fusion promoter showed only 14% of observed for the maximum) CAT gene expression in light-grown tissue. with the 54% activity, contrasting activity Within this promoter fragment, we have defined a 132-bp Cab - Cab and with the corresponding promoter fusion, element (extending from -368 to -234 bp) which on maximum observed for the -1554 'wild- 100% activity bp deletion from the -973 bp Cab-E promoter, reduces gene Cab-E of mRNA type' promoter. Furthermore, by analysis expression from high levels to undetectable levels. Further- nos fusion was shown to this Cab- promoter promote more, when a fragment from the Cab-E promoter, extending in the dark at levels similar to that found in the expression from - 396 to -186, was fused to a truncated nos promoter, while the Cab - Cab fusion directed the light, promoter photoregulated expression was conferred. expected photoregulated expression. By comparative analysis of the 5'-flanking region from the above results we conclude that there must exist From different RBCS genes we have revealed the presence of a in the truncated Cab-E to + sequences promoter (-135 36), conserved sequence of - 100 bp located between -427 and in the truncated 'nos' that are lacking promoter, required - 178 bp from the first ATG codon. Within these promoter the levels of the to mediate high expression promoted by regions the sequence -ACGTGGCA- is highly conserved. PREs. we conclude that there are upstream Furthermore, We have also shown that both tomato and Arabidopsis plants Cab-E also sequences in the truncated promoter, again contain a nuclear factor that binds to this 'nos' which in the protein sequence in the truncated promoter, lacking are for (Giuliano et al., 1988). This same sequence -ACGTGGCA- presence of the upstream sequences required in These reflect is located within the Cab-E promoter a similar relative photoregulated expression. sequences may or elements in the position (-241 bp from the cap site) and within a region negative, unique positive, possibly we to be essential for gene expression. Cab-E have demonstrated truncated promoter. Alternatively, they might simply et al. have characterized conserved of some in the 'nos' Kuhlemeier (1987b) reflect an absence sequences promoter. 'nos' lacks in III and in the In latter context we note that the sequences present boxes I, II, 11*, H1*, pro- the promoter of similar to boxes II both a conventional TATA and CAAT box et moters pea RBCS genes. Sequences (Ebert al., note that we have and IIH are of the G box se- In the former we present immediately upstream 1987). context, a GATA which in the tobacco Cab-E in characterized commonly quence gene (Figure 5). Similarly, previously sequence between the CAAT box and TATA RBCS box 11* occurs from resides as 2-3 repeats pea genes, immediately upstream I CAB et the G us to that factors to box of PSII box, prompting suggest binding type genes (Castresana al., 1987). et This if these in these interact What role, any, sequences might play mediating sequences may (Giuliano al., 1988). of CAB is our observation that these of is high levels photoregulated expression genes suggestion strengthened by in the Cab-E unknown. are presently sequences similarly juxtaposed gene. fact that the G box and II conclusion from the with the the sequence (and An additional experiments Furthermore, that within LREs of both CAB fusion promoters is there reside sequences in the large related sequences) are present to in the smaller a fundamental in the promoter fragment (-1554 -112), lacking and RBCS genes, suggests similarity to which on fusion of of these Consistent with this regulation expression genes. Cab-E promoter fragment (-396 -186), 1935 C.Castresana et al. Apel,K. and Kloppstech,K. (1978) Eur. J. Biochem., 85, 581-588. 'nos' promoter mediate expression in the dark as well to the Benoist,C. and Chambon,P. (1981) Nature, 290, 304-310. in the light. We believe that these sequences are as probably Birnboim,H.C. and Doly,J. (1979) Nucleic Acids Res., 7, 1513-1523. same PRE1 and PRE2 sequences that mediate high levels the Cashmore,A.R. (1984) Proc. NatI. Acad. Sci. USA, 81, 2960-2964. photoregulated expression in both the full-length 'wild- of Castresana,C., Staneloni,R., Malik,V.S. and Cashmore,A.R. Plant (1987) Cab-E promoter, and the Cab - Cab fusion Mol. Biol., 10, 117-126. type' promoter. and Proc. Natl. Acad. Sci. Chen,Z.-L., Schuler,M.A. Beachy,R.N. (1986) the fact that these sequences do not mediate As discussed, 8560-8564. USA, 83, the dark on fusion to the truncated Cab-E expression in Coruzzi,G., Boglie,R., Cashmore,A.R. and Chua,N.-H. (1983) J. Biol. must reflect a significant difference between the promoter, Chem., 258, 1399-1402. two truncated promoters. Cumming,A.C. and Bennett,J. (1981) Eur. J. Biochem., 71-80. 118, Dellaporta,S.L., Wood,J. and Hicks,J.B. (1983) Plant Mol. Biol. Rep., 1, 19-21. Materials and methods Dhaese,P., De Greve,H., Decraemer,H., Schell,J. and van Montagu,M. Nucleic Acids 1837-1849. (1979) Res., 7, Construction of chimeric constructs and J. Mol. Dunsmuir,P., Smith,S.M. Bedbrook,J. (1983) Appl. Genet., constructs were prepared using standard DNA procedures described Chimeric 2, 285-300. et al. (1982). Plasmid DNA was prepared according to Birn- by Maniatis Ebert,P.R., Ha,S.B. and An,G. (1987) Proc. Natl. Acad. Sci. USA, 84, (1979). Escherichia coli JM83 and HB1I1 were used for boim and Doly 5745-5749. DNA transformation experiments. all the 'in vitro' Fluhr,R., Kuhlemeier,C., Nagy,F. and Chua,N.-H. (1986) Science, 232, sequencing 1106-1112. DNA The sequence of the Cab-E promoter was determined by the method of Glazer,A.N. Annu. Rev. 125-128. (1983) Biochem., 52, Maxam and Gilbert (1980). The structure of all chimeric constructs was and Giuliano,G., Pichersky,E., Malik,D.S., Timko,M.P., Scolnik,T.A. by partial sequencing using the same procedure. Proc. Natl. Acad. Sci. in confirmed USA, Cashmore,A.R. (1988) press. Horsch,R.B., Fry,J.E, Hoffman,N.L., Eichholtz,D., Rogers,S.D. and Ti-mediated transfer Fraley,R.T. (1985) Science, 227, 1229-1231. Intermediate cloning vectors containing different chimeric constructs were Kadonaga,J.T., Jones,K.A. and Tjian,T. (1986) Trends Biochem. Sci., 11, transferred to A.tumefaciens harboring the Ti plasmid pGV3850 (Zambryski 20-23. et al., 1983), by triparental mating (Van Haute et al., 1983). The structures Karlin-Neumann,G.A., Kohorn,B.D., Thomber,J.P. and Tobin,E.M. (1985) co-integrates in Agrobacteriwn were analyzed by the method of Dhaese of the J. Mol. Appl. Genet., 3, 45- 61. et al. (1979). Agrobacteria containing the co-integrates, were used to transfer Kay,R., Chan,A., Daly,M. and McPherson,J. (1987) Science, 32, constructs to Nicotiana tabacum SR1 cells by leaf disc the chimeric 1299-1302. et al., 1985). Transformed discs were maintained transformation-(Horsch Kuhlemeier,C., Green,P. and Chua,N.-H. (1987a) Annu. Rev. Plant in MS medium (Murashige and Skoog, 1962) containing hormones to Physiol., 37, 221-257. stimulate shoot formation (1 mg/l 6-BAP and 0.1 mg/l ca NAA) and Kuhlemeier,C., Fluhr,R., Green,P. and Chua,N.-H. (1987b) Genes Dev., kanamycin sulfate (100 to select transformants. Transformed shoots 1pg/mil) 1, 247-255. were selected after rooting in MS medium containing kanamycin sulfate Lamppa,G., Nagy,F. and Chua,N.-H. (1985) Nature, 316, 750-752. and transferred to soil. (50 Leutwiler,L.S., Meyerowitz,E.M. and Tobin,E.M. (1986) Ag/ml), Nucleic Acids Res., 14, 4051-4076. Analysis of transformed plants Maniatis,T., Fritsch,E.F. and Sambrook,J. (1982) DNA Cloning. Transformed plants growing under a 14 h light/lO h dark photoperiod were Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring analyzed between 7 and 8 h after the dark period. Leaves of - 10 cm were Harbor, NY. harvested for analysis -4 weeks after transfer of the plants to soil. Maxam,A.M. and Gilbert,W. (1980) Methods Enzymol., 65, 499-560. Neomycin phosphotransferase (NPT H) activity was measured according Murashige,T. and Skoog,F. (1962) Physiol. Plant., 15, 473-497. to Reiss et al. (1984). Chloramphenicol acetyl transferase (CAT) activity Nagy,F., Kay,S.A., Boutry,M., Hsu,M.-Y. and Chua,N.-H. (1986) EMBO was determined as described by An (1986). In both cases 50 of plant jig J., 5, 1119-1124. protein was used per assay. For Southern blot experiments (Southern, 1975), Nagy,F., Boutry,M., Hsu,M.-Y., Wong,M. and Chua,N.-H. (1987) EMBO DNA from transformed plants was isolated according to the procedure J., 6, 2537-2542. described by Dellaporta et al. (1983). Ow,D.W., Jacobs,J.D. and Howell,S.H. 1987) Proc. Natl. Acad. Sci. USA, total RNA preparations, leaves were ground to a fine powder in liquid For 84, 4870-4874. nitrogen using a pestle and mortar. Guanidinium buffer (5 M guanidinium Pichersky,E., Bernatzky,R., Tanksley,S.D., Breidenbach,R.B., Kausch, thiocyanate, 25 mM sodium citrate, 0.5% sarcosyl, 2 mM EDTA, 1 M A.P. and Cashmore,A.R. (1985) Gene, 40, 247-258. and 50 mM Tris-HCI was then added at a ratio 13-mercaptoethanol pH 7.6) Reiss,B., Sprengel,R., Will,H. and Schaller,H. (1984) Gene, 30, 211-218. of 4 ml/g of fresh tissue. The supernatant was clarified by centrifugation Schmidt,G.W., Bartlett,S.G., Grossman,A.R., Cashmore,A.R. and for 10 min at 5000 g, and extracted with an equal volume of Chua,N.-H. (1981) J. Cell Biol., 91, 468-478. phenol/chloroform. After vortexing the solution was centrifuged for 30 min Simpson,J., Timko,M.P., Cashmore,A.R., Schell,J., van Montagu,M. and at 10 000 g. The upper phase was removed and centrifuged again for 10 min Herrera-Estrella,L. (1985) EMBO J., 4, 2723 -2729. at 5000 g. The nucleic acids were precipitated by addition of 0.1 vol 3 M Simpson,J., Schell,J., van and Herrera-Estrella,L. (1986) Montagu,M. NaOAc pH 5.6 and two vols of ethanol and resuspended in sterile water. Nature, 323, 551-554. RNA was then precipitated in 2 M LiCl overnight at 4°C. The insoluble Southern,E.M. (1975) J. Mol. Biol., 98, 503-517. RNA was pelleted by centrifugation for 10 min at 10 000 g, washed with Struhl,K. (1985) Proc. Natl. Acad. Sci. USA, 82, 8419-8423. 70% ethanol and resuspended in sterile water. After a second precipitation Thornber,J.P. (1985) Annu. Rev. Plant Physiol., 26, 127-158. with NaOAc and ethanol, the RNA was finally dissolved in water and kept Thompson,W.F., Everett,M., Polans,N.O., Jorgensen,R.A. and in aliquots at -80°C. Yields of 1 mg of RNA per gram of fresh tissue Palmer,J.D. (1983) Planta, 158, 487-500. were routinely obtained. Total plant RNA was used to carry out S1 mapping Timko,M.P., Kaush,A.P., Castresana,C., Fassler,J., Herrera-Estrella,L., analysis as previously described (Cashmore, 1984). Van den Broeck,G., van Montagu,M., Schell,J. and Cashmore,A.R. (1985) Nature, 318, 579-582. Acknowledgements Tobin,E.M. (1981) Plant Mol. Biol., 35-51. 1, Van Joos,H., Maes,M., Warren,G., van Montagu,M. and Haute,E., We thank N.Hoffman, T.Ueda, E.Pickersky and R.Donald for critical Schell,J. (1983) EMBO J., 2, 411-418. reading of this manuscript. This work was supported by grants to A.R.C. Viro,M. and Kloppstech,K. (1982) Plant, 154, 18-23. from the Department of Agriculture and the Department of Energy. C.C. Zambryski,P., Joos,H., Genetello,C., Leemans,J., van Montagu,M. and was supported by a NATO post-doctoral fellowship. Schell,J. (1983) EMBO J., 2, 2143-2150. Received on December 12, 1987; revised on April 5, 1988 References Plant An,G. 86-91. (1986) 81, Physiol., Apel,K. (1979) Eur. J. Biochem., 97, 183-188. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The EMBO Journal Springer Journals

Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

Download PDF
8 pages

Loading next page...
 
/lp/springer-journals/both-positive-and-negative-regulatory-elements-mediate-expression-of-a-crpU6RcuGo

References (1)

Publisher
Springer Journals
Copyright
Copyright © European Molecular Biology Organization 1988
ISSN
0261-4189
eISSN
1460-2075
DOI
10.1002/j.1460-2075.1988.tb03030.x
Publisher site
See Article on Publisher Site

Abstract

The EMBO Journal vol.7 no.7 1 - pp. 929 1936, Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia Carmen Castresana' 25, absorbs and the complex light resulting excitation energy Isabel Garcia-Luque1 is 2,3, Elena Alonsol 2, transferred to photosystems I and II (Glazer, 1983; Vedpal S.Malik"'4 and CAB Anthony R.Cashmore2 Thornber, 1985). are encoded proteins by a family of nuclear in all genes examined plant species (Corruzi et al., 'Laboratory of Cell Biology, The Rockefeller 1230 York University, Dunsmuir et Karlin-Neumann 1983; al., 1983; et al., 1985; Avenue, New York, NY 10021, and 2Plant Science Institute, et Leutwiler et Pichersky al., 1985; al., Castresana Department of Biology, 1986; University of Pennsylvania, Philadelphia, PA et 19104, USA are in al., 1987). They the as synthesized cytosol soluble precursors and then into the imported chloroplasts, where Present addresses: 3IATA CSIC Valencia, Spain, 4Phillips Morris are cleaved to their mature Research form and Center, Richmond, VA, they (Apel USA and 5Laboratorium voor Kloppstech, Genetica, Rijksuniversiteit Gent, and B-9000 Gent, Belgium Schmidt et 1978; Cumming Bennett, 1981; al., 1981). of Photoregulated expression CAB has been genes shown Communicated by M.van Montagu to be transcriptionally This is regulated. process mediated We have analyzed promoter via the regulatory elements from photoreceptor phytochrome as indicated by red light photoregulated CAB gene (Cab-E) isolated from induction and reversion far red by light (Apel, 1979; Nicotiana These plumbaginifolia. studies have been and Cumming 198 et Bennett, 1; Thompson al., 1983; Tobin, performed by chimeric introducing gene constructs into Viro and It has 1981; Kloppstech, 1982). been demonstrated tobacco cells via Agrobacterium tumefaciens-mediated that the elements regulatory for these responsible expres- transformation. Expression studies on the sion regenerated characteristics are localized within the 5' non-coding transgenic have plants allowed us to of characterize three region these genes. Chimeric constructs containing positive and one negative cis-acting elements that bacterial reporter genes fused to the 5'-flanking region of influence photoregulated of the expression Cab-E gene. certain CAB have genes been introduced into tobacco and Within the upstream we have sequences identified two petunia plants (Lamppa et al., 1985; Simpson et al., 1985; positive regulatory elements and (PRE1 PRE2) which et In Nagy al., 1986). this manner these constructs have been confer maximum levels of photoregulated expression. shown to confer photoregulated expression. These sequences contain multiple repeated elements The existence of cis-acting regulatory elements localized related to the sequence -ACCGGCCCACTT-. We have in distinct has been promoter regions described for light- also identified within the upstream region a negative regulated genes (Kuhlemeier et al., 1987a). Analysis of two regulatory element (NRE) extremely rich in AT different CAB isolated from genes, pea (AB 8.0) (Simpson sequences, which reduces the level of in et gene expression al., 1986) and wheat (Cab-]) (Nagy et al., 1987), has the light. We have defined a light element revealed the regulatory presence of a positive light regulatory element (LRE) within the promoter from - within the region extending 396 first 400 of the bp promoter. Within this same to -186 which bp confers photoregulated expression promoter a 'silencer' region element has been described for when fused to a constitutive nopaline synthase AB 8.0 et ('nos') (Simpson Further al., 1986). upstream sequences promoter. Within this region there is a 132-bp are to confer element, necessary maximum levels of transcription to from extending -368 to -234 bp, which on deletion the AB 8.0 pea gene (Simpson et al., 1985). However, these from the Cab-E promoter reduces gene expression from upstream sequences have not been characterized in any high levels to undetectable levels. Finally, we have in contrast to detail, the more extensive studies carried out demonstrated for a full Cab-E length promoter with the conferring promoter sequences extending from -500 to high levels of photoregulated expression, that sequences -100 from the site bp cap of these genes. proximal to the Cab-E TATA box are not We replaceable are interested in by defining the different promoter corresponding sequences from a 'nos' promoter. This elements that are involved in mediating the photoregulated contrasts with the of these apparent equivalence Cab-E ofCAB In expression genes. pursuing these interests we have and 'nos' TATA in box-proximal sequences truncated prepared for the Cab-E gene from N.plumbaginifolia promoters conferring low levels of (Castresana et a photoregulated al., 1987) series of 5'-end and internal expression. promoter deletions. Expression studies on transgenic plants words: Key chlorophyll alb binding protein genes/promoter containing chimeric constructs prepared from these deletions analysis/chimeric have allowed us to constructs/transgenic characterize multiple plants/regulatory regulatory elements elements that are in present distinct regions of the promoter. Results Introduction Construction of promoter cloning vectors CAB bind a and b and exist as To polypeptides chlorophyll a facilitate the characterization of promoter regulatory in the membranes of complex thylakoid This sequences, we have constructed two chloroplasts. plasmids designated ©IRL 1 929 Press Limited, Oxford, England C.Castresana et al. BPN R SN NP TATA box tme Nco digeston Bal 31 exonuclease digestion Hind IlIl restricton pLGVneoltO3 Blunt end with Klenow Oct Digest Digest and Religate Sma I/ Sol Smo I/ Sal Set -1554 + 36 Hind III pUC9 pUC9 Eco RI TATA Cob-E 3end promote, box Eco RI restriction Hind Il Linkers ligation Hind Il rostriction Hind III 3.e d GSd NOttr promotor fragment isolation Hind III ligation to pMHl-Nco -1554 + 36 ligt pMH/- ad pNCAT-Ned Hind liI pMHl-Neo Cab.E prorotrr NO$ pMHItNoo So lt 2. Construction of the Cab-E fusion. An Fig. promoter-CAT EcoRl/BamHI DNA 409 of the of the Cab-E fragment containing bp coding region gene 3s ofd Tiod and a to -1554 from the site of 5'-flanking fragment extending bp cap the et was subcloned in The gene (Castresana al., 1987), pUC9. resulting 1. Construction of intermediate cloning vectors. The Fig. plasmid plasmid was linearized at the internal NcoI restriction with site, digested kanaycnreitac marernt h 103 was restrictedStnyalSai. with TheKmISl retrcion the containing pLGVo1 fragment Bal31 exonuclease and then restricted with The ends were HindmH. repaired fused to the and the 3' end NPT(II) gene nopaline synthase promoter with the Klenow fragment of DNA I and then the was polymerase plasmid of the was from an and octopine synthase gene, purified agarose gel recircularized. The plasmids with the HindUI site restored were analyzed to pMH-1 and pNCATM5 restricted with SnaI/Sail ligated (previously for the extent of the 3' deletions by polyacrylamide Plasmids gel sizing. enzymes). were sequenced from the HinduI site to define the end point of the deletion. A plasmid containing a 3' deletion to position +36 from the site of cap the gene was selected, restricted with EcoRI and the ends with repaired and a 1), pMHIe-Neo pNCAT-Neo (Figure by cloning Klenow. After ligation to Hindm linkers followed by restriction with HindLH, kanamycin resistance marker into the SmoaI -Sal restriction the promoter fragment was purified from an agarose and cloned into gel sites of and et al., (Timko plasmids pMHI pNCATM5 the HindllI site of Correct orientation in unique pMHl-Neo. pMHl-Neo contains the of the bacterial was determined by PstIlEcoRI double digest. 1985). pMH1I coding region gene transferase to which we had (CAT) chloramphenicol acetyl fused several from a labeled in the NcoI site (147 bp into the coding region of previously promoter fragments pea RBCS subunit of ribulose 1 The was for 15 h at 450C to (small ,5-bisphosphate Cab-E). fragment hybridized carboxy- lase) and conferred light-regulated expression in 25 of total RNA isolated from N.plumbaginifolia and then gene jAg transformed tissue. As does not contain treated with SI nuclease. A DNA protected of plant pMH1 fragment any marker to select for transformed we isolated a 206 bp was obtained (results not shown) defining the cap plants, under control of the 'nos' promoter site at 59 bp upstream from the first ATG of the kanamycin gene coding from 103 et (nopaline synthase) pLGV1 (Simpson aL., 1985), region. Some SI-resistant of 180- 185 were products bp and cloned this into 1. also obtained. These fragment fragments are presumed to result from pMH The was constructed in a similar of the to pNCAT-Neo plasmid hybridization probe transcripts derived from the manner. It contains a truncated 'nos' other CAB in the genes present N.plumbaginifolia genome. promoter (extending to 145 5' of the mRNA fused to the These CAB genes must diverge from bp cap site) Cab-E in the region coding of the CAT can be used to test 33-38 from the ATG region gene. pNCAT-Neo bp upstream codon. whether a TATA box promoter regulatory sequences lacking can confer to a Construction of a Cab-E promoter-CAT fusion and light-regulated expression heterologous that mediated constitutive promoter normally analysis of transgenic plants expression. We prepared a chimeric construct by fusing the 5 '-flanking Cab-E Mapping region from the transcripts N.plumbaginifolia Cab-E gene to the coding SI were carried out to define protection the region of the CAT gene. experiments cap site for the derived from the Cab-E used To isolate a promoter sequence we carried out Bal31 transcripts gene in this A NcoIIDraI was 5' study. end- digestion from the coding region of Cab-E (Figure 2) and 392-bp fragment 1930 Expression of the CAB gene from N.plumbaginifolia is decreased at least 10-fold when the sequences between S CAT PRE NRE I AI PRtA T -747 to -516 are deleted, suggesting the presence in this region of a second positive regulatory element(s) (PRE2). The deletion to -516 still contains sequences with ability 1o- loo10 to direct low levels of CAT gene expression. Further dele- tions to -234, - 135 or -30, result in a complete loss of 1X575 CAT activity. detectable To assess in more detail the significance of the promoter ~~~~~~~~~~~50 50 identified, we prepared a series of promoter internal elements deletions and analyzed these by plant transformation. Figure 25-25 4C shows that, somewhat independent of the 5' end of the Cab-E promoter fragment utilized, deletion of internal sequences lying from -516 to -234 bp causes almost a -1554 -1182 -973 -747 -516 -234 -135 -30 complete loss of CAT activity (constructs 3 and 7). Even more striking, deletion of sequences located between -368 Fig. 3. 5' End deletion analysis of the Cab-E promoter. Promoter dele- and -234 bp produced a complete loss of CAT activity tions were analyzed by fusion to the coding region of the bacterial CAT 4). In contrast, when upstream sequences and subsequent analyses for CAT activity in transgenic plants. The (construct gene and the promoter strength assigned to each deletion is indicated. 5' end point from -747 to -516 bp are deleted, only a small extending represent the average CAT activity determined for 10 independent The data is observed in the level of activity conferred by reduction and are expressed as a relative percentage of the activity transformed plants, the promoter fragment extending to -973 bp (construct 2). determined for the wild-type promoter (deletion -1554 bp). The percentage We note that construct 2 confers significantly higher levels of AT sequences corresponding to the different promoter deletions are also The regulatory elements PREI, PRE2, NRE and LRE are defined of CAT activity than does construct 8. This result appears presented. in the text. to be a contradiction of our definition of sequences between -973 and -747 as comprising part of a NRE. We suggest that the resolution of this apparent inconsistency is that there a extending from -1554 to +36 bp. A selected fragment resides within the NRE, sequences that act as positive was prepared by inserting this promoter chimeric construct regulatory elements but that the effect of these sequences This was then transferred to fragment into pMH1-Neo. becomes apparent in the absence of both PREI and and introduced into tobacco cells by leaf disc only Agrobacterium 5' deletion studies (Figure 3) clearly indicate PRE2. Our transformation as described in Materials and methods. of PRE2 the overall effect of sequences examined seven independent transgenic plants that in the presence We initially and -747 is that of a NRE element. between -973 to evaluate variability in CAT activity, NPT II activity and copy number (results not shown). We observed that gene Sequence analysis of the Cab-E promoter varied between individual transgenic plants. CAT activity We previously reported the complete sequence of Cab-E in NPT II activity was not so acute, due possibly Variation including its promoter extending to -921 bp upstream from selection. We estimated that the number to the kanamycin the site of the gene (Castresana et al., 1987). We show for both and NPT II) ranged from cap of copies genes (CAT here the sequence of the complete 5'-flanking region used for individual plants. Little correlation was one to 10 extending to -1554 bp from the cap site of CAT activity and either gene copy number in this study, observed between the (Figure 5). H To accommodate the differences in CAT gene or NPT activity. To further characterize DNA sequences which might be 10 independent transformant plants activity, we have assayed responsible for regulatory characteristics of the different and we have reported the average results. for each construct regions defined, we have analyzed the base promoter of the complete 5'-flanking region studied. The composition of regulatory sequences in the 5'-flanking Distribution DNA examined is 62 % AT rich with the complete sequence of Cab-E region nucleotides being very asymmetric (Figure distribution of regulatory sequences within the Cab-E promoter To identify the two upstream regions between It is observed that a series of chimeric constructs by fusing 3). we have prepared -1182 and -747 and -516 containing PREl -1554 to 5' deletions to the CAT gene contained different promoter are the regions within the promoter which and PRE2 only 1-Neo. The deletions were obtained either by Bal3 1 in pMH of GC bases (Figure 3). or convenient restriction sites contain a high percentage exonuclease digestion, by using the promoter region extending from -747 to The nature of the deletion as well as Interestingly, within the promoter. contains the sequence CCCAC repeated six for each construct is shown in Figure 3. -516 (PRE2) the determined activity The same sequence is repeated five times in the com- times. Chimeric constructs which contain promoter fragment strand of the positive element located between either to -1554 or to -747 confer equal levels plementary extending Some of these repeated -1554 and -1182 bp (PREl). to these levels correspond of CAT activity transgenic plants; more extensive homology reaching a share a determined. The activity decreases at least sequences to the maximum of 12 nt in the sequence -ACCGGCCCACTT- maximum the located between -1554 and 5-fold when sequences 5 and Table The heptanucleotide CCGGCCC (Figure I). - deleted. Further deletions from -1182 to -973 1182 are in this is repeated a total of seven times contained sequence result in an increase of strength of and to -747 promoter in the two regulatory elements. 5-fold relative to the -1182 construct. 2.5- and respectively, elements PREI and PRE2, the In contrast to the positive results the presence of a positive regulatory These suggest is extraordinarily rich in element (NRE) upstream negative within the lying from -1554 promoter region element(s) the between -1182 and -973 AT bases with sequences -1182 and a negative regulatory element(s) in to (PREl), 83% containing (Figure 3). from -1182 to -747 Activity (NRE). the region extending 1931 C.Castresana et al. Cab-E promoter confers light-regulated expression transformed either in the or dark plants grown light (Figure To determine whether the various promoter mutants confer 4A). light-regulated expression to the CAT gene, as well as to Plants under a 14 h h growing dark light/lO photoperiod define the point of initiation of SI transcription, mapping were transferred to the dark for 4 and then days placed for analysis was performed on total RNA prepared from 24 h under continuous white No CAT mRNA light. was D L D L D L D L D L D L B D D L D DL -L0 1 2 3 4 6 7 8 9 CAT activity _ _ E 3 6 ~~~~~~~~~~~~~~~4 - n j -r-L _0 5 - 12.5 6 _ _ A 100 Fig. Analysis of light-regulated expression conferred to the CAT the gene by different Cab-E deletion promoter mutants. Panel A. S1 nuclease of 75 digestion of total RNA obtained from transformed for 4 in plants placed days the dark and then returned Ag (D) to the for 24 h A light 5' (L). end-labeled probe containing 240 of the bp CAT and coding region extending to -391 in the Cab-E bp promoter was utilized. The size of the protected fragments was estimated reference to by the of the mobility plasmid pUC18 restricted with Sau3A and end-labeled the Klenow using fragment of DNA polymerase I (first lane on the left). Panel B. SI nuclease of digestion 100 of total RNA obtained from transformed plants icg containing construct number 1. A 5' 748-bp end-labeled DNA fragment containing 565 of the of II bp coding region the NPT gene (neomycin phosphotransferase) and extending to 145 in the bp 'nos' (nopaline synthase) promoter was utilized as a probe. Panel C. of Diagram the deletion mutants. The CAT activity is as expressed described in the to 5. legend Figure -1554 CCAGGTGAACCCGTAACTAGTTTCTTGTATTCGCCTCTGCTGATAGGTGATTATAACCTCCTCAAAAGCAATTTCTACTCCATTTCACCTATAAAATAATCAGAAAACTTAAGTTATATA 1435s CATCAGTAAATAAATTTACACCATAAGATAAAAATTGCTTTCGCAACCGTTAAGGGTGGCATGTGGGCCGGGGCCGGTTCTAAGTGGGCTTTACGGGCCCCGATCCTAAGTAGGCCCAGT - 1315 CCTAAGTGGGC-CGG-TCCTAAGTGGTCCCGGGTTTCGCAGGCTTCTTGTTGTAATCGGCCTrGGATTGGGACCACG CAATACGGTCCCGGGTTAA-GGGTGGGCCG-G-TCCCGGGCCT-AAGT-G-G -119 5 -1182 GCCCAACGMATACTTTCTATTTTTTAAAATAATTTATAGAAGTTAGAGAAAAAAATGAAAATMAAMATATTTAAGGCAATTCCTTGTAAATTATATTATAGAATTGTGACCTAAATTT -107 5 -973 TTTAATTCAAATTAAAGATAAAATATTGTAAAGAGGTATTCAAAGCAATCTGTTATAIATATATATATATATATACTAAGTGTATAGTATATAAGCTATAATTATATATATCTTAAGA - 955S TGTATATATAGTATTATAGTATAGTATAGTAATCTTAACATGTATATATAGCTATAAAAGTATGGGGTTAAMCAAAGTTGGGAAAGGTTATTTTATAAATTGCCAACGGCTATTTTAG - 83 5 -747 CAGGTAAAACCGCCATATTTTAAATGCCATAACGGCTATAATGTGGCACATTTATTTTTTAAAAAbAACTAACCGTTGGGCCCGAATAGGCCTTTTTAGGACCGCTTGAACCGGCCCACTT - 715 CCCAGCCGGTCCCGGTCTCGCGGGCCTCGCCTATGGMACCGACCCACTACCCAGCCCACCTCCCCACGGTCCCGATCCTATTCGGTTAGAACCGTCTAGGCCCACCGCCCATTTGGGCTT - 59 -516 GCGGTCTTGGGCCGCACCTGAACCTAACCGGCCCACATGCCATCCTTACTAACCGTAAATAACTTAGAAGTTATTGTATACGTATGATCGAGCTGTTGGACTTGTAGTATCAMCTTTCA -475 ATGACGCATCAAAATTAATTATGGTAGCTTCGCGTTGGGACACTTGTACATGCATTAACTTGATTTCAATTTCTTTTTTAAAATATTGTCTATTGTCAATTTACCACTCGTACTTGAA - 35 5 GTGGGCCTATTGACAGGTCAGCTAAATACAGAAGTGTATGAACAATGCGTGGCCAAGAGTAACTCTTATGCTAAAGACAAGTGGATATTATATTGCATTAATCCACAATCAGACGTGGC - 23 5 -234 -135 7,AATTTGGATTGGCTATAAGAGAGCAAATCTTCATTAGGTAAGTTTTTTAAACATAAAAAGTATCTAAAAAAATCTTGTCATGTTAACGGTGCTGAACTTTGCCAAATGGACAAGAATG l - l5 -30 CAAAAGGTTAAAATTGCAATCCACCAATTGAAAMGTAGATATAGATACTCAAGGATAMGGGTCTTTGGGCCTGTAAMGCCATTTATATACACTTAGTGCAAAGCCCATGAAMCTCAACCC TCAAATCAACTCTTTCTTTTTGTGCATTCAAGAGTTATCATTTTACTCCTACA 5. Nucleotide of the Fig. of sequence Cab-E Nucleotides are 5'-flanking region numbered with gene. the site + cap 1. TATA designated and CAAT boxes are underlined. Direct and inverted in Table I are repeat sequences also underlined. represented overlined Sequences represent sequences similar to boxes II and III et (Kuhlemeier and the al., G box 5' 1987b) Giuliano et (ACGTGGCA; see text. al., end 1988); of the deletions are points promoter indicated. analyzed 1932 of the CAB Expression gene from N.plumbaginifolia detected after the 4-day dark period. However, when the of is the same in expression approximately dark-grown and plants were returned to the light, CAT mRNA was detected light-grown tissue (Figure 4B). in those plants for which we had previously detected CAT enzymatic activity (Figure 4, panel A and C). The mRNA Fusion of Cab-E promoter sequences to a constitutive increase was in proportion to the level of CAT activity 'nos' promoter previously determined. To evaluate whether the CAB promoter sequences could We observed for all the chimeric CAT constructs exam- confer to a light-regulated expression heterologous promoter ined, the same initiation point for transcription (Figure 4A). that normally mediates constitutive expression, a DNA The SI protection experiments showed the presence of an from -396 to -186 from fragment extending bp the cap SI -resistant product of -287 bp which would correspond site of Cab-E was cloned into the unique HindIfl restriction to a cap site 26 bp downstream from the TATA box, in the site of the plasmid pNCATNeo. This plasmid contains a same region identified for the wild-type Cab-E gene. truncated 'nos' promoter fused to the coding region of the In these studies we included as a control a 5' end-labeled CAT gene. We also fused to the same truncated 'nos' probe for transcripts derived from the NPTII gene. This gene promoter a large Cab-E promoter obtained fragment by is fused to the 'nos' promoter and, as expected, the level Bal3l deletion and extending from -1554 to -112 bp. This large fragment was also fused to a Cab-E truncated promoter extending from -135 to + 36 bp; this construct essentially Table I. Multiple repeated sequences present in the two upstream restores the -1554 wild-type bp Cab-E promoter with the positive regulatory elements (PREI and PRE2) addition of a small duplication of the sequence -135 to C -112 (Figure -1360 - - - - - - - - - A - 6D). -1373 -1354 - - - - - - - - C G G C -1362 Expression in transformed plants was determined by -1339 T A A A - - - - - - - - -1352 assaying for CAT activity and by SI analysis on total RNA. -1298 - - - - - - - - - - - - -1311 Figure 6D shows that no CAT activity is detected when the -1208 - - - - - - - - - - - - - 1221 CAT gene is under the control of either the 'nos' or Cab-E -1187 T T G - - - - - - - - - -1200 truncated promoters (Figure constructs and 6D, 1 4). However, activity is observed when either of the two Cab- A C C -726 G G C C C A C T T -715 E promoter sequences (-396 to and -1554 to -186 -112) -678 - - - - A--- - A -667 were fised to the truncated 'nos' 2 promoter (constructs and 3). -665 C - - A - - C -654 Transformed the to plants containing -396 -186 Cab-E -657 - - - T C---- G -646 T promoter, showed no detectable CAT mRNA -619 C A---- - C when grown G -608 -577 T -----A - G A -590 in the dark. When these plants were placed in the light, -568 - A - -557 significant levels of CAT mRNA were detected (lane 2). These results demonstrated that this Cab-E promoter A dash represents homology. fragment acts as a light regulatory element (LRE) in that A B LD L D L D L D L D L _ _ _ _ _ 4:- *-'48 _ -. _- -633 4 5 r AT activity C- N0S CAT 0 ? M- ------F4fNS csI CAT 1113 7 A B N S A' 14 4 CAT rCASB 0 CAB CABi CAT 54 6. of of chimeric constructs different fusions. Panel A. SI nuclease of Fig. Analysis light-regulated expression 100 containing promoter digestion yg of total RNA isolated from transformed constructs 2 or 3. The utilized contained 240 of the of the plants CAT containing 1, probe bp coding region total RNA isolated from and extended to -145 in the 'nos' Panel B. SI nuclease of gene, bp promoter. transformed digestion plants containing of total RNA isolated from transformed constructs 4 or 5. The utilized was the same as described in A. Panel C. SI nuclease probe digestion plants D. of the fusions The CAT construct 5. The utilized was the same as described in B. Panel containing probe Diagram promoter analyzed. activity was RNA obtained from transformed is as described in the to 5. assigned expressed legend Figure Light-regulated expression assayed using plants in of the was as described the placed for 4 days in the dark and then for 24 h in the The size determined (D), light (L). protected fragments legend to 4. Figure 1933 C.Castresana et al. to the 'nos' truncated it confers photoregulated expression have described here, is similar to the GC-rich box CCGCCC promoter. found in a number of animal viral and cellular promoters, Plants containing the larger Cab-E promoter fragment including the SV40 early promoter, where this sequence is (-1554 to 112) fused to the truncated Cab-E promoter repeated six times (Benoist and Chambon, 1981). This mRNA in the dark (lane similarly showed no detectable CAT sequence is the binding site for the Spl factor which plays were 4), in contrast to the levels found when these plants an important role in activation of transcription (Kadonaga returned to the light (lane 5). Of particular interest, plants et al., 1986). containing the same Cab-E promoter fragment fixed to the PREl is a positive regulatory element which, in our truncated 'nos' promoter, showed significant levels of CAT of we note studies, affects the expression Cab-E. However, mRNA when grown in the dark (lane 3). Equivalent level that in the genome of N.plumbaginifolia from whence these when these were of expression was maintained plants were derived, it is more likely that the primary sequences transferred to the light (lane 3). Thus, whereas the large effect of PREl is on Cab-F (Figure 2). This conclusion is confers the (-1554 to -112) Cab-E promoter fragment based simply on the fact that PREl is closer to Cab-F when fused to the expected photoregulated expression ( - 800 bp) than it is to Cab-E ( - 1400 bp). Thus it is likely truncated CAB promoter, the same fragment confers that PREl and PRE2 are and related structurally functionally constitutive expression when fused to the truncated 'nos' PREs acting on divergently oriented genes. In accordance promoter. with this suggestion, is the divergent orientation of the In these studies we also included as a control a 5' end- repeated sequence found in the two elements. labeled probe for transcripts derived from the NPT II gene Somewhat irrespective of the precise regulatory role of fused to the 'nos' 6C). promoter (Figure PREI and PRE2 in the N.plumbaginifolia genome, in the experiments that we have reported here it is quite clear that both elements affect the level of expression mediated by the Discussion Cab-E promoter. from The 5'-flanking region of the Cab-E promoter N.plum- That PREl and PRE2 contain divergently oriented baginifolia has been used to define promoter elements repeated sequences (Table I) presumed to contribute to the In responsible for photoregulated expression. these studies regulatory characteristics of these elements, is suggestive that we have defined multiple positive and negative regulatory these elements are enhancer We believe this sequences. nature of the elements that determine both the level and the is to be correct and it can be tested. possibility likely readily Cab-E However, in relation to this we note gene expression. suggestion do that at in the content of the Cab-E these least promoter, elements Positive regulatory elements exist far upstream in the not as enhancer are acting general sequences. This conclusion Cab-E promoter is based on the observation that the high level of CAT activity Within we have identified two the upstream sequences observed for the -973 truncated Cab-E promoter containing I which confer positive regulatory elements (PRE and PRE2) PRE2, is totally lost when the LRE fragment between -368 of 5' Promoter maximum levels expression. deletions which to -234 is deleted. Thus in this construct, fusion to PRE2 PREI or both PREI PRE2 eliminate either and produce a to a truncated Cab-E promoter yields an inactive promoter. reduction in gene expression of 5- and 10-fold respectively. Whether or not this dependence of the PRE2 sequences on The existence of upstream sequences that exert an increase the LRE is a characteristic of the Cab-E sequences unique in the level of expression have previously been noticed for promoter is not presently known. This can be tested by fu- a CAB from In gene pea (Simpson et al., 1985). contrast, sion of the positive regulatory elements to other truncated our results differ from those et al. recently reported by Nagy promoters. (1987) using a CAB gene from wheat. Within this gene, to -357 from the promoter sequences extending bp cap site, A element exists far in negative regulatory upstream to maximum of are sufficient confer levels photoregulated the Cab-E promoter in tobacco expression transgenic plants. We have also identified within the upstream promoter region The two elements identified here upstream positive (PRE1 a NRE between the two elements PREl and lying positive are GC-rich contain- and PRE2), relatively sequences PRE2. A 5' deletion to -1182 which extending bp elements related to the ing multiple repeated sequence eliminates a 5-fold reduction in the level PREl, produces In view of their -ACCGGCCCACTT- (Table I). pre- of while deletion of the element gene expression, negative to contribute to the dominance these are sequences likely located between -1182 and -747 bp increases exponen- regulatory characteristics of these positive elements. tially 5-fold, restoring maximum levels of expression. Somewhat related have been in sequences found other NRE in The described for Cab-E is extraordinarly rich promoters in regions known to enhance the level of gene AT AT-rich have been for sequence. sequences described expression. For instance, the embryo-specific gene encoding in yeast promoters (Struhl, 1985). However, this case the the a' subunit of 3-conglycinin from soybean plants contains which exist as were identified as sequences, poly(dA -dT), five 6-bp repeats (AGCCCA) within a 100-bp promoter positive elements necessary for constitutive expression. fragment, the presencce of which raises the level of gene Whether the regulatory characteristics of the Cab-E NRE expression at least 20-fold (Chen et al., 1986). Similarly, are largely a reflection of the high AT content is not known the 35S promoter of the CaMV (cauliflower mosaic virus) at this point. contains the sequence CCAC, and its complement GTGG, Plant NREs have been described for a CAB gene from a total of 10 within a which repeated times region confers a pea (Simpson et al., 1986) and recently for RBCS gene, maximum level of expression (Kay et al., 1987; Ow et al., also from et pea (Kuhlemeier al., 1987b). Both genes are 1987). Furthermore, the GC-rich repeated sequence that we light-regulated, but the negative elements, which are located 1934 gene from N.plumbaginifolia Expression of the CAB between -347 and -100 bp from the cap site of the genes, thought is our observation that the factor that binds to the have been characterized by their ability to silence the G box in the tomato RbcS-3A gene, apparently also binds expression of constitutive promoters either in roots (Simpson to box in the LRE fragment from the Cab-E gene, the G et al., 1986) or in leaf tissue when placed in the dark a synthetic as binding to the Cab-E fragment is competed by (Kuhlemeier et al., 1987b). The negative element that we RbcS-3A G box oligomer (U.Schindler, unpublished obser- describe here for the Cab-E promoter, reduces the level of vation). These data suggest that the G box sequences in the gene expression in leaf tissue in the light, as demonstrated two may indeed be functionally equivalent. genes by an enhancement of expression when this element is deleted. This negative element also differs from previously Sequences proximal to the Cab-E TATA box have described elements, with respect to its far-upstream location. distinct functional characteristics With the NRE, as with the PREs, we have not addressed As discussed, in order to assess whether the element -396 directly the question of whether or not these sequences can to -186 could confer light regulation to a constitutive confer photoregulated expression. However, we believe it promoter, we fused this element to a truncated 'nos' more likely that the far-upstream positive and negative promoter (extending to - 145 bp 5' of the mRNA cap site). regulatory elements simply serve to modulate levels of The fusion promoter gave rise to levels of CAT activity (7% expression. of maximum activity) in light-grown plants which was very near that found for a similarly truncated Cab-E promoter A positive element that mediates light-regulation to -516 bp gave rise to 9% (the Cab-E promoter truncated Positive light regulatory elements (LREs) have previously of maximum CAT activity). Furthermore, the fusion been characterized for light-regulated CAB and RBCS genes promoter conferred photoregulated expression. In these from pea. DNA sequences which promote photoregulated experiments, sequences within the truncated 'nos' promoter expression when fused to constitutive truncated promoters behave in a manner not significantly distinct from the have been localized within promoter regions extending from sequences within the Cab-E promoter. corresponding -400 to -100 bp from the cap site in the genes examined In striking contrast to these results, when a large Cab-E (Fluhr et al., 1986; Simpson et al., 1986; Kuhlemeier et al., promoter element (-1554 to - 112) was fused to the 1987b; Nagy et al., 1987). truncated 'nos' promoter the resulting fusion promoter Several lines of evidence indicated that a similar LRE displayed functional characteristics quite distinct from those resides within the Cab-E promoter. With the 5' deletion element was fused to a observed when the same similarly experiments, we describe a truncated Cab-E promoter 135 to + This Cab -nos truncated Cab-E promoter (- 36). extending to -516 bp which directs low levels (9% of of maximum CAT fusion promoter showed only 14% of observed for the maximum) CAT gene expression in light-grown tissue. with the 54% activity, contrasting activity Within this promoter fragment, we have defined a 132-bp Cab - Cab and with the corresponding promoter fusion, element (extending from -368 to -234 bp) which on maximum observed for the -1554 'wild- 100% activity bp deletion from the -973 bp Cab-E promoter, reduces gene Cab-E of mRNA type' promoter. Furthermore, by analysis expression from high levels to undetectable levels. Further- nos fusion was shown to this Cab- promoter promote more, when a fragment from the Cab-E promoter, extending in the dark at levels similar to that found in the expression from - 396 to -186, was fused to a truncated nos promoter, while the Cab - Cab fusion directed the light, promoter photoregulated expression was conferred. expected photoregulated expression. By comparative analysis of the 5'-flanking region from the above results we conclude that there must exist From different RBCS genes we have revealed the presence of a in the truncated Cab-E to + sequences promoter (-135 36), conserved sequence of - 100 bp located between -427 and in the truncated 'nos' that are lacking promoter, required - 178 bp from the first ATG codon. Within these promoter the levels of the to mediate high expression promoted by regions the sequence -ACGTGGCA- is highly conserved. PREs. we conclude that there are upstream Furthermore, We have also shown that both tomato and Arabidopsis plants Cab-E also sequences in the truncated promoter, again contain a nuclear factor that binds to this 'nos' which in the protein sequence in the truncated promoter, lacking are for (Giuliano et al., 1988). This same sequence -ACGTGGCA- presence of the upstream sequences required in These reflect is located within the Cab-E promoter a similar relative photoregulated expression. sequences may or elements in the position (-241 bp from the cap site) and within a region negative, unique positive, possibly we to be essential for gene expression. Cab-E have demonstrated truncated promoter. Alternatively, they might simply et al. have characterized conserved of some in the 'nos' Kuhlemeier (1987b) reflect an absence sequences promoter. 'nos' lacks in III and in the In latter context we note that the sequences present boxes I, II, 11*, H1*, pro- the promoter of similar to boxes II both a conventional TATA and CAAT box et moters pea RBCS genes. Sequences (Ebert al., note that we have and IIH are of the G box se- In the former we present immediately upstream 1987). context, a GATA which in the tobacco Cab-E in characterized commonly quence gene (Figure 5). Similarly, previously sequence between the CAAT box and TATA RBCS box 11* occurs from resides as 2-3 repeats pea genes, immediately upstream I CAB et the G us to that factors to box of PSII box, prompting suggest binding type genes (Castresana al., 1987). et This if these in these interact What role, any, sequences might play mediating sequences may (Giuliano al., 1988). of CAB is our observation that these of is high levels photoregulated expression genes suggestion strengthened by in the Cab-E unknown. are presently sequences similarly juxtaposed gene. fact that the G box and II conclusion from the with the the sequence (and An additional experiments Furthermore, that within LREs of both CAB fusion promoters is there reside sequences in the large related sequences) are present to in the smaller a fundamental in the promoter fragment (-1554 -112), lacking and RBCS genes, suggests similarity to which on fusion of of these Consistent with this regulation expression genes. Cab-E promoter fragment (-396 -186), 1935 C.Castresana et al. Apel,K. and Kloppstech,K. (1978) Eur. J. Biochem., 85, 581-588. 'nos' promoter mediate expression in the dark as well to the Benoist,C. and Chambon,P. (1981) Nature, 290, 304-310. in the light. We believe that these sequences are as probably Birnboim,H.C. and Doly,J. (1979) Nucleic Acids Res., 7, 1513-1523. same PRE1 and PRE2 sequences that mediate high levels the Cashmore,A.R. (1984) Proc. NatI. Acad. Sci. USA, 81, 2960-2964. photoregulated expression in both the full-length 'wild- of Castresana,C., Staneloni,R., Malik,V.S. and Cashmore,A.R. Plant (1987) Cab-E promoter, and the Cab - Cab fusion Mol. Biol., 10, 117-126. type' promoter. and Proc. Natl. Acad. Sci. Chen,Z.-L., Schuler,M.A. Beachy,R.N. (1986) the fact that these sequences do not mediate As discussed, 8560-8564. USA, 83, the dark on fusion to the truncated Cab-E expression in Coruzzi,G., Boglie,R., Cashmore,A.R. and Chua,N.-H. (1983) J. Biol. must reflect a significant difference between the promoter, Chem., 258, 1399-1402. two truncated promoters. Cumming,A.C. and Bennett,J. (1981) Eur. J. Biochem., 71-80. 118, Dellaporta,S.L., Wood,J. and Hicks,J.B. (1983) Plant Mol. Biol. Rep., 1, 19-21. Materials and methods Dhaese,P., De Greve,H., Decraemer,H., Schell,J. and van Montagu,M. Nucleic Acids 1837-1849. (1979) Res., 7, Construction of chimeric constructs and J. Mol. Dunsmuir,P., Smith,S.M. Bedbrook,J. (1983) Appl. Genet., constructs were prepared using standard DNA procedures described Chimeric 2, 285-300. et al. (1982). Plasmid DNA was prepared according to Birn- by Maniatis Ebert,P.R., Ha,S.B. and An,G. (1987) Proc. Natl. Acad. Sci. USA, 84, (1979). Escherichia coli JM83 and HB1I1 were used for boim and Doly 5745-5749. DNA transformation experiments. all the 'in vitro' Fluhr,R., Kuhlemeier,C., Nagy,F. and Chua,N.-H. (1986) Science, 232, sequencing 1106-1112. DNA The sequence of the Cab-E promoter was determined by the method of Glazer,A.N. Annu. Rev. 125-128. (1983) Biochem., 52, Maxam and Gilbert (1980). The structure of all chimeric constructs was and Giuliano,G., Pichersky,E., Malik,D.S., Timko,M.P., Scolnik,T.A. by partial sequencing using the same procedure. Proc. Natl. Acad. Sci. in confirmed USA, Cashmore,A.R. (1988) press. Horsch,R.B., Fry,J.E, Hoffman,N.L., Eichholtz,D., Rogers,S.D. and Ti-mediated transfer Fraley,R.T. (1985) Science, 227, 1229-1231. Intermediate cloning vectors containing different chimeric constructs were Kadonaga,J.T., Jones,K.A. and Tjian,T. (1986) Trends Biochem. Sci., 11, transferred to A.tumefaciens harboring the Ti plasmid pGV3850 (Zambryski 20-23. et al., 1983), by triparental mating (Van Haute et al., 1983). The structures Karlin-Neumann,G.A., Kohorn,B.D., Thomber,J.P. and Tobin,E.M. (1985) co-integrates in Agrobacteriwn were analyzed by the method of Dhaese of the J. Mol. Appl. Genet., 3, 45- 61. et al. (1979). Agrobacteria containing the co-integrates, were used to transfer Kay,R., Chan,A., Daly,M. and McPherson,J. (1987) Science, 32, constructs to Nicotiana tabacum SR1 cells by leaf disc the chimeric 1299-1302. et al., 1985). Transformed discs were maintained transformation-(Horsch Kuhlemeier,C., Green,P. and Chua,N.-H. (1987a) Annu. Rev. Plant in MS medium (Murashige and Skoog, 1962) containing hormones to Physiol., 37, 221-257. stimulate shoot formation (1 mg/l 6-BAP and 0.1 mg/l ca NAA) and Kuhlemeier,C., Fluhr,R., Green,P. and Chua,N.-H. (1987b) Genes Dev., kanamycin sulfate (100 to select transformants. Transformed shoots 1pg/mil) 1, 247-255. were selected after rooting in MS medium containing kanamycin sulfate Lamppa,G., Nagy,F. and Chua,N.-H. (1985) Nature, 316, 750-752. and transferred to soil. (50 Leutwiler,L.S., Meyerowitz,E.M. and Tobin,E.M. (1986) Ag/ml), Nucleic Acids Res., 14, 4051-4076. Analysis of transformed plants Maniatis,T., Fritsch,E.F. and Sambrook,J. (1982) DNA Cloning. Transformed plants growing under a 14 h light/lO h dark photoperiod were Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring analyzed between 7 and 8 h after the dark period. Leaves of - 10 cm were Harbor, NY. harvested for analysis -4 weeks after transfer of the plants to soil. Maxam,A.M. and Gilbert,W. (1980) Methods Enzymol., 65, 499-560. Neomycin phosphotransferase (NPT H) activity was measured according Murashige,T. and Skoog,F. (1962) Physiol. Plant., 15, 473-497. to Reiss et al. (1984). Chloramphenicol acetyl transferase (CAT) activity Nagy,F., Kay,S.A., Boutry,M., Hsu,M.-Y. and Chua,N.-H. (1986) EMBO was determined as described by An (1986). In both cases 50 of plant jig J., 5, 1119-1124. protein was used per assay. For Southern blot experiments (Southern, 1975), Nagy,F., Boutry,M., Hsu,M.-Y., Wong,M. and Chua,N.-H. (1987) EMBO DNA from transformed plants was isolated according to the procedure J., 6, 2537-2542. described by Dellaporta et al. (1983). Ow,D.W., Jacobs,J.D. and Howell,S.H. 1987) Proc. Natl. Acad. Sci. USA, total RNA preparations, leaves were ground to a fine powder in liquid For 84, 4870-4874. nitrogen using a pestle and mortar. Guanidinium buffer (5 M guanidinium Pichersky,E., Bernatzky,R., Tanksley,S.D., Breidenbach,R.B., Kausch, thiocyanate, 25 mM sodium citrate, 0.5% sarcosyl, 2 mM EDTA, 1 M A.P. and Cashmore,A.R. (1985) Gene, 40, 247-258. and 50 mM Tris-HCI was then added at a ratio 13-mercaptoethanol pH 7.6) Reiss,B., Sprengel,R., Will,H. and Schaller,H. (1984) Gene, 30, 211-218. of 4 ml/g of fresh tissue. The supernatant was clarified by centrifugation Schmidt,G.W., Bartlett,S.G., Grossman,A.R., Cashmore,A.R. and for 10 min at 5000 g, and extracted with an equal volume of Chua,N.-H. (1981) J. Cell Biol., 91, 468-478. phenol/chloroform. After vortexing the solution was centrifuged for 30 min Simpson,J., Timko,M.P., Cashmore,A.R., Schell,J., van Montagu,M. and at 10 000 g. The upper phase was removed and centrifuged again for 10 min Herrera-Estrella,L. (1985) EMBO J., 4, 2723 -2729. at 5000 g. The nucleic acids were precipitated by addition of 0.1 vol 3 M Simpson,J., Schell,J., van and Herrera-Estrella,L. (1986) Montagu,M. NaOAc pH 5.6 and two vols of ethanol and resuspended in sterile water. Nature, 323, 551-554. RNA was then precipitated in 2 M LiCl overnight at 4°C. The insoluble Southern,E.M. (1975) J. Mol. Biol., 98, 503-517. RNA was pelleted by centrifugation for 10 min at 10 000 g, washed with Struhl,K. (1985) Proc. Natl. Acad. Sci. USA, 82, 8419-8423. 70% ethanol and resuspended in sterile water. After a second precipitation Thornber,J.P. (1985) Annu. Rev. Plant Physiol., 26, 127-158. with NaOAc and ethanol, the RNA was finally dissolved in water and kept Thompson,W.F., Everett,M., Polans,N.O., Jorgensen,R.A. and in aliquots at -80°C. Yields of 1 mg of RNA per gram of fresh tissue Palmer,J.D. (1983) Planta, 158, 487-500. were routinely obtained. Total plant RNA was used to carry out S1 mapping Timko,M.P., Kaush,A.P., Castresana,C., Fassler,J., Herrera-Estrella,L., analysis as previously described (Cashmore, 1984). Van den Broeck,G., van Montagu,M., Schell,J. and Cashmore,A.R. (1985) Nature, 318, 579-582. Acknowledgements Tobin,E.M. (1981) Plant Mol. Biol., 35-51. 1, Van Joos,H., Maes,M., Warren,G., van Montagu,M. and Haute,E., We thank N.Hoffman, T.Ueda, E.Pickersky and R.Donald for critical Schell,J. (1983) EMBO J., 2, 411-418. reading of this manuscript. This work was supported by grants to A.R.C. Viro,M. and Kloppstech,K. (1982) Plant, 154, 18-23. from the Department of Agriculture and the Department of Energy. C.C. Zambryski,P., Joos,H., Genetello,C., Leemans,J., van Montagu,M. and was supported by a NATO post-doctoral fellowship. Schell,J. (1983) EMBO J., 2, 2143-2150. Received on December 12, 1987; revised on April 5, 1988 References Plant An,G. 86-91. (1986) 81, Physiol., Apel,K. (1979) Eur. J. Biochem., 97, 183-188.

Journal

The EMBO Journal – Springer Journals

Published: Jul 1, 1988

There are no references for this article.