Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

TH2 Cytokines and Allergic Challenge Induce Ym1 Expression in Macrophages by a STAT6-dependent Mechanism

TH2 Cytokines and Allergic Challenge Induce Ym1 Expression in Macrophages by a STAT6-dependent... THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 277, No. 45, Issue of November 8, pp. 42821–42829, 2002 © 2002 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. 2 Cytokines and Allergic Challenge Induce Ym1 Expression in Macrophages by a STAT6-dependent Mechanism* Received for publication, June 12, 2002, and in revised form, July 31, 2002 Published, JBC Papers in Press, September 4, 2002, DOI 10.1074/jbc.M205873200 John S. Welch‡§¶, Laure Escoubet-Lozach‡, David B. Sykes§, Kate Liddiard**, David R. Greaves‡‡, and Christopher K. Glass‡§§¶¶ From the Departments of ‡Cellular and Molecular Medicine and §§Medicine and the §Medical Scientist Training Program, La Jolla, California 92093-0651 and the Sir William Dunn School of Pathology, University of Oxford, South Parks Road, OX1 3RE Oxford, United Kingdom The diverse functions of macrophages as participants engage processes of the acquired immune response such as in innate and acquired immune responses are regulated antibody-dependent opsonization and subsequent antigen by the specific milieu of environmental factors, cyto- presentation to T-cells (1, 2). kines, and other signaling molecules that are encoun- Macrophage function can be influenced profoundly by cyto- tered at sites of inflammation. Microarray analysis of kines released from T-cells and other immune cells. These the transcriptional response of mouse peritoneal macro- cytokines have been divided largely along two axes: T 1 cyto- phages to the T 2 cytokine interleukin-4 (IL-4) identi- kines, dominated by INF- and T 2 cytokines, dominated by fied Ym1 and arginase as the most highly up-regulated IL-4 (3). Macrophage stimulation by T 1 cytokines results in genes, exhibiting more than 68- and 88-fold induction, free-radical release and increased cytokine secretion, impli- respectively. Molecular characterization of the Ym1 pro- cated as essential signaling components of a successful re- moter in transfected epithelial and macrophage cell sponse to infection by intracellular bacteria and viruses (4 – 6). lines revealed the presence of multiple signal transduc- In contrast, efficient defense against extracellular pathogens ers and activators of transcription 6 (STAT6) response and parasites requires a different response, characterized by elements that function in a combinatorial manner to the release of T 2 cytokines (7). These mediate B-cell class mediate transcriptional responses to IL-4. The partici- switching to IgE antibodies, macrophage opsonization of solu- pation of STAT6 as an obligate component of protein ble antigens, and activation of mast cells, basophils, and eosin- complexes binding to these sites was established by ophils. These two cytokine axes have been proposed to be analysis of nuclear extracts derived from STAT6-defi- mutually antagonistic, both in the commitment of T-cells to- cient macrophages. Macrophage expression of Ym1 was ward a T 1orT 2 lineage and in their influence on effector highly induced in vivo by an IL-4- and STAT6-dependent H H cells such as the macrophage. mechanism during the evolution of allergic peritonitis, In parallel with the separation of T-cells into either T 1- or supporting the biological relevance of the IL-4-depend- ent pathway characterized ex vivo in peritoneal mac- T 2-biased cells, a number of groups have proposed recently rophages. These studies establish Ym1 as a highly in- that the exposure of macrophages to a specific set of cytokines ducible STAT6-dependent transcript in T 2-biased H also biases them toward either an M-1 phenotype (activated inflammation and define Cis-active elements in the Ym1 macrophages) or an M-2 phenotype (alternatively activated promoter that are required for this transcriptional macrophages) (8 –10). Macrophage exposure to IL-4 substan- response. tially blunts subsequent LPS- or INF-stimulated production of cytokines (IL-6, IL-8, IL-12, and tumor necrosis factor-), receptors (CD14, FcI, FcII, and FcIII), and superoxide rad- The macrophage plays an important role bridging between icals (11–14). At the same time, macrophage exposure to IL-4 innate and acquired immune function. It is capable both of results in the increased expression of scavenger receptors (the responding to nonspecific stimuli, such as bacterial lipopolysac- mannose receptor, the scavenger receptor type I, and CD163), carides (LPS) and activated complement factors, but can also CD13 (the aminopeptidase, capable of inactivating inflamma- tory mediators), and CD23 (FcRII), thus blunting the cytotoxic effects of the macrophage and shifting its opsonizing focus from * This work was supported in part by Grant HL59694 from the IgG antibodies to IgE while increasing its phagocytic capabili- NHLBI, National Institutes of Health and by the Stanford-Reynolds Foundation. The costs of publication of this article were defrayed in part ties (9, 15). by the payment of page charges. This article must therefore be hereby Allergic challenge of BALB/c mice with ovalbumin following marked “advertisement” in accordance with 18 U.S.C. Section 1734 sensitization has been shown to result in the recruitment of solely to indicate this fact. macrophages into an environment enriched in IL-4 and IL-5 The nucleotide sequence(s) reported in this paper has been submitted TM (16 –18). This allergic response provides a useful model of to the GenBank /EBI Data Bank with accession number(s) AF533510. ¶ Recipient of a pre-doctoral fellowship from the American Heart macrophages activated alternatively because of the relative Association. abundance of macrophages, the cytokine milieu they are re- ** Recipient of a Wellcome Trust studentship. cruited into, and their high expression of arginase I, a marker ‡‡ British Heart Foundation Basic Science Lecturer. of macrophages activated alternatively (19). In addition, this ¶¶ To whom correspondence should be addressed. Tel.: 858-534-6011; Fax: 858-822-2127; E-mail: [email protected]. model of allergic response has been used to characterize gen- The abbreviations used are: LPS, lipopolysaccarides; IL, interleu- eral allergic phenomenon as they may apply to human patho- kin; INF, interferon; STAT, signal transducers and activators of tran- physiology of allergy and asthma. scription; RT, reverse transcriptase; TK, thymidine kinase; EMSA, INF- and LPS induce large and profound transcriptional electrophoretic mobility shift assay; PBS, phosphate-buffered saline; BAL, bronchial alveolar lavage. changes in the macrophage (13, 20, 21). In contrast, relatively This paper is available on line at http://www.jbc.org 42821 This is an Open Access article under the CC BY license. 42822 STAT6-dependent Expression of Ym1 in Macrophages Primer Extension—Protocol followed that of Ausubel (24) with the few genes have been characterized as direct targets of IL-4 substitution of Superscript (Invitrogen) for avian myeloblastosis virus stimulation. The development of large scale expression arrays reverse transcriptase. In brief, 10 g of total RNA from control and allows near global glimpses of changes in gene expression pro- IL-4-treated ECoM-M macrophages were hybridized at 65 °C for 90 min files during cell proliferation, division, and in response to en- to end-labeled primers GGAAGATCCCAGCTGTACGTTCAGAAG or vironmental signals. We applied this technology to probe the GCACATCAGCTGGTAGGAAGATCCCAG. Reverse transcription was transcriptional response of murine macrophages to the quint- performed for1hat42 °C with Superscript in the appropriate buffer. RNA was degraded with RNaseH (Invitrogen), and cDNA was isolated essential T 2 cytokine, IL-4. Ym1 was one of the most highly by phenol-chloroform extraction, separated on a 9% acrylamide/7 M induced IL-4 target genes, exhibiting a level of induction of urea sequencing gel, and visualized by autoradiography. 70-fold or greater in multiple macrophage populations. Studies EMSA—Nuclear extracts were generated following Nonidet P-40 cell of the Ym1 promoter suggest that the binding of STAT6 to lysis as described previously (25). Nuclear extracts (5 g) were incu- multiple sites within a 600-bp region up-stream of the tran- bated for 10 min on ice with bovine serum albumin (2 g), poly(dI-dC) scriptional start site is required for the IL-4 response in (2 g) in 10 mM Hepes, pH 8, 2.5 mM EDTA, pH 8, 0.5 mM sodium orthovanadate, 1 mM dithiothreitol, and 10% glycerol followed by 30 BEAS-2B cells and RAW macrophages. Ym1 was also highly min on ice with appropriate end-labeled, annealed oligonucleotides as induced in macrophages recruited to the peritoneal cavity during follows: A, GATCCGGCAAGTTCTTTGGAACTCTTA and GATCTAAG- allergic peritonitis in an IL-4- and STAT6-dependent manner. AGTTCCAAAGAACTTGCCG; B, GATCTACTTCTTTCTGAAGAATG- Collectively, these findings establish molecular mechanisms un- GTGTG and GATCCACACCATTCTTCAGAAAGAAGTA; C, GATCCA- derlying the transcriptional response of the most highly induced ATGTCTTCCATGGAATCAA and GATCTTGATTCCATGGAAGACAT- IL-4 target gene identified to date in macrophages. TG; D, GATCCTATGTTTCTAAGAAGTGGGTA and GATCTACCCAC- TTCTTAGAAACATAG. Samples were separated in a gel consisting of MATERIALS AND METHODS 5% polyacrylamide, 0.5 TBE, and 5% glycerol at 4 °C, 300 V. Gel was Cell Culture—Thioglycollate-elicited macrophages were isolated by pre-run for1hat4 °C, 300 V. peritoneal lavage 3 days following peritoneal injection of 2.5 ml of 3% Promoter Studies—Promoter fragments were amplified from the thioglycollate (Difco). Cells were plated in 10% RPMI and washed after genomic clone 5b (26) using Pfx (Stratagene), cloned into TOPOII-Blunt 5 h. Bone marrow-derived macrophages were generated by culturing (Invitrogen) and transferred to the BNXH luciferase or minimal TK- total bone marrow in macrophage colony stimulating factor provided by luciferase reporter (27) by BamHI/HindIII digestion and subsequent 30% L-cell-conditioned media for 7 days in RPMI  10% fetal bovine ligation. Promoter constructs used in deletional studies were amplified serum (22). ECoM-M monocytic leukemia cells were cultured as de- from genomic clone 5A, a generous gift from Robert B. Kirkpatrick scribed previously (23). RAW 267.4 macrophages and BAES-2B bovine (GlaxoSmithKline) (26), using the following primers: CTTAGGATCCC- airway epithelial cells were grown in 10% fetal bovine serum and RPMI AATATCCATGA TTAAGGATCCAGTGTCCAAGAC, ATGTGGATCCG- (Invitrogen). ATTTGTCTAGG, ATAGGGATCCTGACTGAACTGG, TCGCCCTAAG- Expression Array Profiling—Total RNA was purified with Trizol CTTCAGGATTGC, CACCAGATCTGTCAAGATAGC, CCTAGACAGA- (Invitrogen) and RNeasy columns (Qiagen). cRNA was generated from TCTTATTCACATAG, GGGCAGATCTCTGGACATTG, GCTTGGATC- 10 g of total RNA using Superscript (Invitrogen) and the high yield CAGGCAAGTTC. Oligonucleotides described for EMSA analysis of the RNA transcription labeling kit (Enzo). Fragmented cRNA was hybrid- C site were used to generate the multimerized C reporter. BEAS-2B ized to Affymetrix arrays according to manufacturer’s instruction. cells were transfected with LipofectAMINE (Invitrogen) and treated Data was analyzed with Microarray Suite (Affymetrix) and Gene- overnight with human IL-4 (10 ng/ml) (Endogen). Extracts were har- spring (Silicongenetics). vested and assayed as described previously (27). The expression vector Northern Blot Analysis—RNA analysis by Northern blotting followed for human STAT6 was a generous gift of William LaRochelle (NCI, the procedure of Ausubel (24). 5–10 g of total RNA were separated by National Institutes of Health) (28, 29). RAW 264.7 cells were trans- gel electrophoresis and transferred to nitrocellulose (Supercharge; fected with 5 g of Ym-1/luciferase promoter construct DNA and 3 gof Schleicher & Schuell). Prior to hybridization, membranes were UV a murine STAT6 expression vector (gift of Yoshihiro Ohmori). 1 gof cross-linked (Stratagene) and stained with methylene blue (MRC). -galactosidase expression vector was also co-transfected as a control Probes were generated by RT-PCR using the following primers followed for transfection efficiency. Ten million cells were electroporated in by random priming labeling (Invitrogen) and hybridization with Quick- 0.4-cm electrode gap cuvettes using a Bio-Rad Gene Pulser II and Hyb (Stratagene): Arginase I, GAAACAGAGTATGACGTGAGAG, pulsing at 280 V, 1070 microfarad. Immediately after pulsing, cells AGGTGGTTTAAGGTAGTCAGTC; Ifi30, TTCTGCTTCTGCTGTTCC- were recovered into pre-warmed RPMI supplemented with 20% fetal CACT and ACTCCATGATACTCTCTGTGAC; Hspa5, GTGAGGTAGA- calf serum, antibiotics, and L-glutamine. The medium was replaced 1 h AAAGGCTAAGAG and GAAGAAACTCTTTCCCAGTTGC; tissue later with standard 10% fetal calf serum RPMI in the presence or inhibitor of metalloproteinase, ATCTGGCATCCTCTTGTTGCTA and absence of 20 ng/ml recombinant murine IL-4, and cells were harvested GATCTCCAAGTGCACAAGCCTA; Ym1, CTGTGTACTCACCTGATC- 16 h later for analysis of luciferase activity. Luciferase activity was TATG and GAAAGAACCACTGAAGTCATCC; Scya9, TTCTGCTTCTG- normalized to control transfected -galactosidase enzyme activity. CTGTTCCCACT and ACTCCATGATACTCTCTGTGAC. Ovalbumin Sensitization and Allergic Challenge—Mice were sensi- Western Blot Analysis—Macrophages were washed with ice-cold tized with subcutaneous injections of 100 g of ovalbumin (Sigma) phosphate-buffered saline, and the cell pellet was resuspended in RIPA absorbed in 0.1 ml of aluminum hydroxide (Inject Alum; Pierce) and 0.1 lysis buffer (50 mM Tris, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% ml of PBS on days 1 and 7. Efficiency of sensitization was assessed by sodium dodecyl sulfate, 1% Triton X-100, 1 mM EGTA, protease inhib- blood IgE levels and by splenocyte IL-4 production following in vitro itors (Roche Molecular Biochemicals)) and incubated for 10 min at 4 °C. ovalbumin challenge. On day 14, mice were challenged with intraperi- Cell debris were spun down for 10 min at 14,000  g, and supernatants toneal injection of 10 g of ovalbumin in 0.2 ml of PBS. Cells were were collected. The total protein content was quantified, and 50 g of total harvested at indicated time points. IL-4 (11B.11) (NCI, National In- protein was separated on a 10% NuPAGE Bis-Tris gel (Invitrogen) and stitutes of Health) was injected 1 h prior to and 4 h after ovalbumin transferred onto a nitrocellulose membrane. The membrane was probed challenge. BALB/c, C57Bl/6, STAT6 knock-out, and WBB6F1/J mice with an anti-Ym1 antibody (1:500) kindly provided by Shioko Kimura were purchased from Harlan and Jackson Laboratories. (NCI, National Institutes of Health). Immune complexes were revealed by Adoptive Transfer—Splenocytes were isolated, and B-cells, macro- a peroxidase-conjugated anti-rabbit IgG and visualized by chemilumines- phages, monocytes, and dendritic cells were depleted by magnetic cell cence (Pierce). sorting using major histocompatibility complex II (Ia) microbeads RT-PCR—cDNA was generated from 1 g of total RNA using Super- (Miltenyi Biotec) according to the manufacturer’s instructions. 10  10 script (Invitrogen) and amplified with the following primers: Ym1, cells were washed with PBS, resuspended in 500 l of PBS, and injected CTGGAATTGGTGCCCCTACA and CAAGCATGGTGGTTTTACAGGA intravenously into naı ¨ve mice. 24 h after adoptive transfer, mice were or Ym2, CAGAACCGTCAGACATTCATTA and ATGGTCCTTCCAG- challenged as described above. TAGGTAATA. PCR was performed for 25 cycles with Mastermix Taq (Qiagen) at an annealing temperature of 58 °C and visualized by gel RESULTS electrophoresis. BstYI digestion was performed on cDNA amplified with Expression Profiling of Macrophage IL-4 Stimulation—To primers redundant for Ym1 and Ym2: CCTACCAGCTGATGTGC- assess genome-wide effects of IL-4 on macrophage physiology, TACTA and GAAAGAACCACTGAAGTCATCC using Pfu (Stratagene) and for 35 cycles with an annealing temperature of 58 °C. we characterized the transcriptional response of thioglycollate- STAT6-dependent Expression of Ym1 in Macrophages 42823 largely of T-cells and B-cells, with a smaller population of monocytes, displayed a blunted response, suggesting that the response to direct stimulation with IL-4 may be largely mono- cyte-/macrophage-specific (data not shown). We examined the responsiveness of Ym1/2 expression to a large panel of cytokines and macrophage stimuli. In addition to IL-4, IL-13 was capable of strongly inducing Ym1/2 RNA and protein expression and did so nearly equally (Fig. 2, C and D). Both of these cytokines bind to the -common chain of the IL-4 receptor resulting in STAT6 activation (33). In contrast, IL-5, IL-6, IL-7, IL-10, IL-15, granulocyte macrophage colony stim- ulating factor, macrophage colony stimulating factor, granulo- cyte macrophage colony stimulating factor, INF-, tumor ne- crosis factor-, 13-hydroxyoctadecadienoic acid, 15-deoxy- 12,14 PGJ , and LPS failed to induce Ym1/2 expression (Fig. 2D) (data not shown). Thus, Ym1/2 induction appeared, as arginase I, to be a restricted response to T 2-biased cytokines. FIG.1. Expression array profiling of the response of thiogly- colate-elicited macrophages to IL-4. A, scatter plot of cRNA gener- Because arginase I was described to be induced synergistically ated from control TG-M and TG-M treated with IL-4 (10 ng/ml) for by IL-4 and IL-10 in bone marrow-differentiated macrophages 24 h and hybridized to Affymetrix Mu11kA and B arrays. B, Northern and dendritic cells (19), we tested the effect of the combination blot analysis of the expression of selected genes induced by IL-4 in the of these cytokines on Ym1 expression in TG-M. Although microarray experiment. IL-4-induced Ym1 RNA expression seemed to be increased slightly further by IL-10 (Fig. 2F), no synergy between these elicited macrophages (TG-M) to IL-4 treatment using Af- two cytokines was observed at the protein level (Fig. 2E). fymetrix Mu11kA and Mu11kB microarrays. Together these Ym1 is related closely to Ym2, another member of the murine arrays contain a total of 13179 targets, of which 4215 (32%) chitinase family (26). Ym2 shares 95% RNA sequence identity were scored as being present in at least one of the two treat- with Ym1 (34). Using RT-PCR and primers specific for Ym1 or ment groups (Fig. 1A). Arginase I, mannose receptor, and Ym2, we identified the IL-4-induced macrophage transcript as TIMP-2, which have been demonstrated previously to be regu- Ym1 (Fig. 2G). In addition, Ym1 and Ym2 can be distinguished lated by IL-4 (30, 31), were induced and served as positive based on three restriction sites: ScaI, BglII, and BstYI. ScaI controls (data not shown). In addition, several additional genes specifically digests Ym1, BglII specifically digests Ym2, and Bs- were induced, including the glucose-regulated heat shock pro- TM tYI digests Ym1 in two fragments of nearly equal size and Ym2 in tein Hspa5 (GenBank accession number AA086684, Unigene accession number Mm.918), the tissue inhibitor of metallopro- three fragments. We amplified a 1054-bp product with primers common to Ym1 and Ym2 from the same RT reactions and found teinase TIMP-1 (NM_011593, Mm.8245), the cytokine Scya9 or MIP-1 (U19482, Mm.2271), and the interferon--inducible ly- that digestion with BstYI yielded a single band of 520 bp (Fig. sosomal thiol reductase Ifi30 (AA106931, Mm.30241) (Fig. 1B). 2H). BglII digestion did not alter the size of the fragment, and A more complete description of the global transcriptional re- ScaI digestion yielded two fragments, one 880 bp, and the other sponse of macrophages to IL-4 will be presented elsewhere. 270 bp (data not shown). This digestion pattern further confirms Two genes were up-regulated dramatically in both the array that the IL-4-induced macrophage transcript was Ym1. experiment and subsequent confirmation, arginase I (U51805, Characterization of Ym1 Promoter—To characterize the pro- Mm.154144) and Ym1 (M94584, Mm.4571) (Fig. 1). The up- moter and enhancer structure of Ym1, we identified a trace regulation of arginase I in response to IL-4 has been described sequence (krv64h11.b1) from the mouse genome project con- previously and suggested to be an important marker of macro- taining the first exon of Ym1 (26) (Fig. 3A). Using primers phage bias toward an M-2 phenotype (19), where it competes specific for exon 1 and exon 3, we confirmed that this promoter with the inducible nitric-oxide synthase for a common sub- sequence was located immediately up-stream of exon 1 and 3.4 strate (32). In contrast, relatively little is known about the kb up-stream of exon 3 in both the Lambda FIXII clone 5A (26) transcriptional regulation of Ym1, a member of the chitinase and in the Celera database (mCG10749) (data not shown). This family that is sufficiently similar to Ym2 at the nucleotide is important, because exons 1–3 of Ym2 differ from exons 1–3of sequence level to make it difficult to differentiate the two by Ym1 only by nine nucleotides, but intron 1 of Ym2 (mCG63439) microarray and Northern blot techniques. is 4.3 kb, allowing one to distinguish between promoters of Ym1 Macrophage Regulation of Ym1/2 by IL-4 —Ym1/2 expression and Ym2 by their position relative to exon 3. Using primer is up-regulated in response to IL-4 stimulation in multiple extension analysis, we identified the mRNA start site and populations of murine macrophages including bone marrow- found it to be 20 nucleotides up-stream of the ATG located in derived macrophages (BM-M), TG-M, and the immortalized exon 1 (Fig. 3) (data not shown). The trace krv64h11.b1 and monocytic cell line ECoM-M (23) (Fig. 2, A and B) (data not clone 5A sequence matched the information in the Celera da- shown). Induction of Ym1/2 in primary macrophages was found tabase, with the exception of the deletion of a single T, 29 to be STAT6-dependent as Ym1/2 expression did not respond to nucleotides up-stream of the mRNA start site. IL-4 in TG-M derived from STAT6-deficient mice (Fig. 2B). In Previous work has characterized the canonical binding site contrast, three separate clones of the macrophage cell line for STAT proteins as the sequence TTCNXGAA (35). STAT6 RAW 264.7 failed to up-regulate Ym1/2, suggesting a lack of an homodimers generally prefer binding to sites containing a four- essential signaling component in these cells (data not shown). nucleotide spacer (N ), whereas STAT1 homodimers generally Although multiple populations of primary murine macro- prefer a three nucleotide spacer (N ) (Fig. 3C). We identified phages robustly up-regulate Ym1/2 expression in response to four such sites in the 600 nucleotides up-stream of the tran- IL-4 stimulation, the mixed splenocyte population, consisting scriptional start site and only one in the next 9400 nucleotides up-stream. Two of these (A and C) are canonical N sites, Welch et al., manuscript in preparation. whereas the most immediate site up-stream of the start site, D, 42824 STAT6-dependent Expression of Ym1 in Macrophages FIG.2. IL-4 and IL-13 induction of M Ym1 expression. Northern blot analysis of Ym1/2 expression in BM-M (A) and TG-M (B) derived from BALB/c- and STAT6-deficient mice. M were treated as indicated or for 24 h with IL-4 (10 ng/ml). C, D, and F, Northern blot analysis of TG-M treated for 24 h as indicated. # indicates unstripped arginase I probe. E, Western blot analysis of Ym1 expression in TG-M from BalB/c mice. M were treated for 24 h with IL-4 (10 ng/ml), IL-13 (10 ng/ml), and IL-10 (10 ng/ml). G, RT-PCR of samples in D. Lanes 1 and 2, Fig. 5A, lanes 2, 3, and 8 ampli- fied with gene-specific primers. H, BstY1 digestion of PCR product generated with primers degenerate for Ym1 and Ym2. cDNA was generated from total RNA samples represented in A, lane 3; D, lane 2; Fig. 5A, lanes 3 and 8. is an N site (Fig. 3C). The B site contains two overlapping of cotransfected STAT6 (data not shown). Constructs lacking sites, one an N and the other an N . the A site were no longer responsive to IL-4 stimulation (D1, 5 4 The A, C, and D sites all bound IL-4-inducible complexes 630 to 27; D2, 550 to 27; D3, 326 to 27; D4, 176 to with similar mobility when incubated with nuclear extracts 27) (Fig. 4C). Although the B and C sites were not sufficient prepared from BM-M as assessed by EMSA analysis, with for responses to IL-4 in the context of the YM1 proximal pro- strongest binding to the A site (Fig. 4A). These complexes were moter, the multimerized C site (3xC-TK) was as responsive to absent in BM-M from STAT6-deficient mice, indicating that IL-4 as the multimerized STAT6 site from the human 12/15- they contain STAT6 and require its presence for DNA binding. lipoxygenase promoter (4xSTAT6-TK) (36) (Fig. 4C).A3-dele- In contrast, nuclear extracts from the ECoM-M cell line in- tion series of the YM1 promoter was tested for the ability to duced IL-4-dependent shifts on the A and C probes but bound enhance the activity of the TK promoter in an IL-4-dependent a complex with different mobility on the D probe that was lost manner. All constructs transferred modest IL-4 induction, with after IL-4 activation (Fig. 4B). We were unable to identify this deletion of the D site resulting in increased basal activity. complex by supershift analysis with antibodies against We next evaluated IL-4 induction of the Ym1 promoter in STAT1, STAT2, STAT5a, and STAT5b. Unlike the A and C RAW 264.7 cells. These studies revealed a very similar profiled sites, the D site is an N site. This differential binding of of activity for the 5deletion series, with removal of the A site complexes in different cell types, one induced and one lost abolishing IL-4 responsiveness (Fig. 4D). The D2, D3, and D4 during IL-4 stimulation, suggests that the D site may be an deletions were also not inducible by IL-4 (data not shown). In important negative regulator or modulator of basal Ym1 ex- contrast to the findings in BEAS-2B cells, the presence of the D pression in some cell types. The B site was not retarded in the site did not appear to have an inhibitory effect on basal expres- presence of nuclear extracts from cells under either condition, sion or IL-4 induction in RAW macrophages, and the responses of all of the 3-deletions to IL-4 induction were more robust suggesting that the overlapping sequences prevent binding of STAT6 to this site (data not shown). (Fig. 4D). The lung epithelial cell line BEAS-2B was chosen initially for Using the Celera database we compared the promoter se- analysis of the Ym1 promoter because of its responsiveness to quences of Ym1 and Ym2. Despite the fact that Ym1 and Ym2 IL-4 upon expression of STAT6 (36). The Ym1 promoter (664 expression show distinct and largely non-overlapping patterns to 27) was induced consistently 10-fold by IL-4 treatment of basal expression (26), the first 1200 nucleotides located up- when these cells were co-transfected with a STAT6 expression stream of exon 1 are 92% identical to the sequence up-stream of vector (Fig. 4C). IL-4 induction was not observed in the absence Ym2 exon 1, with preservation of the STAT binding sites (Fig. STAT6-dependent Expression of Ym1 in Macrophages 42825 FIG.3. Ym1 sequence up-stream of exon 1. A, promoter sequence of Ym1. Boxes indicate canonical STAT binding sites and translational start site. Under- lined sequences indicate exon 1 and dif- ferences between the trace sequence krv64h11.b1 and the Celera database (mCG10749). B, regions of genomic se- quence identity shared between Ym1 and Ym2. C, differences in STAT binding site sequences in Ym1 and Ym2 promoter el- ements. ND, not determined. 3B). The A and D sites were identical in the Ym1 and Ym2 shown). This peritoneal response appears specific to the type of promoter, the C site had two nucleotide changes in the N induced inflammation. Unlike the allergic peritonitis, thiogly- region (Ym1, TTCCATGGAA; Ym2, TTCCACAGAA), and the collate-induced peritonitis results in minimal Ym1 expression B site N remained intact with a G 3 T alteration potentially (see Fig. 1B and Fig. 2B). By RT-PCR and subsequent digestion abrogating the effect of the overlapping N site (Ym1, TTCTT- with BstYI, ScaI, and BglII we also excluded up-regulation of TCTGAAGAA; Ym2, TTCTTTCTTAAGAA) (Fig. 3C). Ym2 in this model (Fig. 2, G and H). The epitopes in ovalbumin Not only are the sequences up-stream of exon 1 conserved, required for induction of Ym1 appear to be conserved so suffi- but the first 1700 nucleotides down-stream of exon 1 are also ciently in bovine serum albumin that challenge with bovine 93% identical. Although STAT binding sites were common in serum albumin, but not lysozyme, also induced Ym1 expression the up-stream sequences, the conserved sequence down-stream (Fig 5, A and B). Using adhesion selection of peritoneal cells of exon 1 contained only two sites. An unshared insertion of 500 recovered 24 h after ova challenge, we found that the macro- nucleotides (Ym1) or 2000 nucleotides (Ym2) followed the re- phage population was responsible for nearly all of the resulting gion of downstream homology. Then, 500 nucleotides up- peritoneal expression of Ym1 (Fig. 5B). stream of exon 2, homology resumed and continued through the Previous studies have characterized Ym1 as an eosinophil end of exon 3 (Fig. 3B). This high degree of genomic similarity chemokine (37). We were unable to observe expression of other suggests that Ym1 and Ym2 were generated by a recent gene eosinophil chemokines transcripts, chemokine C-C motif ligand duplication event. 5 (Ccl5) and Eotaxin, under identical conditions (data not Allergic Expression of Ym1—To investigate the role of the shown). The high level of Ym1 expression and lack of Ccl5 and IL-4-STAT6 pathway in regulation of Ym1 expression in vivo, Eotaxin transcripts suggests a potential role of Ym1 in this we examined the possibility that Ym1 might be expressed in a eosinophil recruitment. model of murine allergic peritonitis where the release of both Ym1 was characterized recently as a highly expressed neu- IL-4 and IL-5 precedes a peritoneal eosinophilia (16 –18). We trophil protein (38). We also observed Ym1 expression in bone found that T 2-biased BALB/c mice sensitized subcutaneously marrow cells and that this expression decreased over a period with ovalbumin in aluminum hydroxide followed by an ovalbu- of 7 days as the granulocytic cells died out, and the population min challenge (ova) dramatically up-regulated their peritoneal matured into macrophages (data not shown). It is likely that expression of Ym1 transcripts in comparison to mice not sen- the high expression of Ym1 observed 6 h after challenge (Fig. sitized but challenged similarly (Fig. 5A). T 1-biased C57Bl/6 5A) is the result of an early recruited neutrophil population. mice, which mount less robust responses to allergic challenge, However, Ym1 expression remained high in peritoneal cells 24 induced Ym1 expression much less profoundly (data not and 48 h following challenge (Fig. 5A) (data not shown). By 42826 STAT6-dependent Expression of Ym1 in Macrophages FIG.4. STAT6 binding to Ym1 up- stream elements. A, EMSA of nuclear extracts from BM-M derived from BALB/c- and STAT6-deficient mice treated for 24 h with IL-4 (10 ng/ml). Probes A-D correspond to sequences de- scribed in the legend to Fig. 3. B, EMSA of nuclear extracts from differentiated ECoM-M cells treated for 24 h with IL-4 (10 ng/ml). Only the upper half of the gel exhibiting protein-DNA complexes is il- lustrated. C, promoter analysis of Ym1 up-stream elements in BEAS-2B cells. Cells were transfected with the indicated reporter constructs and STAT6-pcDNA3 expression vector (28, 29), treated for 24 h with human IL-4 (10 ng/ml) as indicated prior to analysis of luciferase activity. D, promoter analysis of Ym1 upstream ele- ments in RAW 264.7 macrophages. Cells were transfected with the indicated pro- moter constructs and a STAT6 expression vector and treated for 16 h with murine IL-4 (20 ng/ml) prior to analysis of lucif- erase activity. Induction of the 3xC-TK construct (35-fold) was approximately twice that observed for the 4xSTAT6-TK promoter (16-fold) in this experiment (data not shown). then, the population of peritoneal neutrophils has been re- sensitization with anti-2,4-dinitrophenol IgE followed by 2,4- placed nearly completely by macrophages (16, 39, 40). This dinitrophenol-bovine serum albumin challenge altered perito- pattern of prolonged cellular expression following ova chal- neal cell Ym1 expression (data not shown). More importantly, lenge, in addition to the adhesion selection, supports a role of mast cell-deficient mice responded with Ym1 expression in- macrophage-expressed Ym1 in the allergic response to ova crease similar to wild type mice (Fig. 6B). Adoptive transfer of peritoneal challenge. T-cell-enriched splenocytes from sensitized mice to na¨ ıve mice Three lines of evidence support a role of IL-4 in the ova also did not alter the Ym1 expression of mice challenged sub- challenge increase of macrophage Ym1 expression. First, this sequently (Fig. 6A). Likewise, exposing macrophages from con- up-regulation is not seen in STAT6-deficient mice both sensi- trol animals to splenocytes from sensitized animals in the tized and challenged with ova or in STAT6-deficient mice sen- presence of ovalbumin did not increase Ym1 expression (data sitized and challenged subsequently after adoptive transfer of not shown). These experiments suggest that the cell signaling wild type splenocytes from sensitized animals (Fig. 6A). Sec- the macrophage to increase Ym1 expression is likely neither a ond, injection of anti-IL-4 (11B.11) 1 h prior to and 4 h after ova mast cell nor a T-cell found in the splenocyte compartment. challenge blocked subsequent Ym1 expression (Fig. 5A). Third, Although Ym1 has been demonstrated to induce eosinophil intraperitoneal injection of IL-4, but not IL-5, IL-10, or IL-13, chemotaxis, Ym1 expression during allergic peritonitis does not resulted in up-regulation of Ym1 message (Fig. 5A) (data not appear necessary for general peritoneal recruitment of eosino- shown). phils. Although the adoptive transfer of splenocytes did not Although both mast cells (41) and splenic T-cells have been induce Ym1 expression, it did confer partial ability to recruit demonstrated to release IL-4, neither of these cells appear eosinophils to the general peritoneal cavity, suggesting that responsible for the macrophage expression of Ym1 during ova- Ym1 may not be essential for eosinophil transepithelial recruit- challenged allergic peritonitis. Neither intraperitoneal injec- ment (data not shown). tion of the mast cell activating chemical 48/80 nor passive STAT6-dependent Expression of Ym1 in Macrophages 42827 FIG.6. Lack of regulation of Ym1 expression during allergic peritonitis by splenic T-cells and mast cells. A, mice were sensi- tized on day 1 and 7. On day 14, indicated mice received 10  10 splenocytes intravenously following negative selection for major histo- compatibility complex II from sensitized (S) or control (C) animals. 24 h later, indicated mice were challenged. Peritoneal cells were harvested following an additional 24 h, and total RNA was subjected to Northern FIG.5. Ym1 expression during allergic peritonitis. A, mice were blot analysis. B, mast cell-deficient mice and littermate controls were sensitized by subcutaneous injection of ovalbumin in alum on days 1 sensitized, and indicated mice were challenged. 24 h later peritoneal and 7. On day 14, mice were challenged with 10 g of ova or 10 ng of cells were harvested and subjected to Northern blot analysis. Duplicate cytokine in PBS. Peritoneal cells were harvested on day 15 and sub- lanes represent individual mice. jected to Northern blot analysis. B, mice were sensitized and challenged as before, and peritoneal cells were subjected to5hof adhesion selec- tion to plastic tissue culture dishes prior to RNA extraction and North- with a free amine group, such as GlcN, found in many lectin ern blot analysis. C, mice were injected with 1 mg of IL-4 (11B.11) 1 h receptors. This has lead to a final proposal that Ym1 might act prior to and 4 h after challenge. Peritoneal cells were harvested 24 h in inflammatory resolution by masking lectin binding sites and after ova challenge. Duplicate lanes represent separate mice. preventing entry of new inflammatory cells to the site (43). However, this is clearly not an essential part of all inflamma- DISCUSSION tory resolution as macrophages elicited during thioglycollate Regulation of Ym1 Expression by T 2 Cytokines and Allergic peritonitis express low levels of Ym1. Challenge—Ym1 has been characterized previously as a se- The present studies demonstrate that Ym1 is a highly in- creted, self-crystallizing member of the chitinase family that is duced IL-4 and IL-13 target gene in multiple macrophage pop- expressed during peritoneal exposure to nematodes. Specula- ulations. While this manuscript was in preparation, Raes et al. tion as to the physiological and pathological function of Ym1 (44) also reported macrophage induction of a Ym1 or Ym2 and the highly related Ym2 is difficult at this time. Although transcript in response to the cytokines IL-4 and IL-13. The use both Ym1 and Ym2 contain mutations in their active site that of microarrays in the present studies to profile global transcrip- exist only in members of the chitinase family without chitinase tional responses of macrophages to IL-4 indicated that the Ym1 activity, one group did observe chitinase activity (42), but oth- or Ym2 transcript is one of the genes induced most dramati- ers could not (37, 38). If Ym1 or Ym2 do exhibit chitinase cally in response to T 2 cytokine stimulation. We further iden- activity, it is possible that they act as nonspecific immune tified this Ym transcript as Ym1 and demonstrated that this agents. Chitin is a common element in organisms including induction does not occur in macrophages derived from STAT6- parasites, fungi, and bacteria but does not occur in mammalian deficient mice, indicating that Ym1 is a target of the IL-4/ tissue (42), allowing for a selective anti-microbial activity of a STAT6 signal transduction pathway. chitinase. Alternatively, Ym1 may serve a role in the removal In addition, we observed a striking induction of macrophage of chitin-containing antigens following invasions by such mi- Ym1 expression during allergic challenge of ova-sensitized croorganisms (38). Ym1 has been characterized as an eosino- mice. The induction of peritoneal and alveolar eosinophilia by phil chemokine (37). However, another group was unable to allergic challenge has been shown previously to elicit the re- observe eosinophil chemotaxis in response to Ym2 (34). This lease of IL-4 (7). Deletion of STAT6 (45, 46) or the blockade of may be because of subtle differences between Ym1 and Ym2, both IL-4 and IL-13 activity (47, 48) has been observed to but this seems unlikely as the two are highly conserved, and prevent eosinophil accumulation and airway hyper-reactivity the proposed CXC motif is preserved in both (37). If Ym1 or in murine models of allergy. The high level of Ym1, in addition Ym2 does function as an eosinophil chemokine, this would to arginase I, in macrophages during allergic challenge sug- indicate a mechanism of macrophage-eosinophil cross-talk via gests that these are both distinct markers of macrophage re- Ym1/2 expression unexplored previously and would suggest sponse to T 2 cytokines and that they are likely to play an that such eosinophil cross-talk may be an important part of the important role in allergic immune function. macrophage response to T 2-type cytokines. Finally, analysis Webb et al. (34) observed recently striking induction of Ym2 of Ym1 crystal structure indicated the presence of a / TIM in a model of allergic eosinophilia similar to the one we applied. barrel similar to the lectin family of cell surface receptors. They observed, after intraperitoneal sensitization with ovalbu- Indeed, Ym1 has also been shown to bind to oligosaccharides min, that repeated aerosol challenge of ovalbumin led to eosi- 42828 STAT6-dependent Expression of Ym1 in Macrophages nophilia and cellular expression of both Ym1 and Ym2 in bron- promoter was sufficient to transfer IL-4-dependent induction chial alveolar lavage (BAL) fluid, with Ym2 as the dominate better than that observed for the Ym1 promoter itself. These expressed Ym member. They also found the increase in Ym findings suggest that the binding of activated STAT6 to the A expression, and release depended on the IL-4R subunit and on and C sites results in combinatorial interactions with addi- tional factors that together mediate robust transcriptional re- the release of IL-4 or IL-13. In contrast, we observed a striking STAT6-dependent macrophage induction of Ym1, but not sponse of the Ym1 promoter to IL-4. It will be of interest in Ym2, following subcutaneous sensitization and peritoneal future studies to identify factors that cooperate with STAT6 in this manner. challenge with ovalbumin. We also observed some subtle differences in the regulation of these allergic-induced Ym The promoter regions of Ym1 and Ym2 are highly related, sequences. First, peritoneal Ym1 expression could be blocked with near complete conservation of the STAT6 binding sites by injection of anti-IL-4. In contrast, BAL Ym induction could observed. Despite remarkable sequence conservation, differen- only be abrogated with the blockade of both IL-4 and IL-13. tial basal expression of Ym1 and Ym2 expression have been demonstrated by two groups (7, 50). Both groups found basal Second, intraperitoneal injection of IL-4, but not IL-13, was sufficient to induce Ym1 expression, whereas expression of Ym1 expression highest in spleen and lung with lower expres- Ym protein in BAL cells could be induced with exposure to sion in thymus, intestine, and kidney, whereas Ym2 expression was found highest in stomach with lower levels in thymus and IL-13 alone. Third, adoptive transfer of T-cell-enriched splenocytes was insufficient to induce Ym1 expression follow- kidney. The high degree of genomic similarity indicates that Ym1 and Ym2 were likely generated by a duplication event. ing ova challenge in a na¨ ıve mouse, whereas depletion of The conservation of STAT6 sites likely accounts for the simi- CD4 T-cells with the GK1.5 antibody abolished Ym expres- sion in BAL cells. This final difference suggests that either larly striking induction of Ym1 and Ym2 expression in T 2- type environments but cannot account for either the spatial the cell population signaling macrophage Ym1 expression segregation of peritoneal Ym1 and lung Ym2 expression during during peritoneal ova challenge is different from the popula- tion that signals cellular expression of BAL Ym, or that it is allergic challenge or for the distinct and largely non-overlap- ping patterns of basal expression. Intriguingly, the presence of a common population of CD4 T-cells, which exists outside the D site inhibited basal expression of Ym1-TK fusion genes in the splenic population. BEAS-2B cells, but not in RAW 264.7 macrophages, suggesting Peritoneal Ym1 expression has also been described in mice a role of this element in cell-specific control of Ym1 expression. infected with either Mesocestoides corti (37) or Brugia malayi Consistent with this, we observed a distinct complex bound to (49). In contrast to the allergic induction of Ym1 or Ym2, M. the D site in the ECoM-M cells that was not observed in the corti induction of Ym1 required CD4-CD8 T-cells. Further- BM-M. Sherman (41) identified an IL-4-inducible complex more, deletion of IL-4 or IL-5 alone was insufficient to inhibit bound to the canonical STAT6 element up-stream of the IL-4 B. malayi-induced Ym1 expression. As in the lung allergic promoter, but which had a faster mobility in mast cells com- response, this would support a more important physiologic role pared with B-cells and acted as a repressor. This complex was for IL-13 than would be inferred from experiments involving absent in mast cell extracts from STAT6-deficient mice, sug- peritoneal allergic challenge. gesting that it comprises a novel STAT6 isoform. Although Mechanisms Responsible for IL-4-dependent Activation of differences in tissue-specific expression of Ym1 and Ym2 are Ym1—To characterize the molecular mechanisms underlying likely to be accounted for or by essential enhancer sequences the transcriptional response of Ym1 to IL-4, we analyzed the located outside the conserved genomic regions, it is possible that Ym1 promoter and identified Cis-active elements that are es- a novel STAT6 isoform or other cell type-specific factors binding sential for IL-4 induction. The Ym1 promoter exhibits a canon- to the identical D sites in their respective promoters act to re- ical TATAA box 30 nucleotides up-stream of the site of tran- strict Ym1 and Ym2 expression to appropriate cell types. scriptional initiation and thus represents a conventional PolII In conclusion, we have shown a striking effect of IL-4 on promoter. In addition, multiple potential STAT binding sites macrophage transcription programs exemplified by the induc- were identified within a 600-bp region of 5-flanking informa- tion of arginase I and Ym1. We characterized the promoter tion that was sufficient to mediate induction by IL-4 in tran- sequence of Ym1 and identified three new functional STAT6 sient transfection assays. Although the A, B, and C sites within binding sites, demonstrated the requirement of STAT6 activity this region match the TTCN GAA consensus sequence identi- for IL-4-stimulated induction, and identified the 5-most site, fied previously for STAT6, only the A and C sites bound STAT6- the A site, as essential for IL-4 responsiveness. Furthermore, containing complexes with high affinity in EMSA experiments. we found that peritoneal macrophages in an allergic, T 2-type The obligate participation of STAT6 in protein complexes bind- H environment express high levels of Ym1, suggesting an impor- ing to the A and C sites was demonstrated unambiguously by tant function for the chitinase family members in T 2-biased the lack of binding activity in nuclear extracts derived from H immune response. Ym1 is related closely to Ym2, which is also STAT6-deficient macrophages. The B site contains two over- highly induced during a similar lung allergic challenge. How- lapping STAT6 consensus sequences, such that ambiguity in ever, the near identity of the proximal and distal sequences selection of half-sites by STAT6 dimers could potentially in- surrounding exon 1 of Ym1 and Ym2 can account only for their hibit high affinity binding. Alternatively, the flanking or spacer common responses to STAT6 signaling during ovalbumin-in- sequences in the B site may inhibit STAT6 binding by more duced allergic eosinophilia but cannot account for their distinct general mechanisms, i.e. unfavorable base-specific contacts separation in tissue specificity. These data indicate that the with residues in the STAT6 DNA binding domain. chitinase family members Ym1 and Ym2, in addition to argin- The combination of A site with elements surrounding the ase I, are highly induced during alternative macrophage acti- TATAA box was essential for IL-4-dependent activation of the vation, are likely to play important roles in T 2-biased immune Ym1 promoter in both BEAS-2B cells and RAW 264.7 macro- responses. and may be used as markers of macrophage re- phages. Removal of the A site abolished IL-4 responsiveness, sponse to T 2 stimulation. whereas transfer of the A-C or A-B regions to the basal TK H promoter resulted in much weaker responses to IL-4 than the Acknowledgments—We thank Shioko Kimura for providing the anti- Ym1 promoter itself. Although not essential in these assays, Ym1 antibody, Christoph Binder for help with the adoptive transfer insertion of three copies of the C site up-stream of the basal TK experiments, and Jana Collier for technical assistance. STAT6-dependent Expression of Ym1 in Macrophages 42829 REFERENCES Biol. 18, 3851–3861 26. Jin, H. M., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Kirkpatrick, R. B., 1. Gordon, S. (1998) Res. Immunol. 149, 685– 688 and Rosenberg, M. (1998) Genomics 54, 316 –322 2. Newman, S. L. (1999) Trends Microbiol. 7, 67–71 27. Ricote, M., Li, A. C., Willson, T. M., Kelly, C. J., and Glass, C. K. (1998) Nature 3. Mosmann, T. R., Cherwinski, H., Bond, M. W., Giedlin, M. A., and Coffman, 391, 79 – 82 R. L. (1986) J. Immunol. 136, 2348 –2357 28. Patel, B. K., Pierce, J. H., and LaRochelle, W. J. (1998) Proc. Natl. Acad. Sci. 4. Heinzel, F. P., Sadick, M. D., Holaday, B. J., Coffman, R. L., and Locksley, U. S. A. 95, 172–177 R. M. (1989) J. Exp. Med. 169, 59 –72 29. Patel, B. K., Wang, L. M., Lee, C. C., Taylor, W. G., Pierce, J. H., and 5. Scott, P., Natovitz, P., Coffman, R. L., Pearce, E., and Sher, A. (1988) J. Exp. LaRochelle, W. J. (1996) J. Biol. Chem. 271, 22175–22182 Med. 168, 1675–1684 30. Raveh, D., Kruskal, B. A., Farland, J., and Ezekowitz, R. A. (1998) J. Leukocyte 6. Maeyer, E. D., and Maeyer-Guignard, J. D. (1998) in The Cytokine Handbook Biol. 64, 108 –113 (Thomson, A. W., ed) 3rd Ed., pp. 491–516, Academic Press, San Diego 31. Ihn, H., Yamane, K., Asano, Y., Kubo, M., and Tamaki, K. (2002) J. Immunol. 7. Finkelman, F. D., and Urban, J. F., Jr. (2001) J. Allergy Clin. Immunol. 107, 168, 1895–1902 772–780 32. Rutschman, R., Lang, R., Hesse, M., Ihle, J. N., Wynn, T. A., and Murray, P. J. 8. Mills, C. D., Kincaid, K., Alt, J. M., Heilman, M. J., and Hill, A. M. (2000) (2001) J. Immunol. 166, 2173–2177 J. Immunol. 164, 6166 – 6173 33. de Vries, J. E. (1998) J Allergy Clin. Immunol. 102, 165–169 9. Dickensheets, H. L., and Donnelly, R. P. (1999) J. Leukocyte Biol. 65, 307–312 34. Webb, D. C., McKenzie, A. N., and Foster, P. S. (2001) J. Biol. Chem. 276, 10. Goerdt, S., Politz, O., Schledzewski, K., Birk, R., Gratchev, A., Guillot, P., 41969 – 41976 Hakiy, N., Klemke, C. D., Dippel, E., Kodelja, V., and Orfanos, C. E. (1999) 35. Ivashkiv, L. B. (1995) Immunity 3, 1– 4 Pathobiology 67, 222–226 36. Conrad, D. J., and Lu, M. (2000) Am. J. Respir. Cell Mol. Biol. 22, 226 –234 11. Goerdt, S., and Orfanos, C. E. (1999) Immunity 10, 137–142 37. Owhashi, M., Arita, H., and Hayai, N. (2000) J. Biol. Chem. 275, 1279 –1286 12. Chomarat, P., Rybak, M. E., and Banchereau, J. (1998) in The Cytokine 38. Harbord, M., Novelli, M., Canas, B., Power, D., Davis, C., Godovac- Handbook (Thomson, A. W., ed) 3rd Ed., pp. 149 –150, Academic Press, San Zimmermann, J., Roes, J., and Segal, A. W. (2002) J. Biol. Chem. 277, Diego 5468 –5475 13. Paludan, S. R. (1998) Scand. J. Immunol. 48, 459 – 468 39. Zuany-Amorim, C., Leduc, D., Vargaftig, B. B., and Pretolani, M. (1994) Ann. 14. Bogdan, C., and Nathan, C. (1993) Ann. N. Y. Acad. Sci. 685, 713–739 N. Y. Acad. Sci. 725, 34 – 43 15. Hart, P. H., Bonder, C. S., Balogh, J., Dickensheets, H. L., Donnelly, R. P., and 40. Das, A. M., Ajuebor, M. N., Flower, R. J., Perretti, M., and McColl, S. R. (1999) Finlay-Jones, J. J. (1999) J. Leukocyte Biol. 66, 575–578 Clin. Exp. Immunol. 117, 223–229 16. Zuany-Amorim, C., Leduc, D., Vargaftig, B. B., and Pretolani, M. (1993) Br. J. 41. Sherman, M. A. (2001) Immunol. Rev. 179, 48 –56 Pharmacol. 110, 917–924 42. Guo, L., Johnson, R. S., and Schuh, J. C. (2000) J. Biol. Chem. 275, 8032– 8037 17. Zuany-Amorim, C., Creminon, C., Nevers, M. C., Nahori, M. A., Vargaftig, 43. Chang, N. C., Hung, S. I., Hwa, K. Y., Kato, I., Chen, J. E., Liu, C. H., and B. B., and Pretolani, M. (1996) J. Immunol. 157, 377–384 Chang, A. C. (2001) J. Biol. Chem. 276, 17497–17506 18. Walker, C., Checkel, J., Cammisuli, S., Leibson, P. J., and Gleich, G. J. (1998) 44. Raes, G., De Baetselier, P., Noel, W., Beschin, A., Brombacher, F., and J. Immunol. 161, 1962–1969 Hassanzadeh, G. (2002) J. Leukocyte Biol. 71, 597– 602 19. Munder, M., Eichmann, K., Moran, J. M., Centeno, F., Soler, G., and Modolell, 45. Akimoto, T., Numata, F., Tamura, M., Takata, Y., Higashida, N., Takashi, T., M. (1999) J. Immunol. 163, 3771–3777 Takeda, K., and Akira, S. (1998) J. Exp. Med. 187, 1537–1542 20. Nau, G. J., Richmond, J. F., Schlesinger, A., Jennings, E. G., Lander, E. S., and 46. Kuperman, D., Schofield, B., Wills-Karp, M., and Grusby, M. J. (1998) J. Exp. Young, R. A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 1503–1508 Med. 187, 939 –948 21. Ehrt, S., Schnappinger, D., Bekiranov, S., Drenkow, J., Shi, S., Gingeras, T. R., Gaasterland, T., Schoolnik, G., and Nathan, C. (2001) J. Exp. Med. 194, 47. Webb, D. C., McKenzie, A. N., Koskinen, A. M., Yang, M., Mattes, J., and Foster, P. S. (2000) J. Immunol. 165, 108 –113 1123–1140 22. Celada, A., Gray, P. W., Rinderknecht, E., and Schreiber, R. D. (1984) J. Exp. 48. Tomkinson, A., Duez, C., Cieslewicz, G., Pratt, J. C., Joetham, A., Shanafelt, M. C., Gundel, R., and Gelfand, E. W. (2001) J. Immunol. 166, 5792–5800 Med. 160, 55–74 23. Sykes, D. B., and Kamps, M. P. (2001) Blood 98, 2308 –2318 49. Falcone, F. H., Loke, P., Zang, X., MacDonald, A. S., Maizels, R. M., and Allen, J. E. (2001) J. Immunol. 167, 5348 –5354 24. Ausubel, F. M. (2001) Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York 50. Ward, J. M., Yoon, M., Anver, M. R., Haines, D. C., Kudo, G., Gonzalez, F. J., 25. Guidez, F., Li, A. C., Horvai, A., Welch, J. S., and Glass, C. K. (1998) Mol. Cell. and Kimura, S. (2001) Am. J. Pathol. 158, 323–332 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

TH2 Cytokines and Allergic Challenge Induce Ym1 Expression in Macrophages by a STAT6-dependent Mechanism

Download PDF
9 pages

Loading next page...
 
/lp/unpaywall/th2-cytokines-and-allergic-challenge-induce-ym1-expression-in-dBzgTgR9mD

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.m205873200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 277, No. 45, Issue of November 8, pp. 42821–42829, 2002 © 2002 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. 2 Cytokines and Allergic Challenge Induce Ym1 Expression in Macrophages by a STAT6-dependent Mechanism* Received for publication, June 12, 2002, and in revised form, July 31, 2002 Published, JBC Papers in Press, September 4, 2002, DOI 10.1074/jbc.M205873200 John S. Welch‡§¶, Laure Escoubet-Lozach‡, David B. Sykes§, Kate Liddiard**, David R. Greaves‡‡, and Christopher K. Glass‡§§¶¶ From the Departments of ‡Cellular and Molecular Medicine and §§Medicine and the §Medical Scientist Training Program, La Jolla, California 92093-0651 and the Sir William Dunn School of Pathology, University of Oxford, South Parks Road, OX1 3RE Oxford, United Kingdom The diverse functions of macrophages as participants engage processes of the acquired immune response such as in innate and acquired immune responses are regulated antibody-dependent opsonization and subsequent antigen by the specific milieu of environmental factors, cyto- presentation to T-cells (1, 2). kines, and other signaling molecules that are encoun- Macrophage function can be influenced profoundly by cyto- tered at sites of inflammation. Microarray analysis of kines released from T-cells and other immune cells. These the transcriptional response of mouse peritoneal macro- cytokines have been divided largely along two axes: T 1 cyto- phages to the T 2 cytokine interleukin-4 (IL-4) identi- kines, dominated by INF- and T 2 cytokines, dominated by fied Ym1 and arginase as the most highly up-regulated IL-4 (3). Macrophage stimulation by T 1 cytokines results in genes, exhibiting more than 68- and 88-fold induction, free-radical release and increased cytokine secretion, impli- respectively. Molecular characterization of the Ym1 pro- cated as essential signaling components of a successful re- moter in transfected epithelial and macrophage cell sponse to infection by intracellular bacteria and viruses (4 – 6). lines revealed the presence of multiple signal transduc- In contrast, efficient defense against extracellular pathogens ers and activators of transcription 6 (STAT6) response and parasites requires a different response, characterized by elements that function in a combinatorial manner to the release of T 2 cytokines (7). These mediate B-cell class mediate transcriptional responses to IL-4. The partici- switching to IgE antibodies, macrophage opsonization of solu- pation of STAT6 as an obligate component of protein ble antigens, and activation of mast cells, basophils, and eosin- complexes binding to these sites was established by ophils. These two cytokine axes have been proposed to be analysis of nuclear extracts derived from STAT6-defi- mutually antagonistic, both in the commitment of T-cells to- cient macrophages. Macrophage expression of Ym1 was ward a T 1orT 2 lineage and in their influence on effector highly induced in vivo by an IL-4- and STAT6-dependent H H cells such as the macrophage. mechanism during the evolution of allergic peritonitis, In parallel with the separation of T-cells into either T 1- or supporting the biological relevance of the IL-4-depend- ent pathway characterized ex vivo in peritoneal mac- T 2-biased cells, a number of groups have proposed recently rophages. These studies establish Ym1 as a highly in- that the exposure of macrophages to a specific set of cytokines ducible STAT6-dependent transcript in T 2-biased H also biases them toward either an M-1 phenotype (activated inflammation and define Cis-active elements in the Ym1 macrophages) or an M-2 phenotype (alternatively activated promoter that are required for this transcriptional macrophages) (8 –10). Macrophage exposure to IL-4 substan- response. tially blunts subsequent LPS- or INF-stimulated production of cytokines (IL-6, IL-8, IL-12, and tumor necrosis factor-), receptors (CD14, FcI, FcII, and FcIII), and superoxide rad- The macrophage plays an important role bridging between icals (11–14). At the same time, macrophage exposure to IL-4 innate and acquired immune function. It is capable both of results in the increased expression of scavenger receptors (the responding to nonspecific stimuli, such as bacterial lipopolysac- mannose receptor, the scavenger receptor type I, and CD163), carides (LPS) and activated complement factors, but can also CD13 (the aminopeptidase, capable of inactivating inflamma- tory mediators), and CD23 (FcRII), thus blunting the cytotoxic effects of the macrophage and shifting its opsonizing focus from * This work was supported in part by Grant HL59694 from the IgG antibodies to IgE while increasing its phagocytic capabili- NHLBI, National Institutes of Health and by the Stanford-Reynolds Foundation. The costs of publication of this article were defrayed in part ties (9, 15). by the payment of page charges. This article must therefore be hereby Allergic challenge of BALB/c mice with ovalbumin following marked “advertisement” in accordance with 18 U.S.C. Section 1734 sensitization has been shown to result in the recruitment of solely to indicate this fact. macrophages into an environment enriched in IL-4 and IL-5 The nucleotide sequence(s) reported in this paper has been submitted TM (16 –18). This allergic response provides a useful model of to the GenBank /EBI Data Bank with accession number(s) AF533510. ¶ Recipient of a pre-doctoral fellowship from the American Heart macrophages activated alternatively because of the relative Association. abundance of macrophages, the cytokine milieu they are re- ** Recipient of a Wellcome Trust studentship. cruited into, and their high expression of arginase I, a marker ‡‡ British Heart Foundation Basic Science Lecturer. of macrophages activated alternatively (19). In addition, this ¶¶ To whom correspondence should be addressed. Tel.: 858-534-6011; Fax: 858-822-2127; E-mail: [email protected]. model of allergic response has been used to characterize gen- The abbreviations used are: LPS, lipopolysaccarides; IL, interleu- eral allergic phenomenon as they may apply to human patho- kin; INF, interferon; STAT, signal transducers and activators of tran- physiology of allergy and asthma. scription; RT, reverse transcriptase; TK, thymidine kinase; EMSA, INF- and LPS induce large and profound transcriptional electrophoretic mobility shift assay; PBS, phosphate-buffered saline; BAL, bronchial alveolar lavage. changes in the macrophage (13, 20, 21). In contrast, relatively This paper is available on line at http://www.jbc.org 42821 This is an Open Access article under the CC BY license. 42822 STAT6-dependent Expression of Ym1 in Macrophages Primer Extension—Protocol followed that of Ausubel (24) with the few genes have been characterized as direct targets of IL-4 substitution of Superscript (Invitrogen) for avian myeloblastosis virus stimulation. The development of large scale expression arrays reverse transcriptase. In brief, 10 g of total RNA from control and allows near global glimpses of changes in gene expression pro- IL-4-treated ECoM-M macrophages were hybridized at 65 °C for 90 min files during cell proliferation, division, and in response to en- to end-labeled primers GGAAGATCCCAGCTGTACGTTCAGAAG or vironmental signals. We applied this technology to probe the GCACATCAGCTGGTAGGAAGATCCCAG. Reverse transcription was transcriptional response of murine macrophages to the quint- performed for1hat42 °C with Superscript in the appropriate buffer. RNA was degraded with RNaseH (Invitrogen), and cDNA was isolated essential T 2 cytokine, IL-4. Ym1 was one of the most highly by phenol-chloroform extraction, separated on a 9% acrylamide/7 M induced IL-4 target genes, exhibiting a level of induction of urea sequencing gel, and visualized by autoradiography. 70-fold or greater in multiple macrophage populations. Studies EMSA—Nuclear extracts were generated following Nonidet P-40 cell of the Ym1 promoter suggest that the binding of STAT6 to lysis as described previously (25). Nuclear extracts (5 g) were incu- multiple sites within a 600-bp region up-stream of the tran- bated for 10 min on ice with bovine serum albumin (2 g), poly(dI-dC) scriptional start site is required for the IL-4 response in (2 g) in 10 mM Hepes, pH 8, 2.5 mM EDTA, pH 8, 0.5 mM sodium orthovanadate, 1 mM dithiothreitol, and 10% glycerol followed by 30 BEAS-2B cells and RAW macrophages. Ym1 was also highly min on ice with appropriate end-labeled, annealed oligonucleotides as induced in macrophages recruited to the peritoneal cavity during follows: A, GATCCGGCAAGTTCTTTGGAACTCTTA and GATCTAAG- allergic peritonitis in an IL-4- and STAT6-dependent manner. AGTTCCAAAGAACTTGCCG; B, GATCTACTTCTTTCTGAAGAATG- Collectively, these findings establish molecular mechanisms un- GTGTG and GATCCACACCATTCTTCAGAAAGAAGTA; C, GATCCA- derlying the transcriptional response of the most highly induced ATGTCTTCCATGGAATCAA and GATCTTGATTCCATGGAAGACAT- IL-4 target gene identified to date in macrophages. TG; D, GATCCTATGTTTCTAAGAAGTGGGTA and GATCTACCCAC- TTCTTAGAAACATAG. Samples were separated in a gel consisting of MATERIALS AND METHODS 5% polyacrylamide, 0.5 TBE, and 5% glycerol at 4 °C, 300 V. Gel was Cell Culture—Thioglycollate-elicited macrophages were isolated by pre-run for1hat4 °C, 300 V. peritoneal lavage 3 days following peritoneal injection of 2.5 ml of 3% Promoter Studies—Promoter fragments were amplified from the thioglycollate (Difco). Cells were plated in 10% RPMI and washed after genomic clone 5b (26) using Pfx (Stratagene), cloned into TOPOII-Blunt 5 h. Bone marrow-derived macrophages were generated by culturing (Invitrogen) and transferred to the BNXH luciferase or minimal TK- total bone marrow in macrophage colony stimulating factor provided by luciferase reporter (27) by BamHI/HindIII digestion and subsequent 30% L-cell-conditioned media for 7 days in RPMI  10% fetal bovine ligation. Promoter constructs used in deletional studies were amplified serum (22). ECoM-M monocytic leukemia cells were cultured as de- from genomic clone 5A, a generous gift from Robert B. Kirkpatrick scribed previously (23). RAW 267.4 macrophages and BAES-2B bovine (GlaxoSmithKline) (26), using the following primers: CTTAGGATCCC- airway epithelial cells were grown in 10% fetal bovine serum and RPMI AATATCCATGA TTAAGGATCCAGTGTCCAAGAC, ATGTGGATCCG- (Invitrogen). ATTTGTCTAGG, ATAGGGATCCTGACTGAACTGG, TCGCCCTAAG- Expression Array Profiling—Total RNA was purified with Trizol CTTCAGGATTGC, CACCAGATCTGTCAAGATAGC, CCTAGACAGA- (Invitrogen) and RNeasy columns (Qiagen). cRNA was generated from TCTTATTCACATAG, GGGCAGATCTCTGGACATTG, GCTTGGATC- 10 g of total RNA using Superscript (Invitrogen) and the high yield CAGGCAAGTTC. Oligonucleotides described for EMSA analysis of the RNA transcription labeling kit (Enzo). Fragmented cRNA was hybrid- C site were used to generate the multimerized C reporter. BEAS-2B ized to Affymetrix arrays according to manufacturer’s instruction. cells were transfected with LipofectAMINE (Invitrogen) and treated Data was analyzed with Microarray Suite (Affymetrix) and Gene- overnight with human IL-4 (10 ng/ml) (Endogen). Extracts were har- spring (Silicongenetics). vested and assayed as described previously (27). The expression vector Northern Blot Analysis—RNA analysis by Northern blotting followed for human STAT6 was a generous gift of William LaRochelle (NCI, the procedure of Ausubel (24). 5–10 g of total RNA were separated by National Institutes of Health) (28, 29). RAW 264.7 cells were trans- gel electrophoresis and transferred to nitrocellulose (Supercharge; fected with 5 g of Ym-1/luciferase promoter construct DNA and 3 gof Schleicher & Schuell). Prior to hybridization, membranes were UV a murine STAT6 expression vector (gift of Yoshihiro Ohmori). 1 gof cross-linked (Stratagene) and stained with methylene blue (MRC). -galactosidase expression vector was also co-transfected as a control Probes were generated by RT-PCR using the following primers followed for transfection efficiency. Ten million cells were electroporated in by random priming labeling (Invitrogen) and hybridization with Quick- 0.4-cm electrode gap cuvettes using a Bio-Rad Gene Pulser II and Hyb (Stratagene): Arginase I, GAAACAGAGTATGACGTGAGAG, pulsing at 280 V, 1070 microfarad. Immediately after pulsing, cells AGGTGGTTTAAGGTAGTCAGTC; Ifi30, TTCTGCTTCTGCTGTTCC- were recovered into pre-warmed RPMI supplemented with 20% fetal CACT and ACTCCATGATACTCTCTGTGAC; Hspa5, GTGAGGTAGA- calf serum, antibiotics, and L-glutamine. The medium was replaced 1 h AAAGGCTAAGAG and GAAGAAACTCTTTCCCAGTTGC; tissue later with standard 10% fetal calf serum RPMI in the presence or inhibitor of metalloproteinase, ATCTGGCATCCTCTTGTTGCTA and absence of 20 ng/ml recombinant murine IL-4, and cells were harvested GATCTCCAAGTGCACAAGCCTA; Ym1, CTGTGTACTCACCTGATC- 16 h later for analysis of luciferase activity. Luciferase activity was TATG and GAAAGAACCACTGAAGTCATCC; Scya9, TTCTGCTTCTG- normalized to control transfected -galactosidase enzyme activity. CTGTTCCCACT and ACTCCATGATACTCTCTGTGAC. Ovalbumin Sensitization and Allergic Challenge—Mice were sensi- Western Blot Analysis—Macrophages were washed with ice-cold tized with subcutaneous injections of 100 g of ovalbumin (Sigma) phosphate-buffered saline, and the cell pellet was resuspended in RIPA absorbed in 0.1 ml of aluminum hydroxide (Inject Alum; Pierce) and 0.1 lysis buffer (50 mM Tris, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% ml of PBS on days 1 and 7. Efficiency of sensitization was assessed by sodium dodecyl sulfate, 1% Triton X-100, 1 mM EGTA, protease inhib- blood IgE levels and by splenocyte IL-4 production following in vitro itors (Roche Molecular Biochemicals)) and incubated for 10 min at 4 °C. ovalbumin challenge. On day 14, mice were challenged with intraperi- Cell debris were spun down for 10 min at 14,000  g, and supernatants toneal injection of 10 g of ovalbumin in 0.2 ml of PBS. Cells were were collected. The total protein content was quantified, and 50 g of total harvested at indicated time points. IL-4 (11B.11) (NCI, National In- protein was separated on a 10% NuPAGE Bis-Tris gel (Invitrogen) and stitutes of Health) was injected 1 h prior to and 4 h after ovalbumin transferred onto a nitrocellulose membrane. The membrane was probed challenge. BALB/c, C57Bl/6, STAT6 knock-out, and WBB6F1/J mice with an anti-Ym1 antibody (1:500) kindly provided by Shioko Kimura were purchased from Harlan and Jackson Laboratories. (NCI, National Institutes of Health). Immune complexes were revealed by Adoptive Transfer—Splenocytes were isolated, and B-cells, macro- a peroxidase-conjugated anti-rabbit IgG and visualized by chemilumines- phages, monocytes, and dendritic cells were depleted by magnetic cell cence (Pierce). sorting using major histocompatibility complex II (Ia) microbeads RT-PCR—cDNA was generated from 1 g of total RNA using Super- (Miltenyi Biotec) according to the manufacturer’s instructions. 10  10 script (Invitrogen) and amplified with the following primers: Ym1, cells were washed with PBS, resuspended in 500 l of PBS, and injected CTGGAATTGGTGCCCCTACA and CAAGCATGGTGGTTTTACAGGA intravenously into naı ¨ve mice. 24 h after adoptive transfer, mice were or Ym2, CAGAACCGTCAGACATTCATTA and ATGGTCCTTCCAG- challenged as described above. TAGGTAATA. PCR was performed for 25 cycles with Mastermix Taq (Qiagen) at an annealing temperature of 58 °C and visualized by gel RESULTS electrophoresis. BstYI digestion was performed on cDNA amplified with Expression Profiling of Macrophage IL-4 Stimulation—To primers redundant for Ym1 and Ym2: CCTACCAGCTGATGTGC- assess genome-wide effects of IL-4 on macrophage physiology, TACTA and GAAAGAACCACTGAAGTCATCC using Pfu (Stratagene) and for 35 cycles with an annealing temperature of 58 °C. we characterized the transcriptional response of thioglycollate- STAT6-dependent Expression of Ym1 in Macrophages 42823 largely of T-cells and B-cells, with a smaller population of monocytes, displayed a blunted response, suggesting that the response to direct stimulation with IL-4 may be largely mono- cyte-/macrophage-specific (data not shown). We examined the responsiveness of Ym1/2 expression to a large panel of cytokines and macrophage stimuli. In addition to IL-4, IL-13 was capable of strongly inducing Ym1/2 RNA and protein expression and did so nearly equally (Fig. 2, C and D). Both of these cytokines bind to the -common chain of the IL-4 receptor resulting in STAT6 activation (33). In contrast, IL-5, IL-6, IL-7, IL-10, IL-15, granulocyte macrophage colony stim- ulating factor, macrophage colony stimulating factor, granulo- cyte macrophage colony stimulating factor, INF-, tumor ne- crosis factor-, 13-hydroxyoctadecadienoic acid, 15-deoxy- 12,14 PGJ , and LPS failed to induce Ym1/2 expression (Fig. 2D) (data not shown). Thus, Ym1/2 induction appeared, as arginase I, to be a restricted response to T 2-biased cytokines. FIG.1. Expression array profiling of the response of thiogly- colate-elicited macrophages to IL-4. A, scatter plot of cRNA gener- Because arginase I was described to be induced synergistically ated from control TG-M and TG-M treated with IL-4 (10 ng/ml) for by IL-4 and IL-10 in bone marrow-differentiated macrophages 24 h and hybridized to Affymetrix Mu11kA and B arrays. B, Northern and dendritic cells (19), we tested the effect of the combination blot analysis of the expression of selected genes induced by IL-4 in the of these cytokines on Ym1 expression in TG-M. Although microarray experiment. IL-4-induced Ym1 RNA expression seemed to be increased slightly further by IL-10 (Fig. 2F), no synergy between these elicited macrophages (TG-M) to IL-4 treatment using Af- two cytokines was observed at the protein level (Fig. 2E). fymetrix Mu11kA and Mu11kB microarrays. Together these Ym1 is related closely to Ym2, another member of the murine arrays contain a total of 13179 targets, of which 4215 (32%) chitinase family (26). Ym2 shares 95% RNA sequence identity were scored as being present in at least one of the two treat- with Ym1 (34). Using RT-PCR and primers specific for Ym1 or ment groups (Fig. 1A). Arginase I, mannose receptor, and Ym2, we identified the IL-4-induced macrophage transcript as TIMP-2, which have been demonstrated previously to be regu- Ym1 (Fig. 2G). In addition, Ym1 and Ym2 can be distinguished lated by IL-4 (30, 31), were induced and served as positive based on three restriction sites: ScaI, BglII, and BstYI. ScaI controls (data not shown). In addition, several additional genes specifically digests Ym1, BglII specifically digests Ym2, and Bs- were induced, including the glucose-regulated heat shock pro- TM tYI digests Ym1 in two fragments of nearly equal size and Ym2 in tein Hspa5 (GenBank accession number AA086684, Unigene accession number Mm.918), the tissue inhibitor of metallopro- three fragments. We amplified a 1054-bp product with primers common to Ym1 and Ym2 from the same RT reactions and found teinase TIMP-1 (NM_011593, Mm.8245), the cytokine Scya9 or MIP-1 (U19482, Mm.2271), and the interferon--inducible ly- that digestion with BstYI yielded a single band of 520 bp (Fig. sosomal thiol reductase Ifi30 (AA106931, Mm.30241) (Fig. 1B). 2H). BglII digestion did not alter the size of the fragment, and A more complete description of the global transcriptional re- ScaI digestion yielded two fragments, one 880 bp, and the other sponse of macrophages to IL-4 will be presented elsewhere. 270 bp (data not shown). This digestion pattern further confirms Two genes were up-regulated dramatically in both the array that the IL-4-induced macrophage transcript was Ym1. experiment and subsequent confirmation, arginase I (U51805, Characterization of Ym1 Promoter—To characterize the pro- Mm.154144) and Ym1 (M94584, Mm.4571) (Fig. 1). The up- moter and enhancer structure of Ym1, we identified a trace regulation of arginase I in response to IL-4 has been described sequence (krv64h11.b1) from the mouse genome project con- previously and suggested to be an important marker of macro- taining the first exon of Ym1 (26) (Fig. 3A). Using primers phage bias toward an M-2 phenotype (19), where it competes specific for exon 1 and exon 3, we confirmed that this promoter with the inducible nitric-oxide synthase for a common sub- sequence was located immediately up-stream of exon 1 and 3.4 strate (32). In contrast, relatively little is known about the kb up-stream of exon 3 in both the Lambda FIXII clone 5A (26) transcriptional regulation of Ym1, a member of the chitinase and in the Celera database (mCG10749) (data not shown). This family that is sufficiently similar to Ym2 at the nucleotide is important, because exons 1–3 of Ym2 differ from exons 1–3of sequence level to make it difficult to differentiate the two by Ym1 only by nine nucleotides, but intron 1 of Ym2 (mCG63439) microarray and Northern blot techniques. is 4.3 kb, allowing one to distinguish between promoters of Ym1 Macrophage Regulation of Ym1/2 by IL-4 —Ym1/2 expression and Ym2 by their position relative to exon 3. Using primer is up-regulated in response to IL-4 stimulation in multiple extension analysis, we identified the mRNA start site and populations of murine macrophages including bone marrow- found it to be 20 nucleotides up-stream of the ATG located in derived macrophages (BM-M), TG-M, and the immortalized exon 1 (Fig. 3) (data not shown). The trace krv64h11.b1 and monocytic cell line ECoM-M (23) (Fig. 2, A and B) (data not clone 5A sequence matched the information in the Celera da- shown). Induction of Ym1/2 in primary macrophages was found tabase, with the exception of the deletion of a single T, 29 to be STAT6-dependent as Ym1/2 expression did not respond to nucleotides up-stream of the mRNA start site. IL-4 in TG-M derived from STAT6-deficient mice (Fig. 2B). In Previous work has characterized the canonical binding site contrast, three separate clones of the macrophage cell line for STAT proteins as the sequence TTCNXGAA (35). STAT6 RAW 264.7 failed to up-regulate Ym1/2, suggesting a lack of an homodimers generally prefer binding to sites containing a four- essential signaling component in these cells (data not shown). nucleotide spacer (N ), whereas STAT1 homodimers generally Although multiple populations of primary murine macro- prefer a three nucleotide spacer (N ) (Fig. 3C). We identified phages robustly up-regulate Ym1/2 expression in response to four such sites in the 600 nucleotides up-stream of the tran- IL-4 stimulation, the mixed splenocyte population, consisting scriptional start site and only one in the next 9400 nucleotides up-stream. Two of these (A and C) are canonical N sites, Welch et al., manuscript in preparation. whereas the most immediate site up-stream of the start site, D, 42824 STAT6-dependent Expression of Ym1 in Macrophages FIG.2. IL-4 and IL-13 induction of M Ym1 expression. Northern blot analysis of Ym1/2 expression in BM-M (A) and TG-M (B) derived from BALB/c- and STAT6-deficient mice. M were treated as indicated or for 24 h with IL-4 (10 ng/ml). C, D, and F, Northern blot analysis of TG-M treated for 24 h as indicated. # indicates unstripped arginase I probe. E, Western blot analysis of Ym1 expression in TG-M from BalB/c mice. M were treated for 24 h with IL-4 (10 ng/ml), IL-13 (10 ng/ml), and IL-10 (10 ng/ml). G, RT-PCR of samples in D. Lanes 1 and 2, Fig. 5A, lanes 2, 3, and 8 ampli- fied with gene-specific primers. H, BstY1 digestion of PCR product generated with primers degenerate for Ym1 and Ym2. cDNA was generated from total RNA samples represented in A, lane 3; D, lane 2; Fig. 5A, lanes 3 and 8. is an N site (Fig. 3C). The B site contains two overlapping of cotransfected STAT6 (data not shown). Constructs lacking sites, one an N and the other an N . the A site were no longer responsive to IL-4 stimulation (D1, 5 4 The A, C, and D sites all bound IL-4-inducible complexes 630 to 27; D2, 550 to 27; D3, 326 to 27; D4, 176 to with similar mobility when incubated with nuclear extracts 27) (Fig. 4C). Although the B and C sites were not sufficient prepared from BM-M as assessed by EMSA analysis, with for responses to IL-4 in the context of the YM1 proximal pro- strongest binding to the A site (Fig. 4A). These complexes were moter, the multimerized C site (3xC-TK) was as responsive to absent in BM-M from STAT6-deficient mice, indicating that IL-4 as the multimerized STAT6 site from the human 12/15- they contain STAT6 and require its presence for DNA binding. lipoxygenase promoter (4xSTAT6-TK) (36) (Fig. 4C).A3-dele- In contrast, nuclear extracts from the ECoM-M cell line in- tion series of the YM1 promoter was tested for the ability to duced IL-4-dependent shifts on the A and C probes but bound enhance the activity of the TK promoter in an IL-4-dependent a complex with different mobility on the D probe that was lost manner. All constructs transferred modest IL-4 induction, with after IL-4 activation (Fig. 4B). We were unable to identify this deletion of the D site resulting in increased basal activity. complex by supershift analysis with antibodies against We next evaluated IL-4 induction of the Ym1 promoter in STAT1, STAT2, STAT5a, and STAT5b. Unlike the A and C RAW 264.7 cells. These studies revealed a very similar profiled sites, the D site is an N site. This differential binding of of activity for the 5deletion series, with removal of the A site complexes in different cell types, one induced and one lost abolishing IL-4 responsiveness (Fig. 4D). The D2, D3, and D4 during IL-4 stimulation, suggests that the D site may be an deletions were also not inducible by IL-4 (data not shown). In important negative regulator or modulator of basal Ym1 ex- contrast to the findings in BEAS-2B cells, the presence of the D pression in some cell types. The B site was not retarded in the site did not appear to have an inhibitory effect on basal expres- presence of nuclear extracts from cells under either condition, sion or IL-4 induction in RAW macrophages, and the responses of all of the 3-deletions to IL-4 induction were more robust suggesting that the overlapping sequences prevent binding of STAT6 to this site (data not shown). (Fig. 4D). The lung epithelial cell line BEAS-2B was chosen initially for Using the Celera database we compared the promoter se- analysis of the Ym1 promoter because of its responsiveness to quences of Ym1 and Ym2. Despite the fact that Ym1 and Ym2 IL-4 upon expression of STAT6 (36). The Ym1 promoter (664 expression show distinct and largely non-overlapping patterns to 27) was induced consistently 10-fold by IL-4 treatment of basal expression (26), the first 1200 nucleotides located up- when these cells were co-transfected with a STAT6 expression stream of exon 1 are 92% identical to the sequence up-stream of vector (Fig. 4C). IL-4 induction was not observed in the absence Ym2 exon 1, with preservation of the STAT binding sites (Fig. STAT6-dependent Expression of Ym1 in Macrophages 42825 FIG.3. Ym1 sequence up-stream of exon 1. A, promoter sequence of Ym1. Boxes indicate canonical STAT binding sites and translational start site. Under- lined sequences indicate exon 1 and dif- ferences between the trace sequence krv64h11.b1 and the Celera database (mCG10749). B, regions of genomic se- quence identity shared between Ym1 and Ym2. C, differences in STAT binding site sequences in Ym1 and Ym2 promoter el- ements. ND, not determined. 3B). The A and D sites were identical in the Ym1 and Ym2 shown). This peritoneal response appears specific to the type of promoter, the C site had two nucleotide changes in the N induced inflammation. Unlike the allergic peritonitis, thiogly- region (Ym1, TTCCATGGAA; Ym2, TTCCACAGAA), and the collate-induced peritonitis results in minimal Ym1 expression B site N remained intact with a G 3 T alteration potentially (see Fig. 1B and Fig. 2B). By RT-PCR and subsequent digestion abrogating the effect of the overlapping N site (Ym1, TTCTT- with BstYI, ScaI, and BglII we also excluded up-regulation of TCTGAAGAA; Ym2, TTCTTTCTTAAGAA) (Fig. 3C). Ym2 in this model (Fig. 2, G and H). The epitopes in ovalbumin Not only are the sequences up-stream of exon 1 conserved, required for induction of Ym1 appear to be conserved so suffi- but the first 1700 nucleotides down-stream of exon 1 are also ciently in bovine serum albumin that challenge with bovine 93% identical. Although STAT binding sites were common in serum albumin, but not lysozyme, also induced Ym1 expression the up-stream sequences, the conserved sequence down-stream (Fig 5, A and B). Using adhesion selection of peritoneal cells of exon 1 contained only two sites. An unshared insertion of 500 recovered 24 h after ova challenge, we found that the macro- nucleotides (Ym1) or 2000 nucleotides (Ym2) followed the re- phage population was responsible for nearly all of the resulting gion of downstream homology. Then, 500 nucleotides up- peritoneal expression of Ym1 (Fig. 5B). stream of exon 2, homology resumed and continued through the Previous studies have characterized Ym1 as an eosinophil end of exon 3 (Fig. 3B). This high degree of genomic similarity chemokine (37). We were unable to observe expression of other suggests that Ym1 and Ym2 were generated by a recent gene eosinophil chemokines transcripts, chemokine C-C motif ligand duplication event. 5 (Ccl5) and Eotaxin, under identical conditions (data not Allergic Expression of Ym1—To investigate the role of the shown). The high level of Ym1 expression and lack of Ccl5 and IL-4-STAT6 pathway in regulation of Ym1 expression in vivo, Eotaxin transcripts suggests a potential role of Ym1 in this we examined the possibility that Ym1 might be expressed in a eosinophil recruitment. model of murine allergic peritonitis where the release of both Ym1 was characterized recently as a highly expressed neu- IL-4 and IL-5 precedes a peritoneal eosinophilia (16 –18). We trophil protein (38). We also observed Ym1 expression in bone found that T 2-biased BALB/c mice sensitized subcutaneously marrow cells and that this expression decreased over a period with ovalbumin in aluminum hydroxide followed by an ovalbu- of 7 days as the granulocytic cells died out, and the population min challenge (ova) dramatically up-regulated their peritoneal matured into macrophages (data not shown). It is likely that expression of Ym1 transcripts in comparison to mice not sen- the high expression of Ym1 observed 6 h after challenge (Fig. sitized but challenged similarly (Fig. 5A). T 1-biased C57Bl/6 5A) is the result of an early recruited neutrophil population. mice, which mount less robust responses to allergic challenge, However, Ym1 expression remained high in peritoneal cells 24 induced Ym1 expression much less profoundly (data not and 48 h following challenge (Fig. 5A) (data not shown). By 42826 STAT6-dependent Expression of Ym1 in Macrophages FIG.4. STAT6 binding to Ym1 up- stream elements. A, EMSA of nuclear extracts from BM-M derived from BALB/c- and STAT6-deficient mice treated for 24 h with IL-4 (10 ng/ml). Probes A-D correspond to sequences de- scribed in the legend to Fig. 3. B, EMSA of nuclear extracts from differentiated ECoM-M cells treated for 24 h with IL-4 (10 ng/ml). Only the upper half of the gel exhibiting protein-DNA complexes is il- lustrated. C, promoter analysis of Ym1 up-stream elements in BEAS-2B cells. Cells were transfected with the indicated reporter constructs and STAT6-pcDNA3 expression vector (28, 29), treated for 24 h with human IL-4 (10 ng/ml) as indicated prior to analysis of luciferase activity. D, promoter analysis of Ym1 upstream ele- ments in RAW 264.7 macrophages. Cells were transfected with the indicated pro- moter constructs and a STAT6 expression vector and treated for 16 h with murine IL-4 (20 ng/ml) prior to analysis of lucif- erase activity. Induction of the 3xC-TK construct (35-fold) was approximately twice that observed for the 4xSTAT6-TK promoter (16-fold) in this experiment (data not shown). then, the population of peritoneal neutrophils has been re- sensitization with anti-2,4-dinitrophenol IgE followed by 2,4- placed nearly completely by macrophages (16, 39, 40). This dinitrophenol-bovine serum albumin challenge altered perito- pattern of prolonged cellular expression following ova chal- neal cell Ym1 expression (data not shown). More importantly, lenge, in addition to the adhesion selection, supports a role of mast cell-deficient mice responded with Ym1 expression in- macrophage-expressed Ym1 in the allergic response to ova crease similar to wild type mice (Fig. 6B). Adoptive transfer of peritoneal challenge. T-cell-enriched splenocytes from sensitized mice to na¨ ıve mice Three lines of evidence support a role of IL-4 in the ova also did not alter the Ym1 expression of mice challenged sub- challenge increase of macrophage Ym1 expression. First, this sequently (Fig. 6A). Likewise, exposing macrophages from con- up-regulation is not seen in STAT6-deficient mice both sensi- trol animals to splenocytes from sensitized animals in the tized and challenged with ova or in STAT6-deficient mice sen- presence of ovalbumin did not increase Ym1 expression (data sitized and challenged subsequently after adoptive transfer of not shown). These experiments suggest that the cell signaling wild type splenocytes from sensitized animals (Fig. 6A). Sec- the macrophage to increase Ym1 expression is likely neither a ond, injection of anti-IL-4 (11B.11) 1 h prior to and 4 h after ova mast cell nor a T-cell found in the splenocyte compartment. challenge blocked subsequent Ym1 expression (Fig. 5A). Third, Although Ym1 has been demonstrated to induce eosinophil intraperitoneal injection of IL-4, but not IL-5, IL-10, or IL-13, chemotaxis, Ym1 expression during allergic peritonitis does not resulted in up-regulation of Ym1 message (Fig. 5A) (data not appear necessary for general peritoneal recruitment of eosino- shown). phils. Although the adoptive transfer of splenocytes did not Although both mast cells (41) and splenic T-cells have been induce Ym1 expression, it did confer partial ability to recruit demonstrated to release IL-4, neither of these cells appear eosinophils to the general peritoneal cavity, suggesting that responsible for the macrophage expression of Ym1 during ova- Ym1 may not be essential for eosinophil transepithelial recruit- challenged allergic peritonitis. Neither intraperitoneal injec- ment (data not shown). tion of the mast cell activating chemical 48/80 nor passive STAT6-dependent Expression of Ym1 in Macrophages 42827 FIG.6. Lack of regulation of Ym1 expression during allergic peritonitis by splenic T-cells and mast cells. A, mice were sensi- tized on day 1 and 7. On day 14, indicated mice received 10  10 splenocytes intravenously following negative selection for major histo- compatibility complex II from sensitized (S) or control (C) animals. 24 h later, indicated mice were challenged. Peritoneal cells were harvested following an additional 24 h, and total RNA was subjected to Northern FIG.5. Ym1 expression during allergic peritonitis. A, mice were blot analysis. B, mast cell-deficient mice and littermate controls were sensitized by subcutaneous injection of ovalbumin in alum on days 1 sensitized, and indicated mice were challenged. 24 h later peritoneal and 7. On day 14, mice were challenged with 10 g of ova or 10 ng of cells were harvested and subjected to Northern blot analysis. Duplicate cytokine in PBS. Peritoneal cells were harvested on day 15 and sub- lanes represent individual mice. jected to Northern blot analysis. B, mice were sensitized and challenged as before, and peritoneal cells were subjected to5hof adhesion selec- tion to plastic tissue culture dishes prior to RNA extraction and North- with a free amine group, such as GlcN, found in many lectin ern blot analysis. C, mice were injected with 1 mg of IL-4 (11B.11) 1 h receptors. This has lead to a final proposal that Ym1 might act prior to and 4 h after challenge. Peritoneal cells were harvested 24 h in inflammatory resolution by masking lectin binding sites and after ova challenge. Duplicate lanes represent separate mice. preventing entry of new inflammatory cells to the site (43). However, this is clearly not an essential part of all inflamma- DISCUSSION tory resolution as macrophages elicited during thioglycollate Regulation of Ym1 Expression by T 2 Cytokines and Allergic peritonitis express low levels of Ym1. Challenge—Ym1 has been characterized previously as a se- The present studies demonstrate that Ym1 is a highly in- creted, self-crystallizing member of the chitinase family that is duced IL-4 and IL-13 target gene in multiple macrophage pop- expressed during peritoneal exposure to nematodes. Specula- ulations. While this manuscript was in preparation, Raes et al. tion as to the physiological and pathological function of Ym1 (44) also reported macrophage induction of a Ym1 or Ym2 and the highly related Ym2 is difficult at this time. Although transcript in response to the cytokines IL-4 and IL-13. The use both Ym1 and Ym2 contain mutations in their active site that of microarrays in the present studies to profile global transcrip- exist only in members of the chitinase family without chitinase tional responses of macrophages to IL-4 indicated that the Ym1 activity, one group did observe chitinase activity (42), but oth- or Ym2 transcript is one of the genes induced most dramati- ers could not (37, 38). If Ym1 or Ym2 do exhibit chitinase cally in response to T 2 cytokine stimulation. We further iden- activity, it is possible that they act as nonspecific immune tified this Ym transcript as Ym1 and demonstrated that this agents. Chitin is a common element in organisms including induction does not occur in macrophages derived from STAT6- parasites, fungi, and bacteria but does not occur in mammalian deficient mice, indicating that Ym1 is a target of the IL-4/ tissue (42), allowing for a selective anti-microbial activity of a STAT6 signal transduction pathway. chitinase. Alternatively, Ym1 may serve a role in the removal In addition, we observed a striking induction of macrophage of chitin-containing antigens following invasions by such mi- Ym1 expression during allergic challenge of ova-sensitized croorganisms (38). Ym1 has been characterized as an eosino- mice. The induction of peritoneal and alveolar eosinophilia by phil chemokine (37). However, another group was unable to allergic challenge has been shown previously to elicit the re- observe eosinophil chemotaxis in response to Ym2 (34). This lease of IL-4 (7). Deletion of STAT6 (45, 46) or the blockade of may be because of subtle differences between Ym1 and Ym2, both IL-4 and IL-13 activity (47, 48) has been observed to but this seems unlikely as the two are highly conserved, and prevent eosinophil accumulation and airway hyper-reactivity the proposed CXC motif is preserved in both (37). If Ym1 or in murine models of allergy. The high level of Ym1, in addition Ym2 does function as an eosinophil chemokine, this would to arginase I, in macrophages during allergic challenge sug- indicate a mechanism of macrophage-eosinophil cross-talk via gests that these are both distinct markers of macrophage re- Ym1/2 expression unexplored previously and would suggest sponse to T 2 cytokines and that they are likely to play an that such eosinophil cross-talk may be an important part of the important role in allergic immune function. macrophage response to T 2-type cytokines. Finally, analysis Webb et al. (34) observed recently striking induction of Ym2 of Ym1 crystal structure indicated the presence of a / TIM in a model of allergic eosinophilia similar to the one we applied. barrel similar to the lectin family of cell surface receptors. They observed, after intraperitoneal sensitization with ovalbu- Indeed, Ym1 has also been shown to bind to oligosaccharides min, that repeated aerosol challenge of ovalbumin led to eosi- 42828 STAT6-dependent Expression of Ym1 in Macrophages nophilia and cellular expression of both Ym1 and Ym2 in bron- promoter was sufficient to transfer IL-4-dependent induction chial alveolar lavage (BAL) fluid, with Ym2 as the dominate better than that observed for the Ym1 promoter itself. These expressed Ym member. They also found the increase in Ym findings suggest that the binding of activated STAT6 to the A expression, and release depended on the IL-4R subunit and on and C sites results in combinatorial interactions with addi- tional factors that together mediate robust transcriptional re- the release of IL-4 or IL-13. In contrast, we observed a striking STAT6-dependent macrophage induction of Ym1, but not sponse of the Ym1 promoter to IL-4. It will be of interest in Ym2, following subcutaneous sensitization and peritoneal future studies to identify factors that cooperate with STAT6 in this manner. challenge with ovalbumin. We also observed some subtle differences in the regulation of these allergic-induced Ym The promoter regions of Ym1 and Ym2 are highly related, sequences. First, peritoneal Ym1 expression could be blocked with near complete conservation of the STAT6 binding sites by injection of anti-IL-4. In contrast, BAL Ym induction could observed. Despite remarkable sequence conservation, differen- only be abrogated with the blockade of both IL-4 and IL-13. tial basal expression of Ym1 and Ym2 expression have been demonstrated by two groups (7, 50). Both groups found basal Second, intraperitoneal injection of IL-4, but not IL-13, was sufficient to induce Ym1 expression, whereas expression of Ym1 expression highest in spleen and lung with lower expres- Ym protein in BAL cells could be induced with exposure to sion in thymus, intestine, and kidney, whereas Ym2 expression was found highest in stomach with lower levels in thymus and IL-13 alone. Third, adoptive transfer of T-cell-enriched splenocytes was insufficient to induce Ym1 expression follow- kidney. The high degree of genomic similarity indicates that Ym1 and Ym2 were likely generated by a duplication event. ing ova challenge in a na¨ ıve mouse, whereas depletion of The conservation of STAT6 sites likely accounts for the simi- CD4 T-cells with the GK1.5 antibody abolished Ym expres- sion in BAL cells. This final difference suggests that either larly striking induction of Ym1 and Ym2 expression in T 2- type environments but cannot account for either the spatial the cell population signaling macrophage Ym1 expression segregation of peritoneal Ym1 and lung Ym2 expression during during peritoneal ova challenge is different from the popula- tion that signals cellular expression of BAL Ym, or that it is allergic challenge or for the distinct and largely non-overlap- ping patterns of basal expression. Intriguingly, the presence of a common population of CD4 T-cells, which exists outside the D site inhibited basal expression of Ym1-TK fusion genes in the splenic population. BEAS-2B cells, but not in RAW 264.7 macrophages, suggesting Peritoneal Ym1 expression has also been described in mice a role of this element in cell-specific control of Ym1 expression. infected with either Mesocestoides corti (37) or Brugia malayi Consistent with this, we observed a distinct complex bound to (49). In contrast to the allergic induction of Ym1 or Ym2, M. the D site in the ECoM-M cells that was not observed in the corti induction of Ym1 required CD4-CD8 T-cells. Further- BM-M. Sherman (41) identified an IL-4-inducible complex more, deletion of IL-4 or IL-5 alone was insufficient to inhibit bound to the canonical STAT6 element up-stream of the IL-4 B. malayi-induced Ym1 expression. As in the lung allergic promoter, but which had a faster mobility in mast cells com- response, this would support a more important physiologic role pared with B-cells and acted as a repressor. This complex was for IL-13 than would be inferred from experiments involving absent in mast cell extracts from STAT6-deficient mice, sug- peritoneal allergic challenge. gesting that it comprises a novel STAT6 isoform. Although Mechanisms Responsible for IL-4-dependent Activation of differences in tissue-specific expression of Ym1 and Ym2 are Ym1—To characterize the molecular mechanisms underlying likely to be accounted for or by essential enhancer sequences the transcriptional response of Ym1 to IL-4, we analyzed the located outside the conserved genomic regions, it is possible that Ym1 promoter and identified Cis-active elements that are es- a novel STAT6 isoform or other cell type-specific factors binding sential for IL-4 induction. The Ym1 promoter exhibits a canon- to the identical D sites in their respective promoters act to re- ical TATAA box 30 nucleotides up-stream of the site of tran- strict Ym1 and Ym2 expression to appropriate cell types. scriptional initiation and thus represents a conventional PolII In conclusion, we have shown a striking effect of IL-4 on promoter. In addition, multiple potential STAT binding sites macrophage transcription programs exemplified by the induc- were identified within a 600-bp region of 5-flanking informa- tion of arginase I and Ym1. We characterized the promoter tion that was sufficient to mediate induction by IL-4 in tran- sequence of Ym1 and identified three new functional STAT6 sient transfection assays. Although the A, B, and C sites within binding sites, demonstrated the requirement of STAT6 activity this region match the TTCN GAA consensus sequence identi- for IL-4-stimulated induction, and identified the 5-most site, fied previously for STAT6, only the A and C sites bound STAT6- the A site, as essential for IL-4 responsiveness. Furthermore, containing complexes with high affinity in EMSA experiments. we found that peritoneal macrophages in an allergic, T 2-type The obligate participation of STAT6 in protein complexes bind- H environment express high levels of Ym1, suggesting an impor- ing to the A and C sites was demonstrated unambiguously by tant function for the chitinase family members in T 2-biased the lack of binding activity in nuclear extracts derived from H immune response. Ym1 is related closely to Ym2, which is also STAT6-deficient macrophages. The B site contains two over- highly induced during a similar lung allergic challenge. How- lapping STAT6 consensus sequences, such that ambiguity in ever, the near identity of the proximal and distal sequences selection of half-sites by STAT6 dimers could potentially in- surrounding exon 1 of Ym1 and Ym2 can account only for their hibit high affinity binding. Alternatively, the flanking or spacer common responses to STAT6 signaling during ovalbumin-in- sequences in the B site may inhibit STAT6 binding by more duced allergic eosinophilia but cannot account for their distinct general mechanisms, i.e. unfavorable base-specific contacts separation in tissue specificity. These data indicate that the with residues in the STAT6 DNA binding domain. chitinase family members Ym1 and Ym2, in addition to argin- The combination of A site with elements surrounding the ase I, are highly induced during alternative macrophage acti- TATAA box was essential for IL-4-dependent activation of the vation, are likely to play important roles in T 2-biased immune Ym1 promoter in both BEAS-2B cells and RAW 264.7 macro- responses. and may be used as markers of macrophage re- phages. Removal of the A site abolished IL-4 responsiveness, sponse to T 2 stimulation. whereas transfer of the A-C or A-B regions to the basal TK H promoter resulted in much weaker responses to IL-4 than the Acknowledgments—We thank Shioko Kimura for providing the anti- Ym1 promoter itself. Although not essential in these assays, Ym1 antibody, Christoph Binder for help with the adoptive transfer insertion of three copies of the C site up-stream of the basal TK experiments, and Jana Collier for technical assistance. STAT6-dependent Expression of Ym1 in Macrophages 42829 REFERENCES Biol. 18, 3851–3861 26. Jin, H. M., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Kirkpatrick, R. B., 1. Gordon, S. (1998) Res. Immunol. 149, 685– 688 and Rosenberg, M. (1998) Genomics 54, 316 –322 2. Newman, S. L. (1999) Trends Microbiol. 7, 67–71 27. Ricote, M., Li, A. C., Willson, T. M., Kelly, C. J., and Glass, C. K. (1998) Nature 3. Mosmann, T. R., Cherwinski, H., Bond, M. W., Giedlin, M. A., and Coffman, 391, 79 – 82 R. L. (1986) J. Immunol. 136, 2348 –2357 28. Patel, B. K., Pierce, J. H., and LaRochelle, W. J. (1998) Proc. Natl. Acad. Sci. 4. Heinzel, F. P., Sadick, M. D., Holaday, B. J., Coffman, R. L., and Locksley, U. S. A. 95, 172–177 R. M. (1989) J. Exp. Med. 169, 59 –72 29. Patel, B. K., Wang, L. M., Lee, C. C., Taylor, W. G., Pierce, J. H., and 5. Scott, P., Natovitz, P., Coffman, R. L., Pearce, E., and Sher, A. (1988) J. Exp. LaRochelle, W. J. (1996) J. Biol. Chem. 271, 22175–22182 Med. 168, 1675–1684 30. Raveh, D., Kruskal, B. A., Farland, J., and Ezekowitz, R. A. (1998) J. Leukocyte 6. Maeyer, E. D., and Maeyer-Guignard, J. D. (1998) in The Cytokine Handbook Biol. 64, 108 –113 (Thomson, A. W., ed) 3rd Ed., pp. 491–516, Academic Press, San Diego 31. Ihn, H., Yamane, K., Asano, Y., Kubo, M., and Tamaki, K. (2002) J. Immunol. 7. Finkelman, F. D., and Urban, J. F., Jr. (2001) J. Allergy Clin. Immunol. 107, 168, 1895–1902 772–780 32. Rutschman, R., Lang, R., Hesse, M., Ihle, J. N., Wynn, T. A., and Murray, P. J. 8. Mills, C. D., Kincaid, K., Alt, J. M., Heilman, M. J., and Hill, A. M. (2000) (2001) J. Immunol. 166, 2173–2177 J. Immunol. 164, 6166 – 6173 33. de Vries, J. E. (1998) J Allergy Clin. Immunol. 102, 165–169 9. Dickensheets, H. L., and Donnelly, R. P. (1999) J. Leukocyte Biol. 65, 307–312 34. Webb, D. C., McKenzie, A. N., and Foster, P. S. (2001) J. Biol. Chem. 276, 10. Goerdt, S., Politz, O., Schledzewski, K., Birk, R., Gratchev, A., Guillot, P., 41969 – 41976 Hakiy, N., Klemke, C. D., Dippel, E., Kodelja, V., and Orfanos, C. E. (1999) 35. Ivashkiv, L. B. (1995) Immunity 3, 1– 4 Pathobiology 67, 222–226 36. Conrad, D. J., and Lu, M. (2000) Am. J. Respir. Cell Mol. Biol. 22, 226 –234 11. Goerdt, S., and Orfanos, C. E. (1999) Immunity 10, 137–142 37. Owhashi, M., Arita, H., and Hayai, N. (2000) J. Biol. Chem. 275, 1279 –1286 12. Chomarat, P., Rybak, M. E., and Banchereau, J. (1998) in The Cytokine 38. Harbord, M., Novelli, M., Canas, B., Power, D., Davis, C., Godovac- Handbook (Thomson, A. W., ed) 3rd Ed., pp. 149 –150, Academic Press, San Zimmermann, J., Roes, J., and Segal, A. W. (2002) J. Biol. Chem. 277, Diego 5468 –5475 13. Paludan, S. R. (1998) Scand. J. Immunol. 48, 459 – 468 39. Zuany-Amorim, C., Leduc, D., Vargaftig, B. B., and Pretolani, M. (1994) Ann. 14. Bogdan, C., and Nathan, C. (1993) Ann. N. Y. Acad. Sci. 685, 713–739 N. Y. Acad. Sci. 725, 34 – 43 15. Hart, P. H., Bonder, C. S., Balogh, J., Dickensheets, H. L., Donnelly, R. P., and 40. Das, A. M., Ajuebor, M. N., Flower, R. J., Perretti, M., and McColl, S. R. (1999) Finlay-Jones, J. J. (1999) J. Leukocyte Biol. 66, 575–578 Clin. Exp. Immunol. 117, 223–229 16. Zuany-Amorim, C., Leduc, D., Vargaftig, B. B., and Pretolani, M. (1993) Br. J. 41. Sherman, M. A. (2001) Immunol. Rev. 179, 48 –56 Pharmacol. 110, 917–924 42. Guo, L., Johnson, R. S., and Schuh, J. C. (2000) J. Biol. Chem. 275, 8032– 8037 17. Zuany-Amorim, C., Creminon, C., Nevers, M. C., Nahori, M. A., Vargaftig, 43. Chang, N. C., Hung, S. I., Hwa, K. Y., Kato, I., Chen, J. E., Liu, C. H., and B. B., and Pretolani, M. (1996) J. Immunol. 157, 377–384 Chang, A. C. (2001) J. Biol. Chem. 276, 17497–17506 18. Walker, C., Checkel, J., Cammisuli, S., Leibson, P. J., and Gleich, G. J. (1998) 44. Raes, G., De Baetselier, P., Noel, W., Beschin, A., Brombacher, F., and J. Immunol. 161, 1962–1969 Hassanzadeh, G. (2002) J. Leukocyte Biol. 71, 597– 602 19. Munder, M., Eichmann, K., Moran, J. M., Centeno, F., Soler, G., and Modolell, 45. Akimoto, T., Numata, F., Tamura, M., Takata, Y., Higashida, N., Takashi, T., M. (1999) J. Immunol. 163, 3771–3777 Takeda, K., and Akira, S. (1998) J. Exp. Med. 187, 1537–1542 20. Nau, G. J., Richmond, J. F., Schlesinger, A., Jennings, E. G., Lander, E. S., and 46. Kuperman, D., Schofield, B., Wills-Karp, M., and Grusby, M. J. (1998) J. Exp. Young, R. A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 1503–1508 Med. 187, 939 –948 21. Ehrt, S., Schnappinger, D., Bekiranov, S., Drenkow, J., Shi, S., Gingeras, T. R., Gaasterland, T., Schoolnik, G., and Nathan, C. (2001) J. Exp. Med. 194, 47. Webb, D. C., McKenzie, A. N., Koskinen, A. M., Yang, M., Mattes, J., and Foster, P. S. (2000) J. Immunol. 165, 108 –113 1123–1140 22. Celada, A., Gray, P. W., Rinderknecht, E., and Schreiber, R. D. (1984) J. Exp. 48. Tomkinson, A., Duez, C., Cieslewicz, G., Pratt, J. C., Joetham, A., Shanafelt, M. C., Gundel, R., and Gelfand, E. W. (2001) J. Immunol. 166, 5792–5800 Med. 160, 55–74 23. Sykes, D. B., and Kamps, M. P. (2001) Blood 98, 2308 –2318 49. Falcone, F. H., Loke, P., Zang, X., MacDonald, A. S., Maizels, R. M., and Allen, J. E. (2001) J. Immunol. 167, 5348 –5354 24. Ausubel, F. M. (2001) Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York 50. Ward, J. M., Yoon, M., Anver, M. R., Haines, D. C., Kudo, G., Gonzalez, F. J., 25. Guidez, F., Li, A. C., Horvai, A., Welch, J. S., and Glass, C. K. (1998) Mol. Cell. and Kimura, S. (2001) Am. J. Pathol. 158, 323–332

Journal

Journal of Biological Chemistry – Unpaywall

Published: Nov 1, 2002

There are no references for this article.