Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Cloning of the Human GLI2 Promoter

Cloning of the Human GLI2 Promoter THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 46, pp. 31523–31531, November 13, 2009 © 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. TRANSCRIPTIONAL ACTIVATION BY TRANSFORMING GROWTH FACTOR- VIA □ S SMAD3/-CATENIN COOPERATION Received for publication, August 26, 2009 Published, JBC Papers in Press, September 21, 2009, DOI 10.1074/jbc.M109.059964 1 2 Sylviane Dennler , Jocelyne Andre´, Franck Verrecchia, and Alain Mauviel From INSERM, U697, Universite´ Paris-Diderot, 75010 Paris, France GLI2 (GLI-Kruppel family member 2), a zinc finger transcrip- intracellular cascade, which ultimately leads to the activation tion factor that mediates Hedgehog signaling, is implicated in and nuclear translocation of zinc finger transcription factors of the progression of an ever-growing number of human malignan- the GLI family (7). While Hh signaling favors the stabilization of cies, including prostate and pancreatic cancer, as well as basal the GLI2 protein by inhibiting its proteasomal degradation, it cell carcinoma of the skin. Its expression is up-regulated by also induces the expression of GLI1 and PTCH-1 in a GLI2-de- transforming growth factor- (TGF-) in a variety of cell types, pendent manner (8). both normal and transformed. We report herein that TGF-- There is broad evidence for a functional implication of GLI2 driven GLI2 expression is transcriptional and does not result in the development of solid tumors. For example, GLI2 knock- from stabilization of GLI2 transcripts. We describe the char- down with specific small hairpin RNA or antisense oligonucleo- acterization of the 5-flanking sequence of human GLI2 tides in prostate cancer cells reduces anchorage-independent mRNA, the identification of a transcription start site, the colony formation, delays tumor xenograft growth in vivo, and cloning of 1,600 bp of the regulatory promoter region and enhances paclitaxel chemosensitivity (9, 10). Similarly, GLI2- the identification and functional analysis of a TGF--respon- specific antisense oligonucleotides inhibit the proliferation of sive region mapped to a 91-bp sequence between nucleotides hepatocellular carcinoma cell lines, through the regulation of 119 and 29 of the promoter. This region harbors SMAD genes implicated in cell cycle and apoptosis (11). Moreover, in a and lymphoid enhancer factor/T cell factor binding sites that mouse tumor allograft model, Gli2 silencing in epithelial cells allow functional cooperation between SMAD3 and -cate- that constitutively express an active form of GLI2 (GLI2N2) nin, recruited to the promoter in response to TGF- to drive has unambiguously demonstrated the important role played by GLI2 gene transcription. GLI2 in preventing apoptosis and promoting tumor microvas- cularization (12). Together, these data support the notion that suppression of GLI2 expression may represent a valuable ther- During embryonic development, several key signaling path- apeutic option for the treatment of several cancers (13). ways such as Hedgehog (Hh) , Wnt, and transforming growth Although GLI activation may result from Hh ligand- or Hh factor- (TGF-) govern fundamental cell fate decisions that receptor-induced signaling, recent evidence has shown the pos- regulateproliferationanddifferentiationinatime-andposition- sible implication of noncanonical, Hh-independent signaling dependent fashion. Deregulation of these pathways contributes pathways to regulate GLI expression and/or activity (14). Thus, to the onset or to the development of tumors (1–4). Constitu- the identification of pathways leading to GLI activation is crit- tive activation of Hh signaling has been implicated in the ical for adequate therapeutic targeting. In this context, we have growth of several human malignancies ranging from semima- previously identified TGF- as a potent and ubiquitous inducer lignant tumors of the skin to highly aggressive cancers of the of GLI1 and GLI2 expression in both normal and transformed brain, pancreas, and prostate (5, 6). Cellular responses to Hh are cells (15). initiated by ligand binding to the tumor suppressor transmem- TGF-s encompass a large family of secreted proteins. To brane receptor PTCH-1 (Patched-1). This interaction releases trigger their biological effects, TGF-s bind to type I and the inhibitory effect of PTCH-1 on the seven-transmembrane II serine/threonine kinase receptor complexes. Ligand-de- signaling protein Smoothened (SMOH), thus initiating the Hh pendent receptor activation leads to the recruitment and phosphorylation of intracellular mediators of TGF- signal * This work was supported by the Donation Henriette et Emile Goutie`re (to transduction, namely the SMAD proteins (16, 17). In most A. M.), Cance´ropoˆ le Ile-de-France, and INSERM. □ S The on-line version of this article (available at http://www.jbc.org) contains cell types, TGF-1 induces the activation of SMAD2 and supplemental Table 1. 1 SMAD3 and their association with SMAD4. These complexes Recipient of a postdoctoral fellowship from Institut National du Cancer and relay signals from the cell membrane to the nucleus where Re´gion Ile-de-France. To whom correspondence should be addressed: INSERM, U697, Hoˆ pital SMAD3SMAD4 complexes bind to specific cis-elements, ei- Saint-Louis, 1 Avenue Claude Vellefaux, 75010 Paris, France. Tel.: 33-153- ther alone or in cooperation with other transcription factors 722-069; Fax: 33-153-722-051; E-mail: [email protected]. and co-activators that regulate the transcription of TGF- tar- The abbreviations used are: Hh, Hedgehog; siRNA, small interfering RNA; 5-RACE, 5-rapid amplification of cDNA ends; TRU, TGF--responsive get genes (18, 19). unit; WT, wild-type; CREB, cAMP-responsive element-binding protein; LEF/ In this report, we describe the cloning and functional char- TCF, lympoid enhancer factor/T cell factor; TBE, LEF/TCF binding element; SBE, SMAD3/4 binding element; MLP, major late promoter. acterization of the human GLI2 promoter. We also identify a This is an Open Access article under the CC BY license. NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31523 Human GLI2 Promoter Transactivation by TGF- 91-bp TGF- responsive region whereby TGF- recruits CTGAAATCCCACATACCCTCCCGCCAC; mutant TCF/ SMAD3 and -catenin to induce GLI2 transcription. LEF site (mT) forward, 5-CTCGTTAGAGGAGGCCG- AAGAAACCAGGTGGCGGG; mT reverse, 5-CCCGCCAC- EXPERIMENTAL PROCEDURES CTGGTTTCTTCGGCCTCCTCTAACGAG. Putative bind- Cell Cultures and Reagents—HaCaT immortalized human ing sites are shown in bold, and mutated bases are underlined. keratinocytes and HepG2 hepatocarcinoma cell lines were After amplification, promoter fragments were subcloned into maintained in Dulbecco’s modified Eagle’s medium with 10% the BglII/HindIII sites of pGL3-Basic. TS constructs containing fetal bovine serum and antibiotics (Invitrogen, Cergy-Pon- 1 (TS), 2 (TS2), or 4 (TS4) concatamerized copies of the 66/ toise, France). When indicated, cells were serum-starved for 25 region of the human GLI2 promoter, were obtained by 16 h and treated with 5 ng/ml human recombinant TGF-1 inserting the following double-stranded oligonucleotides into (R&D Systems, Lille, France). Control cultures received corre- the pGL3-Basic XhoI site (italic): 5-TCGAGGAGGAGTTCA- sponding TGF- vehicle buffer (4 mM HCl, 0.1% bovine serum AAGAAACCAGGTGGCGGGAGGGTGTCTGGGATC and albumin). Cycloheximide and actinomycin D were obtained its complementary strand: 5-TCGAGATCCCAGACACCCT- from Euromedex (Strasbourg, France). Small interfering RNAs CCCGCCACCTGGTTTCTTTGAACTCCTCC. TmS4, in (siRNAs) were purchased from Ambion/Applied Biosystems which the SMAD binding element (bold) is mutated to ATGT (Courtabœuf, France). (bold underlined), was obtained by subcloning four copies of Multiplex and Real-time PCR—Total RNA was prepared the following oligonucleotide: 5-TCGAGGAGGAGTTCAA- using a column-based commercial kit (Macherey-Nagel, AGAAACCAGGTGGCGGGAGGGTATGTGGGATC and its Hoerdt, France). Genomic DNA-free RNA was then converted complementary strand: 5-TCGAGATCCCACATACCC- into cDNA using the ThermoScript RT-PCR system (Invitro- TCCCGCCACCTGGTTTCTTTGAACTCCTCC. gen). cDNAs were used for multiplex PCR according to Transfections and Luciferase Reporter Assays—24 h prior to the manufacturer’s recommendations (Qiagen, Courtabœuf, transfection, HaCaT and HepG2 cells were plated in 24-well France), real-time PCR using a Power SYBR Green mixture on plates and transfected with siRNA (Ambion/Applied Biosys- TM an AB7300 apparatus (Applied Biosystems), or for 5-rapid tems) using HiPerfect (Qiagen) when indicated. The follow- amplification of cDNA ends (5-RACE). PCR primer sequences ing day, cells at 40% confluency were transfected with 200 ng and specific PCR conditions are available upon request. of firefly luciferase promoter reporter construct together with 5-RACE—5-RACE was performed using a commercial kit 15 ng of expression vector (when necessary) using JetPEI (Invitrogen). cDNA synthesis was performed using total RNA (PolyPlus Transfection, Strasbourg, France). 40 ng of phRL- from HaCaT cells primed with the following gene-specific MLP Renilla luciferase expression vector was co-transfected to primer, 5-AGAGATCATGGAGAGCGTGG located in exon 4 estimate transfection efficiencies. phRL-MLP was generated by of the GLI2 gene. PCR of the dC-tailed cDNA was performed cloning the adenovirus major late promoter (MLP) upstream of with the AAP primer included in the kit, together with a primer the Renilla luciferase gene as a BgIII/HindIII insert within corresponding to a sequence located in exon 2 of human GLI2: phRL-null (Promega). For each protocol, at least three inde- 5-ATCTCAGCCGCTCATCGTC. Finally, nested PCR was pendent experiments were performed. Sixteen h post-transfec- performed using the AUAP primer of the kit and the exon 1 tion, cells were serum-starved in 0.5% serum-containing primer: 5-TTGGGGAAGCTTCTGACCTTGCTCTTTGAT- medium and treated 8 h later with TGF-1 for 16 h. Cells were GTG, which contains a HindIII site (underlined). The indicated lysed, and luciferase activity was determined with the Dual- exonic information refers to the published NM_005270.3 Gen- Luciferase reporter assay system (Promega) using a Fluoroskan TM Bank sequence. The PCR products containing the unknown Ascent FL (Thermo LabSystems). In each experiment, pro- 5 upstream region of GLI2 transcripts were digested with moter activity is expressed as the firefly/Renilla ratio relative to MluI/HindIII and inserted into the MluI/HindIII sites of pGL3- internal control conditions. Expression vectors for GLI2, Basic for sequencing. SMAD3, TCF4, and constitutively active -catenin (B23) have Reporter Gene Constructs—Genomic DNA was extracted been described previously (20–23). from HaCaT cells using a commercial kit (Qiagen). Various Western Analyses—Cells were lysed in 1% SDS lysis buffer fragments of the human GLI2 promoter were amplified from (10 mM Tris, pH 7.4, 1% SDS, and 1 mM sodium orthovana- genomic DNA, using BglII-containing forward primers and a date). Equal amounts of protein were boiled with Laemmli HindIII-containing reverse primer. PCR products were sub- buffer and subjected to 10% SDS-PAGE. Proteins were then cloned into pGL3-Basic vector (Promega, Charbonnieres, transferred onto nitrocellulose membranes (Amersham Bio- France) and sequenced. The sequence of the constructs is iden- sciences). Membranes were blocked with 5% nonfat milk in TM tical to the sequence of human chromosome 2, Genbank phosphate-buffered saline containing 0.1% Tween 20 for1hat NW_001838848.1. Site-directed mutagenesis to inactivate the room temperature and incubated overnight at 4 °C with the SMAD and lymphoid enhancer factor/T cell factor (TCF/LEF) primary antibody. After several washes, membranes were incu- binding sites, respectively, at positions 33 and 60 of the bated in blocking buffer with a secondary antibody coupled to promoter was carried out according to the DpnI-based horseradish peroxidase (Santa Cruz Biotechnology) for2hat QuikChange site-directed mutagenesis methodology (Strat- room temperature. Antigenantibody complexes were detected agene, La Jolla, CA) with the following primers: mutant using ECLplus (Amersham Biosciences/GE Healthcare, Velizy, SMAD site (mS) forward, 5-GTGGCGGGAGGGTATGT- France) and revealed with a Storm PhosphorImager (Amer- GGGATTTCAGGTTTCAGG; mS reverse, 5-CCTGAAAC- sham Biosciences/GE Healthcare). Anti-Myc, anti-SMAD3, 31524 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 46 • NOVEMBER 13, 2009 Human GLI2 Promoter Transactivation by TGF- and anti-HSP60 were purchased from Santa Cruz Biotechnol- ogy, whereas anti--catenin was from BD Biosciences. Anti-- actin was obtained from Sigma-Aldrich. Chromatin Immunoprecipitation—HaCaT cells were grown to 60–70% confluency on 15-cm plates then serum-starved in 0.5% serum-containing medium for 16 h and stimulated with TGF- for the indicated time. Chromatin immunoprecipita- tion was carried out using the ChIP-IT express kit (Active Motif, Rixensart, Belgium). Briefly, 4 g of enzymatically sheared chromatin were immunoprecipitated using 4 gof antibody against IgG (Santa Cruz Biotechnology), SMAD3, or -catenin overnight at 4 °C, then incubated for another 2 h at 4 °C with protein G beads. Precipitated DNA was used for PCR analysis using human GLI2 promoter-specific prim- ers: forward, 5-GAAGATCTCTGTGACTTTAATGCGG- TGTG; reverse, 5-TTGGGGAAGCTTCACCCTGAAACC- TGAAATCCC. Amplimers were visualized by agarose gel electrophoresis. RESULTS TGF-1 Increases GLI2 Expression but Does Not Stabilize Either GLI2 Transcripts or GLI2 Protein—Treatment of human immortalized HaCaT keratinocytes with TGF-1 led to rapid elevation of GLI2 mRNA, peaking 4 h after TGF-1 induction and remaining significantly higher than basal expression up to 8 h poststimulation (Fig. 1A). Similar results were obtained in the human hepatocarcinoma cell line HepG2, in which basal levels of GLI2 transcripts are very low (see Fig. 2C). These data are consistent with our initial report (15). To determine whether TGF- stabilizes GLI2 transcripts, GLI2 mRNA half- life was estimated in HaCaT cells using the transcription inhib- itor actinomycin D. As shown in Fig. 1B, TGF-1 did not mod- ify the rate of GLI2 mRNA decay (half-life: 2.69  0.02 versus 2.67  0.02 h, respectively), suggesting that TGF--dependent elevation of GLI2 expression is not due to stabilization of GLI2 transcripts. FIGURE 1. TGF- induced GLI2 expression occurs without stabilization of Hh is known to stabilize the GLI2 protein (24). In an attempt either GLI2 mRNA or protein. A, subconfluent HaCaT keratinocytes were serum-starved for 16 h and treated with human recombinant TGF-1 for the to determine whether TGF- may also favor GLI2 protein indicated time periods. GLI2 and glyceraldehyde-3-phosphate dehydrogen- accumulation, HaCaT cells were transfected with a Myc-tagged ase (GAPDH) expression was measured by multiplex reverse transcription- GLI2 expression vector (20), and the stability of the expressed PCR (upper panel) or quantitative reverse transcription-PCR (lower panel)as described previously (15). Results are the mean  S.D. of four quantitative fusion protein was determined by Western blotting. As shown PCR results. B, subconfluent HaCaT keratinocytes were serum-starved for in Fig. 1C, there was no detectable effect of TGF- on Myc- 16 h, at which point 1g/ml actinomycin D was added to the culture medium to block transcription. 30 min later, cells were incubated in the absence or GLI2 stability when protein neosynthesis was blocked by cyclo- presence of TGF-1. RNA was extracted at various time points, and GLI2 heximide. It is thus likely that TGF- exerts its effect on GLI2 mRNA decay was measured by quantitative reverse transcription-PCR. expression primarily at the transcriptional level, although we Results are the mean  S.D. of four quantitative PCR results. C, subconfluent HaCaT keratinocytes were transfected with a Myc-tagged full-length GLI2 cannot exclude a stabilization of endogenous GLI2 protein by expression vector and serum-starved for 16 h, at which point 10 g/ml cyclo- TGF-; its low abundance or our detection capability with cur- heximide was added to the culture medium to block protein neosynthesis. TGF-1 was added 30 min later. Myc-GLI2 protein content in control and rently available commercial antibodies did not allow us to TGF-1-treated cultures was detected at the indicated time points by West- determine its half-life (data not shown). ern blotting using an anti-Myc antibody (upper panel). Myc-GLI2 protein Identification of the 5-regulatory Region of the Human GLI2 decay was analyzed by scanning densitometry (lower panel). Results are the mean  S.D. of two independent densitometric analyses. Gene—As a first step toward cloning the human GLI2 gene promoter region, it was necessary to characterize the gene tran- scription start site(s). For this purpose, 5-RACE by PCR fol- canonical initiator site (Fig. 2B): TCATTCT, with an adenosine lowed by nested amplification with a primer localized on exon 1 as transcription start site. This initiator is located 85 bp TM TM according to the human GLI2 GenBank sequence NM_ upstream of the described exon 1 from GenBank sequence 005270.3, was performed using total human RNA from HaCaT NM_005270.3. Initiator sites are normally associated with a cells as a template (Fig. 2A). Sequencing of the 320-bp PCR downstream core promoter element (25). Such sequence was product resulting from the 5-RACE reaction identified a found in position 35/39 of the GLI2 promoter (see Fig. 2B). NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31525 Human GLI2 Promoter Transactivation by TGF- 31526 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 46 • NOVEMBER 13, 2009 Human GLI2 Promoter Transactivation by TGF- We were next able to PCR-amplify a 2-kb fragment con- induced GLI2 expression and 119pHGLI2luc transactivation taining 1,624 bp of the human GLI2 gene upstream of the in HaCaT (Fig. 3A) and HepG2 cells (data not shown). Con- initiator site (Fig. 2B), identical to a region of chromosome 2 versely, overexpression of SMAD3 activated the proximal pro- TM located 5 of the GLI2 coding sequence (Genbank MW_ moter, increased GLI2 expression, and enhanced TGF- effect 001838848.1). We failed to identify any canonical TATA box in both HaCaT and HepG2 cells (Fig. 3B). near the transcription start site. Yet, other features typical of a Gene transcription in response to -catenin requires the promoter were found, such as two potential CAAT boxes and association of nuclear -catenin to transcription factors of the numerous putative cis-acting elements upstream of the initia- LEF/TCF family bound to cognate cis-elements (3). It has been tor element (for details, see supplemental Table 1), as deter- shown previously that TGF-1 induces the accumulation of TM mined using the MatInspector software (Genomatix). both cytoplasmic and nuclear -catenin in HaCaT cells (26). To address the question of whether this 2-kb GLI2 genomic Functional cooperation between SMAD and LEF/TCF tran- region exhibits transcriptional activity, the fragment was scription factors has been described to mediate TGF- signal- cloned upstream of the luciferase gene into pGL3-Basic to gen- ing and interactions with the Wnt pathway (27–31). We thus erate 1624pHGLI2luc. Parallel transient cell transfection investigated a possible cooperation between -catenin/TCF4 experiments in HaCaT keratinocytes and HepG2 cells compar- and SMAD3 to regulate GLI2 promoter activity. Firstly, we ing the activity of1624pHGLI2luc to that of pGL3-Basic iden- observed that coexpression of TCF4 with SMAD3 in HepG2 tified robust transcriptional activity for this GLI2 genomic frag- cells, in which the -catenin pathway is constitutively activated ment in HaCaT cells (3-fold above pGL3-Basic activity), not in (32), resulted in synergistic transactivation of119pHGLI2luc, HepG2 cells (Fig. 2C, left panel), consistent with the subdetect- indicative of efficient cooperation of these transcription factors able expression of GLI2 transcripts in the latter cell type as to transactivate the GLI2 promoter (Fig. 3C, left panel). TCF4 opposed to HaCaT cells (Fig. 2C, right panel). These data attest was also found to enhance TGF--driven gene transcription. for a promoter function for this region of the GLI2 gene. Secondly, TCF4 was ectopically expressed in HaCaT cells, with- Delineation of a TGF--responsive Region within the Human out or with a constitutively active form of -catenin, B23, GLI2 Promoter—A battery of deletion reporter constructs of known to interact with and favor the transcriptional activity of the human GLI2 promoter was assessed for transcriptional LEF/TCF transcription factors. TCF4 alone had a slight repres- activity in transient cell transfection experiments, in both sor effect on 119pHGLI2luc activity. Such a result is some- HaCaT and HepG2 cells, treated or not with TGF-. Con- what expected, given the low levels of active -catenin in sistent with the data obtained with 1624pHGLI2luc, all HaCaT cells as compared with HepG2 cells, which probably shorter constructs had clearly detectable basal transcrip- allows the formation of inhibitory TCF4 homodimers (3). Con- tional activity in HaCaT cells (2–3-fold above pGL3-luc sistent with this hypothesis, overexpression of active -catenin activity) but were inactive in HepG2 cells (Fig. 2D). A stim- increased the basal activity and amplified the TGF- response ulatory effect of TGF- was observed with all constructs con- of 119pHGLI2luc and reversed the effect of TCF4 to that of a taining between 119 and 1305 bp of the promoter in both cell transcriptional activator (Fig. 3C, right panel). This experimen- types, except for 1624pHGLI2luc, suggesting the existence of tal approach somewhat mimics the endogenous situation in a potential repressor element within the 1624/1305 region HepG2 cells (that contain constitutively active -catenin) and of the promoter. indicates a cooperation of SMAD3 with TCF4/-catenin to Whereas 119pHGLI2luc was efficiently transactivated in drive GLI2 transcription. response to TGF-, the 29-bp construct was not, thus iden- To validate the implication of -catenin in TGF--driven tifying the 91-bp region between nucleotides 119 and 29 as GLI2 promoter transactivation in HepG2 cells, endogenous required for activation by TGF-1 (TGF--responsive unit; -catenin expression was knocked down with specific siRNAs. TRU). Sequence examination identified putative LEF/TCF Western analysis (Fig. 3D, left panel) revealed that siRNA treat- (5-TTCAAAGA) and SMAD3/4 (5-GTCT) binding elements ment efficiently reduced the expression of both short (consti- (TBE and SBE, respectively) within this short fragment of the tutively active) and long (wild-type) forms of -catenin protein GLI2 promoter (Fig. 2E). found in HepG2 cells (32). Subsequently, we found that -cate- The Human GLI2 Promoter TGF--responsive Unit Drives nin siRNA largely abolished TGF- effect on 119pHGLI2luc SMAD and -Catenin/TCF4 Responses—We initially demon- strated that siRNA-mediated SMAD3 knockdown reduces activity (Fig. 3D, right panel). These findings establish that the TGF-1-driven GLI2 expression (15). In accordance with these -catenin pathway is involved in the regulation of GLI2 pro- findings, SMAD3 knockdown effectively prevented TGF-1- moter activation by TGF- in HepG2 cells. FIGURE 2. Characterization of the 5 regulatory region of the human GLI2 gene. A,5-RACE was used to identify the transcription start site of human GLI2 transcripts. MW, molecular weight markers. B, human GLI2 gene promoter sequence obtained after PCR amplification of a1,600-bp fragment upstream of the initiator site (Inr) identified by 5-RACE. DPE, downstream core promoter element. Residues in bold, exon I; residues in italic, intron I. C, 1624pHGLI2luc was transfected in HaCaT and HepG2 together with phRL-MLP to estimate transfection efficiency. RNA was extracted from parallel cultures. GLI2 expression was measured by multiplex PCR (right panel). D, a battery of human GLI2 promoter constructs was transfected in parallel into HaCaT and HepG2. The light gray box corresponds to exon 1; the dark box corresponds to intron I (B). Following TGF- treatment (see under “Experimental Procedures” for experimental conditions), reporter activity was determined. Activity of each construct is expressed as fold activity relative to pGL3-Basic (pGL3b) arbitrarily set to 1. Results are expressed as mean S.D. of triplicate samples from one (representative) of three experiments. Fold induction by TGF- (black bars) above controls (vehicle-treated) (gray bars) is indicated. E, nucleotide sequence of the 91-bp TGF- responsive unit between nucleotides 119 and 29 relative to the transcription start site. NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31527 Human GLI2 Promoter Transactivation by TGF- Functional Analysis of the Putative SMAD3/4 and LEF/TCF Cis-Elements Identified within the TGF--responsive Unit of the Human GLI2 Promoter—To determine whether the putative TBE and SBE cooperate and are sufficient to mediate a TGF-- dependent transcriptional response, a short 42-bp sequence spanning both SBE and TBE sites was concatamerized upstream of a minimal promoter in MLP-luc, itself unrespon- sive to TGF- (33). As shown in Fig. 4A (left panel), TGF- induced a robust transcriptional response of these constructs in HepG2 cells, proportional to the number of sequences inserted in the reporter vectors. Mutation of the SBE site within each monomer of the 4 construct (TmS4) abolished TGF- responsiveness (Fig. 4A, right panel), indicating (a), that the SBE is critical for TGF- response and (b), that the LEF/TCF site is not sufficient to drive TGF- responsiveness in the context of a heterologous promoter. The dramatic induction of 119pHGLI2luc upon TCF4 expression led us to analyze sequences downstream of the TRU. A putative LEF/TCF site (5-ATCAAAGA) was found at position 236 within exon I. 3-End deletion of 119pHGLI2luc was per- formed to generate119/104pHGLI2luc that contains no other SBE and TBE besides those found in the TRU. Regulation of 119/104pHGLI2luc by TGF- and/or SMAD3 overexpres- sion was similar to that of 119pHGLI2luc whereas its response to TCF4 and/or -catenin overexpression was re- duced (see below and compare with Fig. 3C). To determine the respective contribution of the putative SBE (5-GTCT) and TBE (5-TTCAAAGA) sites of the TRU for GLI2 promoter responsiveness to TGF-, GLI2 promoter/re- porter constructs were generated in which the SBE or the TBE were mutated, either alone (mS and mT, respectively) or in combination (mTmS) within 119/104pHGLI2luc. Both mutations efficiently prevent binding of their cognate tran- scription factors, as demonstrated using in vitro-translated TCF4 and SMAD3 protein in electrophoretic mobility shift assay experiments with corresponding labeled oligonucleotides as probes (data not shown). In both HaCaT and HepG2 cells, wild-type 119/104pHGLI2luc responded to TGF- with a 3–8-fold transactivation (Fig. 4B). Mutation of the SBE abol- ished TGF- responsiveness, as shown by the lack of transacti- vation of the mS and mTmS constructs. Thus, the SBE site is critical for TGF- responsiveness of the GLI2 promoter. On the other hand, TGF--driven promoter transactivation was only partially affected by mutation of the TBE. Thus, integrity of both SBE and TBE is required for full TGF- response. The functionality of the SBE and TBE sites was next exam- ined by overexpressing SMAD3 and/or -catenin in HaCaT FIGURE 3. SMAD3 and TCF4/-catenin contribute to GLI2 promoter trans- activation by TGF-. A, SMAD3 expression was reduced in HaCaT by specific keratinocytes, in the absence or presence of exogenous TGF- siRNA knockdown. Efficacy of the knockdown was verified by Western blot- ting with an anti-SMAD3 antibody (left panel). An HSP60 antibody was used as control. GLI2 expression was determined by quantitative PCR (center panel). Right panel, HaCaT cells were cotransfected with control or SMAD3 siRNA Results are expressed as relative activity compared with vehicle-treated together with 119pHGLI2luc and incubated with or without TGF- for 16 h. pcDNA3.1-transfected cells. C, HepG2 (left panel) cells were transfected with For both RNA and promoter data, results are expressed as fold induction by 119pHGLI2luc together with either TCF4 or SMAD3 expression vectors TGF- above vehicle-treated cultures. B, HaCaT (left panel) and HepG2 (center either alone or in combination, whereas HaCaT cells (right panel) were trans- panel) cells were transfected with 119pHGLI2luc in the presence of either fected with 119pHGLI2luc together with expression vectors for either empty pcDNA3.1 or SMAD3 expression vector and treated with TGF-. SMAD3 or a constitutively active form of -catenin, alone or in combination, SMAD3 expression was verified by Western blotting (upper panels). An anti- and then treated with TGF-. Luciferase activity was determined 16 h later. HSP60 antibody was used as control. Right panel, HepG2 cells were trans- D, -catenin expression was knocked down with specific siRNAs. Efficacy was fected with either pcDNA3.1 or a SMAD3 expression vector. 24 h later, cells verified by Western blotting (left panel). HepG2 cells were transfected with were serum-starved for 16 h and incubated with or without TGF-. RNA was 119pHGLI2luc together with control or -catenin siRNAs and treated with extracted 7 h later, and GLI2 expression was measured by quantitative PCR. TGF-. 31528 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 46 • NOVEMBER 13, 2009 Human GLI2 Promoter Transactivation by TGF- FIGURE 4. Contribution of the SBE and TBE sites within the HGLI2 promoter TRU for TGF- responsiveness. A, left panel: HepG2 cells were transfected with TS1luc, TS2luc, and TS4luc, respectively, containing one, two, or four copies of the66/25 GLI2 promoter fragment and then treated with TGF-. Right panel: HepG2 cells were transfected in parallel with TS4luc and TmS4luc and then treated with TGF-. Luciferase activity measured 16 h after TGF- addition is expressed relative to empty MLP-luc activity, arbitrarily set to 1. B, HaCaT (left panel) and HepG2 (right panel) cells were transfected in parallel with either119/104pHGLI2luc (WT), or the corresponding mS, mT, or mTmS mutants, and then treated with TGF-. Luciferase activity measured 16 h after TGF- addition is expressed relative to WT 119/ 104pHGLI2luc activity, arbitrarily set to 1. C, HaCaT cells were cotransfected in parallel with either WT 119/104pHGLI2luc or the corresponding mS and mT mutants, together with either empty pcDNA3.1 (pcDNA), SMAD3 (S3), or constitutively active -catenin (B23) expression vectors and then treated with TGF-. Luciferase activity measured 16 h after TGF- addition is expressed relative to 119/104pHGLI2luc activity cotransfected with pcDNA3.1, arbitrarily set to 1. Schematic representations of the SBE and TBE mutation status within each GLI2 promoter construct are shown as insets. D, HepG2 cells were cotransfected in parallel with either WT119/104pHGLI2luc or the corresponding mS and mT mutants, together with either empty pcDNA3.1, SMAD3, or TCF4 (T4) expression vectors and then treated with TGF-. Luciferase activity measured 16 h after TGF- addition is expressed relative to119/104pHGLI2luc activity cotransfected with pcDNA3.1, arbitrarily set to 1. E, digested chromatin from control or TGF--treated (1 and 3 h) HaCaT cells was immuno-precipitated with either anti-IgG, anti-SMAD3, or anti--catenin antibodies, as indicated. Results show representative PCR reactions with primers spanning the TGF- responsive unit. Input lanes are PCR reactions using chromatin as template, without immunoprecipitation (IP). NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31529 Human GLI2 Promoter Transactivation by TGF- stimulation. Although SMAD3 and -catenin both transacti- by targeting upstream inducers such as TGF- or other path- vated 119/104pHGLI2luc and enhanced TGF- response, ways. In this context, we previously demonstrated that pancre- mutation of the SBE fully abolished SMAD3- and TGF-- atic adenocarcinoma cell lines resistant to the Hh inhibitor driven transactivation. Despite the mS mutation, -catenin still cyclopamine, are growth-inhibited by a small molecule inhibi- exerted its stimulatory effect on basal promoter activity but did tor of TGF- receptor 1 (15). In the context of breast cancer, it not rescue TGF- responsiveness. Mutation of the TBE site was recently found that progression from ductal carcinoma in (mT construct) only slightly affected SMAD3 and TGF- situ to invasive carcinoma implicates TGF- signaling and ele- responsiveness but prevented both promoter transactivation by vated GLI2 expression (35). Consistent with our initial obser- -catenin and cooperation of -catenin with SMAD3 to vations (15), the authors found that TGF- elevates GLI2 levels enhance the TGF- response. Thus, integrity of the TBE, al- and GLI-dependent transcription, influencing myoepithelial though not essential for SMAD3/TGF--driven promoter acti- cell differentiation and progression to invasion. vation, is required for full cooperation of overexpressed Lineage-independent activation of the Wnt/-catenin path- SMAD3 and -catenin. way is often found during cancer progression (36). Remarkably, We then used a similar experimental approach in HepG2 the Wnt/-catenin pathway has been shown to enhance GLI1- cells. TCF4 was found to transactivate the WT promoter and to dependent transcription in stomach, lung, and colon cancer cooperate with SMAD3 to enhance GLI2 promoter activity and cells (37). Also, various Wnt genes are Hh/GLI targets and TGF--driven transactivation. Mutation of the SBE essentially mediate some of GLI functions during embryogenesis (38), sug- abolished GLI2 promoter by overexpressed TCF4 and blocked gesting intricate regulatory mechanisms between these path- SMAD3 and TGF- effects. Interestingly, in the context of a ways. The -catenin pathway is constitutively active in the promoter in which the TBE is inactivated (mT construct), HepG2 cell line due to heterozygote mutation in the CTNNB1 TCF4 still drove promoter activity and enhanced TGF--in- gene leading to a large deletion in the protein that favors its duced transcription. Thus, in a cellular context with constitu- nuclear accumulation and transcriptional activity (32). Why tively active -catenin, transactivation of the GLI2 promoter by HepG2 cells do not express GLI2 unless stimulated by TGF- TCF4 requires a functional SBE site, suggesting a direct coop- remains an enigma, but this suggests that the constitutively eration of SMAD3 and TCF4 via the SBE site. In this context, active -catenin pathway is not sufficient per se to allow GLI2 integrity of the nearby TBE potentiates TGF- response by transcription. This may be either due to the existence of antag- allowing a stronger TCF4 effect. onistic repressory pathways, yet to be identified, or to the abso- We finally examined the possible recruitment of SMAD3 and lute requirement of transcriptional partner(s) such as activated -catenin to the TRU by chromatin immunoprecipitation in SMADs for -catenin to activate GLI2 expression. HaCaT keratinocytes. As shown in Fig. 4C, neither SMAD3 nor Functional interactions between the SMAD and -catenin -catenin bound the human GLI2 promoter TRU in the machineries have been described. Their net outcome and absence of TGF- stimulation. However, a rapid and sustained mechanisms leading to target gene expression involves various recruitment of SMAD3 was observed as early as 1 h following mechanistic possibilities, as both pathways may function as TGF- addition to the culture medium and was still present cofactor for the other. It was initially found, using overex- after 3 h. At this later time point, -catenin was also recruited to pressed proteins in 293T cells, that SMAD4 physically interacts the TRU in response to TGF-. Taken together, these results with -catenin and that LEF1 interacts with both SMAD4 and demonstrate that both SMAD3 and -catenin are recruited to -catenin to form a complex that activates the Xtwn gene, a the GLI2 promoter in response to TGF-. Wnt/-catenin target, via binding to the promoter region (31). A parallel report also identified SMAD2 and SMAD3 as a LEF1/ DISCUSSION -catenin interactor in COS-1 cells, allowing synergistic Xtwn In this report, we have addressed three essential issues per- promoter activation by TGF- and Wnt signaling, via distinct taining to the transcriptional mechanisms controlling the SMAD and LEF/TCF binding sites (27). In glutathione S-trans- human GLI2 gene. First, we have identified the transcription ferase pulldown studies, Lei et al. (28) were able to identify the start site. Second, we have characterized the functional GLI2 interaction of both SMAD3 and SMAD4 to heteromeric core promoter. Third, we have demonstrated the cooperation TCF4-catenin complexes. SMADs and TCF4-catenin over- between SMAD3 and LEF/TCF transcription factors as well as expression synergistically activated the human gastrin pro- -catenin in TGF--induced up-regulation of GLI2 promoter moter in gastric adenocarcinoma cells. We showed that activity. SMADTCF-catenin complexes were also able to regulate Abnormal activation of the Hh pathway has been implicated transcription at isolated SMAD or TCF sites. In the latter two in a variety of cancers (6), and targeted anti-cancer therapy studies, the cooperation of SMADs with LEF/TCF was shown focused on Hh signaling is trying to address unmet needs for to implicate the transcriptional coactivator p300/CREB-bind- efficient cancer treatment. In this context, small molecule Hh ing protein. It was recently demonstrated that the integrity of antagonists have been developed that either block SMOH func- two TCF/LEF binding sites are necessary for vascular endothe- tion or interfere with GLI binding to DNA (13). However, it lial growth factor A regulation by TGF- and involves down- becomes more and more clear that noncanonical signaling regulationofglycogensynthasekinase3-dependentphosphor- events are often responsible for the expression of Hh mediators ylation of -catenin in response to TGF- and recruitment of of the GLI family (15, 34, 35), indicating that therapeutic inter- unphosphorylated -catenin to TCF4SMAD2/3 complexes vention against deleterious GLI expression may also be possible (29). Our data, which demonstrates that TCF4 cooperates with 31530 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 46 • NOVEMBER 13, 2009 Human GLI2 Promoter Transactivation by TGF- 15. Dennler, S., Andre, J., Alexaki, I., Li, A., Magnaldo, T., ten Dijke, P., Wang, SMADs to transactivate the GLI2 promoter in HepG2 cells X. J., Verrecchia, F., and Mauviel, A. (2007) Cancer Res. 67, 6981–6986 even when the TBE is mutated, support the notion that -cate- 16. Massague, J., Seoane, J., and Wotton, D. (2005) Genes Dev. 19, 2783–2810 nin and SMADs act as cofactors to regulate SMAD-dependent 17. Schmierer, B., and Hill, C. S. (2007) Nat. Rev. Mol. Cell Biol. 8, 970–982 gene transcription. The presence of a LEF/TCF site near the 18. Javelaud, D., and Mauviel, A. (2004) Int. J. Biochem. Cell Biol. 36, SBE further accentuates the cooperation of these transcription 1161–1165 factors. 19. ten Dijke, P., and Hill, C. S. (2004) Trends Biochem. Sci. 29, 265–273 It is likely that signals leading to -catenin activation such as 20. Roessler, E., Ermilov, A. N., Grange, D. K., Wang, A., Grachtchouk, M., Dlugosz, A. A., and Muenke, M. (2005) Hum. Mol. Genet. 14, 2181–2188 those initiated by Wnts will cooperate with TGF- to up-regu- 21. Dennler, S., Huet, S., and Gauthier, J. M. (1999) Oncogene 18, 1643–1648 late GLI2 expression, thereby providing de novo substrate for 22. Roose, J., Huls, G., van Beest, M., Moerer, P., van der Horn, K., Gold- enhanced Hh signaling. Such signal convergence leading to schmeding, R., Logtenberg, T., and Clevers, H. (1999) Science 285, GLI2 expression is likely to occur in a number of cancers inde- 1923–1926 pendent of lineage. In this context, our work represents critical 23. Wei, Y., Renard, C. A., Labalette, C., Wu, Y., Levy, L., Neuveut, C., Prieur, groundwork for elucidating the mechanisms regulating GLI2 X., Flajolet, M., Prigent, S., and Buendia, M. A. (2003) J. Biol. Chem. 278, transcription, an important step to elaborate adequate targeted 5188–5194 intervention against upstream signals responsible for GLI2 24. Pan, Y., Bai, C. B., Joyner, A. L., and Wang, B. (2006) Mol. Cell Biol. 26, 3365–3377 expression. 25. Smale, S. T., and Kadonaga, J. T. (2003) Annu. Rev. Biochem. 72, 449–479 26. Edlund, S., Lee, S. Y., Grimsby, S., Zhang, S., Aspenstrom, P., Heldin, C. H., Acknowledgments—We thank Dr. A. Dlugosz (University of Michi- and Landstrom, M. (2005) Mol. Cell Biol. 25, 1475–1488 gan, Ann Arbor, MI) for providing reagents critical for experiments 27. Labbe´, E., Letamendia, A., and Attisano, L. (2000) Proc. Natl. Acad. Sci. and Dr. D. Bernuau (INSERM U697) for helpful discussions. U.S.A. 97, 8358–8363 28. Lei, S., Dubeykovskiy, A., Chakladar, A., Wojtukiewicz, L., and Wang, T. C. (2004) J. Biol. Chem. 279, 42492–42502 REFERENCES 29. Clifford, R. L., Deacon, K., and Knox, A. J. (2008) J. Biol. Chem. 283, 1. Evangelista, M., Tian, H., and de Sauvage, F. J. (2006) Clin Cancer Res. 12, 35337–35353 5924–5928 30. Hirota, M., Watanabe, K., Hamada, S., Sun, Y., Strizzi, L., Mancino, M., 2. Kelleher, F. C., Fennelly, D., and Rafferty, M. (2006) Acta Oncol. 45, Nagaoka, T., Gonzales, M., Seno, M., Bianco, C., and Salomon, D. S. (2008) 375–388 Cell Signal 20, 1632–1641 3. Hoppler, S., and Kavanagh, C. L. (2007) J. Cell Sci. 120, 385–393 31. Nishita, M., Hashimoto, M. K., Ogata, S., Laurent, M. N., Ueno, N., 4. Massague, J. (2008) Cell 134, 215–230 Shibuya, H., and Cho, K. W. (2000) Nature 403, 781–785 5. Pasca di Magliano, M., and Hebrok, M. (2003) Nat. Rev. Cancer 3, 903–911 32. de La Coste, A., Romagnolo, B., Billuart, P., Renard, C. A., Buendia, M. A., 6. Ruiz i Altaba, A., Sanchez, P., and Dahmane, N. (2002) Nat. Rev. Cancer 2, Soubrane, O., Fabre, M., Chelly, J., Beldjord, C., Kahn, A., and Perret, C. 361–372 (1998) Proc. Natl. Acad. Sci. U.S.A. 95, 8847–8851 7. Varjosalo, M., and Taipale, J. (2008) Genes Dev. 22, 2454–2472 33. Dennler, S., Itoh, S., Vivien, D., ten Dijke, P., Huet, S., and Gauthier, J. M. 8. Kasper, M., Regl, G., Frischauf, A. M., and Aberger, F. (2006) Eur. J. Cancer (1998) EMBO J. 17, 3091–3100 42, 437–445 34. Nolan-Stevaux, O., Lau, J., Truitt, M. L., Chu, G. C., Hebrok, M., Fernandez- 9. Thiyagarajan, S., Bhatia, N., Reagan-Shaw, S., Cozma, D., Thomas- Zapico, M. E., and Hanahan, D. (2009) Genes Dev. 23, 24–36 Tikhonenko, A., Ahmad, N., and Spiegelman, V. S. (2007) Cancer Res. 67, 35. Hu, M., Yao, J., Carroll, D. K., Weremowicz, S., Chen, H., Carrasco, D., 10642–10646 Richardson, A., Violette, S., Nikolskaya, T., Nikolsky, Y., Bauerlein, E. L., 10. Narita, S., So, A., Ettinger, S., Hayashi, N., Muramaki, M., Fazli, L., Kim, Y., Hahn, W. C., Gelman, R. S., Allred, C., Bissell, M. J., Schnitt, S., and Polyak, and Gleave, M. E. (2008) Clin. Cancer Res. 14, 5769–5777 K. (2008) Cancer Cell 13, 394–406 11. Kim, Y., Yoon, J. W., Xiao, X., Dean, N. M., Monia, B. P., and Marcusson, 36. Paul, S., and Dey, A. (2008) Neoplasma 55, 165–176 E. G. (2007) Cancer Res. 67, 3583–3593 37. Maeda, O., Kondo, M., Fujita, T., Usami, N., Fukui, T., Shimokata, K., 12. Ji, J., Kump, E., Wernli, M., and Erb, P. (2008) Int. J. Cancer 122, 50–56 Ando, T., Goto, H., and Sekido, Y. (2006) Oncol. Rep. 16, 91–96 13. Rubin, L. L., and de Sauvage, F. J. (2006) Nat. Rev. Drug Discov. 5, 38. Mullor, J. L., Dahmane, N., Sun, T., and Ruiz i Altaba, A. (2001) Curr. Biol. 1026–1033 14. Lauth, M., and Toftgard, R. (2007) Cell Cycle 6, 2458–2463 11, 769–773 NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31531 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Cloning of the Human GLI2 Promoter

Dennler, Sylviane; André, Jocelyne; Verrecchia, Franck; Mauviel, Alain
Journal of Biological Chemistry – Sep 22, 2009
Download PDF
9 pages

Loading next page...
 
/lp/unpaywall/cloning-of-the-human-gli2-promoter-erg2OATk1W

References (40)

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.m109.059964
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 46, pp. 31523–31531, November 13, 2009 © 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. TRANSCRIPTIONAL ACTIVATION BY TRANSFORMING GROWTH FACTOR- VIA □ S SMAD3/-CATENIN COOPERATION Received for publication, August 26, 2009 Published, JBC Papers in Press, September 21, 2009, DOI 10.1074/jbc.M109.059964 1 2 Sylviane Dennler , Jocelyne Andre´, Franck Verrecchia, and Alain Mauviel From INSERM, U697, Universite´ Paris-Diderot, 75010 Paris, France GLI2 (GLI-Kruppel family member 2), a zinc finger transcrip- intracellular cascade, which ultimately leads to the activation tion factor that mediates Hedgehog signaling, is implicated in and nuclear translocation of zinc finger transcription factors of the progression of an ever-growing number of human malignan- the GLI family (7). While Hh signaling favors the stabilization of cies, including prostate and pancreatic cancer, as well as basal the GLI2 protein by inhibiting its proteasomal degradation, it cell carcinoma of the skin. Its expression is up-regulated by also induces the expression of GLI1 and PTCH-1 in a GLI2-de- transforming growth factor- (TGF-) in a variety of cell types, pendent manner (8). both normal and transformed. We report herein that TGF-- There is broad evidence for a functional implication of GLI2 driven GLI2 expression is transcriptional and does not result in the development of solid tumors. For example, GLI2 knock- from stabilization of GLI2 transcripts. We describe the char- down with specific small hairpin RNA or antisense oligonucleo- acterization of the 5-flanking sequence of human GLI2 tides in prostate cancer cells reduces anchorage-independent mRNA, the identification of a transcription start site, the colony formation, delays tumor xenograft growth in vivo, and cloning of 1,600 bp of the regulatory promoter region and enhances paclitaxel chemosensitivity (9, 10). Similarly, GLI2- the identification and functional analysis of a TGF--respon- specific antisense oligonucleotides inhibit the proliferation of sive region mapped to a 91-bp sequence between nucleotides hepatocellular carcinoma cell lines, through the regulation of 119 and 29 of the promoter. This region harbors SMAD genes implicated in cell cycle and apoptosis (11). Moreover, in a and lymphoid enhancer factor/T cell factor binding sites that mouse tumor allograft model, Gli2 silencing in epithelial cells allow functional cooperation between SMAD3 and -cate- that constitutively express an active form of GLI2 (GLI2N2) nin, recruited to the promoter in response to TGF- to drive has unambiguously demonstrated the important role played by GLI2 gene transcription. GLI2 in preventing apoptosis and promoting tumor microvas- cularization (12). Together, these data support the notion that suppression of GLI2 expression may represent a valuable ther- During embryonic development, several key signaling path- apeutic option for the treatment of several cancers (13). ways such as Hedgehog (Hh) , Wnt, and transforming growth Although GLI activation may result from Hh ligand- or Hh factor- (TGF-) govern fundamental cell fate decisions that receptor-induced signaling, recent evidence has shown the pos- regulateproliferationanddifferentiationinatime-andposition- sible implication of noncanonical, Hh-independent signaling dependent fashion. Deregulation of these pathways contributes pathways to regulate GLI expression and/or activity (14). Thus, to the onset or to the development of tumors (1–4). Constitu- the identification of pathways leading to GLI activation is crit- tive activation of Hh signaling has been implicated in the ical for adequate therapeutic targeting. In this context, we have growth of several human malignancies ranging from semima- previously identified TGF- as a potent and ubiquitous inducer lignant tumors of the skin to highly aggressive cancers of the of GLI1 and GLI2 expression in both normal and transformed brain, pancreas, and prostate (5, 6). Cellular responses to Hh are cells (15). initiated by ligand binding to the tumor suppressor transmem- TGF-s encompass a large family of secreted proteins. To brane receptor PTCH-1 (Patched-1). This interaction releases trigger their biological effects, TGF-s bind to type I and the inhibitory effect of PTCH-1 on the seven-transmembrane II serine/threonine kinase receptor complexes. Ligand-de- signaling protein Smoothened (SMOH), thus initiating the Hh pendent receptor activation leads to the recruitment and phosphorylation of intracellular mediators of TGF- signal * This work was supported by the Donation Henriette et Emile Goutie`re (to transduction, namely the SMAD proteins (16, 17). In most A. M.), Cance´ropoˆ le Ile-de-France, and INSERM. □ S The on-line version of this article (available at http://www.jbc.org) contains cell types, TGF-1 induces the activation of SMAD2 and supplemental Table 1. 1 SMAD3 and their association with SMAD4. These complexes Recipient of a postdoctoral fellowship from Institut National du Cancer and relay signals from the cell membrane to the nucleus where Re´gion Ile-de-France. To whom correspondence should be addressed: INSERM, U697, Hoˆ pital SMAD3SMAD4 complexes bind to specific cis-elements, ei- Saint-Louis, 1 Avenue Claude Vellefaux, 75010 Paris, France. Tel.: 33-153- ther alone or in cooperation with other transcription factors 722-069; Fax: 33-153-722-051; E-mail: [email protected]. and co-activators that regulate the transcription of TGF- tar- The abbreviations used are: Hh, Hedgehog; siRNA, small interfering RNA; 5-RACE, 5-rapid amplification of cDNA ends; TRU, TGF--responsive get genes (18, 19). unit; WT, wild-type; CREB, cAMP-responsive element-binding protein; LEF/ In this report, we describe the cloning and functional char- TCF, lympoid enhancer factor/T cell factor; TBE, LEF/TCF binding element; SBE, SMAD3/4 binding element; MLP, major late promoter. acterization of the human GLI2 promoter. We also identify a This is an Open Access article under the CC BY license. NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31523 Human GLI2 Promoter Transactivation by TGF- 91-bp TGF- responsive region whereby TGF- recruits CTGAAATCCCACATACCCTCCCGCCAC; mutant TCF/ SMAD3 and -catenin to induce GLI2 transcription. LEF site (mT) forward, 5-CTCGTTAGAGGAGGCCG- AAGAAACCAGGTGGCGGG; mT reverse, 5-CCCGCCAC- EXPERIMENTAL PROCEDURES CTGGTTTCTTCGGCCTCCTCTAACGAG. Putative bind- Cell Cultures and Reagents—HaCaT immortalized human ing sites are shown in bold, and mutated bases are underlined. keratinocytes and HepG2 hepatocarcinoma cell lines were After amplification, promoter fragments were subcloned into maintained in Dulbecco’s modified Eagle’s medium with 10% the BglII/HindIII sites of pGL3-Basic. TS constructs containing fetal bovine serum and antibiotics (Invitrogen, Cergy-Pon- 1 (TS), 2 (TS2), or 4 (TS4) concatamerized copies of the 66/ toise, France). When indicated, cells were serum-starved for 25 region of the human GLI2 promoter, were obtained by 16 h and treated with 5 ng/ml human recombinant TGF-1 inserting the following double-stranded oligonucleotides into (R&D Systems, Lille, France). Control cultures received corre- the pGL3-Basic XhoI site (italic): 5-TCGAGGAGGAGTTCA- sponding TGF- vehicle buffer (4 mM HCl, 0.1% bovine serum AAGAAACCAGGTGGCGGGAGGGTGTCTGGGATC and albumin). Cycloheximide and actinomycin D were obtained its complementary strand: 5-TCGAGATCCCAGACACCCT- from Euromedex (Strasbourg, France). Small interfering RNAs CCCGCCACCTGGTTTCTTTGAACTCCTCC. TmS4, in (siRNAs) were purchased from Ambion/Applied Biosystems which the SMAD binding element (bold) is mutated to ATGT (Courtabœuf, France). (bold underlined), was obtained by subcloning four copies of Multiplex and Real-time PCR—Total RNA was prepared the following oligonucleotide: 5-TCGAGGAGGAGTTCAA- using a column-based commercial kit (Macherey-Nagel, AGAAACCAGGTGGCGGGAGGGTATGTGGGATC and its Hoerdt, France). Genomic DNA-free RNA was then converted complementary strand: 5-TCGAGATCCCACATACCC- into cDNA using the ThermoScript RT-PCR system (Invitro- TCCCGCCACCTGGTTTCTTTGAACTCCTCC. gen). cDNAs were used for multiplex PCR according to Transfections and Luciferase Reporter Assays—24 h prior to the manufacturer’s recommendations (Qiagen, Courtabœuf, transfection, HaCaT and HepG2 cells were plated in 24-well France), real-time PCR using a Power SYBR Green mixture on plates and transfected with siRNA (Ambion/Applied Biosys- TM an AB7300 apparatus (Applied Biosystems), or for 5-rapid tems) using HiPerfect (Qiagen) when indicated. The follow- amplification of cDNA ends (5-RACE). PCR primer sequences ing day, cells at 40% confluency were transfected with 200 ng and specific PCR conditions are available upon request. of firefly luciferase promoter reporter construct together with 5-RACE—5-RACE was performed using a commercial kit 15 ng of expression vector (when necessary) using JetPEI (Invitrogen). cDNA synthesis was performed using total RNA (PolyPlus Transfection, Strasbourg, France). 40 ng of phRL- from HaCaT cells primed with the following gene-specific MLP Renilla luciferase expression vector was co-transfected to primer, 5-AGAGATCATGGAGAGCGTGG located in exon 4 estimate transfection efficiencies. phRL-MLP was generated by of the GLI2 gene. PCR of the dC-tailed cDNA was performed cloning the adenovirus major late promoter (MLP) upstream of with the AAP primer included in the kit, together with a primer the Renilla luciferase gene as a BgIII/HindIII insert within corresponding to a sequence located in exon 2 of human GLI2: phRL-null (Promega). For each protocol, at least three inde- 5-ATCTCAGCCGCTCATCGTC. Finally, nested PCR was pendent experiments were performed. Sixteen h post-transfec- performed using the AUAP primer of the kit and the exon 1 tion, cells were serum-starved in 0.5% serum-containing primer: 5-TTGGGGAAGCTTCTGACCTTGCTCTTTGAT- medium and treated 8 h later with TGF-1 for 16 h. Cells were GTG, which contains a HindIII site (underlined). The indicated lysed, and luciferase activity was determined with the Dual- exonic information refers to the published NM_005270.3 Gen- Luciferase reporter assay system (Promega) using a Fluoroskan TM Bank sequence. The PCR products containing the unknown Ascent FL (Thermo LabSystems). In each experiment, pro- 5 upstream region of GLI2 transcripts were digested with moter activity is expressed as the firefly/Renilla ratio relative to MluI/HindIII and inserted into the MluI/HindIII sites of pGL3- internal control conditions. Expression vectors for GLI2, Basic for sequencing. SMAD3, TCF4, and constitutively active -catenin (B23) have Reporter Gene Constructs—Genomic DNA was extracted been described previously (20–23). from HaCaT cells using a commercial kit (Qiagen). Various Western Analyses—Cells were lysed in 1% SDS lysis buffer fragments of the human GLI2 promoter were amplified from (10 mM Tris, pH 7.4, 1% SDS, and 1 mM sodium orthovana- genomic DNA, using BglII-containing forward primers and a date). Equal amounts of protein were boiled with Laemmli HindIII-containing reverse primer. PCR products were sub- buffer and subjected to 10% SDS-PAGE. Proteins were then cloned into pGL3-Basic vector (Promega, Charbonnieres, transferred onto nitrocellulose membranes (Amersham Bio- France) and sequenced. The sequence of the constructs is iden- sciences). Membranes were blocked with 5% nonfat milk in TM tical to the sequence of human chromosome 2, Genbank phosphate-buffered saline containing 0.1% Tween 20 for1hat NW_001838848.1. Site-directed mutagenesis to inactivate the room temperature and incubated overnight at 4 °C with the SMAD and lymphoid enhancer factor/T cell factor (TCF/LEF) primary antibody. After several washes, membranes were incu- binding sites, respectively, at positions 33 and 60 of the bated in blocking buffer with a secondary antibody coupled to promoter was carried out according to the DpnI-based horseradish peroxidase (Santa Cruz Biotechnology) for2hat QuikChange site-directed mutagenesis methodology (Strat- room temperature. Antigenantibody complexes were detected agene, La Jolla, CA) with the following primers: mutant using ECLplus (Amersham Biosciences/GE Healthcare, Velizy, SMAD site (mS) forward, 5-GTGGCGGGAGGGTATGT- France) and revealed with a Storm PhosphorImager (Amer- GGGATTTCAGGTTTCAGG; mS reverse, 5-CCTGAAAC- sham Biosciences/GE Healthcare). Anti-Myc, anti-SMAD3, 31524 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 46 • NOVEMBER 13, 2009 Human GLI2 Promoter Transactivation by TGF- and anti-HSP60 were purchased from Santa Cruz Biotechnol- ogy, whereas anti--catenin was from BD Biosciences. Anti-- actin was obtained from Sigma-Aldrich. Chromatin Immunoprecipitation—HaCaT cells were grown to 60–70% confluency on 15-cm plates then serum-starved in 0.5% serum-containing medium for 16 h and stimulated with TGF- for the indicated time. Chromatin immunoprecipita- tion was carried out using the ChIP-IT express kit (Active Motif, Rixensart, Belgium). Briefly, 4 g of enzymatically sheared chromatin were immunoprecipitated using 4 gof antibody against IgG (Santa Cruz Biotechnology), SMAD3, or -catenin overnight at 4 °C, then incubated for another 2 h at 4 °C with protein G beads. Precipitated DNA was used for PCR analysis using human GLI2 promoter-specific prim- ers: forward, 5-GAAGATCTCTGTGACTTTAATGCGG- TGTG; reverse, 5-TTGGGGAAGCTTCACCCTGAAACC- TGAAATCCC. Amplimers were visualized by agarose gel electrophoresis. RESULTS TGF-1 Increases GLI2 Expression but Does Not Stabilize Either GLI2 Transcripts or GLI2 Protein—Treatment of human immortalized HaCaT keratinocytes with TGF-1 led to rapid elevation of GLI2 mRNA, peaking 4 h after TGF-1 induction and remaining significantly higher than basal expression up to 8 h poststimulation (Fig. 1A). Similar results were obtained in the human hepatocarcinoma cell line HepG2, in which basal levels of GLI2 transcripts are very low (see Fig. 2C). These data are consistent with our initial report (15). To determine whether TGF- stabilizes GLI2 transcripts, GLI2 mRNA half- life was estimated in HaCaT cells using the transcription inhib- itor actinomycin D. As shown in Fig. 1B, TGF-1 did not mod- ify the rate of GLI2 mRNA decay (half-life: 2.69  0.02 versus 2.67  0.02 h, respectively), suggesting that TGF--dependent elevation of GLI2 expression is not due to stabilization of GLI2 transcripts. FIGURE 1. TGF- induced GLI2 expression occurs without stabilization of Hh is known to stabilize the GLI2 protein (24). In an attempt either GLI2 mRNA or protein. A, subconfluent HaCaT keratinocytes were serum-starved for 16 h and treated with human recombinant TGF-1 for the to determine whether TGF- may also favor GLI2 protein indicated time periods. GLI2 and glyceraldehyde-3-phosphate dehydrogen- accumulation, HaCaT cells were transfected with a Myc-tagged ase (GAPDH) expression was measured by multiplex reverse transcription- GLI2 expression vector (20), and the stability of the expressed PCR (upper panel) or quantitative reverse transcription-PCR (lower panel)as described previously (15). Results are the mean  S.D. of four quantitative fusion protein was determined by Western blotting. As shown PCR results. B, subconfluent HaCaT keratinocytes were serum-starved for in Fig. 1C, there was no detectable effect of TGF- on Myc- 16 h, at which point 1g/ml actinomycin D was added to the culture medium to block transcription. 30 min later, cells were incubated in the absence or GLI2 stability when protein neosynthesis was blocked by cyclo- presence of TGF-1. RNA was extracted at various time points, and GLI2 heximide. It is thus likely that TGF- exerts its effect on GLI2 mRNA decay was measured by quantitative reverse transcription-PCR. expression primarily at the transcriptional level, although we Results are the mean  S.D. of four quantitative PCR results. C, subconfluent HaCaT keratinocytes were transfected with a Myc-tagged full-length GLI2 cannot exclude a stabilization of endogenous GLI2 protein by expression vector and serum-starved for 16 h, at which point 10 g/ml cyclo- TGF-; its low abundance or our detection capability with cur- heximide was added to the culture medium to block protein neosynthesis. TGF-1 was added 30 min later. Myc-GLI2 protein content in control and rently available commercial antibodies did not allow us to TGF-1-treated cultures was detected at the indicated time points by West- determine its half-life (data not shown). ern blotting using an anti-Myc antibody (upper panel). Myc-GLI2 protein Identification of the 5-regulatory Region of the Human GLI2 decay was analyzed by scanning densitometry (lower panel). Results are the mean  S.D. of two independent densitometric analyses. Gene—As a first step toward cloning the human GLI2 gene promoter region, it was necessary to characterize the gene tran- scription start site(s). For this purpose, 5-RACE by PCR fol- canonical initiator site (Fig. 2B): TCATTCT, with an adenosine lowed by nested amplification with a primer localized on exon 1 as transcription start site. This initiator is located 85 bp TM TM according to the human GLI2 GenBank sequence NM_ upstream of the described exon 1 from GenBank sequence 005270.3, was performed using total human RNA from HaCaT NM_005270.3. Initiator sites are normally associated with a cells as a template (Fig. 2A). Sequencing of the 320-bp PCR downstream core promoter element (25). Such sequence was product resulting from the 5-RACE reaction identified a found in position 35/39 of the GLI2 promoter (see Fig. 2B). NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31525 Human GLI2 Promoter Transactivation by TGF- 31526 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 46 • NOVEMBER 13, 2009 Human GLI2 Promoter Transactivation by TGF- We were next able to PCR-amplify a 2-kb fragment con- induced GLI2 expression and 119pHGLI2luc transactivation taining 1,624 bp of the human GLI2 gene upstream of the in HaCaT (Fig. 3A) and HepG2 cells (data not shown). Con- initiator site (Fig. 2B), identical to a region of chromosome 2 versely, overexpression of SMAD3 activated the proximal pro- TM located 5 of the GLI2 coding sequence (Genbank MW_ moter, increased GLI2 expression, and enhanced TGF- effect 001838848.1). We failed to identify any canonical TATA box in both HaCaT and HepG2 cells (Fig. 3B). near the transcription start site. Yet, other features typical of a Gene transcription in response to -catenin requires the promoter were found, such as two potential CAAT boxes and association of nuclear -catenin to transcription factors of the numerous putative cis-acting elements upstream of the initia- LEF/TCF family bound to cognate cis-elements (3). It has been tor element (for details, see supplemental Table 1), as deter- shown previously that TGF-1 induces the accumulation of TM mined using the MatInspector software (Genomatix). both cytoplasmic and nuclear -catenin in HaCaT cells (26). To address the question of whether this 2-kb GLI2 genomic Functional cooperation between SMAD and LEF/TCF tran- region exhibits transcriptional activity, the fragment was scription factors has been described to mediate TGF- signal- cloned upstream of the luciferase gene into pGL3-Basic to gen- ing and interactions with the Wnt pathway (27–31). We thus erate 1624pHGLI2luc. Parallel transient cell transfection investigated a possible cooperation between -catenin/TCF4 experiments in HaCaT keratinocytes and HepG2 cells compar- and SMAD3 to regulate GLI2 promoter activity. Firstly, we ing the activity of1624pHGLI2luc to that of pGL3-Basic iden- observed that coexpression of TCF4 with SMAD3 in HepG2 tified robust transcriptional activity for this GLI2 genomic frag- cells, in which the -catenin pathway is constitutively activated ment in HaCaT cells (3-fold above pGL3-Basic activity), not in (32), resulted in synergistic transactivation of119pHGLI2luc, HepG2 cells (Fig. 2C, left panel), consistent with the subdetect- indicative of efficient cooperation of these transcription factors able expression of GLI2 transcripts in the latter cell type as to transactivate the GLI2 promoter (Fig. 3C, left panel). TCF4 opposed to HaCaT cells (Fig. 2C, right panel). These data attest was also found to enhance TGF--driven gene transcription. for a promoter function for this region of the GLI2 gene. Secondly, TCF4 was ectopically expressed in HaCaT cells, with- Delineation of a TGF--responsive Region within the Human out or with a constitutively active form of -catenin, B23, GLI2 Promoter—A battery of deletion reporter constructs of known to interact with and favor the transcriptional activity of the human GLI2 promoter was assessed for transcriptional LEF/TCF transcription factors. TCF4 alone had a slight repres- activity in transient cell transfection experiments, in both sor effect on 119pHGLI2luc activity. Such a result is some- HaCaT and HepG2 cells, treated or not with TGF-. Con- what expected, given the low levels of active -catenin in sistent with the data obtained with 1624pHGLI2luc, all HaCaT cells as compared with HepG2 cells, which probably shorter constructs had clearly detectable basal transcrip- allows the formation of inhibitory TCF4 homodimers (3). Con- tional activity in HaCaT cells (2–3-fold above pGL3-luc sistent with this hypothesis, overexpression of active -catenin activity) but were inactive in HepG2 cells (Fig. 2D). A stim- increased the basal activity and amplified the TGF- response ulatory effect of TGF- was observed with all constructs con- of 119pHGLI2luc and reversed the effect of TCF4 to that of a taining between 119 and 1305 bp of the promoter in both cell transcriptional activator (Fig. 3C, right panel). This experimen- types, except for 1624pHGLI2luc, suggesting the existence of tal approach somewhat mimics the endogenous situation in a potential repressor element within the 1624/1305 region HepG2 cells (that contain constitutively active -catenin) and of the promoter. indicates a cooperation of SMAD3 with TCF4/-catenin to Whereas 119pHGLI2luc was efficiently transactivated in drive GLI2 transcription. response to TGF-, the 29-bp construct was not, thus iden- To validate the implication of -catenin in TGF--driven tifying the 91-bp region between nucleotides 119 and 29 as GLI2 promoter transactivation in HepG2 cells, endogenous required for activation by TGF-1 (TGF--responsive unit; -catenin expression was knocked down with specific siRNAs. TRU). Sequence examination identified putative LEF/TCF Western analysis (Fig. 3D, left panel) revealed that siRNA treat- (5-TTCAAAGA) and SMAD3/4 (5-GTCT) binding elements ment efficiently reduced the expression of both short (consti- (TBE and SBE, respectively) within this short fragment of the tutively active) and long (wild-type) forms of -catenin protein GLI2 promoter (Fig. 2E). found in HepG2 cells (32). Subsequently, we found that -cate- The Human GLI2 Promoter TGF--responsive Unit Drives nin siRNA largely abolished TGF- effect on 119pHGLI2luc SMAD and -Catenin/TCF4 Responses—We initially demon- strated that siRNA-mediated SMAD3 knockdown reduces activity (Fig. 3D, right panel). These findings establish that the TGF-1-driven GLI2 expression (15). In accordance with these -catenin pathway is involved in the regulation of GLI2 pro- findings, SMAD3 knockdown effectively prevented TGF-1- moter activation by TGF- in HepG2 cells. FIGURE 2. Characterization of the 5 regulatory region of the human GLI2 gene. A,5-RACE was used to identify the transcription start site of human GLI2 transcripts. MW, molecular weight markers. B, human GLI2 gene promoter sequence obtained after PCR amplification of a1,600-bp fragment upstream of the initiator site (Inr) identified by 5-RACE. DPE, downstream core promoter element. Residues in bold, exon I; residues in italic, intron I. C, 1624pHGLI2luc was transfected in HaCaT and HepG2 together with phRL-MLP to estimate transfection efficiency. RNA was extracted from parallel cultures. GLI2 expression was measured by multiplex PCR (right panel). D, a battery of human GLI2 promoter constructs was transfected in parallel into HaCaT and HepG2. The light gray box corresponds to exon 1; the dark box corresponds to intron I (B). Following TGF- treatment (see under “Experimental Procedures” for experimental conditions), reporter activity was determined. Activity of each construct is expressed as fold activity relative to pGL3-Basic (pGL3b) arbitrarily set to 1. Results are expressed as mean S.D. of triplicate samples from one (representative) of three experiments. Fold induction by TGF- (black bars) above controls (vehicle-treated) (gray bars) is indicated. E, nucleotide sequence of the 91-bp TGF- responsive unit between nucleotides 119 and 29 relative to the transcription start site. NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31527 Human GLI2 Promoter Transactivation by TGF- Functional Analysis of the Putative SMAD3/4 and LEF/TCF Cis-Elements Identified within the TGF--responsive Unit of the Human GLI2 Promoter—To determine whether the putative TBE and SBE cooperate and are sufficient to mediate a TGF-- dependent transcriptional response, a short 42-bp sequence spanning both SBE and TBE sites was concatamerized upstream of a minimal promoter in MLP-luc, itself unrespon- sive to TGF- (33). As shown in Fig. 4A (left panel), TGF- induced a robust transcriptional response of these constructs in HepG2 cells, proportional to the number of sequences inserted in the reporter vectors. Mutation of the SBE site within each monomer of the 4 construct (TmS4) abolished TGF- responsiveness (Fig. 4A, right panel), indicating (a), that the SBE is critical for TGF- response and (b), that the LEF/TCF site is not sufficient to drive TGF- responsiveness in the context of a heterologous promoter. The dramatic induction of 119pHGLI2luc upon TCF4 expression led us to analyze sequences downstream of the TRU. A putative LEF/TCF site (5-ATCAAAGA) was found at position 236 within exon I. 3-End deletion of 119pHGLI2luc was per- formed to generate119/104pHGLI2luc that contains no other SBE and TBE besides those found in the TRU. Regulation of 119/104pHGLI2luc by TGF- and/or SMAD3 overexpres- sion was similar to that of 119pHGLI2luc whereas its response to TCF4 and/or -catenin overexpression was re- duced (see below and compare with Fig. 3C). To determine the respective contribution of the putative SBE (5-GTCT) and TBE (5-TTCAAAGA) sites of the TRU for GLI2 promoter responsiveness to TGF-, GLI2 promoter/re- porter constructs were generated in which the SBE or the TBE were mutated, either alone (mS and mT, respectively) or in combination (mTmS) within 119/104pHGLI2luc. Both mutations efficiently prevent binding of their cognate tran- scription factors, as demonstrated using in vitro-translated TCF4 and SMAD3 protein in electrophoretic mobility shift assay experiments with corresponding labeled oligonucleotides as probes (data not shown). In both HaCaT and HepG2 cells, wild-type 119/104pHGLI2luc responded to TGF- with a 3–8-fold transactivation (Fig. 4B). Mutation of the SBE abol- ished TGF- responsiveness, as shown by the lack of transacti- vation of the mS and mTmS constructs. Thus, the SBE site is critical for TGF- responsiveness of the GLI2 promoter. On the other hand, TGF--driven promoter transactivation was only partially affected by mutation of the TBE. Thus, integrity of both SBE and TBE is required for full TGF- response. The functionality of the SBE and TBE sites was next exam- ined by overexpressing SMAD3 and/or -catenin in HaCaT FIGURE 3. SMAD3 and TCF4/-catenin contribute to GLI2 promoter trans- activation by TGF-. A, SMAD3 expression was reduced in HaCaT by specific keratinocytes, in the absence or presence of exogenous TGF- siRNA knockdown. Efficacy of the knockdown was verified by Western blot- ting with an anti-SMAD3 antibody (left panel). An HSP60 antibody was used as control. GLI2 expression was determined by quantitative PCR (center panel). Right panel, HaCaT cells were cotransfected with control or SMAD3 siRNA Results are expressed as relative activity compared with vehicle-treated together with 119pHGLI2luc and incubated with or without TGF- for 16 h. pcDNA3.1-transfected cells. C, HepG2 (left panel) cells were transfected with For both RNA and promoter data, results are expressed as fold induction by 119pHGLI2luc together with either TCF4 or SMAD3 expression vectors TGF- above vehicle-treated cultures. B, HaCaT (left panel) and HepG2 (center either alone or in combination, whereas HaCaT cells (right panel) were trans- panel) cells were transfected with 119pHGLI2luc in the presence of either fected with 119pHGLI2luc together with expression vectors for either empty pcDNA3.1 or SMAD3 expression vector and treated with TGF-. SMAD3 or a constitutively active form of -catenin, alone or in combination, SMAD3 expression was verified by Western blotting (upper panels). An anti- and then treated with TGF-. Luciferase activity was determined 16 h later. HSP60 antibody was used as control. Right panel, HepG2 cells were trans- D, -catenin expression was knocked down with specific siRNAs. Efficacy was fected with either pcDNA3.1 or a SMAD3 expression vector. 24 h later, cells verified by Western blotting (left panel). HepG2 cells were transfected with were serum-starved for 16 h and incubated with or without TGF-. RNA was 119pHGLI2luc together with control or -catenin siRNAs and treated with extracted 7 h later, and GLI2 expression was measured by quantitative PCR. TGF-. 31528 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 46 • NOVEMBER 13, 2009 Human GLI2 Promoter Transactivation by TGF- FIGURE 4. Contribution of the SBE and TBE sites within the HGLI2 promoter TRU for TGF- responsiveness. A, left panel: HepG2 cells were transfected with TS1luc, TS2luc, and TS4luc, respectively, containing one, two, or four copies of the66/25 GLI2 promoter fragment and then treated with TGF-. Right panel: HepG2 cells were transfected in parallel with TS4luc and TmS4luc and then treated with TGF-. Luciferase activity measured 16 h after TGF- addition is expressed relative to empty MLP-luc activity, arbitrarily set to 1. B, HaCaT (left panel) and HepG2 (right panel) cells were transfected in parallel with either119/104pHGLI2luc (WT), or the corresponding mS, mT, or mTmS mutants, and then treated with TGF-. Luciferase activity measured 16 h after TGF- addition is expressed relative to WT 119/ 104pHGLI2luc activity, arbitrarily set to 1. C, HaCaT cells were cotransfected in parallel with either WT 119/104pHGLI2luc or the corresponding mS and mT mutants, together with either empty pcDNA3.1 (pcDNA), SMAD3 (S3), or constitutively active -catenin (B23) expression vectors and then treated with TGF-. Luciferase activity measured 16 h after TGF- addition is expressed relative to 119/104pHGLI2luc activity cotransfected with pcDNA3.1, arbitrarily set to 1. Schematic representations of the SBE and TBE mutation status within each GLI2 promoter construct are shown as insets. D, HepG2 cells were cotransfected in parallel with either WT119/104pHGLI2luc or the corresponding mS and mT mutants, together with either empty pcDNA3.1, SMAD3, or TCF4 (T4) expression vectors and then treated with TGF-. Luciferase activity measured 16 h after TGF- addition is expressed relative to119/104pHGLI2luc activity cotransfected with pcDNA3.1, arbitrarily set to 1. E, digested chromatin from control or TGF--treated (1 and 3 h) HaCaT cells was immuno-precipitated with either anti-IgG, anti-SMAD3, or anti--catenin antibodies, as indicated. Results show representative PCR reactions with primers spanning the TGF- responsive unit. Input lanes are PCR reactions using chromatin as template, without immunoprecipitation (IP). NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31529 Human GLI2 Promoter Transactivation by TGF- stimulation. Although SMAD3 and -catenin both transacti- by targeting upstream inducers such as TGF- or other path- vated 119/104pHGLI2luc and enhanced TGF- response, ways. In this context, we previously demonstrated that pancre- mutation of the SBE fully abolished SMAD3- and TGF-- atic adenocarcinoma cell lines resistant to the Hh inhibitor driven transactivation. Despite the mS mutation, -catenin still cyclopamine, are growth-inhibited by a small molecule inhibi- exerted its stimulatory effect on basal promoter activity but did tor of TGF- receptor 1 (15). In the context of breast cancer, it not rescue TGF- responsiveness. Mutation of the TBE site was recently found that progression from ductal carcinoma in (mT construct) only slightly affected SMAD3 and TGF- situ to invasive carcinoma implicates TGF- signaling and ele- responsiveness but prevented both promoter transactivation by vated GLI2 expression (35). Consistent with our initial obser- -catenin and cooperation of -catenin with SMAD3 to vations (15), the authors found that TGF- elevates GLI2 levels enhance the TGF- response. Thus, integrity of the TBE, al- and GLI-dependent transcription, influencing myoepithelial though not essential for SMAD3/TGF--driven promoter acti- cell differentiation and progression to invasion. vation, is required for full cooperation of overexpressed Lineage-independent activation of the Wnt/-catenin path- SMAD3 and -catenin. way is often found during cancer progression (36). Remarkably, We then used a similar experimental approach in HepG2 the Wnt/-catenin pathway has been shown to enhance GLI1- cells. TCF4 was found to transactivate the WT promoter and to dependent transcription in stomach, lung, and colon cancer cooperate with SMAD3 to enhance GLI2 promoter activity and cells (37). Also, various Wnt genes are Hh/GLI targets and TGF--driven transactivation. Mutation of the SBE essentially mediate some of GLI functions during embryogenesis (38), sug- abolished GLI2 promoter by overexpressed TCF4 and blocked gesting intricate regulatory mechanisms between these path- SMAD3 and TGF- effects. Interestingly, in the context of a ways. The -catenin pathway is constitutively active in the promoter in which the TBE is inactivated (mT construct), HepG2 cell line due to heterozygote mutation in the CTNNB1 TCF4 still drove promoter activity and enhanced TGF--in- gene leading to a large deletion in the protein that favors its duced transcription. Thus, in a cellular context with constitu- nuclear accumulation and transcriptional activity (32). Why tively active -catenin, transactivation of the GLI2 promoter by HepG2 cells do not express GLI2 unless stimulated by TGF- TCF4 requires a functional SBE site, suggesting a direct coop- remains an enigma, but this suggests that the constitutively eration of SMAD3 and TCF4 via the SBE site. In this context, active -catenin pathway is not sufficient per se to allow GLI2 integrity of the nearby TBE potentiates TGF- response by transcription. This may be either due to the existence of antag- allowing a stronger TCF4 effect. onistic repressory pathways, yet to be identified, or to the abso- We finally examined the possible recruitment of SMAD3 and lute requirement of transcriptional partner(s) such as activated -catenin to the TRU by chromatin immunoprecipitation in SMADs for -catenin to activate GLI2 expression. HaCaT keratinocytes. As shown in Fig. 4C, neither SMAD3 nor Functional interactions between the SMAD and -catenin -catenin bound the human GLI2 promoter TRU in the machineries have been described. Their net outcome and absence of TGF- stimulation. However, a rapid and sustained mechanisms leading to target gene expression involves various recruitment of SMAD3 was observed as early as 1 h following mechanistic possibilities, as both pathways may function as TGF- addition to the culture medium and was still present cofactor for the other. It was initially found, using overex- after 3 h. At this later time point, -catenin was also recruited to pressed proteins in 293T cells, that SMAD4 physically interacts the TRU in response to TGF-. Taken together, these results with -catenin and that LEF1 interacts with both SMAD4 and demonstrate that both SMAD3 and -catenin are recruited to -catenin to form a complex that activates the Xtwn gene, a the GLI2 promoter in response to TGF-. Wnt/-catenin target, via binding to the promoter region (31). A parallel report also identified SMAD2 and SMAD3 as a LEF1/ DISCUSSION -catenin interactor in COS-1 cells, allowing synergistic Xtwn In this report, we have addressed three essential issues per- promoter activation by TGF- and Wnt signaling, via distinct taining to the transcriptional mechanisms controlling the SMAD and LEF/TCF binding sites (27). In glutathione S-trans- human GLI2 gene. First, we have identified the transcription ferase pulldown studies, Lei et al. (28) were able to identify the start site. Second, we have characterized the functional GLI2 interaction of both SMAD3 and SMAD4 to heteromeric core promoter. Third, we have demonstrated the cooperation TCF4-catenin complexes. SMADs and TCF4-catenin over- between SMAD3 and LEF/TCF transcription factors as well as expression synergistically activated the human gastrin pro- -catenin in TGF--induced up-regulation of GLI2 promoter moter in gastric adenocarcinoma cells. We showed that activity. SMADTCF-catenin complexes were also able to regulate Abnormal activation of the Hh pathway has been implicated transcription at isolated SMAD or TCF sites. In the latter two in a variety of cancers (6), and targeted anti-cancer therapy studies, the cooperation of SMADs with LEF/TCF was shown focused on Hh signaling is trying to address unmet needs for to implicate the transcriptional coactivator p300/CREB-bind- efficient cancer treatment. In this context, small molecule Hh ing protein. It was recently demonstrated that the integrity of antagonists have been developed that either block SMOH func- two TCF/LEF binding sites are necessary for vascular endothe- tion or interfere with GLI binding to DNA (13). However, it lial growth factor A regulation by TGF- and involves down- becomes more and more clear that noncanonical signaling regulationofglycogensynthasekinase3-dependentphosphor- events are often responsible for the expression of Hh mediators ylation of -catenin in response to TGF- and recruitment of of the GLI family (15, 34, 35), indicating that therapeutic inter- unphosphorylated -catenin to TCF4SMAD2/3 complexes vention against deleterious GLI expression may also be possible (29). Our data, which demonstrates that TCF4 cooperates with 31530 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 46 • NOVEMBER 13, 2009 Human GLI2 Promoter Transactivation by TGF- 15. Dennler, S., Andre, J., Alexaki, I., Li, A., Magnaldo, T., ten Dijke, P., Wang, SMADs to transactivate the GLI2 promoter in HepG2 cells X. J., Verrecchia, F., and Mauviel, A. (2007) Cancer Res. 67, 6981–6986 even when the TBE is mutated, support the notion that -cate- 16. Massague, J., Seoane, J., and Wotton, D. (2005) Genes Dev. 19, 2783–2810 nin and SMADs act as cofactors to regulate SMAD-dependent 17. Schmierer, B., and Hill, C. S. (2007) Nat. Rev. Mol. Cell Biol. 8, 970–982 gene transcription. The presence of a LEF/TCF site near the 18. Javelaud, D., and Mauviel, A. (2004) Int. J. Biochem. Cell Biol. 36, SBE further accentuates the cooperation of these transcription 1161–1165 factors. 19. ten Dijke, P., and Hill, C. S. (2004) Trends Biochem. Sci. 29, 265–273 It is likely that signals leading to -catenin activation such as 20. Roessler, E., Ermilov, A. N., Grange, D. K., Wang, A., Grachtchouk, M., Dlugosz, A. A., and Muenke, M. (2005) Hum. Mol. Genet. 14, 2181–2188 those initiated by Wnts will cooperate with TGF- to up-regu- 21. Dennler, S., Huet, S., and Gauthier, J. M. (1999) Oncogene 18, 1643–1648 late GLI2 expression, thereby providing de novo substrate for 22. Roose, J., Huls, G., van Beest, M., Moerer, P., van der Horn, K., Gold- enhanced Hh signaling. Such signal convergence leading to schmeding, R., Logtenberg, T., and Clevers, H. (1999) Science 285, GLI2 expression is likely to occur in a number of cancers inde- 1923–1926 pendent of lineage. In this context, our work represents critical 23. Wei, Y., Renard, C. A., Labalette, C., Wu, Y., Levy, L., Neuveut, C., Prieur, groundwork for elucidating the mechanisms regulating GLI2 X., Flajolet, M., Prigent, S., and Buendia, M. A. (2003) J. Biol. Chem. 278, transcription, an important step to elaborate adequate targeted 5188–5194 intervention against upstream signals responsible for GLI2 24. Pan, Y., Bai, C. B., Joyner, A. L., and Wang, B. (2006) Mol. Cell Biol. 26, 3365–3377 expression. 25. Smale, S. T., and Kadonaga, J. T. (2003) Annu. Rev. Biochem. 72, 449–479 26. Edlund, S., Lee, S. Y., Grimsby, S., Zhang, S., Aspenstrom, P., Heldin, C. H., Acknowledgments—We thank Dr. A. Dlugosz (University of Michi- and Landstrom, M. (2005) Mol. Cell Biol. 25, 1475–1488 gan, Ann Arbor, MI) for providing reagents critical for experiments 27. Labbe´, E., Letamendia, A., and Attisano, L. (2000) Proc. Natl. Acad. Sci. and Dr. D. Bernuau (INSERM U697) for helpful discussions. U.S.A. 97, 8358–8363 28. Lei, S., Dubeykovskiy, A., Chakladar, A., Wojtukiewicz, L., and Wang, T. C. (2004) J. Biol. Chem. 279, 42492–42502 REFERENCES 29. Clifford, R. L., Deacon, K., and Knox, A. J. (2008) J. Biol. Chem. 283, 1. Evangelista, M., Tian, H., and de Sauvage, F. J. (2006) Clin Cancer Res. 12, 35337–35353 5924–5928 30. Hirota, M., Watanabe, K., Hamada, S., Sun, Y., Strizzi, L., Mancino, M., 2. Kelleher, F. C., Fennelly, D., and Rafferty, M. (2006) Acta Oncol. 45, Nagaoka, T., Gonzales, M., Seno, M., Bianco, C., and Salomon, D. S. (2008) 375–388 Cell Signal 20, 1632–1641 3. Hoppler, S., and Kavanagh, C. L. (2007) J. Cell Sci. 120, 385–393 31. Nishita, M., Hashimoto, M. K., Ogata, S., Laurent, M. N., Ueno, N., 4. Massague, J. (2008) Cell 134, 215–230 Shibuya, H., and Cho, K. W. (2000) Nature 403, 781–785 5. Pasca di Magliano, M., and Hebrok, M. (2003) Nat. Rev. Cancer 3, 903–911 32. de La Coste, A., Romagnolo, B., Billuart, P., Renard, C. A., Buendia, M. A., 6. Ruiz i Altaba, A., Sanchez, P., and Dahmane, N. (2002) Nat. Rev. Cancer 2, Soubrane, O., Fabre, M., Chelly, J., Beldjord, C., Kahn, A., and Perret, C. 361–372 (1998) Proc. Natl. Acad. Sci. U.S.A. 95, 8847–8851 7. Varjosalo, M., and Taipale, J. (2008) Genes Dev. 22, 2454–2472 33. Dennler, S., Itoh, S., Vivien, D., ten Dijke, P., Huet, S., and Gauthier, J. M. 8. Kasper, M., Regl, G., Frischauf, A. M., and Aberger, F. (2006) Eur. J. Cancer (1998) EMBO J. 17, 3091–3100 42, 437–445 34. Nolan-Stevaux, O., Lau, J., Truitt, M. L., Chu, G. C., Hebrok, M., Fernandez- 9. Thiyagarajan, S., Bhatia, N., Reagan-Shaw, S., Cozma, D., Thomas- Zapico, M. E., and Hanahan, D. (2009) Genes Dev. 23, 24–36 Tikhonenko, A., Ahmad, N., and Spiegelman, V. S. (2007) Cancer Res. 67, 35. Hu, M., Yao, J., Carroll, D. K., Weremowicz, S., Chen, H., Carrasco, D., 10642–10646 Richardson, A., Violette, S., Nikolskaya, T., Nikolsky, Y., Bauerlein, E. L., 10. Narita, S., So, A., Ettinger, S., Hayashi, N., Muramaki, M., Fazli, L., Kim, Y., Hahn, W. C., Gelman, R. S., Allred, C., Bissell, M. J., Schnitt, S., and Polyak, and Gleave, M. E. (2008) Clin. Cancer Res. 14, 5769–5777 K. (2008) Cancer Cell 13, 394–406 11. Kim, Y., Yoon, J. W., Xiao, X., Dean, N. M., Monia, B. P., and Marcusson, 36. Paul, S., and Dey, A. (2008) Neoplasma 55, 165–176 E. G. (2007) Cancer Res. 67, 3583–3593 37. Maeda, O., Kondo, M., Fujita, T., Usami, N., Fukui, T., Shimokata, K., 12. Ji, J., Kump, E., Wernli, M., and Erb, P. (2008) Int. J. Cancer 122, 50–56 Ando, T., Goto, H., and Sekido, Y. (2006) Oncol. Rep. 16, 91–96 13. Rubin, L. L., and de Sauvage, F. J. (2006) Nat. Rev. Drug Discov. 5, 38. Mullor, J. L., Dahmane, N., Sun, T., and Ruiz i Altaba, A. (2001) Curr. Biol. 1026–1033 14. Lauth, M., and Toftgard, R. (2007) Cell Cycle 6, 2458–2463 11, 769–773 NOVEMBER 13, 2009 • VOLUME 284 • NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31531

Journal

Journal of Biological Chemistry – Unpaywall

Published: Sep 22, 2009

There are no references for this article.