Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Coupling of the nucleus and cytoplasm

Coupling of the nucleus and cytoplasm JCB: ARTICLE Coupling of the nucleus and cytoplasm: role of the LINC complex 1 1 1 4 3 1 2 2 Melissa Crisp, Qian Liu, Kyle Roux, J.B. Rattner, Catherine Shanahan, Brian Burke, Phillip D. Stahl, and Didier Hodzic Department of Anatomy and Cell Biology, University of Florida, Gainesville, FL 32610 Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110 Division of Cardiovascular Medicine, Addenbrooke’s Centre for Clinical Investigation, Cambridge CB2 2QQ, UK Department of Cell Biology and Anatomy, University of Calgary, Calgary AB T2N 4N1, Canada he nuclear envelope defines the barrier between shown that localization of nesp2G to the ONM is depen- the nucleus and cytoplasm and features inner and dent upon an interaction with Sun1. In this study, we con- T outer membranes separated by a perinuclear firm and extend these results by demonstrating that both space (PNS). The inner nuclear membrane contains Sun1 and Sun2 contribute to nesp2G localization. specific integral proteins that include Sun1 and Sun2. Codepletion of both of these proteins in HeLa cells leads Although the outer nuclear membrane (ONM) is continu- to the loss of ONM-associated nesp2G, as does overex- ous with the endoplasmic reticulum, it is nevertheless en- pression of the Sun1 lumenal domain. Both treatments re- riched in several integral membrane proteins, including sult in the expansion of the PNS. These data, together nesprin 2 Giant (nesp2G), an 800-kD protein featuring with those of Padmakumar et al. (2005), support a model an NH -terminal actin-binding domain. A recent study in which Sun proteins tether nesprins in the ONM via in- (Padmakumar, V.C., T. Libotte, W. Lu, H. Zaim, S. Abra- teractions spanning the PNS. In this way, Sun proteins ham, A.A. Noegel, J. Gotzmann, R. Foisner, and I. Kar- and nesprins form a complex that links the nucleoskeleton akesisoglou. 2005. J. Cell Sci. 118:3419–3430) has and cytoskeleton (the LINC complex). Introduction The existence of distinct nuclear and cytoplasmic compart- system. Similarly, the PNS represents a perinuclear extension ments is dependent upon the presence of a selective barrier of the ER lumen. called the nuclear envelope (NE). The NE consists of several The final major structural feature of the NE is the nuclear structural elements (Burke and Stewart, 2002; Gruenbaum et lamina. This is a relatively thin (50 nm) protein meshwork al., 2005), the most prominent of which are the inner and outer associated with the nuclear face of the INM. The major compo- nuclear membranes (INM and ONM, respectively). In most nents of the lamina are the A- and B-type lamins (Gerace et al., cells, these two membranes are separated by a regular gap of 1978). These are members of the larger intermediate filament 50 nm, which is known as the perinuclear space (PNS). Peri- family, and, like all intermediate filament proteins, they feature odic annular junctions between the two membranes form a central coiled-coil flanked by nonhelical head and tail do- aqueous channels between the nucleus and the cytoplasm that mains (Gerace and Burke, 1988). The lamins are known to in- accommodate nuclear pore complexes (NPCs) and, therefore, teract with components of the INM as well as with chromatin permit the movement of macromolecules across the NE. proteins. In this way, the lamina provides anchoring sites at the In addition to its connections to the INM at the periphery nuclear periphery for higher order chromatin domains. of each NPC, the ONM also exhibits numerous continuities In mammalian somatic cells, there are two major A-type with the ER, to which it is functionally related. In this way, lamins (lamins A and C) encoded by a single gene, Lmna (in the INM, ONM, and ER form a single continuous membrane mice). The B-type lamins, B1 and B2, are encoded by two sep- arate genes (Hoger et al., 1988, 1990; Lin and Worman, 1993, 1995). Although B-type lamins are found in all cell types, the Correspondence to Didier Hodzic: [email protected]; or Brian Burke: [email protected] expression of A-type lamins is developmentally regulated Abbreviations used in this paper: ABD, actin-binding domain; INM, inner nuclear (Stewart and Burke, 1987; Rober et al., 1989). Typically, A-type membrane; MEF, mouse embryonic fibroblast; NE, nuclear envelope; NPC, lamins are found in most adult cell types but are absent from nuclear pore complex; ONM, outer nuclear membrane; PNS, perinuclear space; RNAi, RNA interference; siRNA, short inhibitory RNA. those of early embryos. Mutations in the LMNA gene have been © The Rockefeller University Press $8.00 The Journal of Cell Biology, Vol. 172, No. 1, January 2, 2006 41–53 http://www.jcb.org/cgi/doi/10.1083/jcb.200509124 JCB 41 THE JOURNAL OF CELL BIOLOGY linked to a variety of human diseases (Burke and Stewart, topology in which the SUN domain is localized in the PNS 2002), many of which are associated with large-scale perturba- (Hodzic et al., 2004). It is tempting to speculate, based upon tions in nuclear organization. These observations have rein- the model of Starr and Han (2003), that SUN domain proteins forced the view that the lamina is an important determinant of function as tethers for ONM-associated nesprins in mamma- nuclear architecture and has an essential role in the mainte- lian cells. nance of NE integrity. Recently, Padmakumar et al. (2005) have shown that lo- Despite their numerous connections, the INM and ONM calization of nesp2G to the ONM is dependent upon an inter- are biochemically distinct. Proteomic studies have revealed the action with another mammalian SUN domain protein, Sun1. existence of at least 50 integral membrane proteins that are en- In this study, we provide evidence that Sun1 is inserted into riched in NEs. Many of these appear to reside within the INM the INM in such a way that its SUN domain, like that of (Schirmer et al., 2003). Proteins become localized to the INM Sun2, faces the PNS. In this way, we can conclusively dem- via a process of selective retention (Powell and Burke, 1990; onstrate that Sun1 does indeed have the appropriate orienta- Soullam and Worman, 1995; Ellenberg et al., 1997). In this tion, as assumed by Padmakumar et al. (2005), for its COOH- scheme, membrane proteins synthesized on the peripheral ER terminal domain to interact with the nesp2G KASH domain. or ONM may gain access to the INM by lateral diffusion via The NH -terminal region of both Sun1 and 2 face the nucleo- the continuities at the periphery of each NPC using an energy- plasm and interact with lamins. Surprisingly, our results indi- dependent mechanism (Ohba et al., 2004). However, only cate that Sun1 has a very strong preference for prelamin A. those proteins that can interact with nuclear or INM/lamina Sun1 is the only nuclear membrane protein described to date components are retained and concentrated. that exhibits such binding activity. This raises the distinct pos- The recent identification of ONM-specific integral mem- sibility that Sun1 may be involved in the targeting and assem- brane proteins has raised some puzzling issues (Zhang et al., bly of newly synthesized lamin A. Finally, we demonstrate that 2001; Zhen et al., 2002; Padmakumar et al., 2004). In particu- Sun1 and 2 share some degree of functional redundancy and lar, what prevents ONM proteins from simply drifting off into that both of these proteins cooperate in tethering nesp2G in the peripheral ER? This question was originally addressed in the ONM. This tethering involves the establishment of mo- Caenorhabditis elegans, where the localization of Anc-1, a lecular interactions that span the PNS and contributes to the very large type II ONM protein involved in actin-dependent remarkably regular spacing that is observed between the nuclear positioning, was shown to be dependent upon Unc-84, ONM and INM. Based upon our findings and upon those of an INM protein (Starr and Han, 2002). Localization of Unc-84 Padmakumar et al. (2005), we are able to conclude that Sun1 itself was found to be dependent upon the single C. elegans and 2 function as key links in a molecular chain that connects lamin (Lee et al., 2002). Based upon these findings, Starr and the actin cytoskeleton via giant nesprin proteins to nuclear Han (2003) and Lee et al. (2002) proposed a novel model in lamins and other components of the nuclear interior. We now which Unc-84 and Anc-1 would interact across the PNS via refer to this assembly as the LINC complex (linker of nu- their respective lumenal domains. In this way, Unc-84 would cleoskeleton and cytoskeleton). act as a tether for Anc-1. In mammalian cells, two giant (up to 1 MD) actin-bind- Results ing proteins have been identified (variously termed NUANCE, nesprin 2 Giant [nesp2G], nesprin 1, enaptin, Syne 1, syne 2, We have previously shown that Sun2 is an INM protein featur- and myne 1) as integral proteins of the ONM (Apel et al., 2000; ing an NH -terminal nucleoplasmic domain and a significantly Zhang et al., 2001; Mislow et al., 2002; Zhen et al., 2002; Pad- larger COOH-terminal domain that is localized within the PNS makumar et al., 2004). These belong to a very large family of (Hodzic et al., 2004). This lumenal region of Sun2 contains a proteins encoded by the nesprin 1 and 2 genes (Zhang et al., COOH-terminal SUN domain that is also found in C. elegans 2001) and consist of a bewildering variety of alternatively Unc-84. The SUN domain is found in at least two additional spliced isoforms. The nesprins are related to Anc-1 as well as mammalian proteins (Fig. 1 A): Sun1 (GenBank/EMBL/DDBJ to a Drosophila melanogaster ONM protein, Klarsicht (Welte accession no. BC048156) and Sun3 (GenBank/EMBL/DDBJ et al., 1998; Mosley-Bishop et al., 1999), in the possession of accession no. BC026189). a 60–amino acid COOH-terminal KASH domain (Klarsicht, Sun1 transcripts are present in a variety of tissues and cell Anc-1, and Syne homology). This domain comprises a single types (Fig. 1 B). A comparison of Sun1 sequences in GenBank transmembrane anchor and a short segment of 40 residues reveals that it exists in multiple, alternatively spliced isoforms. that resides within the PNS. This conclusion is supported by Northern blot analysis, which One of the defining features of Unc-84 is a region of reveals at least four or five discrete Sun1 transcripts in different homology consisting of 200 amino acids with Sad1p, a tissues. We have not, however, surveyed these tissues for Sun1 Schizosaccharomyces pombe protein that is associated with the isoforms. Immunofluorescence experiments using a polyclonal spindle pole body (Hagan and Yanagida, 1995). This region of antibody raised against recombinant human Sun1 suggests that homology is known as the SUN domain (Sad1p and UNc-84) like Sun2, Sun1 is localized largely, if not exclusively, to the and is believed to extend into the PNS. Mammalian cells also NE (Fig. 1 C). This is consistent with the appearance of Sun1 contain several SUN domain proteins. At least one of these, as well as Sun2 in a proteomic screen for NE-specific membrane Sun2, has been shown to be an INM protein with the appropriate proteins (Schirmer et al., 2003). 42 JCB • VOLUME 172 • NUMBER 1 • 2006 Figure 1. Sun1 is a ubiquitously expressed NE protein featuring a conserved COOH-terminal SUN domain. (A) ClustalW alignment of the COOH-terminal region of human Sun1–3 and C. elegans Unc-84 reveals the homology of the SUN domains. (B) Northern blot analysis of mRNA from multiple mouse tissues illustrates widespread expression of Sun1. A GAPDH probe was used as a loading control. (C) The NE localizations of Sun1 and 2 were determined by immunofluorescence microscopy using rabbit antibodies raised against recombinant Sun proteins. (D, left) HeLa cells transiently transfected with HA-tagged Sun1 confirm the predominant NE localization. HA-Sun1 was detected using an anti-HA monoclonal antibody. (D, right) Upon overexpression, HA-Sun1 is also detected in the ER. In each case, Sun protein localization is shown in red, whereas DNA, visualized using Höchst dye 33258, appears in blue. To further address the issue of Sun1 localization, we reasonable orientation for Sun1 would place its COOH terminus, fused an HA epitope to the NH terminus of the largest isoform including its SUN domain, within the microsome lumen. By of mouse Sun1. After transfection into HeLa cells, the exoge- extension, the SUN domain should thus reside within the PNS nous protein was found by immunofluorescence microscopy to in vivo. This orientation is supported by additional experiments be enriched at the NE (Fig. 1 D). At high expression levels, al- described below. though still concentrated in the NE, HA-Sun1 began to appear To examine the roles of the two hydrophobic segments in the peripheral ER (Fig. 1 D). Together, these observations in Sun1 membrane anchoring, we took advantage of naturally confirm that Sun1 is a nuclear membrane protein. Similar ex- occurring splice isoforms. Searches of GenBank reveal sev- periments with HA-tagged Sun3 revealed a distribution that eral mammalian Sun1 cDNAs lacking sequences within the was more typical of an ER protein (not depicted). Furthermore, NH -terminal domain. Comparisons with genomic sequences Northern blot analysis suggests that Sun3 is found primarily in indicate that at least one splice isoform of Sun1 lacks exons the testis (not depicted). Consequently, all of our subsequent 6–8, corresponding to a deletion of residues 222–343 (Fig. 2 C). experiments focused on Sun1 and 2. This particular Sun1 isoform is missing the first hydrophobic The primary structure of mouse Sun1 reveals no NH - segment, H1. When this isoform (Sun16–8) was tagged with terminal signal sequence. However, two distinct hydrophobic HA and transfected into HeLa cells, its localization at the NE domains, H1 and H2, are present (Fig. 2 A). H1 lies between was found to be indistinguishable from full-length Sun1 (Fig. residues 241 and 258, whereas the second and larger domain, 2 D). Translation of Sun16–8 in vitro in the presence of mi- H2, lies between residues 356 and 448. The presence of ex- crosomes revealed a protease-resistant fragment identical in tended hydrophobic regions clearly raises questions concerning size with that derived from full-length Sun1 (Fig. 2 C). This the topology of Sun1 within the nuclear membranes. An earlier finding presents us with two conclusions. First, it proves that study on Sun2 has shown that the SUN domain resides within the protected fragment must be derived from the COOH-terminal the PNS (Hodzic et al., 2004). Is this also the case for Sun1? portion of the molecule. Second, if this first hydrophobic seg- To address this, we used in vitro transcription/translation of ment in Sun1 were to represent a transmembrane domain, its Sun1 (tagged and untagged) both in the presence and absence removal should logically alter the topology of the subsequent of microsomes (Fig. 2 B). Digestion of Sun1 translation prod- membrane-spanning sequences of Sun1 (i.e., H2) within the ucts with proteinase K revealed the existence of a 65–70-kD ER or nuclear membranes. This might potentially lead to the protected fragment in samples containing microsomes. Proteinase flipping of lumenal segments of newly synthesized Sun1 to K digestion in the presence of Triton X-100 to permeabilize the the cytoplasmic aspect of the ER membrane or failure to insert microsomal membranes resulted in the complete loss of the H2 sequences into the membrane. Evidently, this does not protected fragment. Given the size of this protected fragment happen in any detectable way. Therefore, our conclusion is and the location of potential transmembrane domains, the most that given this first hydrophobic sequence in Sun1 is dispens- SUN–NESPRIN INTERACTIONS • CRISP ET AL. 43 Figure 2. Sun1 is a transmembrane protein with a lumenal COOH-terminal domain. (A) Hydropathy plot (Sweet and Eisenberg, 1983) of Sun1 reveals two hydrophobic domains (H1 and H2) upstream of the COOH-terminal coiled-coil and SUN domain. (B) When translated in vitro either in the presence or absence of microsomes, HA-tagged mouse Sun1, labeled with [ S]methionine/cysteine, appears as a 100-kD band, as revealed by SDS-PAGE. Subsequent proteinase K digestion of HA-Sun1 that had been translated in the presence of microsomes lead within 30–60 min to the quantitative loss of the full-length HA-Sun1 and the appearance of an 65–70-kD protected fragment (arrowhead). Inclusion of Triton X-100 in the digest to permeabilize the microsomes leads to the complete degradation of HA-Sun1 within 60 min. (C) An alternatively spliced isoform of Sun1 (6–8) lacks the first hydrophobic domain (H1). When translated in vitro in either the presence or absence of microsomes, HA-Sun16–8 appears as a band that is predictably smaller than the full-length protein. However, both full-length HA-Sun1 and HA-Sun16–8 that were translated in the presence of microsomes and subjected to digestion with proteinase K yield identically sized protected fragments (arrowhead). Inclusion of Triton X-100 in the digestion reaction results in degradation of both proteins. (D) Immunofluorescence microscopy of HeLa cells transfected with HA-Sun16–8 reveals that the exogenous protein is localized at the NE. In this respect, HA-Sun16–8 is indistinguishable from full-length HA-Sun1. HA-Sun16–8 is detected with an anti-HA monoclonal antibody. The corresponding field labeled with Höchst dye to reveal cell nuclei is also shown. able with respect to membrane insertion, it does not function As shown in Fig. 3, the myc tag was never visible at the nuclear as an obligate membrane-spanning domain. Further second- surface (or at any other location) after digitonin permeabilization ary structure analyses of Sun1 using HMMTOP (Tusnady and regardless of the expression level of HA-Sun1–myc. The HA Simon, 2001) indicate that the larger hydrophobic segment, tag was also undetectable at the nuclear surface after digitonin H2, is capable of spanning the ER/nuclear membranes three permeabilization of cells expressing low levels of HA-Sun1– times. Although this conformation for H2 still requires bio- myc. At high expression levels, however, the tag was detect- chemical confirmation, it suggests that Sun1 is a multispanning able at the nuclear surface and was associated with a cytoplas- protein in which the NH -terminal domain faces the cyto- mic reticular structure corresponding to the peripheral ER. plasm, whereas the COOH-terminal domain (including the Clearly, the NH -terminal, but not the COOH-terminal, domain SUN domain) is localized to the lumenal space. of ER-associated Sun1 is exposed to the cytoplasm. Altogether, To further examine Sun1 distribution and orientation in these findings are consistent with the view that Sun1 is a com- vivo, we prepared a form of mouse Sun1 that was tagged with ponent of the INM and that its COOH-terminal domain resides an HA epitope at the NH terminus and a myc epitope at the with the PNS. COOH terminus (Fig. 3, HA-Sun1–myc). These analyses took The aforementioned data, as well as our previously pub- advantage of the fact that low concentrations of digitonin can lished study (Hodzic et al., 2004), indicate that the NH -terminal be used to selectively permeabilize the plasma membrane of domains of Sun1 and 2 are exposed to the nucleoplasm and, cells while leaving the nuclear membranes and ER intact consequently, are accessible for interaction with nuclear com- (Adam et al., 1990). For these experiments, HeLa cells ex- ponents. Given the role that such interactions play in the ap- pressing HA-Sun1–myc were fixed with formaldehyde and propriate targeting of INM proteins, it is not surprising that the permeabilized on ice for 15 min with 0.003% digitonin. The lumenal domain of Sun1 is entirely dispensable with respect to cells were then labeled with either rabbit anti-myc or rabbit Sun1 localization (Fig. 4 A). In this respect, Sun1 mimics anti-HA. After PBS washes to remove unbound antibodies, the Sun2 (Hodzic et al., 2004). Additional experiments suggest cells were refixed, permeabilized with Triton X-100, and fur- that Sun1 and 2 share overlapping interactions. Overexpres- ther incubated with mouse antibodies against either HA or sion of HA-Sun1 in HeLa cells causes displacement of endog- myc. In this way, the first tag could be assayed for accessibility enous Sun2 from the NE (Fig. 4 B). However, the converse is at the nuclear surface, whereas the second tag could be used to not the case (not depicted). The implication is that Sun1 and 2 define the localization and expression level of HA-Sun1–myc. share a subset of interactions that are required for Sun2 local- 44 JCB • VOLUME 172 • NUMBER 1 • 2006 trol were used in pull-down experiments using in vitro trans- lated lamins as targets. Four lamin species were used in these experiments (Fig. 4 D): lamin B1 (LaB1), lamin C (LaC), full-length lamin A (FL LaA), and mature lamin A. Full-length lamin A contains a CaaX motif and should be farnesylated in the reticulocyte ly- sate (Vorburger et al., 1989). However, it does not undergo detectable COOH-terminal proteolysis because the microsome- free in vitro translation mix lacks the appropriate processing enzymes. The mature lamin A cDNA contains a premature stop codon at position 647. In this way, it mimics processed (i.e., mature) lamin A. As shown in Fig. 4 D, GST-Sun2N165 bound all four lamin species, although the interaction with lamins B1 and C appeared barely more than the background observed with GST alone. Similarly, GST-Sun1N220 was also found to interact with all four lamin species. As was the case with Sun2N165, the interactions with lamins B1 and C were relatively weak. However, Sun1N220 showed a very strong preference for unprocessed (full-length lamin A) versus mature lamin A. To determine whether these in vitro interactions might have any relevance in vivo, we prepared HA-tagged versions of both Sun1N220 and Sun2N165. Upon introduction into HeLa cells, both proteins accumulated within the nucleoplasm (Fig. Figure 3. The SUN domain of Sun1 is located within the PNS, whereas 4 E), although a significant cytoplasmic pool was always the NH -terminal domain is exposed to the nucleoplasm. To examine the present. We also prepared a form of lamin A (preLaA) contain- orientation of Sun1, HA and myc epitope tags were placed at the NH and COOH termini, respectively. HeLa cells were transfected with the dou- ing an L647R mutation. This lamin A mutant is cleavage resis- ble-tagged construct and processed for immunofluorescence microscopy tant and, therefore, retains its farnesylated COOH-terminal after 24 h. After fixation, the cells were permeabilized with 0.003% digi- peptide. Cotransfection of HeLa cells with preLaA along with tonin and incubated with an anti-epitope tag antibody (mouse monoclonal). Subsequently, the cells were refixed and permeabilized with Triton X-100 either HA-Sun1N220 or HA-Sun2N165 lead to a dramatic de- to expose the lumenal compartment to a second anti-epitope tag antibody cline in the nucleoplasmic concentration of both Sun protein (rabbit polyclonal). Neither epitope tag was significantly detectable after fragments coincident with recruitment to the nuclear periphery. digitonin permeabilization in HeLa cells expressing low to moderate levels of HA-Sun1–myc. After Triton X-100 permeabilization, both myc and HA Lamin B1, on the other hand, had no such effect. These results were readily detected at the NE. In HeLa cells with elevated expression of indicate that the Sun proteins do indeed have the capacity to HA-Sun1–myc, the HA but not myc epitope tag was detected at the ER af- interact with lamin A in vivo. ter digitonin permeabilization. Both myc and HA tags were identifiable after treatment with Triton X-100. These data indicate that the NH - and 2 To determine whether this interaction with lamin A is re- COOH-terminal domains of Sun1 reside on opposite sides of the INM, quired for Sun2 retention at the NE, we first performed im- with the COOH-terminal domain located in the PNS. munofluorescence experiments on fibroblasts derived from both wild-type and Lmna-null mouse embryonic fibroblasts ization. Sun1 retention must be dependent upon additional (MEFs). Although Sun2 was detected at the NE of all wild- binding partners. type cells, in the majority of Lmna-null MEFs, Sun2 was dis- With what proteins might the Sun1 and 2 nucleoplasmic persed throughout cytoplasmic membranes (Fig. 5 A). At first, domains interact? Our initial thoughts were that the Sun pro- these results do indeed implicate A-type lamins in the appro- teins might associate with lamina components. To address this, priate localization of Sun2 within the INM. However, there is we first adopted an in vitro approach to determine whether A- clearly a minority of Lmna-null cells in which Sun2 is fully re- and B-type lamins could interact with the NH -terminal domain tained at the NE (Fig. 5 A, inset). Furthermore, loss of Sun2 of either protein. We prepared a GST fusion protein containing from the INM is not reversed simply by introducing lamin A the first 165 amino acids of the Sun2 sequence (Sun2N165). and/or C by transfection into Lmna-null MEFs (not depicted). This represents most of the Sun2 nucleoplasmic domain. A Evidently, although A-type lamins could contribute to Sun2 similar, although slightly larger (the first 220 amino acids), localization, they are not the only determinants. This sugges- fusion protein was also prepared using Sun1 sequences that tion is reinforced by experiments in HeLa cells in which we encompassed the bulk of the nonalternatively spliced region of eliminated A-type lamins by RNA interference (RNAi). After the nucleoplasmic domain (Sun1N220). This region of Sun1 48–72 h of RNAi treatment, lamin A/C was undetectable in exhibits significant sequence similarity to the NH -terminal many cells. However, the NE localization of Sun2 was barely domain of Sun2 over a region of 120 residues (Fig. 4 C), al- affected (Fig. 5 C). though Sun1 does display a unique 50-residue NH -terminal In contrast to Sun2, we could find no evidence whatso- extension. Both of these fusion proteins as well as a GST con- ever for any lamin-dependent localization of Sun1. We took the SUN–NESPRIN INTERACTIONS • CRISP ET AL. 45 Figure 4. Interactions between the nucleoplasmic domains of Sun1 and 2 with A-type lamins. (A) An HA-Sun1L construct lacking the SUN domain and most of the lumenal coiled-coil localizes to the NE in a manner similar to the full-length protein. Anti-HA labeling is in red, whereas DNA, visualized with Höchst dye, is in blue. (B) Overexpression of HA-Sun1 leads to the loss of endogenous Sun2 in HeLa cells, suggesting that these two proteins share common binding partners. (C) A ClustalW alignment of the NH -terminal sequences of mouse Sun1 and 2 identifies multiple clusters of homologous amino acids within a region of 120 residues. Sun1 exhibits a unique NH -terminal extension of 50 amino acid residues. (D) The first 222 residues of Sun1 or the first 165 residues of Sun2 (this represents the entire nucleoplasmic domain of the latter) were fused to GST and, with GST alone (Coomassie stain, bottom), were used to pull down S-labeled, in vitro translated lamins B1, C, mature A, and full-length (FL) A (Total). Unlike GST alone, Sun1N220 and Sun2N165 pulled down lamins B1, C, and mature A at similar levels. However, Sun1N222 displayed a higher affinity for FL LaA than did Sun2N165. Evidently, Sun1 has a very strong preference for full-length (or pre) lamin A over mature lamin A (or full-length lamins C and B1). (E) An HA tag was inserted at the NH terminus of the same nucleoplasmic segments of both Sun1 and 2 (as described in D), and the tagged proteins were expressed in HeLa cells. Both of these exogenous proteins appear enriched in the nucleoplasm (top). As observed by deconvolution microscopy, cotransfection of the myc-tagged full- length lamin A (green) with HA-Sun1N222 or HA-Sun2N165 (red) resulted in the recruitment of both HA-Sun proteins to the NE (middle). Myc–lamin B1, in contrast, fails to produce such an effect. Evidently, the nucleoplasmic domains of Sun1 and 2 can interact with lamin A in vivo. approach of introducing HA-Sun1 into both wild-type and To accomplish this, we raised an antibody against the Lmna-null MEFs. In either case, exogenous Sun1 was always NH -terminal actin-binding domain (ABD) of nesp2G. The af- found at the nuclear periphery (Fig. 5 B). Similarly, in HeLa finity-purified antibody recognized a very large (400 kD) cells depleted of A-type lamins by RNAi, endogenous Sun1 al- protein on Western blots of HeLa cell lysates (Fig. 6 A). At ways remained concentrated at the NE (Fig. 5 C). Regardless longer exposure times, lower molecular mass bands appeared, of A-type lamin content, we have never observed cells in which possibly corresponding to smaller nesprin 2 isoforms (Zhang et Sun1 is substantially mislocalized. Thus, although Sun proteins al., 2001) or to degradation products. Immunofluorescence mi- demonstrably interact with A-type lamins, this interaction is croscopy using digitonin permeabilization revealed that the not required for their localization in the INM. anti-nesp2G antibody decorated the cytoplasmic surface of the Studies in C. elegans have shown that the prototype SUN NE (Fig. 6 B, mock). This labeling pattern was abolished by domain protein Unc-84 is required for the appropriate localiza- RNAi treatment of cells using nesprin 2–specific SmartPool tion of Anc-1 in the ONM (Lee et al., 2002; Starr and Han, oligonucleotides. Clearly, our antibody recognizes a very large 2002). Giant nesprin family members are also known to local- ONM-associated nesprin 2 isoform, which is almost certainly ize to the ONM (Zhang et al., 2001; Zhen et al., 2002; Padma- nesp2G. Permeabilization of non–RNAi-treated cells with kumar et al., 2004) and, like Anc-1, feature a COOH-terminal Triton X-100 yielded additional intranuclear labeling (unpub- KASH domain. Therefore, we examined the role that mamma- lished data). This confirms a previous study suggesting that lian SUN domain proteins might play in the localization of one smaller nesprin 2 variants reside within the nucleus (Zhang et of these nesprin proteins (nesp2G; 800 kD). al., 2005). For all of our subsequent experiments, we used digi- 46 JCB • VOLUME 172 • NUMBER 1 • 2006 Figure 5. A-type lamin independent retention of SUN domain proteins at the NE. (A) Endogenous Sun2 is frequently, but not always (inset), lost from the NE in Lmna-null MEFs. In wild-type MEFs, Sun2 is always found at the NE. (B) When HA-Sun1 was introduced by transfection into either wild-type or Lmna-null MEFs, it was always found to localize appropriately to the NE. (C) Depletion of HeLa cells of A-type lamins by RNAi had no significant effect on endogenous Sun1 or 2 localization. In the merged im- ages, Sun protein localization is shown in red, A-type lamin localization (lamin A/C) is shown in green, and nuclei are revealed in blue using Höchst dye. The inference is that A-type lamins have, at best, a limited role in the retention of Sun2 at the NE and no significant role at all in the reten- tion of Sun1. tonin permeabilization to ensure that we were looking exclu- sively at nesp2G that was localized in the ONM. To explore the roles of Sun1 and 2 in nesp2G localiza- tion, we first adopted an RNAi-based approach. When we de- pleted HeLa cells of either Sun1 or 2 (Fig. 6, C and D), we Figure 6. The retention of nesp2G at the ONM requires the expression of could find little effect on the localization of nesp2G at the SUN domain proteins. (A) Western blot of a HeLa lysate fractionated by SDS- ONM (Fig. 6, C and E). However, codepletion of Sun1 and 2 PAGE and probed with an affinity-purified antibody raised against the ABD of led to the elimination of nesp2G from the ONM (Fig. 6, C and E). human nesp2G identifies a very large (400 kD) protein. (B) Immunofluores- cence microscopy of digitonin-permeabilized HeLa cells using the anti-ABD an- Quantitative analysis indicated an 80% reduction in the number tibody reveals labeling of the cytoplasmic face of the NE. Depletion of nesprin of cells with detectable NE-associated nesp2G after codeple- 2 (all splice isoforms) in HeLa cells by RNAi leads to a loss of ONM labeling in tion of Sun1 and 2 versus mock RNAi treatment (Fig. 6 E). the majority of cells (bottom). These data are consistent with the recognition of nesp2G by the anti-ABD antibody. (C) The reduction of either Sun1 or 2 levels Ultrastructural analyses revealed changes in NE morphology in by RNAi had only a marginal effect on nesp2G localization. However, the cells codepleted of both Sun proteins. Mock-treated cells dis- combined depletion of both Sun1 and 2 induced a dramatic loss of nesp2G played the usual uniform spacing between the ONM and INM from the ONM (arrowheads). Overall, we observed an 80% decline in the number of cells exhibiting NE-associated nesp2G (E). In total, 100–200 cells of 50 nm. In the double RNAi-treated cells, however, the were scored for each category in three separate experiments. Error bars repre- ONM was clearly dilated with obvious expansion of the PNS to sent SEM. (D) Western blot analysis reveals that both Sun1 and 2 RNAi treat- 100 nm or more (Fig. 6 F). ments lead to a substantial decline in Sun1 and 2 protein levels. The same blots were probed with an anti-actin antibody to confirm equal loading. (F) If SUN and KASH domain proteins form a molecular Thin section EM of cells subjected to the double (Sun1 and 2) RNAi treatment link across the PNS (Starr and Han, 2003), it should be possible revealed frequent expansion of the PNS and increased separation of the INM to use a dominant-negative approach to break this linkage. In this and ONM (arrowheads). No such effect was observed in mock-treated cells. The nuclear interior (N) and cytoplasm (Cy) is indicated in each panel. strategy, we used almost the entire lumenal domain of Sun1 SUN–NESPRIN INTERACTIONS • CRISP ET AL. 47 Figure 7. A soluble form of the Sun1 lumenal domain causes a loss of nesp2G from the ONM. (A) A signal sequence (SS), HA tag, and KDEL motif were added to the NH and COOH termini, respectively, of the Sun1 lumenal domain (SS–HA-Sun1L–KDEL). (B) SS–HA-Sun1L–KDEL, when translated in vitro in the presence of microsomes, is completely resistant to digestion by proteinase K. If Triton X-100 is included in the digestion reaction to permeabilize the microsomes, the 50-kD SS–HA-Sun1L–KDEL translation product (arrow) is completely degraded. These data demonstrate that the signal sequence is fully functional in directing HA-Sun1L–KDEL to the microsomal lumen. (C) When introduced by transfection into HeLa cells, the SS–HA-Sun1L–KDEL localizes both to the peripheral ER and to the PNS, which is revealed by immunolabeling with an anti-HA monoclonal antibody. Cells expressing SS–HA-Sun1L– KDEL (red in merged images) exhibit a very obvious loss of nesp2G (green in merged images) from the ONM. (D) Thin section EM of HeLa cells expressing SS–HA-Sun1L–KDEL (Transf.) revealed increased separation between the INM and ONM and expansion of the PNS (arrowheads). This effect was not observed in nontransfected cells (NT). The effects of SS–HA-Sun1L–KDEL expression were identical to those observed after codepletion of Sun1 and 2 by RNAi (Fig. 6). tagged at its NH terminus with HA (HA-Sun1L), which we in- GFP-KASH under the control of a tetracycline-inducible pro- troduced in soluble form into the lumen of the ER and PNS moter (HeLaTR GFP-KASH). In the absence of tetracycline, (Fig. 7 A). To accomplish this, we fused the signal sequence GFP-KASH is present at low levels and localizes exclusively and signal peptidase cleavage site of human serum albumin to the NE (Fig. 8 A, Tet). After tetracycline induction, large onto the NH terminus of HA-Sun1L to yield SS–HA-Sun1L. amounts of GFP-KASH may be observed in both the NE and To prevent its secretion, we fused a KDEL tetrapeptide to the peripheral ER (Fig. 8 A, Tet). Introduction of SS–HA-Sun1– COOH terminus of SS–HA-Sun1L, forming SS–HA-Sun1L– KDEL into these cells leads to the complete loss of NE-associated KDEL (Fig. 7 A). Synthesis of this chimeric protein in vitro in GFP-KASH. Indeed, all of the GFP-KASH, regardless of ex- the presence of microsomes yielded a protein product of the ap- pression level, appears to be recruited into vesicular structures, propriate size, which was resistant to digestion by proteinase K potentially as a prelude to degradation (Fig. 8 B, top; arrows). (Fig. 7 B). Clearly, the signal sequence directs HA-Sun1L to Conversely, when full-length Sun1 is introduced into tetracy- the microsome lumen. The shift up in molecular weight of latent cline-induced cells, it leads to the recruitment of GFP-KASH HA-Sun1L–KDEL is likely a result of NH -linked glycosyla- from the peripheral ER to the NE (Fig. 8 B, middle and bottom; tion (Sun1 has two potential glycosylation sites in its lumenal arrows). This is exactly what one would predict if Sun proteins domain). Upon transfection into HeLa cells, HA-Sun1L– function as tethers for KASH domain proteins. A similar ef- KDEL was found to accumulate intracellularly within the fect was also observed when HA-Sun2 was introduced into the peripheral ER and PNS. Examination of the distribution of tetracycline-induced cells (Fig. 8 C), with GFP-KASH re- nesp2G in transfected cells revealed that it was completely cruited to and stabilized at the NE. Altogether, these results eliminated from the ONM (Fig. 7 C). EM analysis of these can only be interpreted in terms of lumenal interactions be- cells exposed clear dilation of the ONM and expansion of the tween SUN domain and KASH domain proteins. Furthermore, PNS (Fig. 7 D). This phenotype is indistinguishable from that they suggest that both Sun1 and 2 can interact in vivo with the associated with Sun1/2 codepletion by RNAi (Fig. 6 F). nesprin 2 KASH domain, which is consistent with our RNAi In further experiments, we took advantage of a cDNA results indicating that both SUN domain proteins contribute to encoding a chimeric protein in which GFP is fused to the NH nesp2G anchoring. terminus of the nesprin 2 KASH domain (Zhang et al., 2001). To further define Sun1/2–KASH interactions, we set out This fusion protein localizes to the NE with the GFP exposed to identify Sun–KASH complexes both in vivo and in vitro. For to the cytoplasm/nucleoplasm. The KASH domain is integrated the former, we performed immunoprecipitation analyses of into the NE, with its 40-residue COOH-terminal domain resid- Sun2. As shown in Fig. 8 E, a high molecular weight protein ing within the PNS. We prepared a HeLa cell line harboring recognized by our antibody against nesp2G was found to 48 JCB • VOLUME 172 • NUMBER 1 • 2006 Figure 8. The nesp2G KASH domain interacts with the Sun1 lumenal domain. (A) Fluorescence microscopy of HeLa cells expressing a tetracycline-inducible GFP-KASH fusion protein (HeLaTR GFP-KASH). In the absence of tetracycline (Tet), GFP-KASH is expressed at low levels and is localized exclusively to the NE. After induction with tetracycline for 24 h (Tet), GFP-KASH is found throughout the peripheral ER as well as the NE. Expression levels of GFP- KASH within the cell population is extremely uniform both before and after induction. (B) Transfection of SS–HA-Sun1–KDEL into the HeLaTR GFP-KASH cells after tetracycline induction resulted in the complete loss of GFP-KASH from the NE. This was accompanied by the formation of cytoplasmic aggre- gates (arrows, top). Conversely, introduction of full-length HA-Sun1 into these cells resulted in the recruitment of GFP-KASH to the NE (arrows, middle and bottom). (C) HA-Sun2 was found to have a similar effect (arrows). In the merged images in B and C, GFP-KASH is presented in green, whereas HA-Sun is shown in red. (D) To identify an in vitro interaction between KASH and SUN domains, GFP-KASH, SS–HA-Sun1–KDEL, or both proteins were translated in reticulocyte lysate containing [ S]methionine/cysteine in either the presence or absence of microsomes (Totals). Anti-GFP immunoprecipitation of a fraction of each sample revealed the pull-down of SS–HA-Sun1–KDEL by GFP-KASH when both proteins were cotranslated in the presence of microsomes (arrow). A slightly faster migrating band (asterisk) was detected in the absence of microsomes. However, this band originates in the GFP-KASH translation and is unrelated to HA-Sun1L–KDEL. Molecular masses are indicated in kD. (E) Immunoprecipitation of HeLa cell lysates with anti-Sun2 antibodies copre- cipitates a very large anti-nesp2G immunoreactive protein (arrow). HC indicates the position of immunoglobulin heavy chains. These data suggest a signifi- cant interaction between KASH and Sun proteins that must involve their lumenal domains. These findings allow us to propose a model for the LINC complex (F) in which nuclear components, including lamins, bind to the INM SUN domain proteins. They, in turn, bind to the KASH domain of the actin-associated giant nesprins on the ONM. Thus, the LINC complex establishes a physical connection between the nucleoskeleton and the cytoskeleton. coimmunoprecipitate with Sun2 from HeLa cell lysates. As a pology of Sun1 matches that of another INM protein, Sun2, to complement to these experiments, we synthesized SS–HA- which it is related. Based upon structural predictions, it is Sun1–KDEL and GFP-KASH in vitro. Interactions between likely that Sun1 possesses three closely spaced transmembrane these proteins were then analyzed by immunoprecipitation us- domains between residues 356 and 448. A separate hydropho- ing antibodies against GFP. As revealed in Fig. 8 D, only when bic region, H1, that is situated closer to the NH terminus does the SUN and KASH domain proteins were cosynthesized in not appear to function as a membrane anchor. This conclusion vitro in the presence of microsomes could we detect HA-Sun1– is based upon the behavior of naturally occurring splice iso- KDEL in immunoprecipitates performed with the anti-GFP an- forms that lack this hydrophobic sequence. A third mammalian tibody. Together, all of these data provide strong evidence for Sun protein, Sun3, is also an integral membrane protein with a the interaction, either direct or indirect, between Sun1/2 and lumenal COOH-terminal SUN domain and a relatively small nesp2G. Such an interaction spanning the PNS provides an cytoplasmic NH -terminal domain (unpublished data). In this obvious mechanism for the Sun1/2-dependent tethering of way, Sun3 conforms to the general topological organization of nesp2G in the ONM. other Sun family members. The organization of the lumenal domains of Sun1 and 2 bears some comment. The membrane proximal sequences of Discussion both proteins are predicted to form a coiled-coil. The implica- We have shown that Sun1 is an INM protein with an NH - tion is that these proteins may form homodimers. Given the terminal nucleoplasmic domain of 350 amino acids and a number of residues within the Sun1 coiled-coil region, this larger COOH-terminal domain of 500 amino acids, including could potentially project 25–30 nm into the PNS and would the SUN domain, that resides in the PNS. In this way, the to- terminate in a pair of globular SUN domains. The coiled-coil SUN–NESPRIN INTERACTIONS • CRISP ET AL. 49 domain of Sun2 is of a similar size. In both cases, the overall attempted to determine whether the Unc-84/Anc-1 paradigm conformation of the Sun protein lumenal domain would be that was applicable in mammalian systems. We used a combination of a flower on a stalk, which could potentially bridge the gap of RNAi and a dominant-negative form of Sun1 to test this between the lumenal faces of the INM and ONM. model. We found that both Sun1 and 2 contribute to the tether- The exact mechanism by which Sun1 and 2 are localized ing of nesp2G in the ONM. Elimination of either Sun protein to the INM has yet to be resolved, although it is likely to in- by RNAi had little or no effect on nesp2G localization in HeLa volve the type of selective retention that has been observed for cells. However, codepletion of Sun1 and 2 leads to the loss of other INM proteins. What is clear is that the lumenal domain of nesp2G from the ONM. This was accompanied by separation both proteins is entirely dispensable for appropriate localiza- of the ONM and INM, leading to expansion of the PNS. The tion. This is exactly the reverse of what is observed for nesprin implication here is that links between the Sun proteins in the proteins (including nesp2G) of the ONM, where the lumenal INM and KASH proteins in the ONM help to maintain the re- and transmembrane domains (comprising the KASH domain) markably regular spacing of the nuclear membranes. This view are essential for their retention at the nuclear periphery (Zhang was reinforced by the findings that overexpression of a soluble et al., 2001). form of the lumenal domain of Sun1 (SS–HA-Sun1L–KDEL) On the nucleoplasmic side of the INM, the Sun1 and 2 induced essentially the same phenotype: loss of nesp2G from NH -terminal domains contain regions of similarity within the the ONM and expansion of the PNS. first 200 amino acid residues. This common NH -terminal re- In a complementary series of experiments, SS–HA- gion interacts, to a greater or lesser extent, with A-type lamins. Sun1L–KDEL expression was also found to lead to the loss of In the case of Sun2, there is some evidence that A-type lamins GFP-KASH from the NEs of HeLa cells. This effect can only might contribute to Sun2 localization in the INM. However, be accounted for by perturbation of lumenal interactions. Con- whether this requires a direct interaction with A-type lamins is versely, overexpression of full-length Sun1 (or Sun2) leads to less clear. Certainly, the concentration of Sun2 in the INM is the recruitment of GFP-KASH to the NE. All of these results A-type lamin independent in some cells. Furthermore, even in are predictable on the basis of SUN domain proteins function- Lmna-null MEFs in which Sun2 is mislocalized, the mere rein- ing as translumenal tethers for KASH domain proteins. troduction of A-type lamins fails to recruit Sun2 to the INM, at Our final experiments demonstrated the existence of least within a period of 24 h (unpublished data). It seems SUN–KASH complexes. Immunoprecipitates of Sun2 from more likely to us that A-type lamins may have indirect effects HeLa extracts were found to contain nesp2G. Similarly, in on Sun2, perhaps by altering the accessibility of chromatin pro- vitro translation of SS–HA-Sun1L–KDEL and GFP-KASH teins with which Sun2 might interact. leads to the formation of HA-Sun1L–KDEL–GFP-KASH com- In the case of Sun1, there is no evidence that lamins play plexes provided that microsomes were present in the translation any role in its localization to the INM. However, Sun1 displays mix. While this manuscript was in preparation, Padmakumar et an extremely robust interaction with prelamin A. Newly syn- al. (2005) published a study that demonstrated a similar inter- thesized lamin A undergoes extensive COOH-terminal pro- action between SUN domain and KASH domain proteins. cessing (Sinensky et al., 1994). This involves farnesylation of Their results suggest, however, that rather than interacting with the COOH-terminal CaaX (single letter code where C is cys- the SUN domain itself, the KASH domain actually bound to a teine, a is any amino acid with an aliphatic side chain, and X is region of the polypeptide chain that is proximal to the SUN any amino acid) motif followed by endoproteolysis to remove domain. This region is present in our Sun1L-based dominant- the aaX residues and carboxy methylation of the farnesyl cys- negative mutant. teine. Once incorporated into the nuclear lamina, a second All of our data suggest that the two Sun proteins are the cleavage event after Y646 yields mature lamin A (Weber et al., key to the appropriate localization of nesp2G in the ONM. In 1989). This cleavage of prelamin A at Y646 abolishes any contrast to previously published findings (Libotte et al., 2005), strong interaction with Sun1. Because prelamin A exists only we could find no evidence of a role for A-type lamins. This is transiently in normal cells, it seems unlikely that its interaction not surprising given that in our HeLa cells, the localization of with Sun1 could contribute to Sun1 localization. In our opin- Sun1 and 2 appear relatively insensitive to A-type lamin ex- ion, it is more likely that Sun1 might function in the organiza- pression (or depletion). Padmakumar et al. (2005) reached ex- tion of newly synthesized lamin A within the nuclear lamina. actly the same conclusion with respect to Sun1. However, in This suggestion is currently under investigation. Lmna-null MEFs, Sun2 is frequently lost from the NE. Given Starr and Han (2002) have shown that the C. elegans that expression levels of Sun1 appear to vary somewhat be- SUN domain protein Unc-84 is required for the localization of tween different tissues, it is conceivable that in at least some Anc-1 in the ONM. They have proposed a model in which the cell types, nesp2G localization to the ONM might be sensitive lumenal domain of Unc-84, which itself is retained in the INM to A-type lamin expression. through interactions with the single C. elegans lamin, forms a Altogether, our findings and those of Padmakumar et al. complex with the lumenal KASH domain of Anc-1. In this (2005) are entirely consistent with the model proposed by Starr way, Unc-84 and Anc-1 would provide links in a molecular and Han (2003) in which SUN and KASH domain proteins form chain that spans the PNS and connects the actin cytoskeleton to a link across the PNS (Fig. 8 F). In addition, in C. elegans, a sim- the nuclear lamina. Because similar SUN and KASH domain ilar mechanism may well operate in the tethering of Zyg-12, a molecules are widely represented in the animal kingdom, we NE protein that is required for dynein-mediated centrosome 50 JCB • VOLUME 172 • NUMBER 1 • 2006 then labeled with appropriate primary and secondary antibodies. For cer- positioning (Malone et al., 2003). As well as tethering ONM tain double-label experiments, a single primary antibody was applied af- proteins, our data would suggest that SUN–KASH linkages ter the digitonin permeabilization. After removal of unbound antibody further contribute to the structural integrity of the NE in main- with three PBS washes, the cells were refixed for 5 min (in 3% formalde- hyde) and subjected to a further permeabilization step in 0.2% Triton X-100. taining the precise separation of the two nuclear membranes. The second primary antibody was then applied followed by appropriate Furthermore, given that the giant nesprins are actin-binding pro- secondary antibodies. Specimens were observed using a microscope (model teins, the SUN–KASH links provide direct molecular connec- DMRB; Leica). Images were collected using a CDC camera (CoolSNAP HQ; Photometrics) linked to a Macintosh G4 computer running IPLab Spec- tions between the actin cytoskeleton and the nuclear interior. trum software (Scanalytics). We now refer to this molecular chain as the LINC complex. Many studies have documented mechanical coupling EM Cells grown in 35-mm petri dishes were fixed in 3% glutaraldehyde and between the nucleus and the cytoplasm. Maniotis et al. (1997) 0.2% tannic acid in 200 mM sodium cacodylate buffer for 1 h at room used microneedle-mediated deformation of the cytoplasm of temperature. Postfixation was performed in 2% OsO for 20 min. The cultured cells to demonstrate mechanical connections between cells were dehydrated in ethanol, lifted from the culture dish using propyl- ene oxide, and infiltrated with Polybed 812 resin. Polymerization was integrins, cytoskeletal filaments, and nucleoplasm. More re- performed at 60C for 24 h. Silver-gray sections were cut using an ultrami- cently, Lammerding et al. (2004) were able to show that fibro- crotome (Leica) equipped with a diamond knife. The sections were stained blasts derived from Lmna-null mouse embryos have impaired with uranyl acetate and lead citrate and examined in an electron micro- scope (model 7000; Hitachi). mechanically activated gene transcription. In related studies, Broers et al. (2004) have shown that these same cells exhibited Short inhibitory RNA (siRNA) methods reduced mechanical stiffness and perturbations in the organiza- HeLa cells were depleted of Sun1, Sun2, nesprin 2, and lamins using ap- propriate SmartPool oligonucleotide duplexes (Dharmacon). Cells were tion of the cytoskeleton. The existence of the LINC complex exposed to each siRNA in the presence of OligofectAMINE (Invitrogen) provides a basis for these various observations in that it may precisely as recommended by the manufacturer. Cells were subjected to integrate the nucleus into a protein matrix that includes the siRNA treatment for periods up to four days. However, most of our analyses were performed after 2–3-d treatments. cytoskeleton, extracellular matrix, and cell–cell adhesion complexes. This mechanical link not only provides structural Immunoblotting and gel electrophoresis continuity within and between cells, but it also allows for a direct Cells (siRNA- or mock-treated) grown in 35-mm tissue culture dishes were washed once in PBS and lysed in a buffer containing 50 mM Tris-HCl, pH physical signaling pathway from the cell surface to the nucleus, 7.4, 500 mM NaCl, 0.5% Triton X-100, 1 mM DTT, 1 mM PMSF, and potentially facilitating rapid and regionalized gene regulation. 1:1,000 CLAP (10 mg/ml in DMSO each of chymostatin, leupeptin, anti- pain, and pepstatin). The lysate was centrifuged for 5 min in an Eppen- dorf centrifuge at 4C. Proteins in the supernatant were precipitated by the Materials and methods addition of TCA to a final concentration of 10%. The precipitate was washed with ethanol/ether and solubilized in SDS-PAGE sample buffer. Cell culture Protein samples were fractionated on polyacrylamide gels (7.5, 10, or HeLa cells and MEFs, both Lmna / and Lmna / (Sullivan et al., 4–15% gradient as appropriate; Laemmli, 1970) and transferred onto ni- 1999), were maintained in 7.5% CO and at 37C in DME (GIBCO BRL) trocellulose filters (usually BA85; Schleicher and Schuell) using a semidry plus 10% FBS (Hyclone), 10% penicillin/streptomycin (GIBCO BRL), and blotting apparatus manufactured by Hoeffer Scientific Instruments Inc. Filters 2 mM glutamine. were blocked and labeled with primary antibodies and peroxidase-conju- gated secondary antibodies exactly as previously described (Burnette, Antibodies 1981). Blots were developed using ECL (GE Healthcare) and exposed to The following antibodies were used in this study: the monoclonal antibody X-OMAT film (Kodak) for appropriate periods of time. against lamins A and C (XB10) has been described previously (Raharjo et al., 2001). The monoclonal antibodies 9E10 and 12CA5 against the myc Immunoprecipitations and HA epitope tags were obtained from the American Type Culture Col- For Sun2/nesp2G coimmunoprecipitations, three subconfluent 35-mm lection and Covance, respectively. Rabbit antibodies against the same dishes of HeLa cells were each extracted with 1 ml each of PBS containing epitopes were obtained from AbCam. Rabbit antibodies against Sun1 0.1% Triton X-100, 1:1,000 CLAP, 2.5 mM sodium pyrophosphate, 1 mM and 2 were raised against GST fusion proteins as previously described -glycerophosphate, and 1 mM sodium vanadate. The dishes were rocked (Hodzic et al., 2004). The chicken antibody against the ABD of nesp2G at 4C for 15 min, and the cell lysates were centrifuged for 10 min at max- was raised against an ABD-GST fusion protein by Aves Labs, Inc. Affinity imum speed and at 4C in a microcentrifuge. The pellets were then reex- purification of the IgY was performed in two stages. In the first step, an af- tracted in a total volume of 3 ml radioimmunoprecipitation assay buffer for finity column was prepared consisting of GST cross-linked to glutathione 15 min, also at 4C. After centrifugation at 4C for 10 min, the superna- agarose (Sigma-Aldrich) using 40 mM dimethyl pimelimidate in 0.2 M bo- tants were pooled and divided into 500-l aliquots. Each aliquot was then rate buffer, pH 9.0, for 1 h at 4C. 5 ml IgY solution was passed over this incubated for 14 h at 4C with appropriate combinations of immune and column (1-ml bed volume), and the flow through was collected. This flow preimmune sera and protein A–Sepharose beads. At the end of this pe- through was applied to a second 1-ml column prepared from ABD-GST riod, the beads were collected by brief centrifugation and washed three that was also cross-linked to glutathione agarose. Antibody bound to the times in PBS containing 0.1% Triton X-100 and once in PBS alone. Finally, column was eluted at pH 2.8 in 0.2 M glycine-HCl. The antibody eluate the beads were suspended in SDS-PAGE sample buffer, heated to 95C was neutralized with 3 M Tris, pH 8.8, and stored at 4C with 1 mM so- for 5 min, and analyzed by SDS-PAGE and Western blotting. dium azide. Secondary antibodies conjugated with AlexaFluor dyes were All other immunoprecipitations were performed in TNX (50 mM Tris- obtained from Invitrogen. Peroxidase-conjugated secondary antibodies HCl, pH 7.4, 100 mM NaCl, and 0.5% Triton X-100) containing 1:1,000 were obtained from Biosource International. CLAP. Incubation with antibodies and protein A–Sepharose beads was for 1 h at 4C with continuous gentle mixing. At the end of this period, the Immunofluorescence microscopy beads were collected by brief centrifugation and were washed three times Cells were grown on glass coverslips and fixed in 3% formaldehyde in TNX and once in 50 mM Tris-HCl, pH 7.4. Finally, the beads were pro- (prepared in PBS from PFA powder) for 10 min followed by a 5-min per- cessed for electrophoresis as described above. meabilization with 0.2% Triton X-100. The cells were then labeled with the appropriate antibodies plus the DNA-specific Höchst dye 33258. For In vitro translations experiments involving selective permeabilization, the cells were first fixed In vitro translations were performed in 25-l reaction volumes using the in 3% formaldehyde. This was followed by permeabilization in 0.003% TNT T7 coupled transcription translation system (Promega). Each transla- digitonin in PBS on ice for 15 min (Adam et al., 1990). The cells were tion reaction contained 20 l TNT master mix and was programmed with SUN–NESPRIN INTERACTIONS • CRISP ET AL. 51 1 l plasmid DNA at a concentration of 0.1 g/l. Labeling of transla- complete medium. The entire volume was then placed on the cells with an S Translabel tion products was accomplished by the inclusion of 10 Ci additional 1.5 ml of complete medium. The cells were then returned to the (MP Biolabs). Where appropriate, up to 3 l of canine pancreatic mi- tissue culture incubator for 12–24 h. At the end of this period, the cells crosomes (Promega) was also included in each reaction. Translation reac- were processed as appropriate. tions were assembled on ice before incubation at 30C for 90 min. At the end of this period, translation mixes were further processed for in vitro Preparation of GST fusion proteins binding studies (see In vitro pull-down...proteins) or were subjected to diges- GST-Sun1 and Sun2 fusion proteins were prepared using the plasmids tion with proteinase K in order to define Sun protein topology. Proteinase pGEX-4T3Sun1N220 and pGEX-4T3Sun2NP. These plasmids were cre- K digestions were performed on ice for periods of up to 1 h. Each diges- ated by amplifying 5 sequences of Sun1 and 2 by PCR. The Sun1 PCR -terminal domain, tion mix (10-l total volume) contained 5 l of the complete in vitro trans- product encoded the first 222 amino acids of the NH -terminal domain of lation reaction, 1 l proteinase K (from a 1-mg/ml stock solution), 1 l of whereas the Sun2 sequences encoded the bulk of NH 10 compensation buffer (containing 0.5 M sucrose, 50 mM Tris-HCl, pH 165 amino acids. These PCR products were inserted into pGEX4T3 (GE 7.6, and 200 mM potassium acetate), and, where appropriate, 1 l of a Healthcare) between BamHI and EcoRI sites. The primers used for Sun1 10% solution of Triton X-100. Termination of digestion was accomplished were 5 -CGCGGATCCGACTTTTCTCGGCTGCAC-3 and 5 -CCGGAAT- by the addition of 100 l of 10% TCA to precipitate the proteins. Precipi- TCTTAGCGTGGTTTGAGAGTCCT-3 , whereas the Sun2 primer pair con- tates were washed in ethanol/ether, air dried, and dissolved in 25 l sisted of 5 -CGCGGATCCTCCCCGAAGAAGCCAGCGCCTCACG-3 SDS-PAGE sample buffer by incubation at 37C. and 5 -CCGGAATTCTTAGGAGCCCGCCCGTGAGACGGC-3 . A single colony of Bl-21 cells transformed with either plasmid was grown overnight Plasmids in 10 ml Luria-Bertani containing 100 g/ml ampicillin and was induced A mouse Sun1 cDNA (IMAGE clone ID 5321879) was obtained from In- with 0.1 mM IPTG for 4 h at 37C. The cells were harvested by 15-min terminus with an HA vitrogen. To generate Sun1 tagged at the NH centrifugation at 4C and at 3,200 g in an Eppendorf table-top centrifuge. epitope, Sun1 cDNA flanked by 5 Sal1 and 3 Afl2 restriction sites was The bacterial pellets were resuspended by trituration in 1 ml of lysis buffer amplified by PCR using primers 5 -GAACGTCGACTTTTCTCGGCTGCA- consisting of STE (150 mM NaCl, 10 mM Tris, pH 8.0, and 1 mM EDTA) CACGTACACC-3 and 5 -CTGGCTTAAGCTACTGGATGGGCTCTCCG-3 . containing 5 mM DTT and 0.25% sarkosyl (N-laurylsarcosine). The sus- The PCR product was digested with Sal1 and Afl2 and inserted down- pension was sonicated to achieve maximum cell breakage and was centri- stream of an HA tag sequence in the vector pCDNA3.1(). This vector fuged at maximum speed in a microcentrifuge for 10 min at 4C. The su- was prepared from pcDNA3.1() containing HA–lamin A (Raharjo et al., pernatant was then transferred to a fresh microcentrifuge tube containing 2001) by digestion with Xho1 and Afl2. The resulting plasmid was 30 l of a 50% suspension in PBS of swollen glutathione agarose beads. pcDNA3.1()HA-Sun1. The cleared bacterial lysate and beads were then incubated with continu- pcDNA3.1()HA-Sun1 was used as a template for generating fur- ous mixing at 4C for 1 h. At the end of this period, the beads were ther Sun1 constructs. The Sun1 splice isoform 6–8 was created by in- washed three to five times with ice-cold STE and twice with ice-cold bind- verse PCR using primers 5 -CGTGGTTTGAGAGTCCTGTCTCTGG-3 and ing buffer (50 mM Tris, pH 7.4, 100 mM NaCl, 0.1% Triton X-100, and 5 -GACCTCTTGGTTCAAGCACTGCGAAGG-3 to amplify the entire plas- 1 mM DTT). mid outside of the deleted region. The PCR product was digested with the Klenow fragment of DNA polymerase and was circularized by liga- In vitro pull-down with GST fusion proteins tion. A double epitope-tagged Sun1 construct, HA-Sun1–myc, was made 1.5 g of plasmid DNA (pcDNA3.1HA–lamin A, –mature lamin A, –lamin by PCR using primers 5 -GCATCTGAAGACCAGCTGAG-3 and 5 - B1, and –lamin C) was included in 25 l TNT-coupled transcription/transla- S Translabel and incubated at 30C for 90 TAAACTTAAGCTAGAGATCCTCTTCTGAGATGAGTTTTTGTTCCTCAGC- tion mixes containing 10 Ci CTGGATGGGCTCTCCGTGGACTCG-3 to insert a 3 myc tag followed min. 1 ul of each reaction was retained for the analysis of total translation by an AflII restriction site. The fragment was then cloned back into the products, whereas the remainder was incubated with 10 ul GST–agarose HindIII–AflII site of the original template. beads in 600 l of binding buffer (containing 10 g/ml chymostatin, leu- To prepare a form of EGFP-KASH that could be translated in vitro, peptin, antipain, pepstatin, and 1 mM PMSF) for 30 min at room tempera- the BamHI–Nhe1 digested fragment of pEGFP-KASH was subcloned into ture with constant mixing. After a low speed centrifugation at 800 g, the the BamHI–Nhe1 site of pCDNA3.1() to yield pcDNA3.1EGFP-KASH. supernatant was split into three tubes containing 5 ul GST–agarose, GST- EGFP-KASH was also inserted into the tetracycline-inducible expression Sun1N220, or GST-Sun2NP beads. The suspensions were then incubated vector pcDNA4TO. This was accomplished by amplifying EGFP-KASH by for 45 min at room temperature with constant mixing. Finally, the beads PCR using the primers 5 -TAAACTTAAGCACCATGGTGAGCAAGGGC- were washed three to five times with binding buffer containing 1 mM DTT. GAGGAGC-3 and 5 -TAAAGCGGCCGCCTATGTGGGGGGTGGC- After the final wash, the binding buffer was replaced with 20 l SDS-PAGE CCATTGGTGTACC-3 . The 1,003-bp product was cut with Afl2 and Not1 sample buffer. The samples were subsequently fractionated by SDS-PAGE. and was ligated into similarly cut pcDNA4TO. The gels were stained with Coomassie blue R-250, impregnated with The soluble Sun1 lumenal domain construct SS–HA-Sun1L–KDEL, Amplify (GE Healthcare), dried, and exposed to X-OMAT film (Kodak). which was targeted to the ER and PNS, was prepared in three stages. The first step involved ligation of a double-stranded oligonucleotide encoding Northern blot analysis -terminal signal sequence of human serum albumin, which the entire NH Double-stranded DNA probes consisting of the 5 (650 bp) and 3 (860 was ligated into pcDNA3.1() between Nhe1 and Apa1 sites to yield bp) fragments of mSun1 and the full-length human Sun3 (1,050 bp) were P]dCTP into the PCR products was pcDNA3.1SS. In the second intermediate step, the 5 end of HA–lamin A generated by PCR. Incorporation of [ was amplified by PCR using the pair of primers 5 -AATTGGGCCCGCT- accomplished by random priming using the Rediprime II Random Primer TACCCTTACGATGTACCG-3 and 5 -ATATCTTAAGCAGCGCATCCGC- Labeling System (GE Healthcare) using 15 ng (in 45 l Tris-EDTA buffer) CAGCCGGCTC-3 . The 787-bp PCR product was ligated downstream of denatured DNA. A mouse multiple tissue Northern blot (BLOT-2; Sigma- the signal sequence in pcDNA3.1SS between the Apa1 and Afl2 sites to Aldrich) containing 2 ug polyA (per lane) RNA isolated from 10 differ- yield pcDNA3.1SS-HALaA5 . For the final step, the lamin A sequences ent mouse organs (brain, heart, liver, kidney, spleen, testis, lung, thymus, were excised using Xho1 and Afl2. To prepare the Sun1 lumenal domain placenta, and skeletal muscle tissues of BALB/c mice) was hybridized in- sequence incorporating a KDEL motif, PCR was performed using mouse dependently with each of the prepared probes, including one against Sun1 cDNA as a template and using the primers 5 -AGAGGGTCGAC- glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1.4 ng/ml in 6 ml GATTCCAAGGGCATGCATAG-3 and 5 -CTGGCTTAAGCTACAACT- PerfectHyb Plus hybridization buffer) for 17 h (Sigma-Aldrich). Between CATCTTTCTGGATGGGCTCTCCGTGGAC-3 . The resultant 1,403-bp each hybridization, the blot was stripped of the probe according to the product was cut with Sal1 and Afl2 and was ligated into the Xho1–Afl2 manufacturer’s instructions. cut vector. The resulting plasmid was pcDNA3.1SS–HA-Sun1L–KDEL. We would like to acknowledge Manfred Lohka, Colin Stewart, and Phyllis All enzymes were obtained from New England Biolabs, Inc. Hansen for valuable discussions. This work was supported by grants from the National Institutes of Transfections Health to B. Burke and P.D. Stahl. D. Hodzic was supported by a fellowship Plasmids were introduced into HeLa cells using the Polyfect reagent as de- from the Muscular Dystrophy Association. scribed by the manufacturer (QIAGEN). Transfections were normally per- formed in six-well plates. In brief, 1.5 g plasmid DNA was combined Submitted: 20 September 2005 with 100 l of serum-free medium and 12 l Polyfect. After a 10-min room temperature incubation, this mixture was combined with 600 l of Accepted: 22 November 2005 52 JCB • VOLUME 172 • NUMBER 1 • 2006 Padmakumar, V.C., S. Abraham, S. Braune, A.A. Noegel, B. Tunggal, I. Karake- References sisoglou, and E. Korenbaum. 2004. Enaptin, a giant actin-binding protein, is an element of the nuclear membrane and the actin cytoskeleton. Exp. Adam, S.A., R.E. Sterne-Marre, and L. Gerace. 1990. Nuclear protein import in Cell Res. 295:330–339. permeabilized mammalian cells requires soluble cytoplasmic factors. Padmakumar, V.C., T. Libotte, W. Lu, H. Zaim, S. Abraham, A.A. Noegel, J. J. Cell Biol. 111:807–816. Gotzmann, R. Foisner, and I. Karakesisoglou. 2005. The inner nuclear Apel, E.D., R.M. Lewis, R.M. Grady, and J.R. Sanes. 2000. Syne-1, a dystro- membrane protein Sun1 mediates the anchorage of Nesprin-2 to the nu- phin- and Klarsicht-related protein associated with synaptic nuclei at the clear envelope. J. Cell Sci. 118:3419–3430. neuromuscular junction. J. Biol. Chem. 275:31986–31995. Powell, L., and B. Burke. 1990. Internuclear exchange of an inner nuclear mem- Broers, J.L., E.A. Peeters, H.J. Kuijpers, J. Endert, C.V. Bouten, C.W. Oomens, brane protein (p55) in heterokaryons: in vivo evidence for the associa- F.P. Baaijens, and F.C. Ramaekers. 2004. Decreased mechanical stiff- tion of p55 with the nuclear lamina. J. Cell Biol. 111:2225–2234. ness in LMNA/ cells is caused by defective nucleo-cytoskeletal in- Raharjo, W.H., P. Enarson, T. Sullivan, C.L. Stewart, and B. Burke. 2001. Nu- tegrity: implications for the development of laminopathies. Hum. Mol. clear envelope defects associated with LMNA mutations causing dilated Genet. 13:2567–2580. cardiomyopathy and Emery-Dreifuss muscular dystrophy. J. Cell Sci. Burke, B., and C.L. Stewart. 2002. Life at the edge: the nuclear envelope and 114:447–457. human disease. Nat. Rev. Mol. Cell Biol. 3:575–585. Rober, R.-A., K. Weber, and M. Osborn. 1989. Differential timing of lamin A/C Burnette, W.N. 1981. ‘Western blotting’: electrophoretic transfer of proteins expression in the various organs of the mouse embryo and the young from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitro- animal: a developmental study. Development. 105:365–378. cellulose and radiographic detection with antibody and radioiodinated Schirmer, E.C., L. Florens, T. Guan, J.R. Yates III, and L. Gerace. 2003. Nu- protein A. Anal. Biochem. 112:195–203. clear membrane proteins with potential disease links found by subtrac- Ellenberg, J., E.D. Siggia, J.E. Moreira, C.L. Smith, J.F. Presley, H.J. Worman, tive proteomics. Science. 301:1380–1382. and J. Lippincott-Schwartz. 1997. Nuclear membrane dynamics and re- Sinensky, M., K. Fantle, M. Trujillo, T. McLain, A. Kupfer, and M. Dalton. assembly in living cells: targeting of an inner nuclear membrane protein 1994. The processing pathway of prelamin A. J. Cell Sci. 107:61–67. in interphase and mitosis. J. Cell Biol. 138:1193–1206. Soullam, B., and H.J. Worman. 1995. Signals and structural features involved Gerace, L., and B. Burke. 1988. Functional organization of the nuclear enve- in integral membrane protein targeting to the inner nuclear membrane. lope. Annu. Rev. Cell Biol. 4:335–374. J. Cell Biol. 130:15–27. Gerace, L., A. Blum, and G. Blobel. 1978. Immunocytochemical localization of Starr, D.A., and M. Han. 2002. Role of ANC-1 in tethering nuclei to the actin the major polypeptides of the nuclear complex-lamina fraction: inter- cytoskeleton. Science. 298:406–409. phase and mitotic distribution. J. Cell Biol. 79:546–566. Starr, D.A., and M. Han. 2003. ANChors away: an actin based mechanism of Gruenbaum, Y., A. Margalit, R.D. Goldman, D.K. Shumaker, and K.L. Wilson. nuclear positioning. J. Cell Sci. 116:211–216. 2005. The nuclear lamina comes of age. Nat. Rev. Mol. Cell Biol. 6:21–31. Stewart, C., and B. Burke. 1987. Teratocarcinoma stem cells and early mouse Hagan, I., and M. Yanagida. 1995. The product of the spindle formation gene embryos contain only a single major lamin polypeptide closely resem- sad1 associates with the fission yeast spindle pole body and is essential bling lamin B. Cell. 51:383–392. for viability. J. Cell Biol. 129:1033–1047. Sullivan, T., D. Escalante-Alcalde, H. Bhatt, M. Anver, N. Bhat, K. Nagashima, Hodzic, D.M., D.B. Yeater, L. Bengtsson, H. Otto, and P.D. Stahl. 2004. Sun2 C.L. Stewart, and B. Burke. 1999. Loss of A-type lamin expression is a novel mammalian inner nuclear membrane protein. J. Biol. Chem. compromises nuclear envelope integrity leading to muscular dystrophy. 279:25805–25812. J. Cell Biol. 147:913–920. Hoger, T.H., G. Krohne, and W.W. Franke. 1988. Amino acid sequence and Sweet, R.M., and D. Eisenberg. 1983. Correlation of sequence hydrophobicities molecular characterization of murine lamin B as deduced from cDNA measures similarity in three-dimensional protein structure. J. Mol. Biol. clones. Eur. J. Cell Biol. 47:283–290. 171:479–488. Hoger, T.H., K. Zatloukal, I. Waizenegger, and G. Krohne. 1990. Character- Tusnady, G.E., and I. Simon. 2001. The HMMTOP transmembrane topology ization of a second highly conserved B-type lamin present in cells pre- prediction server. Bioinformatics. 17:849–850. viously thought to contain only a single B-type lamin. Chromosoma. Vorburger, K., G.T. Kitten, and E.A. Nigg. 1989. Modification of nuclear lamin 99:379–390. proteins by a mevalonic acid derivative occurs in reticulocyte lysates and Laemmli, U.K. 1970. Cleavage of structural proteins during assembly of the requires the cysteine residue of the C-terminal CXXM motif. EMBO J. head of bacteriophage T4. Nature. 227:680–685. 8:4007–4013. Lammerding, J., P.C. Schulze, T. Takahashi, S. Kozlov, T. Sullivan, R.D. Weber, K., U. Plessmann, and P. Traub. 1989. Maturation of nuclear lamin A Kamm, C.L. Stewart, and R.T. Lee. 2004. Lamin A/C deficiency causes involves a specific carboxy-terminal trimming, which removes the poly- defective nuclear mechanics and mechanotransduction. J. Clin. Invest. isoprenylation site from the precursor; implications for the structure of 113:370–378. the nuclear lamina. FEBS Lett. 257:411–414. Lee, K.K., D. Starr, M. Cohen, J. Liu, M. Han, K.L. Wilson, and Y. Gruenbaum. Welte, M.A., S.P. Gross, M. Postner, S.M. Block, and E.F. Wieschaus. 1998. 2002. Lamin-dependent localization of UNC-84, a protein required for nu- Developmental regulation of vesicle transport in Drosophila embryos: clear migration in Caenorhabditis elegans. Mol. Biol. Cell. 13:892–901. forces and kinetics. Cell. 92:547–557. Libotte, T., H. Zaim, S. Abraham, V.C. Padmakumar, M. Schneider, W. Lu, M. Zhang, Q., J.N. Skepper, F. Yang, J.D. Davies, L. Hegyi, R.G. Roberts, P.L. Munck, C. Hutchison, M. Wehnert, B. Fahrenkrog, et al. 2005. Lamin A/C- Weissberg, J.A. Ellis, and C.M. Shanahan. 2001. Nesprins: a novel fam- dependent localization of Nesprin-2, a giant scaffolder at the nuclear en- ily of spectrin-repeat-containing proteins that localize to the nuclear velope. Mol. Biol. Cell. 16:3411–3424. membrane in multiple tissues. J. Cell Sci. 114:4485–4498. Lin, F., and H.J. Worman. 1993. Structural organization of the human gene encod- Zhang, Q., C.D. Ragnauth, J.N. Skepper, N.F. Worth, D.T. Warren, R.G. Roberts, ing nuclear lamin A and nuclear lamin C. J. Biol. Chem. 268:16321–16326. P.L. Weissberg, J.A. Ellis, and C.M. Shanahan. 2005. Nesprin-2 is a multi- Lin, F., and H.J. Worman. 1995. Structural organization of the human gene isomeric protein that binds lamin and emerin at the nuclear envelope and (LMNB1) encoding nuclear lamin B1. Genomics. 27:230–236. forms a subcellular network in skeletal muscle. J. Cell Sci. 118:673–687. Malone, C.J., L. Misner, N. Le Bot, M.C. Tsai, J.M. Campbell, J. Ahringer, Zhen, Y.Y., T. Libotte, M. Munck, A.A. Noegel, and E. Korenbaum. 2002. NU- and J.G. White. 2003. The C. elegans hook protein, ZYG-12, mediates ANCE, a giant protein connecting the nucleus and actin cytoskeleton. the essential attachment between the centrosome and nucleus. Cell. J. Cell Sci. 115:3207–3222. 115:825–836. Maniotis, A.J., C.S. Chen, and D.E. Ingber. 1997. Demonstration of mechanical connections between integrins, cytoskeletal filaments, and nucleoplasm that stabilize nuclear structure. Proc. Natl. Acad. Sci. USA. 94:849–854. Mislow, J.M., M.S. Kim, D.B. Davis, and E.M. McNally. 2002. Myne-1, a spec- trin repeat transmembrane protein of the myocyte inner nuclear mem- brane, interacts with lamin A/C. J. Cell Sci. 115:61–70. Mosley-Bishop, K.L., Q. Li, L. Patterson, and J.A. Fischer. 1999. Molecular analysis of the klarsicht gene and its role in nuclear migration within dif- ferentiating cells of the Drosophila eye. Curr. Biol. 9:1211–1220. Ohba, T., E.C. Schirmer, T. Nishimoto, and L. Gerace. 2004. Energy- and tem- perature-dependent transport of integral proteins to the inner nuclear membrane via the nuclear pore. J. Cell Biol. 167:1051–1062. SUN–NESPRIN INTERACTIONS • CRISP ET AL. 53 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The Journal of Cell Biology Pubmed Central

Coupling of the nucleus and cytoplasm

Crisp, Melissa; Liu, Qian; Roux, Kyle; Rattner, J.B.; Shanahan, Catherine; Burke, Brian; Stahl, Phillip D.; Hodzic, Didier
The Journal of Cell Biology , Volume 172 (1) – Jan 2, 2006
Download PDF
13 pages

Loading next page...
 
/lp/pubmed-central/coupling-of-the-nucleus-and-cytoplasm-mo54ZmsuUk

References (45)

Publisher
Pubmed Central
ISSN
0021-9525
eISSN
1540-8140
DOI
10.1083/jcb.200509124
Publisher site
See Article on Publisher Site

Abstract

JCB: ARTICLE Coupling of the nucleus and cytoplasm: role of the LINC complex 1 1 1 4 3 1 2 2 Melissa Crisp, Qian Liu, Kyle Roux, J.B. Rattner, Catherine Shanahan, Brian Burke, Phillip D. Stahl, and Didier Hodzic Department of Anatomy and Cell Biology, University of Florida, Gainesville, FL 32610 Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110 Division of Cardiovascular Medicine, Addenbrooke’s Centre for Clinical Investigation, Cambridge CB2 2QQ, UK Department of Cell Biology and Anatomy, University of Calgary, Calgary AB T2N 4N1, Canada he nuclear envelope defines the barrier between shown that localization of nesp2G to the ONM is depen- the nucleus and cytoplasm and features inner and dent upon an interaction with Sun1. In this study, we con- T outer membranes separated by a perinuclear firm and extend these results by demonstrating that both space (PNS). The inner nuclear membrane contains Sun1 and Sun2 contribute to nesp2G localization. specific integral proteins that include Sun1 and Sun2. Codepletion of both of these proteins in HeLa cells leads Although the outer nuclear membrane (ONM) is continu- to the loss of ONM-associated nesp2G, as does overex- ous with the endoplasmic reticulum, it is nevertheless en- pression of the Sun1 lumenal domain. Both treatments re- riched in several integral membrane proteins, including sult in the expansion of the PNS. These data, together nesprin 2 Giant (nesp2G), an 800-kD protein featuring with those of Padmakumar et al. (2005), support a model an NH -terminal actin-binding domain. A recent study in which Sun proteins tether nesprins in the ONM via in- (Padmakumar, V.C., T. Libotte, W. Lu, H. Zaim, S. Abra- teractions spanning the PNS. In this way, Sun proteins ham, A.A. Noegel, J. Gotzmann, R. Foisner, and I. Kar- and nesprins form a complex that links the nucleoskeleton akesisoglou. 2005. J. Cell Sci. 118:3419–3430) has and cytoskeleton (the LINC complex). Introduction The existence of distinct nuclear and cytoplasmic compart- system. Similarly, the PNS represents a perinuclear extension ments is dependent upon the presence of a selective barrier of the ER lumen. called the nuclear envelope (NE). The NE consists of several The final major structural feature of the NE is the nuclear structural elements (Burke and Stewart, 2002; Gruenbaum et lamina. This is a relatively thin (50 nm) protein meshwork al., 2005), the most prominent of which are the inner and outer associated with the nuclear face of the INM. The major compo- nuclear membranes (INM and ONM, respectively). In most nents of the lamina are the A- and B-type lamins (Gerace et al., cells, these two membranes are separated by a regular gap of 1978). These are members of the larger intermediate filament 50 nm, which is known as the perinuclear space (PNS). Peri- family, and, like all intermediate filament proteins, they feature odic annular junctions between the two membranes form a central coiled-coil flanked by nonhelical head and tail do- aqueous channels between the nucleus and the cytoplasm that mains (Gerace and Burke, 1988). The lamins are known to in- accommodate nuclear pore complexes (NPCs) and, therefore, teract with components of the INM as well as with chromatin permit the movement of macromolecules across the NE. proteins. In this way, the lamina provides anchoring sites at the In addition to its connections to the INM at the periphery nuclear periphery for higher order chromatin domains. of each NPC, the ONM also exhibits numerous continuities In mammalian somatic cells, there are two major A-type with the ER, to which it is functionally related. In this way, lamins (lamins A and C) encoded by a single gene, Lmna (in the INM, ONM, and ER form a single continuous membrane mice). The B-type lamins, B1 and B2, are encoded by two sep- arate genes (Hoger et al., 1988, 1990; Lin and Worman, 1993, 1995). Although B-type lamins are found in all cell types, the Correspondence to Didier Hodzic: [email protected]; or Brian Burke: [email protected] expression of A-type lamins is developmentally regulated Abbreviations used in this paper: ABD, actin-binding domain; INM, inner nuclear (Stewart and Burke, 1987; Rober et al., 1989). Typically, A-type membrane; MEF, mouse embryonic fibroblast; NE, nuclear envelope; NPC, lamins are found in most adult cell types but are absent from nuclear pore complex; ONM, outer nuclear membrane; PNS, perinuclear space; RNAi, RNA interference; siRNA, short inhibitory RNA. those of early embryos. Mutations in the LMNA gene have been © The Rockefeller University Press $8.00 The Journal of Cell Biology, Vol. 172, No. 1, January 2, 2006 41–53 http://www.jcb.org/cgi/doi/10.1083/jcb.200509124 JCB 41 THE JOURNAL OF CELL BIOLOGY linked to a variety of human diseases (Burke and Stewart, topology in which the SUN domain is localized in the PNS 2002), many of which are associated with large-scale perturba- (Hodzic et al., 2004). It is tempting to speculate, based upon tions in nuclear organization. These observations have rein- the model of Starr and Han (2003), that SUN domain proteins forced the view that the lamina is an important determinant of function as tethers for ONM-associated nesprins in mamma- nuclear architecture and has an essential role in the mainte- lian cells. nance of NE integrity. Recently, Padmakumar et al. (2005) have shown that lo- Despite their numerous connections, the INM and ONM calization of nesp2G to the ONM is dependent upon an inter- are biochemically distinct. Proteomic studies have revealed the action with another mammalian SUN domain protein, Sun1. existence of at least 50 integral membrane proteins that are en- In this study, we provide evidence that Sun1 is inserted into riched in NEs. Many of these appear to reside within the INM the INM in such a way that its SUN domain, like that of (Schirmer et al., 2003). Proteins become localized to the INM Sun2, faces the PNS. In this way, we can conclusively dem- via a process of selective retention (Powell and Burke, 1990; onstrate that Sun1 does indeed have the appropriate orienta- Soullam and Worman, 1995; Ellenberg et al., 1997). In this tion, as assumed by Padmakumar et al. (2005), for its COOH- scheme, membrane proteins synthesized on the peripheral ER terminal domain to interact with the nesp2G KASH domain. or ONM may gain access to the INM by lateral diffusion via The NH -terminal region of both Sun1 and 2 face the nucleo- the continuities at the periphery of each NPC using an energy- plasm and interact with lamins. Surprisingly, our results indi- dependent mechanism (Ohba et al., 2004). However, only cate that Sun1 has a very strong preference for prelamin A. those proteins that can interact with nuclear or INM/lamina Sun1 is the only nuclear membrane protein described to date components are retained and concentrated. that exhibits such binding activity. This raises the distinct pos- The recent identification of ONM-specific integral mem- sibility that Sun1 may be involved in the targeting and assem- brane proteins has raised some puzzling issues (Zhang et al., bly of newly synthesized lamin A. Finally, we demonstrate that 2001; Zhen et al., 2002; Padmakumar et al., 2004). In particu- Sun1 and 2 share some degree of functional redundancy and lar, what prevents ONM proteins from simply drifting off into that both of these proteins cooperate in tethering nesp2G in the peripheral ER? This question was originally addressed in the ONM. This tethering involves the establishment of mo- Caenorhabditis elegans, where the localization of Anc-1, a lecular interactions that span the PNS and contributes to the very large type II ONM protein involved in actin-dependent remarkably regular spacing that is observed between the nuclear positioning, was shown to be dependent upon Unc-84, ONM and INM. Based upon our findings and upon those of an INM protein (Starr and Han, 2002). Localization of Unc-84 Padmakumar et al. (2005), we are able to conclude that Sun1 itself was found to be dependent upon the single C. elegans and 2 function as key links in a molecular chain that connects lamin (Lee et al., 2002). Based upon these findings, Starr and the actin cytoskeleton via giant nesprin proteins to nuclear Han (2003) and Lee et al. (2002) proposed a novel model in lamins and other components of the nuclear interior. We now which Unc-84 and Anc-1 would interact across the PNS via refer to this assembly as the LINC complex (linker of nu- their respective lumenal domains. In this way, Unc-84 would cleoskeleton and cytoskeleton). act as a tether for Anc-1. In mammalian cells, two giant (up to 1 MD) actin-bind- Results ing proteins have been identified (variously termed NUANCE, nesprin 2 Giant [nesp2G], nesprin 1, enaptin, Syne 1, syne 2, We have previously shown that Sun2 is an INM protein featur- and myne 1) as integral proteins of the ONM (Apel et al., 2000; ing an NH -terminal nucleoplasmic domain and a significantly Zhang et al., 2001; Mislow et al., 2002; Zhen et al., 2002; Pad- larger COOH-terminal domain that is localized within the PNS makumar et al., 2004). These belong to a very large family of (Hodzic et al., 2004). This lumenal region of Sun2 contains a proteins encoded by the nesprin 1 and 2 genes (Zhang et al., COOH-terminal SUN domain that is also found in C. elegans 2001) and consist of a bewildering variety of alternatively Unc-84. The SUN domain is found in at least two additional spliced isoforms. The nesprins are related to Anc-1 as well as mammalian proteins (Fig. 1 A): Sun1 (GenBank/EMBL/DDBJ to a Drosophila melanogaster ONM protein, Klarsicht (Welte accession no. BC048156) and Sun3 (GenBank/EMBL/DDBJ et al., 1998; Mosley-Bishop et al., 1999), in the possession of accession no. BC026189). a 60–amino acid COOH-terminal KASH domain (Klarsicht, Sun1 transcripts are present in a variety of tissues and cell Anc-1, and Syne homology). This domain comprises a single types (Fig. 1 B). A comparison of Sun1 sequences in GenBank transmembrane anchor and a short segment of 40 residues reveals that it exists in multiple, alternatively spliced isoforms. that resides within the PNS. This conclusion is supported by Northern blot analysis, which One of the defining features of Unc-84 is a region of reveals at least four or five discrete Sun1 transcripts in different homology consisting of 200 amino acids with Sad1p, a tissues. We have not, however, surveyed these tissues for Sun1 Schizosaccharomyces pombe protein that is associated with the isoforms. Immunofluorescence experiments using a polyclonal spindle pole body (Hagan and Yanagida, 1995). This region of antibody raised against recombinant human Sun1 suggests that homology is known as the SUN domain (Sad1p and UNc-84) like Sun2, Sun1 is localized largely, if not exclusively, to the and is believed to extend into the PNS. Mammalian cells also NE (Fig. 1 C). This is consistent with the appearance of Sun1 contain several SUN domain proteins. At least one of these, as well as Sun2 in a proteomic screen for NE-specific membrane Sun2, has been shown to be an INM protein with the appropriate proteins (Schirmer et al., 2003). 42 JCB • VOLUME 172 • NUMBER 1 • 2006 Figure 1. Sun1 is a ubiquitously expressed NE protein featuring a conserved COOH-terminal SUN domain. (A) ClustalW alignment of the COOH-terminal region of human Sun1–3 and C. elegans Unc-84 reveals the homology of the SUN domains. (B) Northern blot analysis of mRNA from multiple mouse tissues illustrates widespread expression of Sun1. A GAPDH probe was used as a loading control. (C) The NE localizations of Sun1 and 2 were determined by immunofluorescence microscopy using rabbit antibodies raised against recombinant Sun proteins. (D, left) HeLa cells transiently transfected with HA-tagged Sun1 confirm the predominant NE localization. HA-Sun1 was detected using an anti-HA monoclonal antibody. (D, right) Upon overexpression, HA-Sun1 is also detected in the ER. In each case, Sun protein localization is shown in red, whereas DNA, visualized using Höchst dye 33258, appears in blue. To further address the issue of Sun1 localization, we reasonable orientation for Sun1 would place its COOH terminus, fused an HA epitope to the NH terminus of the largest isoform including its SUN domain, within the microsome lumen. By of mouse Sun1. After transfection into HeLa cells, the exoge- extension, the SUN domain should thus reside within the PNS nous protein was found by immunofluorescence microscopy to in vivo. This orientation is supported by additional experiments be enriched at the NE (Fig. 1 D). At high expression levels, al- described below. though still concentrated in the NE, HA-Sun1 began to appear To examine the roles of the two hydrophobic segments in the peripheral ER (Fig. 1 D). Together, these observations in Sun1 membrane anchoring, we took advantage of naturally confirm that Sun1 is a nuclear membrane protein. Similar ex- occurring splice isoforms. Searches of GenBank reveal sev- periments with HA-tagged Sun3 revealed a distribution that eral mammalian Sun1 cDNAs lacking sequences within the was more typical of an ER protein (not depicted). Furthermore, NH -terminal domain. Comparisons with genomic sequences Northern blot analysis suggests that Sun3 is found primarily in indicate that at least one splice isoform of Sun1 lacks exons the testis (not depicted). Consequently, all of our subsequent 6–8, corresponding to a deletion of residues 222–343 (Fig. 2 C). experiments focused on Sun1 and 2. This particular Sun1 isoform is missing the first hydrophobic The primary structure of mouse Sun1 reveals no NH - segment, H1. When this isoform (Sun16–8) was tagged with terminal signal sequence. However, two distinct hydrophobic HA and transfected into HeLa cells, its localization at the NE domains, H1 and H2, are present (Fig. 2 A). H1 lies between was found to be indistinguishable from full-length Sun1 (Fig. residues 241 and 258, whereas the second and larger domain, 2 D). Translation of Sun16–8 in vitro in the presence of mi- H2, lies between residues 356 and 448. The presence of ex- crosomes revealed a protease-resistant fragment identical in tended hydrophobic regions clearly raises questions concerning size with that derived from full-length Sun1 (Fig. 2 C). This the topology of Sun1 within the nuclear membranes. An earlier finding presents us with two conclusions. First, it proves that study on Sun2 has shown that the SUN domain resides within the protected fragment must be derived from the COOH-terminal the PNS (Hodzic et al., 2004). Is this also the case for Sun1? portion of the molecule. Second, if this first hydrophobic seg- To address this, we used in vitro transcription/translation of ment in Sun1 were to represent a transmembrane domain, its Sun1 (tagged and untagged) both in the presence and absence removal should logically alter the topology of the subsequent of microsomes (Fig. 2 B). Digestion of Sun1 translation prod- membrane-spanning sequences of Sun1 (i.e., H2) within the ucts with proteinase K revealed the existence of a 65–70-kD ER or nuclear membranes. This might potentially lead to the protected fragment in samples containing microsomes. Proteinase flipping of lumenal segments of newly synthesized Sun1 to K digestion in the presence of Triton X-100 to permeabilize the the cytoplasmic aspect of the ER membrane or failure to insert microsomal membranes resulted in the complete loss of the H2 sequences into the membrane. Evidently, this does not protected fragment. Given the size of this protected fragment happen in any detectable way. Therefore, our conclusion is and the location of potential transmembrane domains, the most that given this first hydrophobic sequence in Sun1 is dispens- SUN–NESPRIN INTERACTIONS • CRISP ET AL. 43 Figure 2. Sun1 is a transmembrane protein with a lumenal COOH-terminal domain. (A) Hydropathy plot (Sweet and Eisenberg, 1983) of Sun1 reveals two hydrophobic domains (H1 and H2) upstream of the COOH-terminal coiled-coil and SUN domain. (B) When translated in vitro either in the presence or absence of microsomes, HA-tagged mouse Sun1, labeled with [ S]methionine/cysteine, appears as a 100-kD band, as revealed by SDS-PAGE. Subsequent proteinase K digestion of HA-Sun1 that had been translated in the presence of microsomes lead within 30–60 min to the quantitative loss of the full-length HA-Sun1 and the appearance of an 65–70-kD protected fragment (arrowhead). Inclusion of Triton X-100 in the digest to permeabilize the microsomes leads to the complete degradation of HA-Sun1 within 60 min. (C) An alternatively spliced isoform of Sun1 (6–8) lacks the first hydrophobic domain (H1). When translated in vitro in either the presence or absence of microsomes, HA-Sun16–8 appears as a band that is predictably smaller than the full-length protein. However, both full-length HA-Sun1 and HA-Sun16–8 that were translated in the presence of microsomes and subjected to digestion with proteinase K yield identically sized protected fragments (arrowhead). Inclusion of Triton X-100 in the digestion reaction results in degradation of both proteins. (D) Immunofluorescence microscopy of HeLa cells transfected with HA-Sun16–8 reveals that the exogenous protein is localized at the NE. In this respect, HA-Sun16–8 is indistinguishable from full-length HA-Sun1. HA-Sun16–8 is detected with an anti-HA monoclonal antibody. The corresponding field labeled with Höchst dye to reveal cell nuclei is also shown. able with respect to membrane insertion, it does not function As shown in Fig. 3, the myc tag was never visible at the nuclear as an obligate membrane-spanning domain. Further second- surface (or at any other location) after digitonin permeabilization ary structure analyses of Sun1 using HMMTOP (Tusnady and regardless of the expression level of HA-Sun1–myc. The HA Simon, 2001) indicate that the larger hydrophobic segment, tag was also undetectable at the nuclear surface after digitonin H2, is capable of spanning the ER/nuclear membranes three permeabilization of cells expressing low levels of HA-Sun1– times. Although this conformation for H2 still requires bio- myc. At high expression levels, however, the tag was detect- chemical confirmation, it suggests that Sun1 is a multispanning able at the nuclear surface and was associated with a cytoplas- protein in which the NH -terminal domain faces the cyto- mic reticular structure corresponding to the peripheral ER. plasm, whereas the COOH-terminal domain (including the Clearly, the NH -terminal, but not the COOH-terminal, domain SUN domain) is localized to the lumenal space. of ER-associated Sun1 is exposed to the cytoplasm. Altogether, To further examine Sun1 distribution and orientation in these findings are consistent with the view that Sun1 is a com- vivo, we prepared a form of mouse Sun1 that was tagged with ponent of the INM and that its COOH-terminal domain resides an HA epitope at the NH terminus and a myc epitope at the with the PNS. COOH terminus (Fig. 3, HA-Sun1–myc). These analyses took The aforementioned data, as well as our previously pub- advantage of the fact that low concentrations of digitonin can lished study (Hodzic et al., 2004), indicate that the NH -terminal be used to selectively permeabilize the plasma membrane of domains of Sun1 and 2 are exposed to the nucleoplasm and, cells while leaving the nuclear membranes and ER intact consequently, are accessible for interaction with nuclear com- (Adam et al., 1990). For these experiments, HeLa cells ex- ponents. Given the role that such interactions play in the ap- pressing HA-Sun1–myc were fixed with formaldehyde and propriate targeting of INM proteins, it is not surprising that the permeabilized on ice for 15 min with 0.003% digitonin. The lumenal domain of Sun1 is entirely dispensable with respect to cells were then labeled with either rabbit anti-myc or rabbit Sun1 localization (Fig. 4 A). In this respect, Sun1 mimics anti-HA. After PBS washes to remove unbound antibodies, the Sun2 (Hodzic et al., 2004). Additional experiments suggest cells were refixed, permeabilized with Triton X-100, and fur- that Sun1 and 2 share overlapping interactions. Overexpres- ther incubated with mouse antibodies against either HA or sion of HA-Sun1 in HeLa cells causes displacement of endog- myc. In this way, the first tag could be assayed for accessibility enous Sun2 from the NE (Fig. 4 B). However, the converse is at the nuclear surface, whereas the second tag could be used to not the case (not depicted). The implication is that Sun1 and 2 define the localization and expression level of HA-Sun1–myc. share a subset of interactions that are required for Sun2 local- 44 JCB • VOLUME 172 • NUMBER 1 • 2006 trol were used in pull-down experiments using in vitro trans- lated lamins as targets. Four lamin species were used in these experiments (Fig. 4 D): lamin B1 (LaB1), lamin C (LaC), full-length lamin A (FL LaA), and mature lamin A. Full-length lamin A contains a CaaX motif and should be farnesylated in the reticulocyte ly- sate (Vorburger et al., 1989). However, it does not undergo detectable COOH-terminal proteolysis because the microsome- free in vitro translation mix lacks the appropriate processing enzymes. The mature lamin A cDNA contains a premature stop codon at position 647. In this way, it mimics processed (i.e., mature) lamin A. As shown in Fig. 4 D, GST-Sun2N165 bound all four lamin species, although the interaction with lamins B1 and C appeared barely more than the background observed with GST alone. Similarly, GST-Sun1N220 was also found to interact with all four lamin species. As was the case with Sun2N165, the interactions with lamins B1 and C were relatively weak. However, Sun1N220 showed a very strong preference for unprocessed (full-length lamin A) versus mature lamin A. To determine whether these in vitro interactions might have any relevance in vivo, we prepared HA-tagged versions of both Sun1N220 and Sun2N165. Upon introduction into HeLa cells, both proteins accumulated within the nucleoplasm (Fig. Figure 3. The SUN domain of Sun1 is located within the PNS, whereas 4 E), although a significant cytoplasmic pool was always the NH -terminal domain is exposed to the nucleoplasm. To examine the present. We also prepared a form of lamin A (preLaA) contain- orientation of Sun1, HA and myc epitope tags were placed at the NH and COOH termini, respectively. HeLa cells were transfected with the dou- ing an L647R mutation. This lamin A mutant is cleavage resis- ble-tagged construct and processed for immunofluorescence microscopy tant and, therefore, retains its farnesylated COOH-terminal after 24 h. After fixation, the cells were permeabilized with 0.003% digi- peptide. Cotransfection of HeLa cells with preLaA along with tonin and incubated with an anti-epitope tag antibody (mouse monoclonal). Subsequently, the cells were refixed and permeabilized with Triton X-100 either HA-Sun1N220 or HA-Sun2N165 lead to a dramatic de- to expose the lumenal compartment to a second anti-epitope tag antibody cline in the nucleoplasmic concentration of both Sun protein (rabbit polyclonal). Neither epitope tag was significantly detectable after fragments coincident with recruitment to the nuclear periphery. digitonin permeabilization in HeLa cells expressing low to moderate levels of HA-Sun1–myc. After Triton X-100 permeabilization, both myc and HA Lamin B1, on the other hand, had no such effect. These results were readily detected at the NE. In HeLa cells with elevated expression of indicate that the Sun proteins do indeed have the capacity to HA-Sun1–myc, the HA but not myc epitope tag was detected at the ER af- interact with lamin A in vivo. ter digitonin permeabilization. Both myc and HA tags were identifiable after treatment with Triton X-100. These data indicate that the NH - and 2 To determine whether this interaction with lamin A is re- COOH-terminal domains of Sun1 reside on opposite sides of the INM, quired for Sun2 retention at the NE, we first performed im- with the COOH-terminal domain located in the PNS. munofluorescence experiments on fibroblasts derived from both wild-type and Lmna-null mouse embryonic fibroblasts ization. Sun1 retention must be dependent upon additional (MEFs). Although Sun2 was detected at the NE of all wild- binding partners. type cells, in the majority of Lmna-null MEFs, Sun2 was dis- With what proteins might the Sun1 and 2 nucleoplasmic persed throughout cytoplasmic membranes (Fig. 5 A). At first, domains interact? Our initial thoughts were that the Sun pro- these results do indeed implicate A-type lamins in the appro- teins might associate with lamina components. To address this, priate localization of Sun2 within the INM. However, there is we first adopted an in vitro approach to determine whether A- clearly a minority of Lmna-null cells in which Sun2 is fully re- and B-type lamins could interact with the NH -terminal domain tained at the NE (Fig. 5 A, inset). Furthermore, loss of Sun2 of either protein. We prepared a GST fusion protein containing from the INM is not reversed simply by introducing lamin A the first 165 amino acids of the Sun2 sequence (Sun2N165). and/or C by transfection into Lmna-null MEFs (not depicted). This represents most of the Sun2 nucleoplasmic domain. A Evidently, although A-type lamins could contribute to Sun2 similar, although slightly larger (the first 220 amino acids), localization, they are not the only determinants. This sugges- fusion protein was also prepared using Sun1 sequences that tion is reinforced by experiments in HeLa cells in which we encompassed the bulk of the nonalternatively spliced region of eliminated A-type lamins by RNA interference (RNAi). After the nucleoplasmic domain (Sun1N220). This region of Sun1 48–72 h of RNAi treatment, lamin A/C was undetectable in exhibits significant sequence similarity to the NH -terminal many cells. However, the NE localization of Sun2 was barely domain of Sun2 over a region of 120 residues (Fig. 4 C), al- affected (Fig. 5 C). though Sun1 does display a unique 50-residue NH -terminal In contrast to Sun2, we could find no evidence whatso- extension. Both of these fusion proteins as well as a GST con- ever for any lamin-dependent localization of Sun1. We took the SUN–NESPRIN INTERACTIONS • CRISP ET AL. 45 Figure 4. Interactions between the nucleoplasmic domains of Sun1 and 2 with A-type lamins. (A) An HA-Sun1L construct lacking the SUN domain and most of the lumenal coiled-coil localizes to the NE in a manner similar to the full-length protein. Anti-HA labeling is in red, whereas DNA, visualized with Höchst dye, is in blue. (B) Overexpression of HA-Sun1 leads to the loss of endogenous Sun2 in HeLa cells, suggesting that these two proteins share common binding partners. (C) A ClustalW alignment of the NH -terminal sequences of mouse Sun1 and 2 identifies multiple clusters of homologous amino acids within a region of 120 residues. Sun1 exhibits a unique NH -terminal extension of 50 amino acid residues. (D) The first 222 residues of Sun1 or the first 165 residues of Sun2 (this represents the entire nucleoplasmic domain of the latter) were fused to GST and, with GST alone (Coomassie stain, bottom), were used to pull down S-labeled, in vitro translated lamins B1, C, mature A, and full-length (FL) A (Total). Unlike GST alone, Sun1N220 and Sun2N165 pulled down lamins B1, C, and mature A at similar levels. However, Sun1N222 displayed a higher affinity for FL LaA than did Sun2N165. Evidently, Sun1 has a very strong preference for full-length (or pre) lamin A over mature lamin A (or full-length lamins C and B1). (E) An HA tag was inserted at the NH terminus of the same nucleoplasmic segments of both Sun1 and 2 (as described in D), and the tagged proteins were expressed in HeLa cells. Both of these exogenous proteins appear enriched in the nucleoplasm (top). As observed by deconvolution microscopy, cotransfection of the myc-tagged full- length lamin A (green) with HA-Sun1N222 or HA-Sun2N165 (red) resulted in the recruitment of both HA-Sun proteins to the NE (middle). Myc–lamin B1, in contrast, fails to produce such an effect. Evidently, the nucleoplasmic domains of Sun1 and 2 can interact with lamin A in vivo. approach of introducing HA-Sun1 into both wild-type and To accomplish this, we raised an antibody against the Lmna-null MEFs. In either case, exogenous Sun1 was always NH -terminal actin-binding domain (ABD) of nesp2G. The af- found at the nuclear periphery (Fig. 5 B). Similarly, in HeLa finity-purified antibody recognized a very large (400 kD) cells depleted of A-type lamins by RNAi, endogenous Sun1 al- protein on Western blots of HeLa cell lysates (Fig. 6 A). At ways remained concentrated at the NE (Fig. 5 C). Regardless longer exposure times, lower molecular mass bands appeared, of A-type lamin content, we have never observed cells in which possibly corresponding to smaller nesprin 2 isoforms (Zhang et Sun1 is substantially mislocalized. Thus, although Sun proteins al., 2001) or to degradation products. Immunofluorescence mi- demonstrably interact with A-type lamins, this interaction is croscopy using digitonin permeabilization revealed that the not required for their localization in the INM. anti-nesp2G antibody decorated the cytoplasmic surface of the Studies in C. elegans have shown that the prototype SUN NE (Fig. 6 B, mock). This labeling pattern was abolished by domain protein Unc-84 is required for the appropriate localiza- RNAi treatment of cells using nesprin 2–specific SmartPool tion of Anc-1 in the ONM (Lee et al., 2002; Starr and Han, oligonucleotides. Clearly, our antibody recognizes a very large 2002). Giant nesprin family members are also known to local- ONM-associated nesprin 2 isoform, which is almost certainly ize to the ONM (Zhang et al., 2001; Zhen et al., 2002; Padma- nesp2G. Permeabilization of non–RNAi-treated cells with kumar et al., 2004) and, like Anc-1, feature a COOH-terminal Triton X-100 yielded additional intranuclear labeling (unpub- KASH domain. Therefore, we examined the role that mamma- lished data). This confirms a previous study suggesting that lian SUN domain proteins might play in the localization of one smaller nesprin 2 variants reside within the nucleus (Zhang et of these nesprin proteins (nesp2G; 800 kD). al., 2005). For all of our subsequent experiments, we used digi- 46 JCB • VOLUME 172 • NUMBER 1 • 2006 Figure 5. A-type lamin independent retention of SUN domain proteins at the NE. (A) Endogenous Sun2 is frequently, but not always (inset), lost from the NE in Lmna-null MEFs. In wild-type MEFs, Sun2 is always found at the NE. (B) When HA-Sun1 was introduced by transfection into either wild-type or Lmna-null MEFs, it was always found to localize appropriately to the NE. (C) Depletion of HeLa cells of A-type lamins by RNAi had no significant effect on endogenous Sun1 or 2 localization. In the merged im- ages, Sun protein localization is shown in red, A-type lamin localization (lamin A/C) is shown in green, and nuclei are revealed in blue using Höchst dye. The inference is that A-type lamins have, at best, a limited role in the retention of Sun2 at the NE and no significant role at all in the reten- tion of Sun1. tonin permeabilization to ensure that we were looking exclu- sively at nesp2G that was localized in the ONM. To explore the roles of Sun1 and 2 in nesp2G localiza- tion, we first adopted an RNAi-based approach. When we de- pleted HeLa cells of either Sun1 or 2 (Fig. 6, C and D), we Figure 6. The retention of nesp2G at the ONM requires the expression of could find little effect on the localization of nesp2G at the SUN domain proteins. (A) Western blot of a HeLa lysate fractionated by SDS- ONM (Fig. 6, C and E). However, codepletion of Sun1 and 2 PAGE and probed with an affinity-purified antibody raised against the ABD of led to the elimination of nesp2G from the ONM (Fig. 6, C and E). human nesp2G identifies a very large (400 kD) protein. (B) Immunofluores- cence microscopy of digitonin-permeabilized HeLa cells using the anti-ABD an- Quantitative analysis indicated an 80% reduction in the number tibody reveals labeling of the cytoplasmic face of the NE. Depletion of nesprin of cells with detectable NE-associated nesp2G after codeple- 2 (all splice isoforms) in HeLa cells by RNAi leads to a loss of ONM labeling in tion of Sun1 and 2 versus mock RNAi treatment (Fig. 6 E). the majority of cells (bottom). These data are consistent with the recognition of nesp2G by the anti-ABD antibody. (C) The reduction of either Sun1 or 2 levels Ultrastructural analyses revealed changes in NE morphology in by RNAi had only a marginal effect on nesp2G localization. However, the cells codepleted of both Sun proteins. Mock-treated cells dis- combined depletion of both Sun1 and 2 induced a dramatic loss of nesp2G played the usual uniform spacing between the ONM and INM from the ONM (arrowheads). Overall, we observed an 80% decline in the number of cells exhibiting NE-associated nesp2G (E). In total, 100–200 cells of 50 nm. In the double RNAi-treated cells, however, the were scored for each category in three separate experiments. Error bars repre- ONM was clearly dilated with obvious expansion of the PNS to sent SEM. (D) Western blot analysis reveals that both Sun1 and 2 RNAi treat- 100 nm or more (Fig. 6 F). ments lead to a substantial decline in Sun1 and 2 protein levels. The same blots were probed with an anti-actin antibody to confirm equal loading. (F) If SUN and KASH domain proteins form a molecular Thin section EM of cells subjected to the double (Sun1 and 2) RNAi treatment link across the PNS (Starr and Han, 2003), it should be possible revealed frequent expansion of the PNS and increased separation of the INM to use a dominant-negative approach to break this linkage. In this and ONM (arrowheads). No such effect was observed in mock-treated cells. The nuclear interior (N) and cytoplasm (Cy) is indicated in each panel. strategy, we used almost the entire lumenal domain of Sun1 SUN–NESPRIN INTERACTIONS • CRISP ET AL. 47 Figure 7. A soluble form of the Sun1 lumenal domain causes a loss of nesp2G from the ONM. (A) A signal sequence (SS), HA tag, and KDEL motif were added to the NH and COOH termini, respectively, of the Sun1 lumenal domain (SS–HA-Sun1L–KDEL). (B) SS–HA-Sun1L–KDEL, when translated in vitro in the presence of microsomes, is completely resistant to digestion by proteinase K. If Triton X-100 is included in the digestion reaction to permeabilize the microsomes, the 50-kD SS–HA-Sun1L–KDEL translation product (arrow) is completely degraded. These data demonstrate that the signal sequence is fully functional in directing HA-Sun1L–KDEL to the microsomal lumen. (C) When introduced by transfection into HeLa cells, the SS–HA-Sun1L–KDEL localizes both to the peripheral ER and to the PNS, which is revealed by immunolabeling with an anti-HA monoclonal antibody. Cells expressing SS–HA-Sun1L– KDEL (red in merged images) exhibit a very obvious loss of nesp2G (green in merged images) from the ONM. (D) Thin section EM of HeLa cells expressing SS–HA-Sun1L–KDEL (Transf.) revealed increased separation between the INM and ONM and expansion of the PNS (arrowheads). This effect was not observed in nontransfected cells (NT). The effects of SS–HA-Sun1L–KDEL expression were identical to those observed after codepletion of Sun1 and 2 by RNAi (Fig. 6). tagged at its NH terminus with HA (HA-Sun1L), which we in- GFP-KASH under the control of a tetracycline-inducible pro- troduced in soluble form into the lumen of the ER and PNS moter (HeLaTR GFP-KASH). In the absence of tetracycline, (Fig. 7 A). To accomplish this, we fused the signal sequence GFP-KASH is present at low levels and localizes exclusively and signal peptidase cleavage site of human serum albumin to the NE (Fig. 8 A, Tet). After tetracycline induction, large onto the NH terminus of HA-Sun1L to yield SS–HA-Sun1L. amounts of GFP-KASH may be observed in both the NE and To prevent its secretion, we fused a KDEL tetrapeptide to the peripheral ER (Fig. 8 A, Tet). Introduction of SS–HA-Sun1– COOH terminus of SS–HA-Sun1L, forming SS–HA-Sun1L– KDEL into these cells leads to the complete loss of NE-associated KDEL (Fig. 7 A). Synthesis of this chimeric protein in vitro in GFP-KASH. Indeed, all of the GFP-KASH, regardless of ex- the presence of microsomes yielded a protein product of the ap- pression level, appears to be recruited into vesicular structures, propriate size, which was resistant to digestion by proteinase K potentially as a prelude to degradation (Fig. 8 B, top; arrows). (Fig. 7 B). Clearly, the signal sequence directs HA-Sun1L to Conversely, when full-length Sun1 is introduced into tetracy- the microsome lumen. The shift up in molecular weight of latent cline-induced cells, it leads to the recruitment of GFP-KASH HA-Sun1L–KDEL is likely a result of NH -linked glycosyla- from the peripheral ER to the NE (Fig. 8 B, middle and bottom; tion (Sun1 has two potential glycosylation sites in its lumenal arrows). This is exactly what one would predict if Sun proteins domain). Upon transfection into HeLa cells, HA-Sun1L– function as tethers for KASH domain proteins. A similar ef- KDEL was found to accumulate intracellularly within the fect was also observed when HA-Sun2 was introduced into the peripheral ER and PNS. Examination of the distribution of tetracycline-induced cells (Fig. 8 C), with GFP-KASH re- nesp2G in transfected cells revealed that it was completely cruited to and stabilized at the NE. Altogether, these results eliminated from the ONM (Fig. 7 C). EM analysis of these can only be interpreted in terms of lumenal interactions be- cells exposed clear dilation of the ONM and expansion of the tween SUN domain and KASH domain proteins. Furthermore, PNS (Fig. 7 D). This phenotype is indistinguishable from that they suggest that both Sun1 and 2 can interact in vivo with the associated with Sun1/2 codepletion by RNAi (Fig. 6 F). nesprin 2 KASH domain, which is consistent with our RNAi In further experiments, we took advantage of a cDNA results indicating that both SUN domain proteins contribute to encoding a chimeric protein in which GFP is fused to the NH nesp2G anchoring. terminus of the nesprin 2 KASH domain (Zhang et al., 2001). To further define Sun1/2–KASH interactions, we set out This fusion protein localizes to the NE with the GFP exposed to identify Sun–KASH complexes both in vivo and in vitro. For to the cytoplasm/nucleoplasm. The KASH domain is integrated the former, we performed immunoprecipitation analyses of into the NE, with its 40-residue COOH-terminal domain resid- Sun2. As shown in Fig. 8 E, a high molecular weight protein ing within the PNS. We prepared a HeLa cell line harboring recognized by our antibody against nesp2G was found to 48 JCB • VOLUME 172 • NUMBER 1 • 2006 Figure 8. The nesp2G KASH domain interacts with the Sun1 lumenal domain. (A) Fluorescence microscopy of HeLa cells expressing a tetracycline-inducible GFP-KASH fusion protein (HeLaTR GFP-KASH). In the absence of tetracycline (Tet), GFP-KASH is expressed at low levels and is localized exclusively to the NE. After induction with tetracycline for 24 h (Tet), GFP-KASH is found throughout the peripheral ER as well as the NE. Expression levels of GFP- KASH within the cell population is extremely uniform both before and after induction. (B) Transfection of SS–HA-Sun1–KDEL into the HeLaTR GFP-KASH cells after tetracycline induction resulted in the complete loss of GFP-KASH from the NE. This was accompanied by the formation of cytoplasmic aggre- gates (arrows, top). Conversely, introduction of full-length HA-Sun1 into these cells resulted in the recruitment of GFP-KASH to the NE (arrows, middle and bottom). (C) HA-Sun2 was found to have a similar effect (arrows). In the merged images in B and C, GFP-KASH is presented in green, whereas HA-Sun is shown in red. (D) To identify an in vitro interaction between KASH and SUN domains, GFP-KASH, SS–HA-Sun1–KDEL, or both proteins were translated in reticulocyte lysate containing [ S]methionine/cysteine in either the presence or absence of microsomes (Totals). Anti-GFP immunoprecipitation of a fraction of each sample revealed the pull-down of SS–HA-Sun1–KDEL by GFP-KASH when both proteins were cotranslated in the presence of microsomes (arrow). A slightly faster migrating band (asterisk) was detected in the absence of microsomes. However, this band originates in the GFP-KASH translation and is unrelated to HA-Sun1L–KDEL. Molecular masses are indicated in kD. (E) Immunoprecipitation of HeLa cell lysates with anti-Sun2 antibodies copre- cipitates a very large anti-nesp2G immunoreactive protein (arrow). HC indicates the position of immunoglobulin heavy chains. These data suggest a signifi- cant interaction between KASH and Sun proteins that must involve their lumenal domains. These findings allow us to propose a model for the LINC complex (F) in which nuclear components, including lamins, bind to the INM SUN domain proteins. They, in turn, bind to the KASH domain of the actin-associated giant nesprins on the ONM. Thus, the LINC complex establishes a physical connection between the nucleoskeleton and the cytoskeleton. coimmunoprecipitate with Sun2 from HeLa cell lysates. As a pology of Sun1 matches that of another INM protein, Sun2, to complement to these experiments, we synthesized SS–HA- which it is related. Based upon structural predictions, it is Sun1–KDEL and GFP-KASH in vitro. Interactions between likely that Sun1 possesses three closely spaced transmembrane these proteins were then analyzed by immunoprecipitation us- domains between residues 356 and 448. A separate hydropho- ing antibodies against GFP. As revealed in Fig. 8 D, only when bic region, H1, that is situated closer to the NH terminus does the SUN and KASH domain proteins were cosynthesized in not appear to function as a membrane anchor. This conclusion vitro in the presence of microsomes could we detect HA-Sun1– is based upon the behavior of naturally occurring splice iso- KDEL in immunoprecipitates performed with the anti-GFP an- forms that lack this hydrophobic sequence. A third mammalian tibody. Together, all of these data provide strong evidence for Sun protein, Sun3, is also an integral membrane protein with a the interaction, either direct or indirect, between Sun1/2 and lumenal COOH-terminal SUN domain and a relatively small nesp2G. Such an interaction spanning the PNS provides an cytoplasmic NH -terminal domain (unpublished data). In this obvious mechanism for the Sun1/2-dependent tethering of way, Sun3 conforms to the general topological organization of nesp2G in the ONM. other Sun family members. The organization of the lumenal domains of Sun1 and 2 bears some comment. The membrane proximal sequences of Discussion both proteins are predicted to form a coiled-coil. The implica- We have shown that Sun1 is an INM protein with an NH - tion is that these proteins may form homodimers. Given the terminal nucleoplasmic domain of 350 amino acids and a number of residues within the Sun1 coiled-coil region, this larger COOH-terminal domain of 500 amino acids, including could potentially project 25–30 nm into the PNS and would the SUN domain, that resides in the PNS. In this way, the to- terminate in a pair of globular SUN domains. The coiled-coil SUN–NESPRIN INTERACTIONS • CRISP ET AL. 49 domain of Sun2 is of a similar size. In both cases, the overall attempted to determine whether the Unc-84/Anc-1 paradigm conformation of the Sun protein lumenal domain would be that was applicable in mammalian systems. We used a combination of a flower on a stalk, which could potentially bridge the gap of RNAi and a dominant-negative form of Sun1 to test this between the lumenal faces of the INM and ONM. model. We found that both Sun1 and 2 contribute to the tether- The exact mechanism by which Sun1 and 2 are localized ing of nesp2G in the ONM. Elimination of either Sun protein to the INM has yet to be resolved, although it is likely to in- by RNAi had little or no effect on nesp2G localization in HeLa volve the type of selective retention that has been observed for cells. However, codepletion of Sun1 and 2 leads to the loss of other INM proteins. What is clear is that the lumenal domain of nesp2G from the ONM. This was accompanied by separation both proteins is entirely dispensable for appropriate localiza- of the ONM and INM, leading to expansion of the PNS. The tion. This is exactly the reverse of what is observed for nesprin implication here is that links between the Sun proteins in the proteins (including nesp2G) of the ONM, where the lumenal INM and KASH proteins in the ONM help to maintain the re- and transmembrane domains (comprising the KASH domain) markably regular spacing of the nuclear membranes. This view are essential for their retention at the nuclear periphery (Zhang was reinforced by the findings that overexpression of a soluble et al., 2001). form of the lumenal domain of Sun1 (SS–HA-Sun1L–KDEL) On the nucleoplasmic side of the INM, the Sun1 and 2 induced essentially the same phenotype: loss of nesp2G from NH -terminal domains contain regions of similarity within the the ONM and expansion of the PNS. first 200 amino acid residues. This common NH -terminal re- In a complementary series of experiments, SS–HA- gion interacts, to a greater or lesser extent, with A-type lamins. Sun1L–KDEL expression was also found to lead to the loss of In the case of Sun2, there is some evidence that A-type lamins GFP-KASH from the NEs of HeLa cells. This effect can only might contribute to Sun2 localization in the INM. However, be accounted for by perturbation of lumenal interactions. Con- whether this requires a direct interaction with A-type lamins is versely, overexpression of full-length Sun1 (or Sun2) leads to less clear. Certainly, the concentration of Sun2 in the INM is the recruitment of GFP-KASH to the NE. All of these results A-type lamin independent in some cells. Furthermore, even in are predictable on the basis of SUN domain proteins function- Lmna-null MEFs in which Sun2 is mislocalized, the mere rein- ing as translumenal tethers for KASH domain proteins. troduction of A-type lamins fails to recruit Sun2 to the INM, at Our final experiments demonstrated the existence of least within a period of 24 h (unpublished data). It seems SUN–KASH complexes. Immunoprecipitates of Sun2 from more likely to us that A-type lamins may have indirect effects HeLa extracts were found to contain nesp2G. Similarly, in on Sun2, perhaps by altering the accessibility of chromatin pro- vitro translation of SS–HA-Sun1L–KDEL and GFP-KASH teins with which Sun2 might interact. leads to the formation of HA-Sun1L–KDEL–GFP-KASH com- In the case of Sun1, there is no evidence that lamins play plexes provided that microsomes were present in the translation any role in its localization to the INM. However, Sun1 displays mix. While this manuscript was in preparation, Padmakumar et an extremely robust interaction with prelamin A. Newly syn- al. (2005) published a study that demonstrated a similar inter- thesized lamin A undergoes extensive COOH-terminal pro- action between SUN domain and KASH domain proteins. cessing (Sinensky et al., 1994). This involves farnesylation of Their results suggest, however, that rather than interacting with the COOH-terminal CaaX (single letter code where C is cys- the SUN domain itself, the KASH domain actually bound to a teine, a is any amino acid with an aliphatic side chain, and X is region of the polypeptide chain that is proximal to the SUN any amino acid) motif followed by endoproteolysis to remove domain. This region is present in our Sun1L-based dominant- the aaX residues and carboxy methylation of the farnesyl cys- negative mutant. teine. Once incorporated into the nuclear lamina, a second All of our data suggest that the two Sun proteins are the cleavage event after Y646 yields mature lamin A (Weber et al., key to the appropriate localization of nesp2G in the ONM. In 1989). This cleavage of prelamin A at Y646 abolishes any contrast to previously published findings (Libotte et al., 2005), strong interaction with Sun1. Because prelamin A exists only we could find no evidence of a role for A-type lamins. This is transiently in normal cells, it seems unlikely that its interaction not surprising given that in our HeLa cells, the localization of with Sun1 could contribute to Sun1 localization. In our opin- Sun1 and 2 appear relatively insensitive to A-type lamin ex- ion, it is more likely that Sun1 might function in the organiza- pression (or depletion). Padmakumar et al. (2005) reached ex- tion of newly synthesized lamin A within the nuclear lamina. actly the same conclusion with respect to Sun1. However, in This suggestion is currently under investigation. Lmna-null MEFs, Sun2 is frequently lost from the NE. Given Starr and Han (2002) have shown that the C. elegans that expression levels of Sun1 appear to vary somewhat be- SUN domain protein Unc-84 is required for the localization of tween different tissues, it is conceivable that in at least some Anc-1 in the ONM. They have proposed a model in which the cell types, nesp2G localization to the ONM might be sensitive lumenal domain of Unc-84, which itself is retained in the INM to A-type lamin expression. through interactions with the single C. elegans lamin, forms a Altogether, our findings and those of Padmakumar et al. complex with the lumenal KASH domain of Anc-1. In this (2005) are entirely consistent with the model proposed by Starr way, Unc-84 and Anc-1 would provide links in a molecular and Han (2003) in which SUN and KASH domain proteins form chain that spans the PNS and connects the actin cytoskeleton to a link across the PNS (Fig. 8 F). In addition, in C. elegans, a sim- the nuclear lamina. Because similar SUN and KASH domain ilar mechanism may well operate in the tethering of Zyg-12, a molecules are widely represented in the animal kingdom, we NE protein that is required for dynein-mediated centrosome 50 JCB • VOLUME 172 • NUMBER 1 • 2006 then labeled with appropriate primary and secondary antibodies. For cer- positioning (Malone et al., 2003). As well as tethering ONM tain double-label experiments, a single primary antibody was applied af- proteins, our data would suggest that SUN–KASH linkages ter the digitonin permeabilization. After removal of unbound antibody further contribute to the structural integrity of the NE in main- with three PBS washes, the cells were refixed for 5 min (in 3% formalde- hyde) and subjected to a further permeabilization step in 0.2% Triton X-100. taining the precise separation of the two nuclear membranes. The second primary antibody was then applied followed by appropriate Furthermore, given that the giant nesprins are actin-binding pro- secondary antibodies. Specimens were observed using a microscope (model teins, the SUN–KASH links provide direct molecular connec- DMRB; Leica). Images were collected using a CDC camera (CoolSNAP HQ; Photometrics) linked to a Macintosh G4 computer running IPLab Spec- tions between the actin cytoskeleton and the nuclear interior. trum software (Scanalytics). We now refer to this molecular chain as the LINC complex. Many studies have documented mechanical coupling EM Cells grown in 35-mm petri dishes were fixed in 3% glutaraldehyde and between the nucleus and the cytoplasm. Maniotis et al. (1997) 0.2% tannic acid in 200 mM sodium cacodylate buffer for 1 h at room used microneedle-mediated deformation of the cytoplasm of temperature. Postfixation was performed in 2% OsO for 20 min. The cultured cells to demonstrate mechanical connections between cells were dehydrated in ethanol, lifted from the culture dish using propyl- ene oxide, and infiltrated with Polybed 812 resin. Polymerization was integrins, cytoskeletal filaments, and nucleoplasm. More re- performed at 60C for 24 h. Silver-gray sections were cut using an ultrami- cently, Lammerding et al. (2004) were able to show that fibro- crotome (Leica) equipped with a diamond knife. The sections were stained blasts derived from Lmna-null mouse embryos have impaired with uranyl acetate and lead citrate and examined in an electron micro- scope (model 7000; Hitachi). mechanically activated gene transcription. In related studies, Broers et al. (2004) have shown that these same cells exhibited Short inhibitory RNA (siRNA) methods reduced mechanical stiffness and perturbations in the organiza- HeLa cells were depleted of Sun1, Sun2, nesprin 2, and lamins using ap- propriate SmartPool oligonucleotide duplexes (Dharmacon). Cells were tion of the cytoskeleton. The existence of the LINC complex exposed to each siRNA in the presence of OligofectAMINE (Invitrogen) provides a basis for these various observations in that it may precisely as recommended by the manufacturer. Cells were subjected to integrate the nucleus into a protein matrix that includes the siRNA treatment for periods up to four days. However, most of our analyses were performed after 2–3-d treatments. cytoskeleton, extracellular matrix, and cell–cell adhesion complexes. This mechanical link not only provides structural Immunoblotting and gel electrophoresis continuity within and between cells, but it also allows for a direct Cells (siRNA- or mock-treated) grown in 35-mm tissue culture dishes were washed once in PBS and lysed in a buffer containing 50 mM Tris-HCl, pH physical signaling pathway from the cell surface to the nucleus, 7.4, 500 mM NaCl, 0.5% Triton X-100, 1 mM DTT, 1 mM PMSF, and potentially facilitating rapid and regionalized gene regulation. 1:1,000 CLAP (10 mg/ml in DMSO each of chymostatin, leupeptin, anti- pain, and pepstatin). The lysate was centrifuged for 5 min in an Eppen- dorf centrifuge at 4C. Proteins in the supernatant were precipitated by the Materials and methods addition of TCA to a final concentration of 10%. The precipitate was washed with ethanol/ether and solubilized in SDS-PAGE sample buffer. Cell culture Protein samples were fractionated on polyacrylamide gels (7.5, 10, or HeLa cells and MEFs, both Lmna / and Lmna / (Sullivan et al., 4–15% gradient as appropriate; Laemmli, 1970) and transferred onto ni- 1999), were maintained in 7.5% CO and at 37C in DME (GIBCO BRL) trocellulose filters (usually BA85; Schleicher and Schuell) using a semidry plus 10% FBS (Hyclone), 10% penicillin/streptomycin (GIBCO BRL), and blotting apparatus manufactured by Hoeffer Scientific Instruments Inc. Filters 2 mM glutamine. were blocked and labeled with primary antibodies and peroxidase-conju- gated secondary antibodies exactly as previously described (Burnette, Antibodies 1981). Blots were developed using ECL (GE Healthcare) and exposed to The following antibodies were used in this study: the monoclonal antibody X-OMAT film (Kodak) for appropriate periods of time. against lamins A and C (XB10) has been described previously (Raharjo et al., 2001). The monoclonal antibodies 9E10 and 12CA5 against the myc Immunoprecipitations and HA epitope tags were obtained from the American Type Culture Col- For Sun2/nesp2G coimmunoprecipitations, three subconfluent 35-mm lection and Covance, respectively. Rabbit antibodies against the same dishes of HeLa cells were each extracted with 1 ml each of PBS containing epitopes were obtained from AbCam. Rabbit antibodies against Sun1 0.1% Triton X-100, 1:1,000 CLAP, 2.5 mM sodium pyrophosphate, 1 mM and 2 were raised against GST fusion proteins as previously described -glycerophosphate, and 1 mM sodium vanadate. The dishes were rocked (Hodzic et al., 2004). The chicken antibody against the ABD of nesp2G at 4C for 15 min, and the cell lysates were centrifuged for 10 min at max- was raised against an ABD-GST fusion protein by Aves Labs, Inc. Affinity imum speed and at 4C in a microcentrifuge. The pellets were then reex- purification of the IgY was performed in two stages. In the first step, an af- tracted in a total volume of 3 ml radioimmunoprecipitation assay buffer for finity column was prepared consisting of GST cross-linked to glutathione 15 min, also at 4C. After centrifugation at 4C for 10 min, the superna- agarose (Sigma-Aldrich) using 40 mM dimethyl pimelimidate in 0.2 M bo- tants were pooled and divided into 500-l aliquots. Each aliquot was then rate buffer, pH 9.0, for 1 h at 4C. 5 ml IgY solution was passed over this incubated for 14 h at 4C with appropriate combinations of immune and column (1-ml bed volume), and the flow through was collected. This flow preimmune sera and protein A–Sepharose beads. At the end of this pe- through was applied to a second 1-ml column prepared from ABD-GST riod, the beads were collected by brief centrifugation and washed three that was also cross-linked to glutathione agarose. Antibody bound to the times in PBS containing 0.1% Triton X-100 and once in PBS alone. Finally, column was eluted at pH 2.8 in 0.2 M glycine-HCl. The antibody eluate the beads were suspended in SDS-PAGE sample buffer, heated to 95C was neutralized with 3 M Tris, pH 8.8, and stored at 4C with 1 mM so- for 5 min, and analyzed by SDS-PAGE and Western blotting. dium azide. Secondary antibodies conjugated with AlexaFluor dyes were All other immunoprecipitations were performed in TNX (50 mM Tris- obtained from Invitrogen. Peroxidase-conjugated secondary antibodies HCl, pH 7.4, 100 mM NaCl, and 0.5% Triton X-100) containing 1:1,000 were obtained from Biosource International. CLAP. Incubation with antibodies and protein A–Sepharose beads was for 1 h at 4C with continuous gentle mixing. At the end of this period, the Immunofluorescence microscopy beads were collected by brief centrifugation and were washed three times Cells were grown on glass coverslips and fixed in 3% formaldehyde in TNX and once in 50 mM Tris-HCl, pH 7.4. Finally, the beads were pro- (prepared in PBS from PFA powder) for 10 min followed by a 5-min per- cessed for electrophoresis as described above. meabilization with 0.2% Triton X-100. The cells were then labeled with the appropriate antibodies plus the DNA-specific Höchst dye 33258. For In vitro translations experiments involving selective permeabilization, the cells were first fixed In vitro translations were performed in 25-l reaction volumes using the in 3% formaldehyde. This was followed by permeabilization in 0.003% TNT T7 coupled transcription translation system (Promega). Each transla- digitonin in PBS on ice for 15 min (Adam et al., 1990). The cells were tion reaction contained 20 l TNT master mix and was programmed with SUN–NESPRIN INTERACTIONS • CRISP ET AL. 51 1 l plasmid DNA at a concentration of 0.1 g/l. Labeling of transla- complete medium. The entire volume was then placed on the cells with an S Translabel tion products was accomplished by the inclusion of 10 Ci additional 1.5 ml of complete medium. The cells were then returned to the (MP Biolabs). Where appropriate, up to 3 l of canine pancreatic mi- tissue culture incubator for 12–24 h. At the end of this period, the cells crosomes (Promega) was also included in each reaction. Translation reac- were processed as appropriate. tions were assembled on ice before incubation at 30C for 90 min. At the end of this period, translation mixes were further processed for in vitro Preparation of GST fusion proteins binding studies (see In vitro pull-down...proteins) or were subjected to diges- GST-Sun1 and Sun2 fusion proteins were prepared using the plasmids tion with proteinase K in order to define Sun protein topology. Proteinase pGEX-4T3Sun1N220 and pGEX-4T3Sun2NP. These plasmids were cre- K digestions were performed on ice for periods of up to 1 h. Each diges- ated by amplifying 5 sequences of Sun1 and 2 by PCR. The Sun1 PCR -terminal domain, tion mix (10-l total volume) contained 5 l of the complete in vitro trans- product encoded the first 222 amino acids of the NH -terminal domain of lation reaction, 1 l proteinase K (from a 1-mg/ml stock solution), 1 l of whereas the Sun2 sequences encoded the bulk of NH 10 compensation buffer (containing 0.5 M sucrose, 50 mM Tris-HCl, pH 165 amino acids. These PCR products were inserted into pGEX4T3 (GE 7.6, and 200 mM potassium acetate), and, where appropriate, 1 l of a Healthcare) between BamHI and EcoRI sites. The primers used for Sun1 10% solution of Triton X-100. Termination of digestion was accomplished were 5 -CGCGGATCCGACTTTTCTCGGCTGCAC-3 and 5 -CCGGAAT- by the addition of 100 l of 10% TCA to precipitate the proteins. Precipi- TCTTAGCGTGGTTTGAGAGTCCT-3 , whereas the Sun2 primer pair con- tates were washed in ethanol/ether, air dried, and dissolved in 25 l sisted of 5 -CGCGGATCCTCCCCGAAGAAGCCAGCGCCTCACG-3 SDS-PAGE sample buffer by incubation at 37C. and 5 -CCGGAATTCTTAGGAGCCCGCCCGTGAGACGGC-3 . A single colony of Bl-21 cells transformed with either plasmid was grown overnight Plasmids in 10 ml Luria-Bertani containing 100 g/ml ampicillin and was induced A mouse Sun1 cDNA (IMAGE clone ID 5321879) was obtained from In- with 0.1 mM IPTG for 4 h at 37C. The cells were harvested by 15-min terminus with an HA vitrogen. To generate Sun1 tagged at the NH centrifugation at 4C and at 3,200 g in an Eppendorf table-top centrifuge. epitope, Sun1 cDNA flanked by 5 Sal1 and 3 Afl2 restriction sites was The bacterial pellets were resuspended by trituration in 1 ml of lysis buffer amplified by PCR using primers 5 -GAACGTCGACTTTTCTCGGCTGCA- consisting of STE (150 mM NaCl, 10 mM Tris, pH 8.0, and 1 mM EDTA) CACGTACACC-3 and 5 -CTGGCTTAAGCTACTGGATGGGCTCTCCG-3 . containing 5 mM DTT and 0.25% sarkosyl (N-laurylsarcosine). The sus- The PCR product was digested with Sal1 and Afl2 and inserted down- pension was sonicated to achieve maximum cell breakage and was centri- stream of an HA tag sequence in the vector pCDNA3.1(). This vector fuged at maximum speed in a microcentrifuge for 10 min at 4C. The su- was prepared from pcDNA3.1() containing HA–lamin A (Raharjo et al., pernatant was then transferred to a fresh microcentrifuge tube containing 2001) by digestion with Xho1 and Afl2. The resulting plasmid was 30 l of a 50% suspension in PBS of swollen glutathione agarose beads. pcDNA3.1()HA-Sun1. The cleared bacterial lysate and beads were then incubated with continu- pcDNA3.1()HA-Sun1 was used as a template for generating fur- ous mixing at 4C for 1 h. At the end of this period, the beads were ther Sun1 constructs. The Sun1 splice isoform 6–8 was created by in- washed three to five times with ice-cold STE and twice with ice-cold bind- verse PCR using primers 5 -CGTGGTTTGAGAGTCCTGTCTCTGG-3 and ing buffer (50 mM Tris, pH 7.4, 100 mM NaCl, 0.1% Triton X-100, and 5 -GACCTCTTGGTTCAAGCACTGCGAAGG-3 to amplify the entire plas- 1 mM DTT). mid outside of the deleted region. The PCR product was digested with the Klenow fragment of DNA polymerase and was circularized by liga- In vitro pull-down with GST fusion proteins tion. A double epitope-tagged Sun1 construct, HA-Sun1–myc, was made 1.5 g of plasmid DNA (pcDNA3.1HA–lamin A, –mature lamin A, –lamin by PCR using primers 5 -GCATCTGAAGACCAGCTGAG-3 and 5 - B1, and –lamin C) was included in 25 l TNT-coupled transcription/transla- S Translabel and incubated at 30C for 90 TAAACTTAAGCTAGAGATCCTCTTCTGAGATGAGTTTTTGTTCCTCAGC- tion mixes containing 10 Ci CTGGATGGGCTCTCCGTGGACTCG-3 to insert a 3 myc tag followed min. 1 ul of each reaction was retained for the analysis of total translation by an AflII restriction site. The fragment was then cloned back into the products, whereas the remainder was incubated with 10 ul GST–agarose HindIII–AflII site of the original template. beads in 600 l of binding buffer (containing 10 g/ml chymostatin, leu- To prepare a form of EGFP-KASH that could be translated in vitro, peptin, antipain, pepstatin, and 1 mM PMSF) for 30 min at room tempera- the BamHI–Nhe1 digested fragment of pEGFP-KASH was subcloned into ture with constant mixing. After a low speed centrifugation at 800 g, the the BamHI–Nhe1 site of pCDNA3.1() to yield pcDNA3.1EGFP-KASH. supernatant was split into three tubes containing 5 ul GST–agarose, GST- EGFP-KASH was also inserted into the tetracycline-inducible expression Sun1N220, or GST-Sun2NP beads. The suspensions were then incubated vector pcDNA4TO. This was accomplished by amplifying EGFP-KASH by for 45 min at room temperature with constant mixing. Finally, the beads PCR using the primers 5 -TAAACTTAAGCACCATGGTGAGCAAGGGC- were washed three to five times with binding buffer containing 1 mM DTT. GAGGAGC-3 and 5 -TAAAGCGGCCGCCTATGTGGGGGGTGGC- After the final wash, the binding buffer was replaced with 20 l SDS-PAGE CCATTGGTGTACC-3 . The 1,003-bp product was cut with Afl2 and Not1 sample buffer. The samples were subsequently fractionated by SDS-PAGE. and was ligated into similarly cut pcDNA4TO. The gels were stained with Coomassie blue R-250, impregnated with The soluble Sun1 lumenal domain construct SS–HA-Sun1L–KDEL, Amplify (GE Healthcare), dried, and exposed to X-OMAT film (Kodak). which was targeted to the ER and PNS, was prepared in three stages. The first step involved ligation of a double-stranded oligonucleotide encoding Northern blot analysis -terminal signal sequence of human serum albumin, which the entire NH Double-stranded DNA probes consisting of the 5 (650 bp) and 3 (860 was ligated into pcDNA3.1() between Nhe1 and Apa1 sites to yield bp) fragments of mSun1 and the full-length human Sun3 (1,050 bp) were P]dCTP into the PCR products was pcDNA3.1SS. In the second intermediate step, the 5 end of HA–lamin A generated by PCR. Incorporation of [ was amplified by PCR using the pair of primers 5 -AATTGGGCCCGCT- accomplished by random priming using the Rediprime II Random Primer TACCCTTACGATGTACCG-3 and 5 -ATATCTTAAGCAGCGCATCCGC- Labeling System (GE Healthcare) using 15 ng (in 45 l Tris-EDTA buffer) CAGCCGGCTC-3 . The 787-bp PCR product was ligated downstream of denatured DNA. A mouse multiple tissue Northern blot (BLOT-2; Sigma- the signal sequence in pcDNA3.1SS between the Apa1 and Afl2 sites to Aldrich) containing 2 ug polyA (per lane) RNA isolated from 10 differ- yield pcDNA3.1SS-HALaA5 . For the final step, the lamin A sequences ent mouse organs (brain, heart, liver, kidney, spleen, testis, lung, thymus, were excised using Xho1 and Afl2. To prepare the Sun1 lumenal domain placenta, and skeletal muscle tissues of BALB/c mice) was hybridized in- sequence incorporating a KDEL motif, PCR was performed using mouse dependently with each of the prepared probes, including one against Sun1 cDNA as a template and using the primers 5 -AGAGGGTCGAC- glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1.4 ng/ml in 6 ml GATTCCAAGGGCATGCATAG-3 and 5 -CTGGCTTAAGCTACAACT- PerfectHyb Plus hybridization buffer) for 17 h (Sigma-Aldrich). Between CATCTTTCTGGATGGGCTCTCCGTGGAC-3 . The resultant 1,403-bp each hybridization, the blot was stripped of the probe according to the product was cut with Sal1 and Afl2 and was ligated into the Xho1–Afl2 manufacturer’s instructions. cut vector. The resulting plasmid was pcDNA3.1SS–HA-Sun1L–KDEL. We would like to acknowledge Manfred Lohka, Colin Stewart, and Phyllis All enzymes were obtained from New England Biolabs, Inc. Hansen for valuable discussions. This work was supported by grants from the National Institutes of Transfections Health to B. Burke and P.D. Stahl. D. Hodzic was supported by a fellowship Plasmids were introduced into HeLa cells using the Polyfect reagent as de- from the Muscular Dystrophy Association. scribed by the manufacturer (QIAGEN). Transfections were normally per- formed in six-well plates. In brief, 1.5 g plasmid DNA was combined Submitted: 20 September 2005 with 100 l of serum-free medium and 12 l Polyfect. After a 10-min room temperature incubation, this mixture was combined with 600 l of Accepted: 22 November 2005 52 JCB • VOLUME 172 • NUMBER 1 • 2006 Padmakumar, V.C., S. Abraham, S. Braune, A.A. Noegel, B. Tunggal, I. Karake- References sisoglou, and E. Korenbaum. 2004. Enaptin, a giant actin-binding protein, is an element of the nuclear membrane and the actin cytoskeleton. Exp. Adam, S.A., R.E. Sterne-Marre, and L. Gerace. 1990. Nuclear protein import in Cell Res. 295:330–339. permeabilized mammalian cells requires soluble cytoplasmic factors. Padmakumar, V.C., T. Libotte, W. Lu, H. Zaim, S. Abraham, A.A. Noegel, J. J. Cell Biol. 111:807–816. Gotzmann, R. Foisner, and I. Karakesisoglou. 2005. The inner nuclear Apel, E.D., R.M. Lewis, R.M. Grady, and J.R. Sanes. 2000. Syne-1, a dystro- membrane protein Sun1 mediates the anchorage of Nesprin-2 to the nu- phin- and Klarsicht-related protein associated with synaptic nuclei at the clear envelope. J. Cell Sci. 118:3419–3430. neuromuscular junction. J. Biol. Chem. 275:31986–31995. Powell, L., and B. Burke. 1990. Internuclear exchange of an inner nuclear mem- Broers, J.L., E.A. Peeters, H.J. Kuijpers, J. Endert, C.V. Bouten, C.W. Oomens, brane protein (p55) in heterokaryons: in vivo evidence for the associa- F.P. Baaijens, and F.C. Ramaekers. 2004. Decreased mechanical stiff- tion of p55 with the nuclear lamina. J. Cell Biol. 111:2225–2234. ness in LMNA/ cells is caused by defective nucleo-cytoskeletal in- Raharjo, W.H., P. Enarson, T. Sullivan, C.L. Stewart, and B. Burke. 2001. Nu- tegrity: implications for the development of laminopathies. Hum. Mol. clear envelope defects associated with LMNA mutations causing dilated Genet. 13:2567–2580. cardiomyopathy and Emery-Dreifuss muscular dystrophy. J. Cell Sci. Burke, B., and C.L. Stewart. 2002. Life at the edge: the nuclear envelope and 114:447–457. human disease. Nat. Rev. Mol. Cell Biol. 3:575–585. Rober, R.-A., K. Weber, and M. Osborn. 1989. Differential timing of lamin A/C Burnette, W.N. 1981. ‘Western blotting’: electrophoretic transfer of proteins expression in the various organs of the mouse embryo and the young from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitro- animal: a developmental study. Development. 105:365–378. cellulose and radiographic detection with antibody and radioiodinated Schirmer, E.C., L. Florens, T. Guan, J.R. Yates III, and L. Gerace. 2003. Nu- protein A. Anal. Biochem. 112:195–203. clear membrane proteins with potential disease links found by subtrac- Ellenberg, J., E.D. Siggia, J.E. Moreira, C.L. Smith, J.F. Presley, H.J. Worman, tive proteomics. Science. 301:1380–1382. and J. Lippincott-Schwartz. 1997. Nuclear membrane dynamics and re- Sinensky, M., K. Fantle, M. Trujillo, T. McLain, A. Kupfer, and M. Dalton. assembly in living cells: targeting of an inner nuclear membrane protein 1994. The processing pathway of prelamin A. J. Cell Sci. 107:61–67. in interphase and mitosis. J. Cell Biol. 138:1193–1206. Soullam, B., and H.J. Worman. 1995. Signals and structural features involved Gerace, L., and B. Burke. 1988. Functional organization of the nuclear enve- in integral membrane protein targeting to the inner nuclear membrane. lope. Annu. Rev. Cell Biol. 4:335–374. J. Cell Biol. 130:15–27. Gerace, L., A. Blum, and G. Blobel. 1978. Immunocytochemical localization of Starr, D.A., and M. Han. 2002. Role of ANC-1 in tethering nuclei to the actin the major polypeptides of the nuclear complex-lamina fraction: inter- cytoskeleton. Science. 298:406–409. phase and mitotic distribution. J. Cell Biol. 79:546–566. Starr, D.A., and M. Han. 2003. ANChors away: an actin based mechanism of Gruenbaum, Y., A. Margalit, R.D. Goldman, D.K. Shumaker, and K.L. Wilson. nuclear positioning. J. Cell Sci. 116:211–216. 2005. The nuclear lamina comes of age. Nat. Rev. Mol. Cell Biol. 6:21–31. Stewart, C., and B. Burke. 1987. Teratocarcinoma stem cells and early mouse Hagan, I., and M. Yanagida. 1995. The product of the spindle formation gene embryos contain only a single major lamin polypeptide closely resem- sad1 associates with the fission yeast spindle pole body and is essential bling lamin B. Cell. 51:383–392. for viability. J. Cell Biol. 129:1033–1047. Sullivan, T., D. Escalante-Alcalde, H. Bhatt, M. Anver, N. Bhat, K. Nagashima, Hodzic, D.M., D.B. Yeater, L. Bengtsson, H. Otto, and P.D. Stahl. 2004. Sun2 C.L. Stewart, and B. Burke. 1999. Loss of A-type lamin expression is a novel mammalian inner nuclear membrane protein. J. Biol. Chem. compromises nuclear envelope integrity leading to muscular dystrophy. 279:25805–25812. J. Cell Biol. 147:913–920. Hoger, T.H., G. Krohne, and W.W. Franke. 1988. Amino acid sequence and Sweet, R.M., and D. Eisenberg. 1983. Correlation of sequence hydrophobicities molecular characterization of murine lamin B as deduced from cDNA measures similarity in three-dimensional protein structure. J. Mol. Biol. clones. Eur. J. Cell Biol. 47:283–290. 171:479–488. Hoger, T.H., K. Zatloukal, I. Waizenegger, and G. Krohne. 1990. Character- Tusnady, G.E., and I. Simon. 2001. The HMMTOP transmembrane topology ization of a second highly conserved B-type lamin present in cells pre- prediction server. Bioinformatics. 17:849–850. viously thought to contain only a single B-type lamin. Chromosoma. Vorburger, K., G.T. Kitten, and E.A. Nigg. 1989. Modification of nuclear lamin 99:379–390. proteins by a mevalonic acid derivative occurs in reticulocyte lysates and Laemmli, U.K. 1970. Cleavage of structural proteins during assembly of the requires the cysteine residue of the C-terminal CXXM motif. EMBO J. head of bacteriophage T4. Nature. 227:680–685. 8:4007–4013. Lammerding, J., P.C. Schulze, T. Takahashi, S. Kozlov, T. Sullivan, R.D. Weber, K., U. Plessmann, and P. Traub. 1989. Maturation of nuclear lamin A Kamm, C.L. Stewart, and R.T. Lee. 2004. Lamin A/C deficiency causes involves a specific carboxy-terminal trimming, which removes the poly- defective nuclear mechanics and mechanotransduction. J. Clin. Invest. isoprenylation site from the precursor; implications for the structure of 113:370–378. the nuclear lamina. FEBS Lett. 257:411–414. Lee, K.K., D. Starr, M. Cohen, J. Liu, M. Han, K.L. Wilson, and Y. Gruenbaum. Welte, M.A., S.P. Gross, M. Postner, S.M. Block, and E.F. Wieschaus. 1998. 2002. Lamin-dependent localization of UNC-84, a protein required for nu- Developmental regulation of vesicle transport in Drosophila embryos: clear migration in Caenorhabditis elegans. Mol. Biol. Cell. 13:892–901. forces and kinetics. Cell. 92:547–557. Libotte, T., H. Zaim, S. Abraham, V.C. Padmakumar, M. Schneider, W. Lu, M. Zhang, Q., J.N. Skepper, F. Yang, J.D. Davies, L. Hegyi, R.G. Roberts, P.L. Munck, C. Hutchison, M. Wehnert, B. Fahrenkrog, et al. 2005. Lamin A/C- Weissberg, J.A. Ellis, and C.M. Shanahan. 2001. Nesprins: a novel fam- dependent localization of Nesprin-2, a giant scaffolder at the nuclear en- ily of spectrin-repeat-containing proteins that localize to the nuclear velope. Mol. Biol. Cell. 16:3411–3424. membrane in multiple tissues. J. Cell Sci. 114:4485–4498. Lin, F., and H.J. Worman. 1993. Structural organization of the human gene encod- Zhang, Q., C.D. Ragnauth, J.N. Skepper, N.F. Worth, D.T. Warren, R.G. Roberts, ing nuclear lamin A and nuclear lamin C. J. Biol. Chem. 268:16321–16326. P.L. Weissberg, J.A. Ellis, and C.M. Shanahan. 2005. Nesprin-2 is a multi- Lin, F., and H.J. Worman. 1995. Structural organization of the human gene isomeric protein that binds lamin and emerin at the nuclear envelope and (LMNB1) encoding nuclear lamin B1. Genomics. 27:230–236. forms a subcellular network in skeletal muscle. J. Cell Sci. 118:673–687. Malone, C.J., L. Misner, N. Le Bot, M.C. Tsai, J.M. Campbell, J. Ahringer, Zhen, Y.Y., T. Libotte, M. Munck, A.A. Noegel, and E. Korenbaum. 2002. NU- and J.G. White. 2003. The C. elegans hook protein, ZYG-12, mediates ANCE, a giant protein connecting the nucleus and actin cytoskeleton. the essential attachment between the centrosome and nucleus. Cell. J. Cell Sci. 115:3207–3222. 115:825–836. Maniotis, A.J., C.S. Chen, and D.E. Ingber. 1997. Demonstration of mechanical connections between integrins, cytoskeletal filaments, and nucleoplasm that stabilize nuclear structure. Proc. Natl. Acad. Sci. USA. 94:849–854. Mislow, J.M., M.S. Kim, D.B. Davis, and E.M. McNally. 2002. Myne-1, a spec- trin repeat transmembrane protein of the myocyte inner nuclear mem- brane, interacts with lamin A/C. J. Cell Sci. 115:61–70. Mosley-Bishop, K.L., Q. Li, L. Patterson, and J.A. Fischer. 1999. Molecular analysis of the klarsicht gene and its role in nuclear migration within dif- ferentiating cells of the Drosophila eye. Curr. Biol. 9:1211–1220. Ohba, T., E.C. Schirmer, T. Nishimoto, and L. Gerace. 2004. Energy- and tem- perature-dependent transport of integral proteins to the inner nuclear membrane via the nuclear pore. J. Cell Biol. 167:1051–1062. SUN–NESPRIN INTERACTIONS • CRISP ET AL. 53

Journal

The Journal of Cell Biology – Pubmed Central

Published: Jan 2, 2006

There are no references for this article.