Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Regulation of Chemerin Bioactivity by Plasma Carboxypeptidase N, Carboxypeptidase B (Activated Thrombin-activable Fibrinolysis Inhibitor), and Platelets

Regulation of Chemerin Bioactivity by Plasma Carboxypeptidase N, Carboxypeptidase B (Activated... THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 2, pp. 751–758, January 9, 2009 Author’s Choice Printed in the U.S.A. Regulation of Chemerin Bioactivity by Plasma Carboxypeptidase N, Carboxypeptidase B (Activated Thrombin-activable Fibrinolysis Inhibitor), and Platelets Received for publication, July 1, 2008, and in revised form, November 12, 2008 Published, JBC Papers in Press, November 14, 2008, DOI 10.1074/jbc.M805000200 ‡ §¶ ‡1   ‡ Xiao-Yan Du , Brian A. Zabel , Timothy Myles , Samantha J. Allen , Tracy M. Handel , Peter P. Lee , §¶ ‡¶2 Eugene C. Butcher , and Lawrence L. Leung ‡ § From the Division of Hematology and the Department of Pathology, Stanford University School of Medicine, Stanford, California 94305, the Veterans Affairs Palo Alto Health Care System, Palo Alto, CA 94304, and the Skaggs School of Pharmacy and Pharmaceutical Sciences, University of California, San Diego, La Jolla, California 92093 Chemerin is a potent chemoattractant for cells expressing the (CMKLR1, also named ChemR23) is a G protein-coupled serpentine receptor CMKLR1 (chemokine-like receptor 1), such receptor specifically expressed by circulating human plasmacy- as plasmacytoid dendritic cells and tissue macrophages. The toid dendritic cells, natural killer cells, and tissue macrophages bioactivity of chemerin is post-translationally regulated; the (1–5). In their capacity as antigen-presenting cells, plasmacy- attractant circulates in blood in a relatively inactive form toid dendritic cells and macrophages can influence the activa- (prochemerin) and is activated by carboxyl-terminal proteolytic tion of many other cell types, including monocytes, myeloid cleavage. We discovered that plasma carboxypeptidase N (CPN) dendritic cells, B cells, T cells, and natural killer cells; thus and B (CPB or activated thrombin-activable fibrinolysis inhibi- chemerin appears to be an important chemoattractant in both tor, TAFIa) enhanced the bioactivity of 10-mer chemerin pep- innate and adaptive immune responses (2, 6, 7). tide NH -YFPGQFAFSK-COOH by removing the carboxyl-ter- Chemerin circulates in blood in an inactive prochemerin minal lysine (K). Sequential cleavages of either a prochemerin form at low nanomolar concentrations (3nM) (4). Its chemo- peptide (NH -YFPGQFAFSKALPRS-COOH) or recombinant tactic activity is released following proteolytic cleavage of its full-length prochemerin by plasmin and CPN/CPB substantially carboxyl-terminal amino acids by serine proteases of the coag- increased their chemotactic activities. Endogenous CPN pres- ulation, fibrinolytic, and inflammatory cascades (4, 8). These ent in circulating plasma enhanced the activity of plasmin- include factor XIIa, VIIa, plasmin, neutrophil elastase, and mast cleaved prochemerin. In addition, we discovered that platelets cell tryptase. Of interest, staphopain B, a cysteine protease store chemerin protein and release it upon stimulation. Thus secreted by Staphylococcus aureus, also cleaves prochemerin circulating CPN/CPB and platelets may potentially contribute and converts it into a potent chemoattractant (9). Interestingly, to regulating the bioactivity of leukocyte chemoattractant the cleavage sites in the labile carboxyl terminus (NH -YFPGQ- chemerin, and further extend the molecular link between blood FAFSKALPRS-COOH) are not conserved, and the cleavage coagulation/fibrinolysis and CMKLR1-mediated immune products generated by chemerin-activating proteases display responses. different potencies in bioactivity assays. Based on synthetic peptides, the 9-mer NH -YFPGQFAFS-COOH is the most active, but it is still not as active as intact cleaved chemerin protein, indicating that the amino-terminal part of chemerin is Chemerin is a recently discovered chemoattractant molecule required for maximal activity (4, 10). that is predicted to share structural similarity with cystatins Plasma carboxypeptidases CPN and CPB cleave the basic (cysteine protease inhibitors) and cathelicidin precursors (anti- amino acids arginine or lysine from the carboxyl terminus of bacterial peptides) (1). Chemerin is present in circulating blood proteins or peptides such as bradykinin and complement pro- and several human inflammatory fluids (1). Even though teins C3a and C5a. CPN is a constitutively active zinc metallo- chemerin is not similar to CXC and CC chemokines based on protease present in plasma at a concentration of about 100 nM primary amino acid sequence, it functions like a chemokine in and is considered the major anaphylatoxins inhibitor (11), gen- that it induces leukocyte migration and intracellular calcium erating inactive “desArg” forms of C3a and C5a. In contrast, mobilization. Chemerin receptor chemokine-like receptor 1 CPB exists in plasma as a proenzyme, proCPB, or thrombin- activable fibrinolysis inhibitor (TAFI) at a concentration of * This work was supported, in whole or in part, by National Institutes of Health Grants RO1 HL57530 (to L. L.) and AI59625, AI057229, and DK56339 (to E. B.). The costs of publication of this article were defrayed in part by the The abbreviations used are: CMKLR1, chemokine-like receptor 1; CPN, car- payment of page charges. This article must therefore be hereby marked boxypeptidase N; CPB, carboxypeptidase B; TAFI, thrombin-activable “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indi- fibrinolysis inhibitor; MGTA, DL-2-mercaptomethyl-3 guanidinoethylthio- cate this fact. propanoic acid; PPACK, D-phenylalanyl-L-prolyl-L-arginine chloromethyl Author’s Choice—Final version full access. ketone; HPLC, high performance liquid chromatography; PRP, platelet-rich Present address: Maxygen Inc., 515 Galveston Dr., Redwood City, CA 94063. plasma; PIPES, piperazine-N,N-bis(2-ethanesulfonic acid); RT, reverse tran- To whom corresponding should be addressed: VA Palo Alto Health Care scription; ELISA, enzyme-linked immunosorbent assay; MALDI-TOF, System, 3801 Miranda Ave. (11), Palo Alto, CA 94304. Fax: 650-736-0974; matrix-assisted laser desorption ionization time-of-flight; PPP, platelet- E-mail: [email protected]. poor plasma. JANUARY 9, 2009• VOLUME 284 • NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 751 This is an Open Access article under the CC BY license. CPN, CPB, and Platelets Regulate Chemerin Activity about 50 nM and is activated by thrombin in complex with serum albumin were from Sigma. Human soluble thrombo- thrombomodulin on the vascular endothelial surface. CPB modulin and recombinant CPN were kind gifts from Drs. John inhibits fibrin degradation by removing carboxyl-terminal lysines Moser and Mariko Nagashima (Berlex Biosciences, Richmond, from partially digested fibrin, which prevents further incorpora- CA). Hep3B and MEG-01 cells were from the American Type tion of fibrinolytic plasminogen and tissue plasminogen activator Culture Collection. (12, 13). CPB is thermolabile and has a half-life of15 min at 37 °C Preparation of Recombinant Prochemerin—Recombinant (14). We have shown that CPB also has broad substrate reactivity prochemerin was purified as previously published (8). Briefly, and is able to cleave and inactivate bradykinin, C3a, C5a, and prochemerin with a carboxyl-terminal His tag was cloned into thrombin-cleaved osteopontin (15–17). CPN and CPB may play pACGP67 (BD Biosciences) and transfected into Sf-9 cells. The complementary roles, with the former being constitutively active mature prochemerin protein has the amino acid sequence and capable of regulating systemic anaphylatoxins, and the latter NH -ADPELTEAQ…FAFSKALPRSPHHHHHH-COOH, where activated locally at sites of vascular injury to provide site-specific the underlined residues are not native. After viral amplification, anti-inflammatory control. Peptidases can also modulate the bio- prochemerin was expressed by adding high titer virus to logical activity of certain chemokines (4). For example, dipeptidyl shaker flasks containing Hi-5 insect cells in Ex-cell 420 peptidase (DPP-IV/CD26), a serine protease, inactivates CXCL9, medium (JRH Biosciences). After incubation for 2–3 days at CXCL10, CXCL11, and CXCL12 by cleaving these chemokines in 27.5 °C, the supernatant was harvested by centrifugation, fil- the amino terminus (18, 19). tered to 0.22 M, and concentrated at 4 °C using a tangential Platelets store a variety of potent cytokines and chemokines flow concentrator with a 3-kDa cut-off filter (Filtron). within -granules that are released upon cell activation. Platelet Prochemerin was purified by nickel-Sepharose affinity chro- degranulation products, particularly the leukocyte chemoat- matography (American Biosciences) and C-18 reverse phase tractants, which include CXCL4 (platelet factor 4), -thrombo- HPLC (Vydac). The protein was lyophilized and checked for globulin, CCL5 (RANTES), CCL7 (monocyte chemotactic pro- purity using electrospray mass spectrometry. tein 3), and CXCL12 (stromal-derived factor 1), may contribute Tissue Culture—Murine pre-B lymphoma L1.2 cells were to host defense and also play a role in pathophysiologic condi- stably transfected with human CMKLR1 or empty vector tions (20, 21). For example, platelet factor 4 forms complexes pcDNA3 (Invitrogen) and maintained in RPMI 1640 medium with heparin in blood or some glycosaminoglycans on platelet supplemented with 10% fetal bovine serum and 1 mg/ml gene- surfaces to form the major antigen implicated in heparin-in- ticin (Invitrogen). duced thrombocytopenia (22, 23). Platelets not only store In Vitro Transwell Chemotaxis Assay—24-well plates with CXCL12 but also express its receptor CXCR4, a coreceptor for 5-m pore size Transwell inserts (Costar) were used for the cellular entry of human immunodeficiency virus, type 1, sug- chemotaxis assays. 200 l of cells (10 cells/ml) in 0.3% bovine gesting that platelets may be involved in host defense (24). serum albumin/Hank’s solution were added to the top well, and In this study, we found that plasma CPN or CPB can function test samples were added to the bottom well in 500 l of solu- in concert with plasmin to elicit and augment the chemotactic tion. The cells that migrated to the lower chamber after3hat activity of prochemerin. Furthermore, we show that platelets 37 °C were counted by flow cytometry, and the results are could store and release partially active chemerin upon activa- reported as cells/ml in the lower chamber. tion. Thus circulating CPN/CPB and platelets may contribute Preparation of Platelet-rich Plasma, Platelet-poor Plasma, to regulating the bioactivity of leukocyte chemoattractant Washed Platelets, and Platelet Lysates—Blood was drawn into chemerin and further extend the molecular link between blood tubes containing 3.8% sodium citrate (9:1 v/v) and platelet-rich coagulation/fibrinolysis and CMKLR1-mediated immune plasma (PRP) prepared following standard procedure (25). responses. Platelet-poor plasma was prepared by spinning the PRP at 1200  g for 10 min at room temperature. The platelets were EXPERIMENTAL PROCEDURES washed with PIPES buffer (25 mM PIPES, 137 mM NaCl, 4 mM 21–157 Materials—Recombinant human chemerin , polyclonal KCl, and 0.1% glucose) at pH 6.4 as previously described (25). goat anti-human chemerin antibodies, and biotinylated poly- Platelet lysates were obtained by lysing washed platelets with clonal goat anti-human antibodies were from R & D radioimmune precipitation assay lysis buffer (Upstate, NY) Systems (Minneapolis, MN). Peptides 9-mer, YFPGQFAFS with protease inhibitors. The mixture was spun at 10,000  g, 149–157 149–158 (chemerin ); 10-mer, YFPGQFAFSK (chemerin ); and the supernatant protein concentration was determined by 149–163 and 15-mer, YFPGQFAFSKALPRS (chemerin ) were Bradford protein assay. synthesized by Elim Biopharmaceuticals (Hayward, CA). Reverse Transcription (RT)-PCR—Total RNA was prepared Human plasmin and -thrombin were purchased from Hema- from human washed platelets and Hep3B and MEG-01 cells by tologic Technologies (Essex Junction, VT). DL-2-Mercaptom- using TRIzol reagent. Total RNA (1 g) was converted to ethyl-3 guanidinoethylthiopropanoic acid (MGTA) was cDNAs using the oligo(dT) primer and Superscript II enzyme obtained from Calbiochem (La Jolla, CA). Collagen and ADP (Invitrogen). The specific primers used for cloning a 229-bp were from Chrono-log (Havertown, PA). Human plasma-de- chemerin fragment were GAAGAAACCCGAGTGCAAAG rived CPB (TAFIa) and a CPB activity kit were from American (forward) and CTTGGAGAAGGCGAACTGTC (reverse) (the Diagnostica (Stamford, CT). Thrombin receptor-activating annealing temperature was 57 °C, 35 cycles). peptide (SFLLRN peptide), D-phenylalanyl-L-prolyl-L-arginine HPLC Analysis of Chemerin Peptides Cleavage—To evaluate chloromethyl ketone (PPACK), heparin-agarose, and bovine the efficiency of synthetic chemerin 10-mer cleavage by CPN or 752 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 2 •JANUARY 9, 2009 CPN, CPB, and Platelets Regulate Chemerin Activity CPB, 50 l of 10-mer (1 M) was treated with either CPN or CPB (30 nM) for 30 min at 37 °C, and the reaction mixtures were loaded onto a Waters C18 (4.6  150 mm) column and sepa- rated with a 0–35% acetonitrile gradient in 0.1% trifluoroacetic acid (v/v) by HPLC. For 15-mer cleavage, 15-mer (1 M) was incubated with plasmin (1 M) at 37° for 30 min; the reaction was then terminated by PPACK (serine protease inhibitor) (10 M). CPN or CPB (30 nM) was added and incubated for 30 min at 37 °C. 40 l of each reaction mixture (15-mer, 15-mer plus plasmin, 15-mer plus plasmin and CPN/CPB) was analyzed by reverse phase HPLC as described above. Kinetic Analysis of Hydrolysis of 10-mer Chemerin Peptides by CPB and CPN—Michaelis-Menten kinetics was used to determine the K and k for the hydrolysis of 10-mer peptide m cat (YFPGQFAFSK) by CPB and CPN. The concentrations of 10-mer peptides ranged from 20 to 320 M and were digested with 50 nM CPB or 5 nM CPN for 5 min at 37 °C in assay buffer. The reactions were stopped by boiling for 5 min. Cleaved pep- tide was resolved by HPLC, and the nmol of peptide generated was determined from the peak area of cleaved peptide. The values for K and k were determined by plotting the initial m cat velocities of cleavage against the different substrate concentra- tions and then fitting to the Michaelis-Menten equation by nonlinear regression analysis as previously described (15). The experiments were performed in duplicate, and the data were pooled for analysis. CPB Activity Assays—100 l of CPN (10 nM) and CPB (15 nM) were added to a 96-well plate in the presence or absence of MGTA at the indicated concentrations. 50 l of chromogenic CPB (TAFIa) substrate was used in each well as described in the Actichrome CPB kit. Activated CPB (TAFIa) ranging from 0.125 to 2 g/ml was used to construct the standard curve. All of the tests were performed in duplicate. The plate was placed in an ELISA plate reader at 37 °C with constant mixing, and the absorbance at 420 nm was read 30 min after sample addition. Development of Sandwich ELISA for Chemerin—Polyclonal goat anti-human chemerin antibodies were used to coat 96-well plates at a concentration of 4 g/ml. Biotinylated polyclonal goat anti-human chemerin antibodies (0.2 g/ml) and horse- radish peroxidase-labeled streptavidin was used to detect bound chemerin protein. The lower limit of detection of chemerin in this assay was 0.5 ng/ml. For the determination of chemerin levels in plasma, the samples were diluted 10-fold before assay. Mass Spectrometry—MALDI-TOF mass spectrometry was performed by the Stanford Protein and Nucleic Acid Core Facility. FIGURE 1. CPN and CPB up-regulate chemerin 10-mer activity by remov- ing the carboxyl-terminal lysine. A and B, in vitro transwell chemotaxis of Statistical Analyses—The data are expressed as the means CMKLR1/L1.2 transfectants to synthetic 9- and 10-mer chemerin peptides (A) S.D., and statistical evaluation was performed using Student’s t and to CPN (30 nM) or CPB (30 nM)-treated 10-mer peptides at 37 °C for 30 min (B). The results represent one of three independent experiments and are test. Differences were considered to be significant when p expressed as the means  S.D. (n  3). C, HPLC analysis of the chemerin 0.05 (*) or 0.005 (**). 10-mer cleavage products generated by CPN and CPB. 50 l of 10-mer (1 M) was treated with either CPN or CPB (30 nM) for 30 min at 37 °C, and the reac- RESULTS tion mixtures were separated by HPLC. CPN and CPB Up-regulate Chemerin 10-mer Activity by Removing the Carboxyl-terminal Lysine Residue—The syn- occurring at 10–100 nM. Empty vector transfected controls did 149–157 thetic 9-mer chemerin peptide YFPGQFAFS (chemerin ) not migrate to the 9-mer (data not shown), The 10-mer peptide 149–158 induced substantial, dose-dependent migration of human YFPGQFAFSK (chemerin ) did not induce any signifi- CMKLR1-L1.2 transfectants (Fig. 1A) with a peak response cant CMKLR1-dependent chemotaxis even at 10 M concen- JANUARY 9, 2009• VOLUME 284 • NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 753 CPN, CPB, and Platelets Regulate Chemerin Activity TABLE 1 Hydrolysis of chemerin 10-mer peptides by CPB and CPN Chemerin peptides ranging from 20 to 320 M were digested with CPB or CPN as described under “Experimental Procedures.” The values for K , k , and k /K m cat cat m were compared with those obtained from CPB and CPN cleavages of peptides derived from bradykinin, C5a, C3a, and fibrinopeptides (FB) , , and  (15). Substrate Enzyme K k k /K m cat cat m 1 1 1 M s M s Chemerin CPB 122.8  6.4 2.7  0.1 2.2  10 Bradykinin CPB 70.6  4.8 19.7  4.8 2.8  10 66–74 5 C5a CPB 219.0  16.2 29.5  0.7 1.3  10 69–77 5 C3a CPB 35.9  6.6 8.4  0.6 2.3  10 96–104 3 FB-Arg CPB 361.4  69.2 1.5  0.1 4.2  10 125–133 5 FB-Lys CPB 14.3  0.7 13.6  0.2 9.5  10 54–62 4 FB-Lys CPB 34.0  4.1 2.6  0.1 7.6  10 77–85 4 FB-Lys CPB 238.9  24.2 5.9  0.3 2.5  10 Chemerin CPN 170.6  27.2 80.35  5.0 4.7  10 Bradykinin CPN 302.7  29.1 9.1  0.2 3.0  10 66–74 4 C5a CPN 602.2  74.3 9.3  0.4 1.5  10 69–77 5 C3a CPN 77.1  11.2 57.9  2.1 7.5  10 96–104 3 FB-Arg CPN 448.9  43.8 2.9  0.1 6.5  10 125–133 6 FB-Lys CPN 53.2  4.9 109.1  3.6 2.1  10 54–62 3 FB-Lys CPN 657.6  20.5 3.5  0.1 5.3  10 77–85 3 FB-Lys CPN 3727.0  408.6 11.8  0.8 3.2  10 tration (Fig. 1A). Treatment of the 10-mer peptide with CPN or CPB, however, substantially enhanced the chemotactic activity of the peptide (Fig. 1B). CPN and CPB alone (tested at 100 nM) did not induce CMKLR1/L1.2 transfectant migration (Fig. 1B). FIGURE 2. Sequential proteolysis of prochemerin 15-mer by plasmin and We analyzed the mixtures of 10-mer treated with either CPN or carboxypeptidases generates bioactive chemerin 9-mer. A, in vitro tran- swell chemotaxis of CMKLR1/L1.2 cells to prochemerin 15-mer in the pres- CPB by HPLC and found that the 10-mer/CPN mixture had a ence or absence of plasmin, CPB or CPN. 15-mer peptide (1M) was incubated major peak with a retention time of 28.25 min, which is almost with plasmin (1 M) at 37 °C for 30 min; the reaction was then terminated by PPACK (10 M). CPN or CPB (30 nM) was added and incubated for 30 min at identical to that of the purified 9-mer (28.26 min), and different 37 °C. The final concentration of 15-mer used for the assay was 100 nM. The from the 10-mer (25.90 min). For the 10-mer treated with CPB, results represent one of three independent experiments and are expressed as we detected two major fractions corresponding to the 10-mer the means  S.D. (n  3). **, p  0.005. B, HPLC analysis of prochemerin 15-mer cleavage by plasmin, plasmin/CPN, or plasmin/CPB. (25.90 min) and 9-mer (28.28 min) (Fig. 1C). The efficiency of 10-mer cleavage by CPB at 30 nM was about 60%, likely because CPB is thermolabile under the experimental conditions used. In (retention time: 25.3 min; the peak with the retention time at this work, CPN was also used at 30 nM to compare with CPB 12.4 min is the carboxyl-terminal plasmin-generated 5-mer). enzymatic activity. Of note, the plasma levels of proCPB and CPN or CPB then converted the 10-mer to the 9-mer (retention CPN are 50 and 100 nM, respectively (11, 14). time, 27.6 min) (Fig. 2B). Determination of the Kinetic Parameters for the Hydrolysis of Sequential Proteolysis of Prochemerin by Plasmin and Car- 149–158 10-mer Peptide (Chemerin ) by CPB and CPN—The boxypeptidases Synergistically Enhances Bioactivity—We next 149–158 hydrolysis of chemerin by CPB gave estimates for K asked whether sequential treatment of chemotactically inert 1 4 1 (122.8 6.4 M), k (2.7 0.1 s ), and k /K (2.2 10 M concentrations of prochemerin by plasmin and CPN or CPB cat cat m 1 149–158 s ) (Table 1). The concentrations of chemerin ranged could activate the attractant and generate the NH -YFPGQ- from 20 to 320 M, and chemerin was digested with 50 nM CPB. FAFS-COOH form. Plasmin alone cleaved prochemerin and The k /K for chemerin cleavage was about 10-fold less effi- increased its chemotactic bioactivity (Fig. 3A). Sequential treat- cat m 66–74 69–77 cient compared with bradykinin and C5a , C3a but ment of prochemerin with plasmin and CPN or CPB, however, 77–85 comparable with fibrinopeptide -Lys . Meanwhile, the dramatically enhanced its chemotactic activity (Fig. 3B). The 5 1 1 k /K of 10-mer cleavage by CPN is 4.7  10 M s , which proteolytic products were evaluated by mass spectrometry to cat m is about 20-fold faster than CPB, and is about 20-fold faster than determine the processing sites (Fig. 3C). Plasmin first cleaved bradykinin and C5a peptide but similar to that of C3a peptide. prochemerin (17730.12 Da) to the NH -YFPGQFAFSK- Sequential Proteolysis of Prochemerin 15-mer Peptide by COOH form (16301.13 Da), and then CPN or CPB removed the Plasmin and Carboxypeptidases Synergistically Enhances terminal lysine to generate a desLys form (16156.22/16156.36 Bioactivity—The synthetic chemerin 15-mer peptide, YFPGQ- Da) with enhanced activity. Prochemerin treated with CPN and 149–163 FAFSKALPRS (chemerin ) is chemotactically inert (Fig. CPB alone did not induce CMKLR1-mediated chemotaxis 2A). Treatment of the 15-mer with CPN or CPB alone had no (data not shown). effect on chemerin bioactivity. However, sequential treatment Endogenous Plasma CPN Is Critical for the Increased Activity of the 15-mer with plasmin and CPN or CPB dramatically of Plasmin-cleaved Prochemerin—Prochemerin was incubated enhanced its chemotactic activity. The proteolytic products with plasmin and then treated with PPACK to inhibit serine were evaluated by HPLC to determine processing sites. Plasmin protease activity. Plasmin-treated prochemerin was added to first cleaved the 15-mer (retention time, 29.96 min) to 10-mer normal platelet-poor plasma (PPP) as well as PPP treated with 754 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 2 •JANUARY 9, 2009 CPN, CPB, and Platelets Regulate Chemerin Activity FIGURE 4. Endogenous plasma CPN increases the bioactivity of plasmin- cleaved prochemerin. A, MGTA specifically inhibits CPN but not CPB. 1 g/ml of either CPN or CPB was used. B, in vitro transwell chemotaxis of CMKLR1/L1.2 cells to plasmin-treated full-length recombinant prochemerin protein, prochemerin/plasmin/PPP, or prochemerin/plasmin/PPP treated with the CPN inhibitor MGTA (5 M). Prochemerin was treated with plasmin (1 FIGURE 3. Sequential proteolysis of prochemerin protein by plasmin and M) at 37 °C for 30 min, and the reaction was stopped by PPACK (10 M). PPP carboxypeptidases generates a potent chemerin isoform. A, dose-re- or PPP/MGTA was added to plasmin cleaved prochemerin. The final concen- sponse curve of prochemerin activation by plasmin assayed by CMKLR1/L1.2 tration of treated prochemerin was 0.2 nM. The results represent one of three cells chemotaxis. B, in vitro transwell chemotaxis of CMKLR1/L1.2 cells to full- independent experiments and are expressed as the means  S.D. (n  3). **, length recombinant prochemerin protein, prochemerin/plasmin, p  0.005. prochemerin/plasmin/CPN, or CPB. The final concentration of chemerin used for the assay was 0.5 nM. The results represent one of three independent (hepatic carcinoma cell line) and MEG-01 (megakaryotic cell experiments and are expressed as the means  S.D. (n  3). **, p  0.005. C, MALDI-TOF mass spectrometry analysis of prochemerin cleavage by plas- line) cells (Fig. 5B). Identity of the amplified chemerin PCR min, plasmin/CPN, or plasmin/CPB. The concentrations of plasmin, CPN, and product was confirmed by direct sequencing. CPB used in B and C were 1 M,30nM, and 30 nM, respectively. Platelets Release Chemerin upon Activation—As quantified by ELISA, the concentration of chemerin in PRP was 48  1.1 MGTA, a specific inhibitor for CPN but not CPB (Fig. 4A). ng/ml. The addition of thrombin (5 units/ml) to PRP increased Plasmin-cleaved prochemerin did not induce CMKLR1-medi- the chemerin level to 78  0.7 ng/ml (p  0.005) (Fig. 6A). The ated chemotaxis (Fig. 4B). Incubation with PPP, however, dra- addition of thrombin to PPP, on the other hand, had no effect matically increased its bioactivity, which was inhibited by on chemerin activities (Fig. 6B). Thrombin itself did not induce MGTA, indicating that endogenous plasma CPN is critical for the chemotaxis of CMKLR1-transfected cells, and thrombin activating low concentrations of plasmin-cleaved chemerin does not cleave and activate prochemein (8). Thus we conclude (Fig. 4B). that the increased chemerin bioactivity in thrombin-treated Identification of Chemerin in Platelet—Platelets store various PRP was not due to proteolysis of circulating plasma coagulation proteins as well as inflammatory factors. To deter- prochemerin by thrombin but rather was dependent on the mine whether platelets are also involved in chemerin expres- release of chemerin from platelets following thrombin activa- sion, Western blot analysis and RT-PCR were performed. tion. Furthermore, platelet-activating agonists such as throm- Chemerin was detected by Western blot in total platelet lysates, bin receptor-activating peptide, collagen, and, to a lesser extent, with a molecular mass of 16 kDa, similar to recombinant ADP induced the release of chemerin from washed platelets 21–157 chemerin (Fig. 5A). Although platelets are anuclear, long (Fig. 6C), which corresponded with an increase in chemerin lived mRNAs are present in the cytosol, including messages for bioactivity as determined by CMKLR1 transfectant migration certain chemokines (26). We detected chemerin mRNA in (Fig. 6D). platelets by RT-PCR. An expected 229-bp PCR product was We next investigated whether the chemerin released from amplified from cDNAs of platelets, as well as from Hep3B activated platelets is a prochemerin form or an active isoform. JANUARY 9, 2009• VOLUME 284 • NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 755 CPN, CPB, and Platelets Regulate Chemerin Activity FIGURE 5. Platelets contain chemerin mRNA and protein. A, Western blot analysis of chemerin in platelet lysates. B, RT-PCR analysis of chemerin mes- sage in various cell lines and platelets. 21–157 The same amount of prochemerin and active chemerin were used as controls for platelet-derived chemerin (as quanti- fied by ELISA) in transwell assays using CMKLR1/L1.2 trans- fectants. Chemerin activity released from activated platelets is higher than prochemerin but substantially less active than 21–157 chemerin (Fig. 7A). The specific response of platelet-de- rived chemerin to CMKLR1 transfectants was confirmed in the chemotaxis assay using nontransfected cells as controls (Fig. 7B). This suggested that platelets might release chemerin in a partially active form, or platelet-derived chemerin is a mixture of different forms of chemerin, which probably could undergo further proteolysis to fully express its biological activities. With the addition of plasmin/CPB or plasmin/CPN to platelet releas- ates, no enhanced chemerin activities were observed, which is likely due to the presence of various plasmin inhibitors, includ- ing  -antiplasmin, which is known to be released from acti- vated platelets (27) (data not shown). When platelet-derived chemerins were partially purified by heparin-agarose chroma- tography as previously described (8), a significantly increased chemerin activity was detected after adding plasmin, plasmin/ CPB, and plasmin/CPN (Fig. 7C). Interestingly, chemerin activ- ity was also enhanced even in the presence of CPN or CPB alone (Fig. 7C), indicating that at least a portion of the chemerins released from activated platelets has been already cleaved to a form that is accessible to CPN or CPB cleavage. DISCUSSION In this study, we report that plasma-derived CPN and CPB substantially up-regulated the bioactivity of plasmin-cleaved FIGURE 6. Platelets release chemerin upon activation. A, ELISA quantifica- prochemerin via the removal of the carboxyl-terminal lysine tion of total chemerin present in resting and thrombin (5 units/ml) activated residue, adding a novel mechanism to prochemerin processing PRP. B, in vitro transwell chemotaxis of CMKLR1/L1.2 cells to PRP, and PRP/ and activation by proteases (Table 2). We demonstrated this in thrombin (5 units/ml), PPP, and PPP/thrombin (5 units/ml). Thrombin at 5 units/ml was added to PRP or PPP at 37 °C for 5 min. C and D, identification of three different in vitro scenarios: 1) CPN and CPB removed the chemerin in washed platelet lysates by Western blot analysis (C)or in vitro carboxyl-terminal lysine from a 10-mer chemerin peptide and transwell chemotaxis of CMKLR1/L1.2 cells (D). The platelets were treated with the indicated platelet-activating agonists at 37 °C for 3 min: thrombin converted it to a bioactive 9-mer; 2) plasmin cleaved receptor-activating peptide (20 M), thrombin (5 units/ml), collagen (10 prochemerin 15-mer to 10-mer, which was subsequently con- g/ml), and ADP (10 M). 200 l of platelet releasates were tested in chemo- verted to the bioactive 9-mer by CPN or CPB; and 3) sequential taxis assays. The results represent one of three independent experiments and are expressed as the means  S.D. (n  3). **, p  0.005. proteolysis of recombinant prochemerin protein by plasmin followed by CPN or CPB generated a chemerin isoform with 756 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 2 •JANUARY 9, 2009 CPN, CPB, and Platelets Regulate Chemerin Activity TABLE 2 Prochemerin cleavages by various proteases Shown is a summary of prochemerin cleavages by various proteases. ND, not determined. Protease C-terminal sequence Amino acid order Unprocessed . . . YFPGQFAFSKALPRS 21–163 Plasmin/CPB . . . YFPGQFAFS 21–157 Plasmin/CPN . . . YFPGQFAFS 21–157 Plasmin . . . YFPGQFAFSK 21–158 Elastase . . . YFPGQFAFS 21–157 . . . YFPGQFA 21–155 . . . YFPG 21–152 Tryptase . . . YFPGQFAFSK 21–158 . . . YFPGQFA 21–155 Cathepsin G . . . YFPGQFAF 21–156 Staphopain B . . . YFPGQFAFS 21–157 FVIIa ND FXIIa ND kines at the post-translational level (1). These enzymes are par- ticularly adept at modifying chemokines to dampen immune responses. For example, CCL7 is a physiological substrate of matrix metalloproteinase 2; matrix metalloproteinase 2-cleaved CCL7 acts as a general chemokine antagonist by binding to but not activating the CC-chemokine receptors-1, -2, and -3, thereby blocking leukocyte recruitment and damp- ening inflammation (28). Carboxypeptidases CPN and CPB are well known for their ability to inactivate a number of pro-in- flammatory mediators including C5a, C3a, bradykinin, and thrombin-cleaved osteopontin (15–17). In the case of plasmin- cleaved prochemerin, CPN/CPB enhances, rather than dimin- ishes, the chemotactic activity of the attractant under the cur- rent experimental conditions. Cells that are chemerin-responsive include plasmacytoid dendritic cells and macrophages, leukocytes capable of func- tioning as “immune interpreters”; in the absence of “danger signals,” chemerin-recruited plasmacytoid dendritic cell and macrophages may play an immune suppressive role, dampen- ing inflammation through interleukin-10 and transforming growth factor  secretion and regulating T cell responses. Thus FIGURE 7. Bioactivity of platelet-derived chemerin. A, comparison of che- CPN/CPB may serve to dampen inflammatory responses by motactic activity of chemerin released from activated platelets, prochemerin, 21–157 and the active form chemerin . B, the specific chemotactic response of inactivating anaphylatoxins and by recruiting immune sup- platelet-derived chemerin to CMKLR1/L1.2 transfectants. C, proteolytic regu- pressive CMKLR1-positive leukocytes to sites of sterile tissue lation of platelet-derived chemerin bioactivity. Platelet-derived chemerin injury. was partially purified by heparin affinity chromatography (8). Fractions con- taining chemerin were eluted with 0.6 M of NaCl. The concentration of The regulation of chemerin bioactivity at a site of tissue chemerin was quantitated by ELISA. The conditions of platelet-derived injury in vivo appears to involve a complex interplay among chemerin treated with CPN, CPB, plasmin, plasmin/CPN, or plasmin/CPB were many enzymatic components. In our study, plasmin at 1 M identical to that in Fig. 3. The results represent one of three independent experiments and are expressed as the means S.D. (n 3). *, p 0.05; **, p efficiently cleaves prochemerin in vitro. Although this is a sub- 0.005. stantial concentration of plasmin, human platelets have well defined plasminogen binding sites, and these binding sites are potent chemoattractant activity (carboxyl-terminal sequence further increased by 5-fold upon platelet activation (29, 30). NH -YFPGQFAFS-COOH). These data show that CPN and In addition, it has been reported that thrombin stimulation spe- CPB generate a highly active “desLys” form of plasmin-cleaved cifically induces plasminogen activation that is mediated by chemerin. Interestingly, we also found that platelets can regu- endogenous urokinase-type plasminogen activator (31). Thus late chemerin bioactivity by storing and releasing it upon stim- given the substantial plasma concentration of plasminogen ulation. We have therefore identified additional circulating fac- (2.2 M), it is entirely plausible that prochemerin, upon tors (Table 2) that contribute to the regulation of chemerin release from activated platelets, will be efficiently cleaved to bioactivity and further link the processes of blood coagulation/ chemerin by plasmin generated locally at the site of vascular fibrinolysis with mediators that regulate leukocyte migration. inflammation in vivo. Plasmin-cleaved prochemerin can be fur- There is a growing appreciation for the role of extracellular ther activated by CPB and CPN. CPB is activated locally by matrix metalloproteinases and serine proteases such as DPP- endothelial cell bound thrombin/thrombomodulin and IV/CD26 and cathepsin G in regulating the activity of chemo- enhances the chemotactic activity of plasmin-cleaved JANUARY 9, 2009• VOLUME 284 • NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 757 CPN, CPB, and Platelets Regulate Chemerin Activity 3713–3720 prochemerin via removal of the carboxyl-terminal lysine. At the 10. Wittamer, V., Gre´goire, F., Robberecht, P., Vassart, G., Communi, D., and same time, CPB, in its role as a fibrinolysis inhibitor, blocks Parmentier, M. (2004) J. Biol. Chem. 279, 9956–9962 plasmin generation, which would diminish the initial activation 11. Matthews, K. W., Mueller-Ortiz, S. L., and Wetsel, R. A. (2004) Mol. Im- of circulating prochemerin. Thus CPB may limit the extent of munol. 40, 785–793 prochemerin activation but enhance the activity of the plasmin- 12. Redlitz, A., Tan, A. K., Eaton, D. L., and Plow, E. F. (1995) J. Clin. Investig. cleaved chemerin that has already been formed. Our study pro- 96, 2534–2538 vides further evidence that CPB functions not only as an inhib- 13. Bajzar, L., Morser, J., and Nesheim, M. (1996) J. Biol. Chem. 271, 16603–16608 itor of fibrinolysis, but also as a mediator of inflammatory 14. Ceresa, E., Van de Borne, K., Peeters, M., Lijnen, H. R., Declerck, P. J., and responses. CPB may be important for local and specific action Gils, A. (2006) J. Biol. Chem. 281, 15878–15883 at sites of tissue damage, whereas constitutively active CPN 15. Myles, T., Nishimura, T., Yun, T. H., and Leung, L. L. K. (2003) J. Biol. may regulate its targets systemically. Chem. 278, 51059–51067 Platelets are critical in maintaining normal hemostasis (32, 16. Nishimura, T., Myles, T., Piliponsky, A. M., Kao, P. N., Berry, G. J., and 33). Activated platelets release granular proteins that include Leung, L. L. K. (2007) Blood 109, 1992–1997 17. Myles, T., and Leung, L. L. (2008) J. Biol. Chem. 283, 17789–17796 platelet agonists, adhesive proteins, and chemoattractants at 18. Hildebrandt, M., and Schabath, R. (2008) Front. Biosci. 13, 1774–1779 the site of vascular injury, which may play a role in tissue 19. Gonzalez-Gronow, M., Kaczowka, S., Gawdi, G., and Pizzo, S. V. (2008) inflammation and remodeling (34–36). In our study, we found Front. Biosci. 13, 1610–1618 that platelets store chemerin. Upon activation, platelets release 20. Boehlen, F., and Clemetson, K. J. (2001) Transfus. Med. 11, 403–417 a mixture of chemerin isoforms with different levels of bioac- 21. Brandt, E., Ludwig, A., Petersen, F., and Flad, H. D. (2000) Immunol. Rev. tivity. Some of them would undergo further proteolysis to fully 177, 204–216 22. Warkentin, T. E., Chong, B. H., and Greinacher, A. (1998) Thromb. Hae- express its biological activity. Our future work will investigate mostasis 79, 1–7 the role of chemerin in platelet biology and tissue remodeling. 23. Cines, D. B., Rauova, L., Arpelly, G., Reilly, M. P., McKenzie, S. E., Sachais, REFERENCES B. S., and Poncz, M. (2007) J. Clin. Apher. 22, 31–36 24. Clemetson, K. J., Clemetson, J. M., Proudfoot, A. E., Power, C. A., Baggio- 1. Zabel, B. A., Zuniga, L., Ohyama, T., Allen, S. J., Cichy, J., Handel, T. M., lini, M., and Wells, T. N. (2000) Blood 96, 4046–4054 and Butcher, E. C. (2006) Exp. Hematol. 34, 1106–1114 25. Du, X. Y., Clemetson, J. M., Navdaev, A., Magnenat, E. M., Wells, T. N., 2. Zabel, B. A., Silverio, A. M., and Butcher, E. C. (2005) J. Immunol. 174, and Clemetson, K. J. (2002) J. Biol. Chem. 277, 35124–35132 244–251 26. Power, C. A., Clemetson, J. M., Clemetson, K. J., and Wells, T. N. (1995) 3. Wittamer, V., Franssen, J. D., Vulcano, M., Mirjolet, J. F., Le Poul, E., Cytokine 7, 479–482 Migeotte, I., Bre´zillon, S., Tyldesley, R., Blanpain, C., Detheux, M., Man- 27. Plow, E. F., and Collen, D. (1981) Blood 58, 1069–1074 tovani, A., Sozzani, S., Vassart, G., Parmentier, M., and Communi, D. 28. McQuibban, G. A., Gong, J. H., Tam, E. M., McCulloch, C. A., Clark- (2003) J. Exp. Med. 198, 977–985 Lewis, I., and Overall, C. M. (2000) Science 289, 1202–1206 4. Zabel, B. A., Ohyama, T., Zuniga, L., Kim, J. Y., Johnston, B., Allen, S. J., 29. Miles, L. A., and Plow, E. F. (1985) J. Biol. Chem. 260, 4303–4311 Guido, D. G., Handel, T. M., and Butcher, E. C. (2006) Exp. Hematol. 34, 30. Miles, L. A., Ginsberg, M. H., White, J. G., and Plow, E. F. (1986) J. Clin. 1021–1032 Investig. 77, 2001–2009 5. Parolini, S., Santoro, A., Marcenaro, E., Luini, W., Massardi, L., Facchetti, 31. Lenich, C., Liu, J. N., and Gurewich, V. (1997) Blood 90, 3579–3586 F., Communi, D., Parmentier, M., Majorana, A., Sironi, M., Tabellini, G., 32. Andrews, R. K., and Berndt, M. C. (2004) Thromb. Res. 114, 447–453 Moretta, A., and Sozzani, S. (2007) Blood 109, 3625–3632 6. Zhang, Z., and Wang, F. S. (2005) Cell Mol. Immunol. 2, 411–417 33. Clemetson, K. J., and Clemetson, J. M. (2007) Curr. Pharm. Des. 13, 7. Wittamer, V., Bondue, B., Guillabert, A., Vassart, G., Parmentier, M., and 2673–2683 Communi, D. (2005) J. Immunol. 175, 487–493 34. Du, X. Y., Sim, D. S., Lee, W. H., and Zhang, Y. (2006) Blood Cells Mol. Dis. 8. Zabel, B. A., Allen, S. J., Kulig, P., Allen, J. A., Cichy, J., Handel, T. M., and 36, 414–421 Butcher, E. C. (2005) J. Biol. Chem. 280, 34661–34666 35. von Hundelshausen, P., Petersen, F., and Brandt, E. (2007) Thromb. Hae- 9. Kulig, P., Zabel, B. A., Dubin, G., Allen, S. J., Ohyama, T., Potempa, J., mostasis 97, 704–713 Handel, T. M., Butcher, E. C., and Cichy, J. (2007) J. Immunol. 178, 36. Stellos, K., and Gawaz, M. (2007) Thromb. Haemostasis 98, 922–929 758 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 2 •JANUARY 9, 2009 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Regulation of Chemerin Bioactivity by Plasma Carboxypeptidase N, Carboxypeptidase B (Activated Thrombin-activable Fibrinolysis Inhibitor), and Platelets

Download PDF
8 pages

Loading next page...
 
/lp/unpaywall/regulation-of-chemerin-bioactivity-by-plasma-carboxypeptidase-n-pCIrOHQLSR

References (37)

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.m805000200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 2, pp. 751–758, January 9, 2009 Author’s Choice Printed in the U.S.A. Regulation of Chemerin Bioactivity by Plasma Carboxypeptidase N, Carboxypeptidase B (Activated Thrombin-activable Fibrinolysis Inhibitor), and Platelets Received for publication, July 1, 2008, and in revised form, November 12, 2008 Published, JBC Papers in Press, November 14, 2008, DOI 10.1074/jbc.M805000200 ‡ §¶ ‡1   ‡ Xiao-Yan Du , Brian A. Zabel , Timothy Myles , Samantha J. Allen , Tracy M. Handel , Peter P. Lee , §¶ ‡¶2 Eugene C. Butcher , and Lawrence L. Leung ‡ § From the Division of Hematology and the Department of Pathology, Stanford University School of Medicine, Stanford, California 94305, the Veterans Affairs Palo Alto Health Care System, Palo Alto, CA 94304, and the Skaggs School of Pharmacy and Pharmaceutical Sciences, University of California, San Diego, La Jolla, California 92093 Chemerin is a potent chemoattractant for cells expressing the (CMKLR1, also named ChemR23) is a G protein-coupled serpentine receptor CMKLR1 (chemokine-like receptor 1), such receptor specifically expressed by circulating human plasmacy- as plasmacytoid dendritic cells and tissue macrophages. The toid dendritic cells, natural killer cells, and tissue macrophages bioactivity of chemerin is post-translationally regulated; the (1–5). In their capacity as antigen-presenting cells, plasmacy- attractant circulates in blood in a relatively inactive form toid dendritic cells and macrophages can influence the activa- (prochemerin) and is activated by carboxyl-terminal proteolytic tion of many other cell types, including monocytes, myeloid cleavage. We discovered that plasma carboxypeptidase N (CPN) dendritic cells, B cells, T cells, and natural killer cells; thus and B (CPB or activated thrombin-activable fibrinolysis inhibi- chemerin appears to be an important chemoattractant in both tor, TAFIa) enhanced the bioactivity of 10-mer chemerin pep- innate and adaptive immune responses (2, 6, 7). tide NH -YFPGQFAFSK-COOH by removing the carboxyl-ter- Chemerin circulates in blood in an inactive prochemerin minal lysine (K). Sequential cleavages of either a prochemerin form at low nanomolar concentrations (3nM) (4). Its chemo- peptide (NH -YFPGQFAFSKALPRS-COOH) or recombinant tactic activity is released following proteolytic cleavage of its full-length prochemerin by plasmin and CPN/CPB substantially carboxyl-terminal amino acids by serine proteases of the coag- increased their chemotactic activities. Endogenous CPN pres- ulation, fibrinolytic, and inflammatory cascades (4, 8). These ent in circulating plasma enhanced the activity of plasmin- include factor XIIa, VIIa, plasmin, neutrophil elastase, and mast cleaved prochemerin. In addition, we discovered that platelets cell tryptase. Of interest, staphopain B, a cysteine protease store chemerin protein and release it upon stimulation. Thus secreted by Staphylococcus aureus, also cleaves prochemerin circulating CPN/CPB and platelets may potentially contribute and converts it into a potent chemoattractant (9). Interestingly, to regulating the bioactivity of leukocyte chemoattractant the cleavage sites in the labile carboxyl terminus (NH -YFPGQ- chemerin, and further extend the molecular link between blood FAFSKALPRS-COOH) are not conserved, and the cleavage coagulation/fibrinolysis and CMKLR1-mediated immune products generated by chemerin-activating proteases display responses. different potencies in bioactivity assays. Based on synthetic peptides, the 9-mer NH -YFPGQFAFS-COOH is the most active, but it is still not as active as intact cleaved chemerin protein, indicating that the amino-terminal part of chemerin is Chemerin is a recently discovered chemoattractant molecule required for maximal activity (4, 10). that is predicted to share structural similarity with cystatins Plasma carboxypeptidases CPN and CPB cleave the basic (cysteine protease inhibitors) and cathelicidin precursors (anti- amino acids arginine or lysine from the carboxyl terminus of bacterial peptides) (1). Chemerin is present in circulating blood proteins or peptides such as bradykinin and complement pro- and several human inflammatory fluids (1). Even though teins C3a and C5a. CPN is a constitutively active zinc metallo- chemerin is not similar to CXC and CC chemokines based on protease present in plasma at a concentration of about 100 nM primary amino acid sequence, it functions like a chemokine in and is considered the major anaphylatoxins inhibitor (11), gen- that it induces leukocyte migration and intracellular calcium erating inactive “desArg” forms of C3a and C5a. In contrast, mobilization. Chemerin receptor chemokine-like receptor 1 CPB exists in plasma as a proenzyme, proCPB, or thrombin- activable fibrinolysis inhibitor (TAFI) at a concentration of * This work was supported, in whole or in part, by National Institutes of Health Grants RO1 HL57530 (to L. L.) and AI59625, AI057229, and DK56339 (to E. B.). The costs of publication of this article were defrayed in part by the The abbreviations used are: CMKLR1, chemokine-like receptor 1; CPN, car- payment of page charges. This article must therefore be hereby marked boxypeptidase N; CPB, carboxypeptidase B; TAFI, thrombin-activable “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indi- fibrinolysis inhibitor; MGTA, DL-2-mercaptomethyl-3 guanidinoethylthio- cate this fact. propanoic acid; PPACK, D-phenylalanyl-L-prolyl-L-arginine chloromethyl Author’s Choice—Final version full access. ketone; HPLC, high performance liquid chromatography; PRP, platelet-rich Present address: Maxygen Inc., 515 Galveston Dr., Redwood City, CA 94063. plasma; PIPES, piperazine-N,N-bis(2-ethanesulfonic acid); RT, reverse tran- To whom corresponding should be addressed: VA Palo Alto Health Care scription; ELISA, enzyme-linked immunosorbent assay; MALDI-TOF, System, 3801 Miranda Ave. (11), Palo Alto, CA 94304. Fax: 650-736-0974; matrix-assisted laser desorption ionization time-of-flight; PPP, platelet- E-mail: [email protected]. poor plasma. JANUARY 9, 2009• VOLUME 284 • NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 751 This is an Open Access article under the CC BY license. CPN, CPB, and Platelets Regulate Chemerin Activity about 50 nM and is activated by thrombin in complex with serum albumin were from Sigma. Human soluble thrombo- thrombomodulin on the vascular endothelial surface. CPB modulin and recombinant CPN were kind gifts from Drs. John inhibits fibrin degradation by removing carboxyl-terminal lysines Moser and Mariko Nagashima (Berlex Biosciences, Richmond, from partially digested fibrin, which prevents further incorpora- CA). Hep3B and MEG-01 cells were from the American Type tion of fibrinolytic plasminogen and tissue plasminogen activator Culture Collection. (12, 13). CPB is thermolabile and has a half-life of15 min at 37 °C Preparation of Recombinant Prochemerin—Recombinant (14). We have shown that CPB also has broad substrate reactivity prochemerin was purified as previously published (8). Briefly, and is able to cleave and inactivate bradykinin, C3a, C5a, and prochemerin with a carboxyl-terminal His tag was cloned into thrombin-cleaved osteopontin (15–17). CPN and CPB may play pACGP67 (BD Biosciences) and transfected into Sf-9 cells. The complementary roles, with the former being constitutively active mature prochemerin protein has the amino acid sequence and capable of regulating systemic anaphylatoxins, and the latter NH -ADPELTEAQ…FAFSKALPRSPHHHHHH-COOH, where activated locally at sites of vascular injury to provide site-specific the underlined residues are not native. After viral amplification, anti-inflammatory control. Peptidases can also modulate the bio- prochemerin was expressed by adding high titer virus to logical activity of certain chemokines (4). For example, dipeptidyl shaker flasks containing Hi-5 insect cells in Ex-cell 420 peptidase (DPP-IV/CD26), a serine protease, inactivates CXCL9, medium (JRH Biosciences). After incubation for 2–3 days at CXCL10, CXCL11, and CXCL12 by cleaving these chemokines in 27.5 °C, the supernatant was harvested by centrifugation, fil- the amino terminus (18, 19). tered to 0.22 M, and concentrated at 4 °C using a tangential Platelets store a variety of potent cytokines and chemokines flow concentrator with a 3-kDa cut-off filter (Filtron). within -granules that are released upon cell activation. Platelet Prochemerin was purified by nickel-Sepharose affinity chro- degranulation products, particularly the leukocyte chemoat- matography (American Biosciences) and C-18 reverse phase tractants, which include CXCL4 (platelet factor 4), -thrombo- HPLC (Vydac). The protein was lyophilized and checked for globulin, CCL5 (RANTES), CCL7 (monocyte chemotactic pro- purity using electrospray mass spectrometry. tein 3), and CXCL12 (stromal-derived factor 1), may contribute Tissue Culture—Murine pre-B lymphoma L1.2 cells were to host defense and also play a role in pathophysiologic condi- stably transfected with human CMKLR1 or empty vector tions (20, 21). For example, platelet factor 4 forms complexes pcDNA3 (Invitrogen) and maintained in RPMI 1640 medium with heparin in blood or some glycosaminoglycans on platelet supplemented with 10% fetal bovine serum and 1 mg/ml gene- surfaces to form the major antigen implicated in heparin-in- ticin (Invitrogen). duced thrombocytopenia (22, 23). Platelets not only store In Vitro Transwell Chemotaxis Assay—24-well plates with CXCL12 but also express its receptor CXCR4, a coreceptor for 5-m pore size Transwell inserts (Costar) were used for the cellular entry of human immunodeficiency virus, type 1, sug- chemotaxis assays. 200 l of cells (10 cells/ml) in 0.3% bovine gesting that platelets may be involved in host defense (24). serum albumin/Hank’s solution were added to the top well, and In this study, we found that plasma CPN or CPB can function test samples were added to the bottom well in 500 l of solu- in concert with plasmin to elicit and augment the chemotactic tion. The cells that migrated to the lower chamber after3hat activity of prochemerin. Furthermore, we show that platelets 37 °C were counted by flow cytometry, and the results are could store and release partially active chemerin upon activa- reported as cells/ml in the lower chamber. tion. Thus circulating CPN/CPB and platelets may contribute Preparation of Platelet-rich Plasma, Platelet-poor Plasma, to regulating the bioactivity of leukocyte chemoattractant Washed Platelets, and Platelet Lysates—Blood was drawn into chemerin and further extend the molecular link between blood tubes containing 3.8% sodium citrate (9:1 v/v) and platelet-rich coagulation/fibrinolysis and CMKLR1-mediated immune plasma (PRP) prepared following standard procedure (25). responses. Platelet-poor plasma was prepared by spinning the PRP at 1200  g for 10 min at room temperature. The platelets were EXPERIMENTAL PROCEDURES washed with PIPES buffer (25 mM PIPES, 137 mM NaCl, 4 mM 21–157 Materials—Recombinant human chemerin , polyclonal KCl, and 0.1% glucose) at pH 6.4 as previously described (25). goat anti-human chemerin antibodies, and biotinylated poly- Platelet lysates were obtained by lysing washed platelets with clonal goat anti-human antibodies were from R & D radioimmune precipitation assay lysis buffer (Upstate, NY) Systems (Minneapolis, MN). Peptides 9-mer, YFPGQFAFS with protease inhibitors. The mixture was spun at 10,000  g, 149–157 149–158 (chemerin ); 10-mer, YFPGQFAFSK (chemerin ); and the supernatant protein concentration was determined by 149–163 and 15-mer, YFPGQFAFSKALPRS (chemerin ) were Bradford protein assay. synthesized by Elim Biopharmaceuticals (Hayward, CA). Reverse Transcription (RT)-PCR—Total RNA was prepared Human plasmin and -thrombin were purchased from Hema- from human washed platelets and Hep3B and MEG-01 cells by tologic Technologies (Essex Junction, VT). DL-2-Mercaptom- using TRIzol reagent. Total RNA (1 g) was converted to ethyl-3 guanidinoethylthiopropanoic acid (MGTA) was cDNAs using the oligo(dT) primer and Superscript II enzyme obtained from Calbiochem (La Jolla, CA). Collagen and ADP (Invitrogen). The specific primers used for cloning a 229-bp were from Chrono-log (Havertown, PA). Human plasma-de- chemerin fragment were GAAGAAACCCGAGTGCAAAG rived CPB (TAFIa) and a CPB activity kit were from American (forward) and CTTGGAGAAGGCGAACTGTC (reverse) (the Diagnostica (Stamford, CT). Thrombin receptor-activating annealing temperature was 57 °C, 35 cycles). peptide (SFLLRN peptide), D-phenylalanyl-L-prolyl-L-arginine HPLC Analysis of Chemerin Peptides Cleavage—To evaluate chloromethyl ketone (PPACK), heparin-agarose, and bovine the efficiency of synthetic chemerin 10-mer cleavage by CPN or 752 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 2 •JANUARY 9, 2009 CPN, CPB, and Platelets Regulate Chemerin Activity CPB, 50 l of 10-mer (1 M) was treated with either CPN or CPB (30 nM) for 30 min at 37 °C, and the reaction mixtures were loaded onto a Waters C18 (4.6  150 mm) column and sepa- rated with a 0–35% acetonitrile gradient in 0.1% trifluoroacetic acid (v/v) by HPLC. For 15-mer cleavage, 15-mer (1 M) was incubated with plasmin (1 M) at 37° for 30 min; the reaction was then terminated by PPACK (serine protease inhibitor) (10 M). CPN or CPB (30 nM) was added and incubated for 30 min at 37 °C. 40 l of each reaction mixture (15-mer, 15-mer plus plasmin, 15-mer plus plasmin and CPN/CPB) was analyzed by reverse phase HPLC as described above. Kinetic Analysis of Hydrolysis of 10-mer Chemerin Peptides by CPB and CPN—Michaelis-Menten kinetics was used to determine the K and k for the hydrolysis of 10-mer peptide m cat (YFPGQFAFSK) by CPB and CPN. The concentrations of 10-mer peptides ranged from 20 to 320 M and were digested with 50 nM CPB or 5 nM CPN for 5 min at 37 °C in assay buffer. The reactions were stopped by boiling for 5 min. Cleaved pep- tide was resolved by HPLC, and the nmol of peptide generated was determined from the peak area of cleaved peptide. The values for K and k were determined by plotting the initial m cat velocities of cleavage against the different substrate concentra- tions and then fitting to the Michaelis-Menten equation by nonlinear regression analysis as previously described (15). The experiments were performed in duplicate, and the data were pooled for analysis. CPB Activity Assays—100 l of CPN (10 nM) and CPB (15 nM) were added to a 96-well plate in the presence or absence of MGTA at the indicated concentrations. 50 l of chromogenic CPB (TAFIa) substrate was used in each well as described in the Actichrome CPB kit. Activated CPB (TAFIa) ranging from 0.125 to 2 g/ml was used to construct the standard curve. All of the tests were performed in duplicate. The plate was placed in an ELISA plate reader at 37 °C with constant mixing, and the absorbance at 420 nm was read 30 min after sample addition. Development of Sandwich ELISA for Chemerin—Polyclonal goat anti-human chemerin antibodies were used to coat 96-well plates at a concentration of 4 g/ml. Biotinylated polyclonal goat anti-human chemerin antibodies (0.2 g/ml) and horse- radish peroxidase-labeled streptavidin was used to detect bound chemerin protein. The lower limit of detection of chemerin in this assay was 0.5 ng/ml. For the determination of chemerin levels in plasma, the samples were diluted 10-fold before assay. Mass Spectrometry—MALDI-TOF mass spectrometry was performed by the Stanford Protein and Nucleic Acid Core Facility. FIGURE 1. CPN and CPB up-regulate chemerin 10-mer activity by remov- ing the carboxyl-terminal lysine. A and B, in vitro transwell chemotaxis of Statistical Analyses—The data are expressed as the means CMKLR1/L1.2 transfectants to synthetic 9- and 10-mer chemerin peptides (A) S.D., and statistical evaluation was performed using Student’s t and to CPN (30 nM) or CPB (30 nM)-treated 10-mer peptides at 37 °C for 30 min (B). The results represent one of three independent experiments and are test. Differences were considered to be significant when p expressed as the means  S.D. (n  3). C, HPLC analysis of the chemerin 0.05 (*) or 0.005 (**). 10-mer cleavage products generated by CPN and CPB. 50 l of 10-mer (1 M) was treated with either CPN or CPB (30 nM) for 30 min at 37 °C, and the reac- RESULTS tion mixtures were separated by HPLC. CPN and CPB Up-regulate Chemerin 10-mer Activity by Removing the Carboxyl-terminal Lysine Residue—The syn- occurring at 10–100 nM. Empty vector transfected controls did 149–157 thetic 9-mer chemerin peptide YFPGQFAFS (chemerin ) not migrate to the 9-mer (data not shown), The 10-mer peptide 149–158 induced substantial, dose-dependent migration of human YFPGQFAFSK (chemerin ) did not induce any signifi- CMKLR1-L1.2 transfectants (Fig. 1A) with a peak response cant CMKLR1-dependent chemotaxis even at 10 M concen- JANUARY 9, 2009• VOLUME 284 • NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 753 CPN, CPB, and Platelets Regulate Chemerin Activity TABLE 1 Hydrolysis of chemerin 10-mer peptides by CPB and CPN Chemerin peptides ranging from 20 to 320 M were digested with CPB or CPN as described under “Experimental Procedures.” The values for K , k , and k /K m cat cat m were compared with those obtained from CPB and CPN cleavages of peptides derived from bradykinin, C5a, C3a, and fibrinopeptides (FB) , , and  (15). Substrate Enzyme K k k /K m cat cat m 1 1 1 M s M s Chemerin CPB 122.8  6.4 2.7  0.1 2.2  10 Bradykinin CPB 70.6  4.8 19.7  4.8 2.8  10 66–74 5 C5a CPB 219.0  16.2 29.5  0.7 1.3  10 69–77 5 C3a CPB 35.9  6.6 8.4  0.6 2.3  10 96–104 3 FB-Arg CPB 361.4  69.2 1.5  0.1 4.2  10 125–133 5 FB-Lys CPB 14.3  0.7 13.6  0.2 9.5  10 54–62 4 FB-Lys CPB 34.0  4.1 2.6  0.1 7.6  10 77–85 4 FB-Lys CPB 238.9  24.2 5.9  0.3 2.5  10 Chemerin CPN 170.6  27.2 80.35  5.0 4.7  10 Bradykinin CPN 302.7  29.1 9.1  0.2 3.0  10 66–74 4 C5a CPN 602.2  74.3 9.3  0.4 1.5  10 69–77 5 C3a CPN 77.1  11.2 57.9  2.1 7.5  10 96–104 3 FB-Arg CPN 448.9  43.8 2.9  0.1 6.5  10 125–133 6 FB-Lys CPN 53.2  4.9 109.1  3.6 2.1  10 54–62 3 FB-Lys CPN 657.6  20.5 3.5  0.1 5.3  10 77–85 3 FB-Lys CPN 3727.0  408.6 11.8  0.8 3.2  10 tration (Fig. 1A). Treatment of the 10-mer peptide with CPN or CPB, however, substantially enhanced the chemotactic activity of the peptide (Fig. 1B). CPN and CPB alone (tested at 100 nM) did not induce CMKLR1/L1.2 transfectant migration (Fig. 1B). FIGURE 2. Sequential proteolysis of prochemerin 15-mer by plasmin and We analyzed the mixtures of 10-mer treated with either CPN or carboxypeptidases generates bioactive chemerin 9-mer. A, in vitro tran- swell chemotaxis of CMKLR1/L1.2 cells to prochemerin 15-mer in the pres- CPB by HPLC and found that the 10-mer/CPN mixture had a ence or absence of plasmin, CPB or CPN. 15-mer peptide (1M) was incubated major peak with a retention time of 28.25 min, which is almost with plasmin (1 M) at 37 °C for 30 min; the reaction was then terminated by PPACK (10 M). CPN or CPB (30 nM) was added and incubated for 30 min at identical to that of the purified 9-mer (28.26 min), and different 37 °C. The final concentration of 15-mer used for the assay was 100 nM. The from the 10-mer (25.90 min). For the 10-mer treated with CPB, results represent one of three independent experiments and are expressed as we detected two major fractions corresponding to the 10-mer the means  S.D. (n  3). **, p  0.005. B, HPLC analysis of prochemerin 15-mer cleavage by plasmin, plasmin/CPN, or plasmin/CPB. (25.90 min) and 9-mer (28.28 min) (Fig. 1C). The efficiency of 10-mer cleavage by CPB at 30 nM was about 60%, likely because CPB is thermolabile under the experimental conditions used. In (retention time: 25.3 min; the peak with the retention time at this work, CPN was also used at 30 nM to compare with CPB 12.4 min is the carboxyl-terminal plasmin-generated 5-mer). enzymatic activity. Of note, the plasma levels of proCPB and CPN or CPB then converted the 10-mer to the 9-mer (retention CPN are 50 and 100 nM, respectively (11, 14). time, 27.6 min) (Fig. 2B). Determination of the Kinetic Parameters for the Hydrolysis of Sequential Proteolysis of Prochemerin by Plasmin and Car- 149–158 10-mer Peptide (Chemerin ) by CPB and CPN—The boxypeptidases Synergistically Enhances Bioactivity—We next 149–158 hydrolysis of chemerin by CPB gave estimates for K asked whether sequential treatment of chemotactically inert 1 4 1 (122.8 6.4 M), k (2.7 0.1 s ), and k /K (2.2 10 M concentrations of prochemerin by plasmin and CPN or CPB cat cat m 1 149–158 s ) (Table 1). The concentrations of chemerin ranged could activate the attractant and generate the NH -YFPGQ- from 20 to 320 M, and chemerin was digested with 50 nM CPB. FAFS-COOH form. Plasmin alone cleaved prochemerin and The k /K for chemerin cleavage was about 10-fold less effi- increased its chemotactic bioactivity (Fig. 3A). Sequential treat- cat m 66–74 69–77 cient compared with bradykinin and C5a , C3a but ment of prochemerin with plasmin and CPN or CPB, however, 77–85 comparable with fibrinopeptide -Lys . Meanwhile, the dramatically enhanced its chemotactic activity (Fig. 3B). The 5 1 1 k /K of 10-mer cleavage by CPN is 4.7  10 M s , which proteolytic products were evaluated by mass spectrometry to cat m is about 20-fold faster than CPB, and is about 20-fold faster than determine the processing sites (Fig. 3C). Plasmin first cleaved bradykinin and C5a peptide but similar to that of C3a peptide. prochemerin (17730.12 Da) to the NH -YFPGQFAFSK- Sequential Proteolysis of Prochemerin 15-mer Peptide by COOH form (16301.13 Da), and then CPN or CPB removed the Plasmin and Carboxypeptidases Synergistically Enhances terminal lysine to generate a desLys form (16156.22/16156.36 Bioactivity—The synthetic chemerin 15-mer peptide, YFPGQ- Da) with enhanced activity. Prochemerin treated with CPN and 149–163 FAFSKALPRS (chemerin ) is chemotactically inert (Fig. CPB alone did not induce CMKLR1-mediated chemotaxis 2A). Treatment of the 15-mer with CPN or CPB alone had no (data not shown). effect on chemerin bioactivity. However, sequential treatment Endogenous Plasma CPN Is Critical for the Increased Activity of the 15-mer with plasmin and CPN or CPB dramatically of Plasmin-cleaved Prochemerin—Prochemerin was incubated enhanced its chemotactic activity. The proteolytic products with plasmin and then treated with PPACK to inhibit serine were evaluated by HPLC to determine processing sites. Plasmin protease activity. Plasmin-treated prochemerin was added to first cleaved the 15-mer (retention time, 29.96 min) to 10-mer normal platelet-poor plasma (PPP) as well as PPP treated with 754 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 2 •JANUARY 9, 2009 CPN, CPB, and Platelets Regulate Chemerin Activity FIGURE 4. Endogenous plasma CPN increases the bioactivity of plasmin- cleaved prochemerin. A, MGTA specifically inhibits CPN but not CPB. 1 g/ml of either CPN or CPB was used. B, in vitro transwell chemotaxis of CMKLR1/L1.2 cells to plasmin-treated full-length recombinant prochemerin protein, prochemerin/plasmin/PPP, or prochemerin/plasmin/PPP treated with the CPN inhibitor MGTA (5 M). Prochemerin was treated with plasmin (1 FIGURE 3. Sequential proteolysis of prochemerin protein by plasmin and M) at 37 °C for 30 min, and the reaction was stopped by PPACK (10 M). PPP carboxypeptidases generates a potent chemerin isoform. A, dose-re- or PPP/MGTA was added to plasmin cleaved prochemerin. The final concen- sponse curve of prochemerin activation by plasmin assayed by CMKLR1/L1.2 tration of treated prochemerin was 0.2 nM. The results represent one of three cells chemotaxis. B, in vitro transwell chemotaxis of CMKLR1/L1.2 cells to full- independent experiments and are expressed as the means  S.D. (n  3). **, length recombinant prochemerin protein, prochemerin/plasmin, p  0.005. prochemerin/plasmin/CPN, or CPB. The final concentration of chemerin used for the assay was 0.5 nM. The results represent one of three independent (hepatic carcinoma cell line) and MEG-01 (megakaryotic cell experiments and are expressed as the means  S.D. (n  3). **, p  0.005. C, MALDI-TOF mass spectrometry analysis of prochemerin cleavage by plas- line) cells (Fig. 5B). Identity of the amplified chemerin PCR min, plasmin/CPN, or plasmin/CPB. The concentrations of plasmin, CPN, and product was confirmed by direct sequencing. CPB used in B and C were 1 M,30nM, and 30 nM, respectively. Platelets Release Chemerin upon Activation—As quantified by ELISA, the concentration of chemerin in PRP was 48  1.1 MGTA, a specific inhibitor for CPN but not CPB (Fig. 4A). ng/ml. The addition of thrombin (5 units/ml) to PRP increased Plasmin-cleaved prochemerin did not induce CMKLR1-medi- the chemerin level to 78  0.7 ng/ml (p  0.005) (Fig. 6A). The ated chemotaxis (Fig. 4B). Incubation with PPP, however, dra- addition of thrombin to PPP, on the other hand, had no effect matically increased its bioactivity, which was inhibited by on chemerin activities (Fig. 6B). Thrombin itself did not induce MGTA, indicating that endogenous plasma CPN is critical for the chemotaxis of CMKLR1-transfected cells, and thrombin activating low concentrations of plasmin-cleaved chemerin does not cleave and activate prochemein (8). Thus we conclude (Fig. 4B). that the increased chemerin bioactivity in thrombin-treated Identification of Chemerin in Platelet—Platelets store various PRP was not due to proteolysis of circulating plasma coagulation proteins as well as inflammatory factors. To deter- prochemerin by thrombin but rather was dependent on the mine whether platelets are also involved in chemerin expres- release of chemerin from platelets following thrombin activa- sion, Western blot analysis and RT-PCR were performed. tion. Furthermore, platelet-activating agonists such as throm- Chemerin was detected by Western blot in total platelet lysates, bin receptor-activating peptide, collagen, and, to a lesser extent, with a molecular mass of 16 kDa, similar to recombinant ADP induced the release of chemerin from washed platelets 21–157 chemerin (Fig. 5A). Although platelets are anuclear, long (Fig. 6C), which corresponded with an increase in chemerin lived mRNAs are present in the cytosol, including messages for bioactivity as determined by CMKLR1 transfectant migration certain chemokines (26). We detected chemerin mRNA in (Fig. 6D). platelets by RT-PCR. An expected 229-bp PCR product was We next investigated whether the chemerin released from amplified from cDNAs of platelets, as well as from Hep3B activated platelets is a prochemerin form or an active isoform. JANUARY 9, 2009• VOLUME 284 • NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 755 CPN, CPB, and Platelets Regulate Chemerin Activity FIGURE 5. Platelets contain chemerin mRNA and protein. A, Western blot analysis of chemerin in platelet lysates. B, RT-PCR analysis of chemerin mes- sage in various cell lines and platelets. 21–157 The same amount of prochemerin and active chemerin were used as controls for platelet-derived chemerin (as quanti- fied by ELISA) in transwell assays using CMKLR1/L1.2 trans- fectants. Chemerin activity released from activated platelets is higher than prochemerin but substantially less active than 21–157 chemerin (Fig. 7A). The specific response of platelet-de- rived chemerin to CMKLR1 transfectants was confirmed in the chemotaxis assay using nontransfected cells as controls (Fig. 7B). This suggested that platelets might release chemerin in a partially active form, or platelet-derived chemerin is a mixture of different forms of chemerin, which probably could undergo further proteolysis to fully express its biological activities. With the addition of plasmin/CPB or plasmin/CPN to platelet releas- ates, no enhanced chemerin activities were observed, which is likely due to the presence of various plasmin inhibitors, includ- ing  -antiplasmin, which is known to be released from acti- vated platelets (27) (data not shown). When platelet-derived chemerins were partially purified by heparin-agarose chroma- tography as previously described (8), a significantly increased chemerin activity was detected after adding plasmin, plasmin/ CPB, and plasmin/CPN (Fig. 7C). Interestingly, chemerin activ- ity was also enhanced even in the presence of CPN or CPB alone (Fig. 7C), indicating that at least a portion of the chemerins released from activated platelets has been already cleaved to a form that is accessible to CPN or CPB cleavage. DISCUSSION In this study, we report that plasma-derived CPN and CPB substantially up-regulated the bioactivity of plasmin-cleaved FIGURE 6. Platelets release chemerin upon activation. A, ELISA quantifica- prochemerin via the removal of the carboxyl-terminal lysine tion of total chemerin present in resting and thrombin (5 units/ml) activated residue, adding a novel mechanism to prochemerin processing PRP. B, in vitro transwell chemotaxis of CMKLR1/L1.2 cells to PRP, and PRP/ and activation by proteases (Table 2). We demonstrated this in thrombin (5 units/ml), PPP, and PPP/thrombin (5 units/ml). Thrombin at 5 units/ml was added to PRP or PPP at 37 °C for 5 min. C and D, identification of three different in vitro scenarios: 1) CPN and CPB removed the chemerin in washed platelet lysates by Western blot analysis (C)or in vitro carboxyl-terminal lysine from a 10-mer chemerin peptide and transwell chemotaxis of CMKLR1/L1.2 cells (D). The platelets were treated with the indicated platelet-activating agonists at 37 °C for 3 min: thrombin converted it to a bioactive 9-mer; 2) plasmin cleaved receptor-activating peptide (20 M), thrombin (5 units/ml), collagen (10 prochemerin 15-mer to 10-mer, which was subsequently con- g/ml), and ADP (10 M). 200 l of platelet releasates were tested in chemo- verted to the bioactive 9-mer by CPN or CPB; and 3) sequential taxis assays. The results represent one of three independent experiments and are expressed as the means  S.D. (n  3). **, p  0.005. proteolysis of recombinant prochemerin protein by plasmin followed by CPN or CPB generated a chemerin isoform with 756 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 2 •JANUARY 9, 2009 CPN, CPB, and Platelets Regulate Chemerin Activity TABLE 2 Prochemerin cleavages by various proteases Shown is a summary of prochemerin cleavages by various proteases. ND, not determined. Protease C-terminal sequence Amino acid order Unprocessed . . . YFPGQFAFSKALPRS 21–163 Plasmin/CPB . . . YFPGQFAFS 21–157 Plasmin/CPN . . . YFPGQFAFS 21–157 Plasmin . . . YFPGQFAFSK 21–158 Elastase . . . YFPGQFAFS 21–157 . . . YFPGQFA 21–155 . . . YFPG 21–152 Tryptase . . . YFPGQFAFSK 21–158 . . . YFPGQFA 21–155 Cathepsin G . . . YFPGQFAF 21–156 Staphopain B . . . YFPGQFAFS 21–157 FVIIa ND FXIIa ND kines at the post-translational level (1). These enzymes are par- ticularly adept at modifying chemokines to dampen immune responses. For example, CCL7 is a physiological substrate of matrix metalloproteinase 2; matrix metalloproteinase 2-cleaved CCL7 acts as a general chemokine antagonist by binding to but not activating the CC-chemokine receptors-1, -2, and -3, thereby blocking leukocyte recruitment and damp- ening inflammation (28). Carboxypeptidases CPN and CPB are well known for their ability to inactivate a number of pro-in- flammatory mediators including C5a, C3a, bradykinin, and thrombin-cleaved osteopontin (15–17). In the case of plasmin- cleaved prochemerin, CPN/CPB enhances, rather than dimin- ishes, the chemotactic activity of the attractant under the cur- rent experimental conditions. Cells that are chemerin-responsive include plasmacytoid dendritic cells and macrophages, leukocytes capable of func- tioning as “immune interpreters”; in the absence of “danger signals,” chemerin-recruited plasmacytoid dendritic cell and macrophages may play an immune suppressive role, dampen- ing inflammation through interleukin-10 and transforming growth factor  secretion and regulating T cell responses. Thus FIGURE 7. Bioactivity of platelet-derived chemerin. A, comparison of che- CPN/CPB may serve to dampen inflammatory responses by motactic activity of chemerin released from activated platelets, prochemerin, 21–157 and the active form chemerin . B, the specific chemotactic response of inactivating anaphylatoxins and by recruiting immune sup- platelet-derived chemerin to CMKLR1/L1.2 transfectants. C, proteolytic regu- pressive CMKLR1-positive leukocytes to sites of sterile tissue lation of platelet-derived chemerin bioactivity. Platelet-derived chemerin injury. was partially purified by heparin affinity chromatography (8). Fractions con- taining chemerin were eluted with 0.6 M of NaCl. The concentration of The regulation of chemerin bioactivity at a site of tissue chemerin was quantitated by ELISA. The conditions of platelet-derived injury in vivo appears to involve a complex interplay among chemerin treated with CPN, CPB, plasmin, plasmin/CPN, or plasmin/CPB were many enzymatic components. In our study, plasmin at 1 M identical to that in Fig. 3. The results represent one of three independent experiments and are expressed as the means S.D. (n 3). *, p 0.05; **, p efficiently cleaves prochemerin in vitro. Although this is a sub- 0.005. stantial concentration of plasmin, human platelets have well defined plasminogen binding sites, and these binding sites are potent chemoattractant activity (carboxyl-terminal sequence further increased by 5-fold upon platelet activation (29, 30). NH -YFPGQFAFS-COOH). These data show that CPN and In addition, it has been reported that thrombin stimulation spe- CPB generate a highly active “desLys” form of plasmin-cleaved cifically induces plasminogen activation that is mediated by chemerin. Interestingly, we also found that platelets can regu- endogenous urokinase-type plasminogen activator (31). Thus late chemerin bioactivity by storing and releasing it upon stim- given the substantial plasma concentration of plasminogen ulation. We have therefore identified additional circulating fac- (2.2 M), it is entirely plausible that prochemerin, upon tors (Table 2) that contribute to the regulation of chemerin release from activated platelets, will be efficiently cleaved to bioactivity and further link the processes of blood coagulation/ chemerin by plasmin generated locally at the site of vascular fibrinolysis with mediators that regulate leukocyte migration. inflammation in vivo. Plasmin-cleaved prochemerin can be fur- There is a growing appreciation for the role of extracellular ther activated by CPB and CPN. CPB is activated locally by matrix metalloproteinases and serine proteases such as DPP- endothelial cell bound thrombin/thrombomodulin and IV/CD26 and cathepsin G in regulating the activity of chemo- enhances the chemotactic activity of plasmin-cleaved JANUARY 9, 2009• VOLUME 284 • NUMBER 2 JOURNAL OF BIOLOGICAL CHEMISTRY 757 CPN, CPB, and Platelets Regulate Chemerin Activity 3713–3720 prochemerin via removal of the carboxyl-terminal lysine. At the 10. Wittamer, V., Gre´goire, F., Robberecht, P., Vassart, G., Communi, D., and same time, CPB, in its role as a fibrinolysis inhibitor, blocks Parmentier, M. (2004) J. Biol. Chem. 279, 9956–9962 plasmin generation, which would diminish the initial activation 11. Matthews, K. W., Mueller-Ortiz, S. L., and Wetsel, R. A. (2004) Mol. Im- of circulating prochemerin. Thus CPB may limit the extent of munol. 40, 785–793 prochemerin activation but enhance the activity of the plasmin- 12. Redlitz, A., Tan, A. K., Eaton, D. L., and Plow, E. F. (1995) J. Clin. Investig. cleaved chemerin that has already been formed. Our study pro- 96, 2534–2538 vides further evidence that CPB functions not only as an inhib- 13. Bajzar, L., Morser, J., and Nesheim, M. (1996) J. Biol. Chem. 271, 16603–16608 itor of fibrinolysis, but also as a mediator of inflammatory 14. Ceresa, E., Van de Borne, K., Peeters, M., Lijnen, H. R., Declerck, P. J., and responses. CPB may be important for local and specific action Gils, A. (2006) J. Biol. Chem. 281, 15878–15883 at sites of tissue damage, whereas constitutively active CPN 15. Myles, T., Nishimura, T., Yun, T. H., and Leung, L. L. K. (2003) J. Biol. may regulate its targets systemically. Chem. 278, 51059–51067 Platelets are critical in maintaining normal hemostasis (32, 16. Nishimura, T., Myles, T., Piliponsky, A. M., Kao, P. N., Berry, G. J., and 33). Activated platelets release granular proteins that include Leung, L. L. K. (2007) Blood 109, 1992–1997 17. Myles, T., and Leung, L. L. (2008) J. Biol. Chem. 283, 17789–17796 platelet agonists, adhesive proteins, and chemoattractants at 18. Hildebrandt, M., and Schabath, R. (2008) Front. Biosci. 13, 1774–1779 the site of vascular injury, which may play a role in tissue 19. Gonzalez-Gronow, M., Kaczowka, S., Gawdi, G., and Pizzo, S. V. (2008) inflammation and remodeling (34–36). In our study, we found Front. Biosci. 13, 1610–1618 that platelets store chemerin. Upon activation, platelets release 20. Boehlen, F., and Clemetson, K. J. (2001) Transfus. Med. 11, 403–417 a mixture of chemerin isoforms with different levels of bioac- 21. Brandt, E., Ludwig, A., Petersen, F., and Flad, H. D. (2000) Immunol. Rev. tivity. Some of them would undergo further proteolysis to fully 177, 204–216 22. Warkentin, T. E., Chong, B. H., and Greinacher, A. (1998) Thromb. Hae- express its biological activity. Our future work will investigate mostasis 79, 1–7 the role of chemerin in platelet biology and tissue remodeling. 23. Cines, D. B., Rauova, L., Arpelly, G., Reilly, M. P., McKenzie, S. E., Sachais, REFERENCES B. S., and Poncz, M. (2007) J. Clin. Apher. 22, 31–36 24. Clemetson, K. J., Clemetson, J. M., Proudfoot, A. E., Power, C. A., Baggio- 1. Zabel, B. A., Zuniga, L., Ohyama, T., Allen, S. J., Cichy, J., Handel, T. M., lini, M., and Wells, T. N. (2000) Blood 96, 4046–4054 and Butcher, E. C. (2006) Exp. Hematol. 34, 1106–1114 25. Du, X. Y., Clemetson, J. M., Navdaev, A., Magnenat, E. M., Wells, T. N., 2. Zabel, B. A., Silverio, A. M., and Butcher, E. C. (2005) J. Immunol. 174, and Clemetson, K. J. (2002) J. Biol. Chem. 277, 35124–35132 244–251 26. Power, C. A., Clemetson, J. M., Clemetson, K. J., and Wells, T. N. (1995) 3. Wittamer, V., Franssen, J. D., Vulcano, M., Mirjolet, J. F., Le Poul, E., Cytokine 7, 479–482 Migeotte, I., Bre´zillon, S., Tyldesley, R., Blanpain, C., Detheux, M., Man- 27. Plow, E. F., and Collen, D. (1981) Blood 58, 1069–1074 tovani, A., Sozzani, S., Vassart, G., Parmentier, M., and Communi, D. 28. McQuibban, G. A., Gong, J. H., Tam, E. M., McCulloch, C. A., Clark- (2003) J. Exp. Med. 198, 977–985 Lewis, I., and Overall, C. M. (2000) Science 289, 1202–1206 4. Zabel, B. A., Ohyama, T., Zuniga, L., Kim, J. Y., Johnston, B., Allen, S. J., 29. Miles, L. A., and Plow, E. F. (1985) J. Biol. Chem. 260, 4303–4311 Guido, D. G., Handel, T. M., and Butcher, E. C. (2006) Exp. Hematol. 34, 30. Miles, L. A., Ginsberg, M. H., White, J. G., and Plow, E. F. (1986) J. Clin. 1021–1032 Investig. 77, 2001–2009 5. Parolini, S., Santoro, A., Marcenaro, E., Luini, W., Massardi, L., Facchetti, 31. Lenich, C., Liu, J. N., and Gurewich, V. (1997) Blood 90, 3579–3586 F., Communi, D., Parmentier, M., Majorana, A., Sironi, M., Tabellini, G., 32. Andrews, R. K., and Berndt, M. C. (2004) Thromb. Res. 114, 447–453 Moretta, A., and Sozzani, S. (2007) Blood 109, 3625–3632 6. Zhang, Z., and Wang, F. S. (2005) Cell Mol. Immunol. 2, 411–417 33. Clemetson, K. J., and Clemetson, J. M. (2007) Curr. Pharm. Des. 13, 7. Wittamer, V., Bondue, B., Guillabert, A., Vassart, G., Parmentier, M., and 2673–2683 Communi, D. (2005) J. Immunol. 175, 487–493 34. Du, X. Y., Sim, D. S., Lee, W. H., and Zhang, Y. (2006) Blood Cells Mol. Dis. 8. Zabel, B. A., Allen, S. J., Kulig, P., Allen, J. A., Cichy, J., Handel, T. M., and 36, 414–421 Butcher, E. C. (2005) J. Biol. Chem. 280, 34661–34666 35. von Hundelshausen, P., Petersen, F., and Brandt, E. (2007) Thromb. Hae- 9. Kulig, P., Zabel, B. A., Dubin, G., Allen, S. J., Ohyama, T., Potempa, J., mostasis 97, 704–713 Handel, T. M., Butcher, E. C., and Cichy, J. (2007) J. Immunol. 178, 36. Stellos, K., and Gawaz, M. (2007) Thromb. Haemostasis 98, 922–929 758 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 2 •JANUARY 9, 2009

Journal

Journal of Biological Chemistry – Unpaywall

Published: Jan 1, 2009

There are no references for this article.