Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Vascular endothelial growth factor-C expression in human prostatic carcinoma and its relationship to lymph node metastasis

Vascular endothelial growth factor-C expression in human prostatic carcinoma and its relationship... British Journal of Cancer (1999) 80(1/2), 309–313 © 1999 Cancer Research Campaign Article no. bjoc.1998.0356 Vascular endothelial growth factor-C expression in human prostatic carcinoma and its relationship to lymph node metastasis 1,2 1 1 1 1 3 2 T Tsurusaki , S Kanda , H Sakai , H Kanetake , Y Saito , K Alitalo and T Koji 1 2 Departments of Urology and Histology and Cell Biology, Nagasaki University School of Medicine, 1-7-1 Sakamoto, Nagasaki 852-8102, Japan; Molecular/Cancer Biology Laboratory, Haartman Institute, University of Helsinki, PL21, 00014 Helsinki, Finland Summary Lymph node dissemination is a major prognostic factor in human cancer. However, the molecular mechanisms underlying lymph node metastasis are poorly understood. Recently, vascular endothelial growth factor-C (VEGF-C) was identified as a ligand for VEGF receptor-3 (VEGFR-3/Flt-4) and the expression of VEGFR-3 was found to be highly restricted to the lymphatic endothelial cells. In this report, we investigated the expression of VEGF-C and VEGFR-3 in human prostatic carcinoma tissue by using in situ hybridization and immunohistochemical staining respectively. Expression of VEGF-C mRNA in prostatic carcinoma was significantly higher in lymph node- positive group than in lymph node-negative group. In addition, the number of VEGFR-3-positive vessels was increased in stroma surrounding VEGF-C-positive prostatic carcinoma cells. These results suggest that the expression of VEGF-C in prostatic carcinoma cells is implicated in the lymph node metastasis. Keywords: prostatic carcinoma; vascular endothelial growth factor-C; VEGF receptor-3; lymph node metastasis Prostatic carcinoma is one of the major cancers in men. It is known denoted VEGF-C and -D, were cloned (Joukov et al, 1996; Achen that the progression of the disease is highly associated with meta- et al, 1998). Receptors for VEGF-C and -D are VEGFR-3 (Flt-4) stasis to the bone and the lymph nodes (Slack et al, 1986). The (Pajusola et al, 1992) and VEGFR-2. VEGFR-2 has an affinity for major therapy for extensive disease is androgen deprivation VEGF/VPF, whereas VEGFR-3 can bind specifically to VEGF-C therapy, whereas there are several ways to treat localized (non- and -D. The distribution of VEGFR-3 is highly restricted to the metastatic) prostatic cancer, including anti-androgen therapy, lymphatic endothelial cells (Kaipainen et al, 1995), suggesting that radical prostatectomy, radiotherapy and cryotherapy. The prog- VEGFR-3 is one of the specific markers for lymphatic endothelial nosis is dependent on the presence of lymph node metastasis cells. VEGF-C-transgenic mice revealed that an increase in the (Epstein et al, 1996). However, the molecular mechanisms under- diameter of lymphatic vessels was the major effect of VEGF-C lying lymph node metastasis are poorly examined. overexpression instead of an increase in number of vessels (Jeltsch Vascular endothelial growth factor (VEGF)/vascular perme- et al, 1997). In contrast, VEGF-C-coated thermanox disks ability factor (VPF) belongs to the platelet-derived growth factor markedly induced lymphangiogenesis (increase in number of (PDGF)/VEGF family, which is known as a potent inducer of lymphatic vessels) in the differentiated avian chorioallantoic angiogenesis (Dvorak et al, 1995; Ferrara and Davis-Smyth, membrane (Oh et al, 1997). These results suggest differences in 1997). VEGF receptor-1 (VEGFR-1; Flt-1) and VEGFR-2 (Flk- the effects of VEGF-C on embryonic and mature lymphatic 1/KDR) are receptor tyrosine kinases for VEGF/VPF (Ferrara and vessels. Davis-Smyth, 1997). These receptors are found to be largely In this study, we examined the expression of VEGF-C in human expressed on the vascular endothelial cells. VEGFR-2 has an prostatic carcinoma tissue and found that there was a significant ability to transduce signals for biological responses leading to correlation between the expression of VEGF-C and lymph node angiogenesis, including proliferation and migration of endothelial dissemination. Additionally, the number of VEGFR-3-positive cells in vitro, whereas the significance of Flt-1 was unclear vessels was increased in the surrounding stromal tissue of VEGF- (Waltenberger et al, 1994). Recently, Flt-1 was reported to trans- C positive prostatic carcinoma cells. These results indicate that the duce signals for migration and activation of monocytes (Barleon et determination of VEGF-C expression in prostatic carcinoma tissue al, 1996; Clauss et al, 1996). Gene targeting of VEGFR-1 and would be useful to predict lymph node metastasis and suggest a VEGFR-2 results in the fetal death associated with the lack of role for VEGF-C in lymphatic metastasis. normal vasculature in utero (Fong et al, 1995; Shalabi et al, 1995), indicating that VEGF receptors are important for vascular devel- MATERIALS AND METHODS opment. Recently, new members of the VEGF/VPF family, Tissue collection and preparation, and patients’ characteristics Received 8 June 1998 Revised 28 September 1998 Prostate cancer tissues from 26 patients were used in this study. Accepted 21 October 1998 All tissue specimens were obtained by 16- or 18-gauge needle Correspondence to: S Kanda transperineal biopsies under informed consent prior to treatment. 309 310 T Tsurusaki et al Tissue specimens for in situ hybridization (ISH) were fixed in 10% with 2 ´ SSC, the membranes were stained immunochemically neutral buffered formalin and embedded in paraffin, and some with anti-T-T IgG as described previously (Koji et al, 1996) and specimens for immunohistochemistry (IHC) were kept as fresh the signals were visualized by the incubation with 0.1 M phosphate –1 frozen sections. Histological grade was determined in each sample buffer, pH 7.5, containing 0.15 mg ml 3,3¢-diaminobenzidine-4 by using the Gleason grading system (Gleason et al, 1977) and the hydrochloric acid (HCl) (DAB), 0.01% hydrogen peroxide (H O ), 2 2 tissue area containing the primary grade site (predominant) was 0.025% CoCl and 0.02% NiSO (NH ) SO (Adams, 1981). 2 4 4 2 4 selected for further investigation. Serum prostatic specific antigen (PSA) was measured prior to the biopsy by using Tandem R assay. ISH for cultured cells Patients were examined for detection of metastasis with chest X- ray, abdominal ultrasonography, computerized tomography scan- Human prostatic adenocarcinoma cell lines, PC-3, DU145 and ning, magnetic resonance imaging and bone scintigraphy, and LNCap cells were grown in Ham’s F-12 medium supplemented clinical stage was assessed by the 1992 TNM system (Hermanek with 10% heated-inactivated fetal bovine serum (Life Tech. and Sobin, 1992). Patients were divided into three groups: group 1 Oriental, Tokyo, Japan). For ISH, cells were seeded into wells of consisted of seven cases with clinically localized, well-differenti- 8-well Lab-Tek chamber glass slides (Nalge Nunc International, ated (Gleason score 2–4) prostatic adenocarcinoma; group 2 Naperville, IL, USA) and cultured overnight. ISH of these cells consisted of ten cases with bone metastases, which are thought to was performed according to the method described previously be the metastatic sites via blood vessels; and group 3 consisted of (Koji et al, 1996; Tsurusaki et al, 1998). Briefly, cells grown on nine cases with both bone and lymph node metastases. The mean glass slides were sequentially incubated with 0.2 N HCl for ages of patients in each group were 74.0, 75.0 and 69.6 years old, 20 min, 0.2% Triton X-100 in phosphate-buffered saline (PBS) for –1 respectively, and the differences were not statistically significant. 10 min, and 2 mg ml proteinase K at 37°C for 20 min. After fixa- There was no statistical difference in Gleason score and T stage tion with 4% paraformaldehyde in PBS for 5 min, the cells were –1 between group 2 and group 3. immersed in PBS containing 2 mg ml glycine for 30 min and kept in 4 ´ SSC containing 40% deionized formamide until use for hybridization. Hybridization was carried out at 37°C overnight Preparation of oligo-DNA probes –1 with 2 mg ml T-T dimerized antisense oligo-DNA for VEGF-C A 40-base sequence complementary to VEGF-C mRNA was dissolved in hybridization medium. The cells were washed with selected. The antisense and sense sequences were synthesized 50% formamide in 2 ´ SSC for 5 h followed by washing with PBS, together with two and three TTA repeats at the 5¢- and 3¢-ends and were then incubated with anti-T-T dimer monoclonal antibody of sequences for the T-T dimer formation. The sequences followed by the incubation with peroxidase-conjugated anti- of antisense and sense probes used in this study were mouse IgG. Peroxidase bound to tissue sections was visualized as 5¢-TTATTATGAGGTAGCTCGTGCTGGTGTTCATGCACT- described previously (Koji et al, 1996; Tsurusaki et al, 1998). GCAGCCCCTCACTATATTATTATT-3¢ and 5¢-TTATTAATAGT- Hybridization signals were considered positive when accumulated GAGGGGCTGCAGTGCATGAACACCAGCACGAGCTACCT black deposits were seen in individual cells. When the signal was CAATTATTATT-3¢, respectively. A computer-assisted search similar to that of the negative control, the sample was regarded as (GenBank Rel. 95.0, 1996) of the above antisense sequence, as ‘negative’. ‘Weak positive’ staining was assigned when the signals well as the sense sequence, showed no significant homology with were present, but only localized to the perinuclear area. ‘Strong any known sequences. The T-T dimer, which is used to provide a positive’ staining represented dense and clear signals throughout hapten for antibody recognition of the ISH probes (Koji et al, the cytoplasm. 1996), was introduced into oligo-DNAs by UV irradiation (254 –2 nm) with a dose of 12 000 J m . The generation of T-T dimer was ISH for prostatic carcinoma specimens verified immunochemically by using mouse monoclonal anti-T-T IgG (Kyowa Medex, Tokyo, Japan). Deparaffinized and rehydrated biopsy specimens were sequen- tially treated with 0.3% H O in methanol for 15 min, 0.2 N HCl 2 2 –1 for 20 min and 100 mg ml proteinase K at 37°C for 15 min. ISH Dot-blot hybridization for biopsy specimens was performed according to the method Various amounts of the sense oligo-DNA between 1 pg and 10 ng discribed in ISH for cultured cells. were spotted onto nitrocellulose membranes that had been soaked in 20 ´ suline–sodium citrate (SSC) [1 ´ SSC; 0.015 M sodium Control experiments for ISH citrate, pH 7.0 supplemented with 0.15 M sodium chloride (NaCl)]. After air-drying, the filters were baked at 80°C for 2 h, To evaluate the specificity of VEGF-C mRNA signals, a panel of followed by the incubation with prehybridization medium control experiments were conducted on sections adjacent to the containing 10 mM Tris-HCl, pH 7.4, 0.6 M NaCl, 1 mM EDTA, malignant area (Koji et al, 1996; Tsurusaki et al, 1998). A number of –1 –1 1 ´ Denhardt’s solution, 500 mg ml yeast tRNA, 250 mg ml consecutive tissue sections were hybridized with T-T dimerized salmon testicular DNA (Sigma, St Louis, MO, USA) and 40% oligo-DNA complementary to 28S rRNA as a positive control (v/v) deionized formamide at 37°C for 2 h. The membranes were (Yoshii et al, 1995) and also T-T dimerized VEGF-C sense oligo- –1 then incubated with 1 mg ml T-T dimerized oligo-DNA probe in DNA as a negative control in every run. Another group of tissue hybridization medium containing 10 mM Tris-HCl (pH 7.4), 0.6 M sections was hybridized with the VEGF-C antisense probe in the –1 NaCl, 1 mM EDTA, 1 ´ Denhardt’s solution, 250 mg ml yeast presence of an excess amount (50-fold) of either homologous or non- –1 tRNA, 125 mg ml salmon testicular DNA, 10% dextran sulphate homologous unlabelled oligo-DNA probe, to confirm the sequence and 40% deionized formamide at 37°C overnight. After washing specificity of the signals. To eliminate possible involvement of British Journal of Cancer (1999) 80(1/2), 309–313 © Cancer Research Campaign 1999 VEGF-C expression in prostatic cancer 311 Table 1 Summary of VEGF-C mRNA expression in primary prostatic carcinoma specimens determined by in situ hybridization Group 1 Group 2 Group 3 Gleason sum 4 ± 0 8.2 ± 1.1 8.9 ± 0.9 –1 PSA (ng ml ) 18.3 ± 10.9 213.2 ± 393.9 622.3 ± 799.4 T stage 2.3 ± 0.5 3.5 ± 0.5 3.0 ± 0.5 Metastatic sites None Bone Bone with lymph nodes VEGF-C mRNA expression Negative 4 6 0 Weakly positive 1 3 3 Strongly positive 2 1 6 Formalin-fixed, paraffin-embedded tissues were hybridized with T-T dimerized antisense probes for VEGF-C and hybridized probes were visualized by using anti-T-T antibody followed by peroxidase reaction. No staining of tumour cells is indicated as ‘negative’. ‘Weakly positive’ indicates a positive staining restricted to the perinuclear area, and ‘strongly positive’ indicates diffuse cytoplasmic staining in the tumour cells. Group 3 (with lymph node metastasis) demonstrated significantly stronger VEGF-C mRNA expression than other groups (without lymph node metastasis; P = 0.0083, by the c test). Figure 1 VEGF-C mRNA expression in human prostatic carcinoma cell lines, PC-3 (A–G), LNCaP (H) and DU-145 (I) by using the non-radioactive in RESULTS situ hybridization method. (A) 28S rRNA antisense probe; (B) VEGF-C sense probe; (C, H, I) VEGF-C antisense probe; (D) competition with excess Dot-blot hybridization with T-T dimerized synthetic amount (50-fold) of unlabelled probe; (E) competition with excess amount (50-fold) of non-homologous unlabelled oligo-DNA; (F) hybridization with oligo-DNA antisense probe followed by washing at excessively high stringency; (G) treatment with RNase-A before hybridization with VEGF-C antisense probe. To examine the sensitivity of synthesized antisense oligo-DNA, Magnification ´ 400 VEGF-C sense oligo-DNA on a nitrocellulose membrane was hybridized with T-T dimerized VEGF-C antisense oligo-DNA or T-T dimerized VEGF-C sense oligo-DNA. One picogram of the sense DNA was detected with the antisense probe, while the sense proteins and DNA in signal formation, some sections were –1 oligo-DNA detected no signal (data not shown). These results digested with 100 mg ml of ribonuclease-A (RNase-A) at 37°C indicate that the antisense probe was specific and had adequate for 60 min before the post-fixation step. In some sections, exces- sensitivity to be used in ISH studies. sively stringent washing conditions (50% formamide in 2 ´ SSC at 37°C for 5 h and 50% formamide in 0.1 ´ SSC at 45°C for 30 min) were applied after hybridization with the VEGF-C antisense VEGF-C mRNA expression in cultured human prostatic probes. carcinoma cells assessed by ISH To certify the quality of T-T dimerized VEGF-C antisense oligo- IHC for VEGFR-3 DNA in ISH study, expression of mRNA for VEGF-C in PC-3, LNCaP and DU145 cells was examined. VEGF-C mRNA was The monoclonal antibody raised against the extracellular domain expressed in the cytoplasmic area of more than 90% of these cells. of human VEGFR-3 (mouse IgG ) (Jussila et al, 1998) was used. In LNCaP cells, high expression of VEGF-C was observed, and The antibody could recognize VEGFR-3 expressed in tissues DU145 cells were found to express low amount of VEGF-C prepared as frozen sections. Fresh frozen prostatic tissue sections mRNA. To confirm the sequence specificity of the VEGF-C from six patients (two sections each from VEGF-C-negative, mRNA signal in these cell lines, we conducted various control VEGF-C weakly positive and VEGF-C strongly positive cancer experiments. A representative set of control experiments on PC-3 tissues) were fixed with acetone at 4°C and treated with 5% was shown in Figure 1A, B and D–G. When cells were hybridized normal goat serum in 1% bovine serum albumin in PBS. Then the –1 with the T-T dimerized oligo-DNA complementary to 28S rRNA, sections were incubated with 2 mg ml monoclonal antibody at signals were detected in the cytoplasmic area as well as in nucleoli room temperature overnight and then with horseradish peroxidase (Figure 1A), whereas no staining was found with T-T dimerized (HRP) conjugated goat anti-mouse IgG for 60 min. Peroxidase VEGF-C sense probe (Figure 1B). When cells were hybridized was visualized with DAB and H O , and the sections were 2 2 with VEGF-C antisense probe in the presence of excess amount of counterstained with methyl green and mounted. The consecutive –1 the homologous unlabelled oligo-DNA, cytoplasmic signal was sections were incubated with 2 mg ml normal mouse IgG in place much weaker (Figure 1D). On the other hand, the VEGF-C mRNA of the specific monoclonal antibody and used as a negative control. staining was not altered by the presence of excess amount of non- homologous unlabelled oligo-DNA (Figure 1E). When cells were Statistical analysis washed at excessively high stringency or were digested with RNase-A, a remarkable decrease in the staining was observed The c test was used to analyse the relationship of VEGF-C (Figure 1F, G). mRNA expression between groups 1 + 2 and 3. © Cancer Research Campaign 1999 British Journal of Cancer (1999) 80(1/2), 309–313 312 T Tsurusaki et al VEGFR-3 protein expression assessed by IHC Receptors for VEGF-C were identified as VEGFR-2 and -3 (Joukov et al, 1996). Since the expression of VEGFR-3 is highly restricted to lymphatic endothelial cells (Kaipainen et al, 1995), it has been suggested that VEGF-C is involved in lymphangiogen- esis (increase in the number of lymphatic vessels) in differentiated tissues. To examine the role of VEGF-C expression in prostatic AB C carcinoma, VEGFR-3 expression was studied in two fresh frozen Figure 2 VEGF-C mRNA expression of a grade 5 prostatic carcinoma sections from each of VEGF-C-negative, VEGF-C weakly posi- tissue visualized by using the non-radioactive in situ hybridization method. (A) 28S rRNA antisense probe used as a positive control; (B) VEGF-C tive and VEGF-C strongly positive groups by IHC. Two speci- antisense probe; (C) VEGF-C sense probe used as a negative control. mens in each group showed representative results and the typical Magnification x 200 tumour areas from each group are shown in Figure 3. In the VEGF-C mRNA-negative specimens, VEGFR-3-positive vessels were hardly observed, as shown in Figure 3A. However, in the VEGF-C mRNA expression in human prostatic VEGF-C mRNA-positive specimens, the number of VEGFR-3- carcinoma tissues positive vessels was clearly increased in the stromal tissues Twenty-six human prostatic carcinoma samples were examined surrounding tumour nests, as shown in Figure 3B and 3C. The for the expression of VEGF-C mRNA by ISH. Sixteen specimens VEGFR-3-positive vessels were hardly observed in the tumour out of 26 (61.5%) were estimated as positive, in which the cancer nests and none of the VEGFR-3-positive channels contained red epithelial cells were positive for VEGF-C mRNA, while other blood cells. types of cells, such as basal cells, stromal cells, endothelial cells and vascular smooth muscle cells, were negative for VEGF-C expression. The staining for VEGF-C mRNA was localized to the DISCUSSION cytoplasmic area of epithelial cells. A typical staining is shown in Figure 2. In group 1, three specimens out of seven (42.9%) were In this study, we demonstrated that the expression of VEGF-C in estimated as positive (two strongly positive and one weakly posi- human prostatic carcinoma cells was significantly correlated with tive). In group 2, four specimens out of ten (40%) were positive for the presence of lymph node metastasis. In addition, VEGFR-3- VEGF-C mRNA, and in group 3, all nine specimens (100%) were positive vessels (possibly lymphatic vessels), which were positive (Table 1). Group 3 (with lymph node metastases) demon- observed only in tumour stromal tissue, were increased in density strated significantly higher VEGF-C mRNA expression than other when VEGF-C was expressed in the prostatic carcinoma cells, groups (without lymph node metastases) (P = 0.0083) and no indicating a paracrine relationship between VEGF-C expressed in significant difference was observed between localized disease and prostatic cancer cells and its receptor, VEGFR-3, expressed in advanced disease (group 1 vs group 2). These data demonstrate adjacent stromal tissue. This is the first demonstration of the asso- that the expression of VEGF-C mRNA in prostatic carcinoma cells ciation of VEGF-C expression and lymphatic dissemination of is closely associated with the presence of lymph node metastasis. human carcinoma. ABC Figure 3 VEGFR-3 expression in fresh frozen sections of prostate carcinoma tissue examined by immunohistochemistry. (A) VEGF-C mRNA-negative specimen; (B) in VEGF-C mRNA weakly positive specimen; (C) VEGF-C mRNA strongly positive specimen. Arrows in (B) show the positive staining of VEGFR- 3. Magnification ´ 400 British Journal of Cancer (1999) 80(1/2), 309–313 © Cancer Research Campaign 1999 VEGF-C expression in prostatic cancer 313 for the tyrosine kinases VEGF receptor-2 (Flk1) and VEGF receptor-3 (Flt-4). There is no definitive marker for the identification of lymphatic Proc Natl Acad Sci USA 95: 548–553 endothelial cells yet. According to recent studies (Jussila et al, Adams JC (1981) Heavy metal intensification of DAB-based HRP reaction product. 1998), the combination of anti-PAL-E and anti-CD31 immunos- J Histochem Cytochem 29: 775 taining was useful to recognize lymphatic endothelial cells (PAL- Barleon B, Sozzani S, Zhou D, Weich H, Mantovani A and Marmé D (1996) Migration of human monocytes in response to vascular endothelial growth E-negative/CD31-positive) and VEGFR-3 expression was mostly factor (VEGF) is mediated via the VEGF receptor flt-1. Blood 87: 3336–3343 observed in lymphatic endothelial cells. Our results indicate that Clauss M, Weich H, Breier G, Knies U, Rock W, Waltenberger J and Risau W (1996) VEGFR-3 expression could be one of the good markers of The vascular endothelial growth factor receptor Flt-1 mediates biological lymphatic endothelial cells. In this study, VEGFR-3-positive cells activities. Implications for a functional role of placenta growth factor in were found only in connective tissue stroma surrounding tumour monocyte activation and chemotaxis. J Biol Chem 271: 17629–17634 Dvorak HF, Brown LF, Detmar M and Dvorak AM (1995) Vascular permeability nests and none of the VEGFR-3-positive channels contained red factor/vascular endothelial growth factor, microvascular permeability, and blood cells. These findings suggest that VEGFR-3-positive cells angiogenesis. Am J Pathol 146: 1029–1039 are possibly lymphatic endothelial cells. Epstein JI, Partin AW, Sauvageot J and Walsh PC (1996) Prediction of progression VEGF-C is a ligand for VEGFR-2 and -3. VEGFR-2 is expressed following radical prostatectomy: a multivariate analysis of 721 men with long- term follow-up. Am J Surg Pathol 20: 286–292 in both blood vessel and lymphatic endothelial cells. In the present Ferrara N and Davis-Smyth T (1997) The biology of vascular endothelial growth study, we could not observe a remarkable difference of the blood factor. Endocrine Rev 18: 4–25 vessel density between VEGF-C-positive and -negative prostatic Folkman J and Shing Y (1992) Angiogenesis. J Biol Chem 267: 10931–10934 carcinoma specimens (data not shown). Angiogenesis is stimulated Fong G-H, Rossant J, Gertenstein M and Breitman M (1995) Role of Flt-1 receptor by a variety of growth factors, including fibroblast growth factors, tyrosine kinase in regulation of assembly of vascular endothelium. Nature 376: 66–67 VEGF and transforming growth factor-b (Folkman and Shing, 1992). Gleason DF (1977) Histologic grading and clinical staging of prostatic carcinoma. In In prostatic carcinoma, many of these growth factors are known to be Urologic Pathology: Prostate, Tannenbaum M (ed), pp. 171–198. Lea & expressed (Steiner, 1993) and angiogenesis in prostatic carcinoma Febiger, Philadelphia may be regulated by these growth factors rather than VEGF-C. In Jeltsch M, Kaipainen A, Joukov V, Meng X, Lakso M, Rauvala H, Swartz M, Fukumura D, Jain RK and Alitaro K (1997) Hyperplasia of lymphatic vessels contrast, the expression of VEGFR-3 is highly restricted to lymphatic in VEGF-C transgenic mice. Science 276: 1423–1425 endothelial cells. The role of the signal transduction pathway via Joukov V, Pajusola K, Kaipainen A, Chilov D, Lahtinen I, Kukk E, Saksela O, VEGFR-3 in the biological responses of lymphatic endothelial cells Kalkkinen N and Alitalo K (1996) A novel vascular endothelial growth factor, has not been clarified yet. However, the present data is compatible VEGF-C, is a ligand for the Flt-4 (VEGFR-3) and KDR (VEGFR-2) receptor with the view that VEGF-C stimulates lymphangiogenesis in vivo. In tyrosine kinases. EMBO J 15: 290–298 Jussila L, Valtola R, Partanen TA, Salven P, Heikkilä P, Matikainen M-T, Renkonen transgenic mice, overexpression of VEGF-C resulted in the increase R, Kaipainen A, Detmar M, Tschachler E, Alitalo R and Alitalo K (1998) in diameter of lymphatic vessels, whereas an increase in the number Lymphatic endothelium and Kaposi’s sarcoma spindle cells detected by of vessels was not observed (Jeltsch et al, 1997). In the differentiated antibodies against the vascular endothelial growth factor receptor-3. Cancer chorioallantoic membrane, VEGF-C was stimulatory also for in vivo Res 58: 1599–1604 Kaipainen A, Korhonen J, Mustonen T, van Hinsbergh VWM, Fang G-H, Dumont lymphangiogenesis (Oh et al, 1997). The difference of VEGF-C D, Beitman M and Alitalo K (1995) Expression of the fms-like tyrosine kinase functions between developing and mature tissues may be due to the 4 gene becomes restricted to lymphatic endothelium during development. Proc presence of specific signal transduction pathways or an unidentified Natl Acad Sci USA 92: 3566–3570 specific receptor for VEGF-C, which could be expressed only in Koji T and Nakane PK (1996) Recent advances in molecular histochemical mature lymphatic endothelial cells and could be necessary for the techniques: in situ hybridization and southwestern histochemistry. J Electron Microsc 45: 119–127 increase in lymphatic vessels. Oh S-J, Jeltsch M, Birkenhäger R, McCarthy JEG, Weich HA, Christ B, Alitaro K In the present study, some clinically lymph node-negative prostatic and Wilting J (1997) VEGF and VEGF-C: Specific induction of angiogenesis carcinoma specimens also showed VEGF-C expression. It is possible and lymphangiogenesis in the differentiated avian chorioallantoic membrane. that VEGF-C-positive prostatic carcinoma patients without clinical Dev Biol 188: 96–109 Pajusola K, Aprelikova O, Korhonen J, Kaipainen A, Pertovaara L, Alitalo R and lymph node metastasis in the present study might have lymph node Alitalo K (1992) FLT4 receptor tyrosine kinase contains seven metastasis at microscopic level. Nevertheless, more importantly, the immunoglobulin-like loops and is expressed in multiple human tissues and cell expression of VEGF-C was significantly higher in lymph node- lines. Cancer Res 52: 5738–5743 positive patients than in node-negative patients, suggesting that the Shalabi F, Rossant J, Yamaguchi TP, Gertenstein M, Wu X-F, Breitman ML and examination of VEGF-C expression in prostatic carcinoma tissue Schuh AC (1995) Failure of blood island formation and vasculogenesis in Flk-1 dificient mice. Nature 376: 62–66 may be an indicator of the presence of lymph node metastasis. Slack NH, Lane WW, Priore RL and Murphy GP (1986) Prostatic cancer treated at a categorical center, 1980–1983. Urology 27: 205–213 ACKNOWLEDGEMENTS Steiner MS (1993) Role of peptide growth factors in the prostate: a review. Urology 42: 99–110 We are grateful to Dr Shin-ichi Kiyokawa for the preparation of Tsurusaki T, Koji T, Sakai H, Kanetake H, Nakane PK and Saito Y (1998) Cellular cryostat sections. We also thank Takumi Shimogama and Miki expression of beta-microseminoprotein (b-MSP) mRNA and its protein in Yoshimoto for their outstanding help. This work was supported by untreated prostate cancer. Prostate 35: 109–116 Waltenberger J, Claesson-Welsh L, Siegbahn A, Shibuya M and Heldin C-H (1994) a grant-in-aid for scientific research (A) (No. 06404059) from the Different signal transduction properties of KDR and Flt-1, two receptors for Ministry of Education, Science, Sports and Culture, Japan. vascular endothelial growth factor. J Biol Chem 269: 26988–26995 Yoshii A, Koji T, Ohsawa N and Nakane PK (1995) In situ localization of ribosomal REFERENCES RNAs in a reliable reference for hybridizable RNA in tissue sections. J Histochem Cytochem 43: 321–327 Achen MG, Jeltsch M, Kukk E, Makinen T, Vitali A, Wilks AF, Alitalo K and Stacker SA (1998) Vascular endothelial growth factor D (VEGF-D) is a ligand © Cancer Research Campaign 1999 British Journal of Cancer (1999) 80(1/2), 309–313 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png British Journal of Cancer Springer Journals

Vascular endothelial growth factor-C expression in human prostatic carcinoma and its relationship to lymph node metastasis

Download PDF
5 pages

Loading next page...
 
/lp/springer-journals/vascular-endothelial-growth-factor-c-expression-in-human-prostatic-qRR9wmWe0m

References (30)

Publisher
Springer Journals
Copyright
Copyright © 1999 by The Author(s)
Subject
Biomedicine; Biomedicine, general; Cancer Research; Epidemiology; Molecular Medicine; Oncology; Drug Resistance
ISSN
0007-0920
eISSN
1532-1827
DOI
10.1038/sj.bjc.6690356
Publisher site
See Article on Publisher Site

Abstract

British Journal of Cancer (1999) 80(1/2), 309–313 © 1999 Cancer Research Campaign Article no. bjoc.1998.0356 Vascular endothelial growth factor-C expression in human prostatic carcinoma and its relationship to lymph node metastasis 1,2 1 1 1 1 3 2 T Tsurusaki , S Kanda , H Sakai , H Kanetake , Y Saito , K Alitalo and T Koji 1 2 Departments of Urology and Histology and Cell Biology, Nagasaki University School of Medicine, 1-7-1 Sakamoto, Nagasaki 852-8102, Japan; Molecular/Cancer Biology Laboratory, Haartman Institute, University of Helsinki, PL21, 00014 Helsinki, Finland Summary Lymph node dissemination is a major prognostic factor in human cancer. However, the molecular mechanisms underlying lymph node metastasis are poorly understood. Recently, vascular endothelial growth factor-C (VEGF-C) was identified as a ligand for VEGF receptor-3 (VEGFR-3/Flt-4) and the expression of VEGFR-3 was found to be highly restricted to the lymphatic endothelial cells. In this report, we investigated the expression of VEGF-C and VEGFR-3 in human prostatic carcinoma tissue by using in situ hybridization and immunohistochemical staining respectively. Expression of VEGF-C mRNA in prostatic carcinoma was significantly higher in lymph node- positive group than in lymph node-negative group. In addition, the number of VEGFR-3-positive vessels was increased in stroma surrounding VEGF-C-positive prostatic carcinoma cells. These results suggest that the expression of VEGF-C in prostatic carcinoma cells is implicated in the lymph node metastasis. Keywords: prostatic carcinoma; vascular endothelial growth factor-C; VEGF receptor-3; lymph node metastasis Prostatic carcinoma is one of the major cancers in men. It is known denoted VEGF-C and -D, were cloned (Joukov et al, 1996; Achen that the progression of the disease is highly associated with meta- et al, 1998). Receptors for VEGF-C and -D are VEGFR-3 (Flt-4) stasis to the bone and the lymph nodes (Slack et al, 1986). The (Pajusola et al, 1992) and VEGFR-2. VEGFR-2 has an affinity for major therapy for extensive disease is androgen deprivation VEGF/VPF, whereas VEGFR-3 can bind specifically to VEGF-C therapy, whereas there are several ways to treat localized (non- and -D. The distribution of VEGFR-3 is highly restricted to the metastatic) prostatic cancer, including anti-androgen therapy, lymphatic endothelial cells (Kaipainen et al, 1995), suggesting that radical prostatectomy, radiotherapy and cryotherapy. The prog- VEGFR-3 is one of the specific markers for lymphatic endothelial nosis is dependent on the presence of lymph node metastasis cells. VEGF-C-transgenic mice revealed that an increase in the (Epstein et al, 1996). However, the molecular mechanisms under- diameter of lymphatic vessels was the major effect of VEGF-C lying lymph node metastasis are poorly examined. overexpression instead of an increase in number of vessels (Jeltsch Vascular endothelial growth factor (VEGF)/vascular perme- et al, 1997). In contrast, VEGF-C-coated thermanox disks ability factor (VPF) belongs to the platelet-derived growth factor markedly induced lymphangiogenesis (increase in number of (PDGF)/VEGF family, which is known as a potent inducer of lymphatic vessels) in the differentiated avian chorioallantoic angiogenesis (Dvorak et al, 1995; Ferrara and Davis-Smyth, membrane (Oh et al, 1997). These results suggest differences in 1997). VEGF receptor-1 (VEGFR-1; Flt-1) and VEGFR-2 (Flk- the effects of VEGF-C on embryonic and mature lymphatic 1/KDR) are receptor tyrosine kinases for VEGF/VPF (Ferrara and vessels. Davis-Smyth, 1997). These receptors are found to be largely In this study, we examined the expression of VEGF-C in human expressed on the vascular endothelial cells. VEGFR-2 has an prostatic carcinoma tissue and found that there was a significant ability to transduce signals for biological responses leading to correlation between the expression of VEGF-C and lymph node angiogenesis, including proliferation and migration of endothelial dissemination. Additionally, the number of VEGFR-3-positive cells in vitro, whereas the significance of Flt-1 was unclear vessels was increased in the surrounding stromal tissue of VEGF- (Waltenberger et al, 1994). Recently, Flt-1 was reported to trans- C positive prostatic carcinoma cells. These results indicate that the duce signals for migration and activation of monocytes (Barleon et determination of VEGF-C expression in prostatic carcinoma tissue al, 1996; Clauss et al, 1996). Gene targeting of VEGFR-1 and would be useful to predict lymph node metastasis and suggest a VEGFR-2 results in the fetal death associated with the lack of role for VEGF-C in lymphatic metastasis. normal vasculature in utero (Fong et al, 1995; Shalabi et al, 1995), indicating that VEGF receptors are important for vascular devel- MATERIALS AND METHODS opment. Recently, new members of the VEGF/VPF family, Tissue collection and preparation, and patients’ characteristics Received 8 June 1998 Revised 28 September 1998 Prostate cancer tissues from 26 patients were used in this study. Accepted 21 October 1998 All tissue specimens were obtained by 16- or 18-gauge needle Correspondence to: S Kanda transperineal biopsies under informed consent prior to treatment. 309 310 T Tsurusaki et al Tissue specimens for in situ hybridization (ISH) were fixed in 10% with 2 ´ SSC, the membranes were stained immunochemically neutral buffered formalin and embedded in paraffin, and some with anti-T-T IgG as described previously (Koji et al, 1996) and specimens for immunohistochemistry (IHC) were kept as fresh the signals were visualized by the incubation with 0.1 M phosphate –1 frozen sections. Histological grade was determined in each sample buffer, pH 7.5, containing 0.15 mg ml 3,3¢-diaminobenzidine-4 by using the Gleason grading system (Gleason et al, 1977) and the hydrochloric acid (HCl) (DAB), 0.01% hydrogen peroxide (H O ), 2 2 tissue area containing the primary grade site (predominant) was 0.025% CoCl and 0.02% NiSO (NH ) SO (Adams, 1981). 2 4 4 2 4 selected for further investigation. Serum prostatic specific antigen (PSA) was measured prior to the biopsy by using Tandem R assay. ISH for cultured cells Patients were examined for detection of metastasis with chest X- ray, abdominal ultrasonography, computerized tomography scan- Human prostatic adenocarcinoma cell lines, PC-3, DU145 and ning, magnetic resonance imaging and bone scintigraphy, and LNCap cells were grown in Ham’s F-12 medium supplemented clinical stage was assessed by the 1992 TNM system (Hermanek with 10% heated-inactivated fetal bovine serum (Life Tech. and Sobin, 1992). Patients were divided into three groups: group 1 Oriental, Tokyo, Japan). For ISH, cells were seeded into wells of consisted of seven cases with clinically localized, well-differenti- 8-well Lab-Tek chamber glass slides (Nalge Nunc International, ated (Gleason score 2–4) prostatic adenocarcinoma; group 2 Naperville, IL, USA) and cultured overnight. ISH of these cells consisted of ten cases with bone metastases, which are thought to was performed according to the method described previously be the metastatic sites via blood vessels; and group 3 consisted of (Koji et al, 1996; Tsurusaki et al, 1998). Briefly, cells grown on nine cases with both bone and lymph node metastases. The mean glass slides were sequentially incubated with 0.2 N HCl for ages of patients in each group were 74.0, 75.0 and 69.6 years old, 20 min, 0.2% Triton X-100 in phosphate-buffered saline (PBS) for –1 respectively, and the differences were not statistically significant. 10 min, and 2 mg ml proteinase K at 37°C for 20 min. After fixa- There was no statistical difference in Gleason score and T stage tion with 4% paraformaldehyde in PBS for 5 min, the cells were –1 between group 2 and group 3. immersed in PBS containing 2 mg ml glycine for 30 min and kept in 4 ´ SSC containing 40% deionized formamide until use for hybridization. Hybridization was carried out at 37°C overnight Preparation of oligo-DNA probes –1 with 2 mg ml T-T dimerized antisense oligo-DNA for VEGF-C A 40-base sequence complementary to VEGF-C mRNA was dissolved in hybridization medium. The cells were washed with selected. The antisense and sense sequences were synthesized 50% formamide in 2 ´ SSC for 5 h followed by washing with PBS, together with two and three TTA repeats at the 5¢- and 3¢-ends and were then incubated with anti-T-T dimer monoclonal antibody of sequences for the T-T dimer formation. The sequences followed by the incubation with peroxidase-conjugated anti- of antisense and sense probes used in this study were mouse IgG. Peroxidase bound to tissue sections was visualized as 5¢-TTATTATGAGGTAGCTCGTGCTGGTGTTCATGCACT- described previously (Koji et al, 1996; Tsurusaki et al, 1998). GCAGCCCCTCACTATATTATTATT-3¢ and 5¢-TTATTAATAGT- Hybridization signals were considered positive when accumulated GAGGGGCTGCAGTGCATGAACACCAGCACGAGCTACCT black deposits were seen in individual cells. When the signal was CAATTATTATT-3¢, respectively. A computer-assisted search similar to that of the negative control, the sample was regarded as (GenBank Rel. 95.0, 1996) of the above antisense sequence, as ‘negative’. ‘Weak positive’ staining was assigned when the signals well as the sense sequence, showed no significant homology with were present, but only localized to the perinuclear area. ‘Strong any known sequences. The T-T dimer, which is used to provide a positive’ staining represented dense and clear signals throughout hapten for antibody recognition of the ISH probes (Koji et al, the cytoplasm. 1996), was introduced into oligo-DNAs by UV irradiation (254 –2 nm) with a dose of 12 000 J m . The generation of T-T dimer was ISH for prostatic carcinoma specimens verified immunochemically by using mouse monoclonal anti-T-T IgG (Kyowa Medex, Tokyo, Japan). Deparaffinized and rehydrated biopsy specimens were sequen- tially treated with 0.3% H O in methanol for 15 min, 0.2 N HCl 2 2 –1 for 20 min and 100 mg ml proteinase K at 37°C for 15 min. ISH Dot-blot hybridization for biopsy specimens was performed according to the method Various amounts of the sense oligo-DNA between 1 pg and 10 ng discribed in ISH for cultured cells. were spotted onto nitrocellulose membranes that had been soaked in 20 ´ suline–sodium citrate (SSC) [1 ´ SSC; 0.015 M sodium Control experiments for ISH citrate, pH 7.0 supplemented with 0.15 M sodium chloride (NaCl)]. After air-drying, the filters were baked at 80°C for 2 h, To evaluate the specificity of VEGF-C mRNA signals, a panel of followed by the incubation with prehybridization medium control experiments were conducted on sections adjacent to the containing 10 mM Tris-HCl, pH 7.4, 0.6 M NaCl, 1 mM EDTA, malignant area (Koji et al, 1996; Tsurusaki et al, 1998). A number of –1 –1 1 ´ Denhardt’s solution, 500 mg ml yeast tRNA, 250 mg ml consecutive tissue sections were hybridized with T-T dimerized salmon testicular DNA (Sigma, St Louis, MO, USA) and 40% oligo-DNA complementary to 28S rRNA as a positive control (v/v) deionized formamide at 37°C for 2 h. The membranes were (Yoshii et al, 1995) and also T-T dimerized VEGF-C sense oligo- –1 then incubated with 1 mg ml T-T dimerized oligo-DNA probe in DNA as a negative control in every run. Another group of tissue hybridization medium containing 10 mM Tris-HCl (pH 7.4), 0.6 M sections was hybridized with the VEGF-C antisense probe in the –1 NaCl, 1 mM EDTA, 1 ´ Denhardt’s solution, 250 mg ml yeast presence of an excess amount (50-fold) of either homologous or non- –1 tRNA, 125 mg ml salmon testicular DNA, 10% dextran sulphate homologous unlabelled oligo-DNA probe, to confirm the sequence and 40% deionized formamide at 37°C overnight. After washing specificity of the signals. To eliminate possible involvement of British Journal of Cancer (1999) 80(1/2), 309–313 © Cancer Research Campaign 1999 VEGF-C expression in prostatic cancer 311 Table 1 Summary of VEGF-C mRNA expression in primary prostatic carcinoma specimens determined by in situ hybridization Group 1 Group 2 Group 3 Gleason sum 4 ± 0 8.2 ± 1.1 8.9 ± 0.9 –1 PSA (ng ml ) 18.3 ± 10.9 213.2 ± 393.9 622.3 ± 799.4 T stage 2.3 ± 0.5 3.5 ± 0.5 3.0 ± 0.5 Metastatic sites None Bone Bone with lymph nodes VEGF-C mRNA expression Negative 4 6 0 Weakly positive 1 3 3 Strongly positive 2 1 6 Formalin-fixed, paraffin-embedded tissues were hybridized with T-T dimerized antisense probes for VEGF-C and hybridized probes were visualized by using anti-T-T antibody followed by peroxidase reaction. No staining of tumour cells is indicated as ‘negative’. ‘Weakly positive’ indicates a positive staining restricted to the perinuclear area, and ‘strongly positive’ indicates diffuse cytoplasmic staining in the tumour cells. Group 3 (with lymph node metastasis) demonstrated significantly stronger VEGF-C mRNA expression than other groups (without lymph node metastasis; P = 0.0083, by the c test). Figure 1 VEGF-C mRNA expression in human prostatic carcinoma cell lines, PC-3 (A–G), LNCaP (H) and DU-145 (I) by using the non-radioactive in RESULTS situ hybridization method. (A) 28S rRNA antisense probe; (B) VEGF-C sense probe; (C, H, I) VEGF-C antisense probe; (D) competition with excess Dot-blot hybridization with T-T dimerized synthetic amount (50-fold) of unlabelled probe; (E) competition with excess amount (50-fold) of non-homologous unlabelled oligo-DNA; (F) hybridization with oligo-DNA antisense probe followed by washing at excessively high stringency; (G) treatment with RNase-A before hybridization with VEGF-C antisense probe. To examine the sensitivity of synthesized antisense oligo-DNA, Magnification ´ 400 VEGF-C sense oligo-DNA on a nitrocellulose membrane was hybridized with T-T dimerized VEGF-C antisense oligo-DNA or T-T dimerized VEGF-C sense oligo-DNA. One picogram of the sense DNA was detected with the antisense probe, while the sense proteins and DNA in signal formation, some sections were –1 oligo-DNA detected no signal (data not shown). These results digested with 100 mg ml of ribonuclease-A (RNase-A) at 37°C indicate that the antisense probe was specific and had adequate for 60 min before the post-fixation step. In some sections, exces- sensitivity to be used in ISH studies. sively stringent washing conditions (50% formamide in 2 ´ SSC at 37°C for 5 h and 50% formamide in 0.1 ´ SSC at 45°C for 30 min) were applied after hybridization with the VEGF-C antisense VEGF-C mRNA expression in cultured human prostatic probes. carcinoma cells assessed by ISH To certify the quality of T-T dimerized VEGF-C antisense oligo- IHC for VEGFR-3 DNA in ISH study, expression of mRNA for VEGF-C in PC-3, LNCaP and DU145 cells was examined. VEGF-C mRNA was The monoclonal antibody raised against the extracellular domain expressed in the cytoplasmic area of more than 90% of these cells. of human VEGFR-3 (mouse IgG ) (Jussila et al, 1998) was used. In LNCaP cells, high expression of VEGF-C was observed, and The antibody could recognize VEGFR-3 expressed in tissues DU145 cells were found to express low amount of VEGF-C prepared as frozen sections. Fresh frozen prostatic tissue sections mRNA. To confirm the sequence specificity of the VEGF-C from six patients (two sections each from VEGF-C-negative, mRNA signal in these cell lines, we conducted various control VEGF-C weakly positive and VEGF-C strongly positive cancer experiments. A representative set of control experiments on PC-3 tissues) were fixed with acetone at 4°C and treated with 5% was shown in Figure 1A, B and D–G. When cells were hybridized normal goat serum in 1% bovine serum albumin in PBS. Then the –1 with the T-T dimerized oligo-DNA complementary to 28S rRNA, sections were incubated with 2 mg ml monoclonal antibody at signals were detected in the cytoplasmic area as well as in nucleoli room temperature overnight and then with horseradish peroxidase (Figure 1A), whereas no staining was found with T-T dimerized (HRP) conjugated goat anti-mouse IgG for 60 min. Peroxidase VEGF-C sense probe (Figure 1B). When cells were hybridized was visualized with DAB and H O , and the sections were 2 2 with VEGF-C antisense probe in the presence of excess amount of counterstained with methyl green and mounted. The consecutive –1 the homologous unlabelled oligo-DNA, cytoplasmic signal was sections were incubated with 2 mg ml normal mouse IgG in place much weaker (Figure 1D). On the other hand, the VEGF-C mRNA of the specific monoclonal antibody and used as a negative control. staining was not altered by the presence of excess amount of non- homologous unlabelled oligo-DNA (Figure 1E). When cells were Statistical analysis washed at excessively high stringency or were digested with RNase-A, a remarkable decrease in the staining was observed The c test was used to analyse the relationship of VEGF-C (Figure 1F, G). mRNA expression between groups 1 + 2 and 3. © Cancer Research Campaign 1999 British Journal of Cancer (1999) 80(1/2), 309–313 312 T Tsurusaki et al VEGFR-3 protein expression assessed by IHC Receptors for VEGF-C were identified as VEGFR-2 and -3 (Joukov et al, 1996). Since the expression of VEGFR-3 is highly restricted to lymphatic endothelial cells (Kaipainen et al, 1995), it has been suggested that VEGF-C is involved in lymphangiogen- esis (increase in the number of lymphatic vessels) in differentiated tissues. To examine the role of VEGF-C expression in prostatic AB C carcinoma, VEGFR-3 expression was studied in two fresh frozen Figure 2 VEGF-C mRNA expression of a grade 5 prostatic carcinoma sections from each of VEGF-C-negative, VEGF-C weakly posi- tissue visualized by using the non-radioactive in situ hybridization method. (A) 28S rRNA antisense probe used as a positive control; (B) VEGF-C tive and VEGF-C strongly positive groups by IHC. Two speci- antisense probe; (C) VEGF-C sense probe used as a negative control. mens in each group showed representative results and the typical Magnification x 200 tumour areas from each group are shown in Figure 3. In the VEGF-C mRNA-negative specimens, VEGFR-3-positive vessels were hardly observed, as shown in Figure 3A. However, in the VEGF-C mRNA expression in human prostatic VEGF-C mRNA-positive specimens, the number of VEGFR-3- carcinoma tissues positive vessels was clearly increased in the stromal tissues Twenty-six human prostatic carcinoma samples were examined surrounding tumour nests, as shown in Figure 3B and 3C. The for the expression of VEGF-C mRNA by ISH. Sixteen specimens VEGFR-3-positive vessels were hardly observed in the tumour out of 26 (61.5%) were estimated as positive, in which the cancer nests and none of the VEGFR-3-positive channels contained red epithelial cells were positive for VEGF-C mRNA, while other blood cells. types of cells, such as basal cells, stromal cells, endothelial cells and vascular smooth muscle cells, were negative for VEGF-C expression. The staining for VEGF-C mRNA was localized to the DISCUSSION cytoplasmic area of epithelial cells. A typical staining is shown in Figure 2. In group 1, three specimens out of seven (42.9%) were In this study, we demonstrated that the expression of VEGF-C in estimated as positive (two strongly positive and one weakly posi- human prostatic carcinoma cells was significantly correlated with tive). In group 2, four specimens out of ten (40%) were positive for the presence of lymph node metastasis. In addition, VEGFR-3- VEGF-C mRNA, and in group 3, all nine specimens (100%) were positive vessels (possibly lymphatic vessels), which were positive (Table 1). Group 3 (with lymph node metastases) demon- observed only in tumour stromal tissue, were increased in density strated significantly higher VEGF-C mRNA expression than other when VEGF-C was expressed in the prostatic carcinoma cells, groups (without lymph node metastases) (P = 0.0083) and no indicating a paracrine relationship between VEGF-C expressed in significant difference was observed between localized disease and prostatic cancer cells and its receptor, VEGFR-3, expressed in advanced disease (group 1 vs group 2). These data demonstrate adjacent stromal tissue. This is the first demonstration of the asso- that the expression of VEGF-C mRNA in prostatic carcinoma cells ciation of VEGF-C expression and lymphatic dissemination of is closely associated with the presence of lymph node metastasis. human carcinoma. ABC Figure 3 VEGFR-3 expression in fresh frozen sections of prostate carcinoma tissue examined by immunohistochemistry. (A) VEGF-C mRNA-negative specimen; (B) in VEGF-C mRNA weakly positive specimen; (C) VEGF-C mRNA strongly positive specimen. Arrows in (B) show the positive staining of VEGFR- 3. Magnification ´ 400 British Journal of Cancer (1999) 80(1/2), 309–313 © Cancer Research Campaign 1999 VEGF-C expression in prostatic cancer 313 for the tyrosine kinases VEGF receptor-2 (Flk1) and VEGF receptor-3 (Flt-4). There is no definitive marker for the identification of lymphatic Proc Natl Acad Sci USA 95: 548–553 endothelial cells yet. According to recent studies (Jussila et al, Adams JC (1981) Heavy metal intensification of DAB-based HRP reaction product. 1998), the combination of anti-PAL-E and anti-CD31 immunos- J Histochem Cytochem 29: 775 taining was useful to recognize lymphatic endothelial cells (PAL- Barleon B, Sozzani S, Zhou D, Weich H, Mantovani A and Marmé D (1996) Migration of human monocytes in response to vascular endothelial growth E-negative/CD31-positive) and VEGFR-3 expression was mostly factor (VEGF) is mediated via the VEGF receptor flt-1. Blood 87: 3336–3343 observed in lymphatic endothelial cells. Our results indicate that Clauss M, Weich H, Breier G, Knies U, Rock W, Waltenberger J and Risau W (1996) VEGFR-3 expression could be one of the good markers of The vascular endothelial growth factor receptor Flt-1 mediates biological lymphatic endothelial cells. In this study, VEGFR-3-positive cells activities. Implications for a functional role of placenta growth factor in were found only in connective tissue stroma surrounding tumour monocyte activation and chemotaxis. J Biol Chem 271: 17629–17634 Dvorak HF, Brown LF, Detmar M and Dvorak AM (1995) Vascular permeability nests and none of the VEGFR-3-positive channels contained red factor/vascular endothelial growth factor, microvascular permeability, and blood cells. These findings suggest that VEGFR-3-positive cells angiogenesis. Am J Pathol 146: 1029–1039 are possibly lymphatic endothelial cells. Epstein JI, Partin AW, Sauvageot J and Walsh PC (1996) Prediction of progression VEGF-C is a ligand for VEGFR-2 and -3. VEGFR-2 is expressed following radical prostatectomy: a multivariate analysis of 721 men with long- term follow-up. Am J Surg Pathol 20: 286–292 in both blood vessel and lymphatic endothelial cells. In the present Ferrara N and Davis-Smyth T (1997) The biology of vascular endothelial growth study, we could not observe a remarkable difference of the blood factor. Endocrine Rev 18: 4–25 vessel density between VEGF-C-positive and -negative prostatic Folkman J and Shing Y (1992) Angiogenesis. J Biol Chem 267: 10931–10934 carcinoma specimens (data not shown). Angiogenesis is stimulated Fong G-H, Rossant J, Gertenstein M and Breitman M (1995) Role of Flt-1 receptor by a variety of growth factors, including fibroblast growth factors, tyrosine kinase in regulation of assembly of vascular endothelium. Nature 376: 66–67 VEGF and transforming growth factor-b (Folkman and Shing, 1992). Gleason DF (1977) Histologic grading and clinical staging of prostatic carcinoma. In In prostatic carcinoma, many of these growth factors are known to be Urologic Pathology: Prostate, Tannenbaum M (ed), pp. 171–198. Lea & expressed (Steiner, 1993) and angiogenesis in prostatic carcinoma Febiger, Philadelphia may be regulated by these growth factors rather than VEGF-C. In Jeltsch M, Kaipainen A, Joukov V, Meng X, Lakso M, Rauvala H, Swartz M, Fukumura D, Jain RK and Alitaro K (1997) Hyperplasia of lymphatic vessels contrast, the expression of VEGFR-3 is highly restricted to lymphatic in VEGF-C transgenic mice. Science 276: 1423–1425 endothelial cells. The role of the signal transduction pathway via Joukov V, Pajusola K, Kaipainen A, Chilov D, Lahtinen I, Kukk E, Saksela O, VEGFR-3 in the biological responses of lymphatic endothelial cells Kalkkinen N and Alitalo K (1996) A novel vascular endothelial growth factor, has not been clarified yet. However, the present data is compatible VEGF-C, is a ligand for the Flt-4 (VEGFR-3) and KDR (VEGFR-2) receptor with the view that VEGF-C stimulates lymphangiogenesis in vivo. In tyrosine kinases. EMBO J 15: 290–298 Jussila L, Valtola R, Partanen TA, Salven P, Heikkilä P, Matikainen M-T, Renkonen transgenic mice, overexpression of VEGF-C resulted in the increase R, Kaipainen A, Detmar M, Tschachler E, Alitalo R and Alitalo K (1998) in diameter of lymphatic vessels, whereas an increase in the number Lymphatic endothelium and Kaposi’s sarcoma spindle cells detected by of vessels was not observed (Jeltsch et al, 1997). In the differentiated antibodies against the vascular endothelial growth factor receptor-3. Cancer chorioallantoic membrane, VEGF-C was stimulatory also for in vivo Res 58: 1599–1604 Kaipainen A, Korhonen J, Mustonen T, van Hinsbergh VWM, Fang G-H, Dumont lymphangiogenesis (Oh et al, 1997). The difference of VEGF-C D, Beitman M and Alitalo K (1995) Expression of the fms-like tyrosine kinase functions between developing and mature tissues may be due to the 4 gene becomes restricted to lymphatic endothelium during development. Proc presence of specific signal transduction pathways or an unidentified Natl Acad Sci USA 92: 3566–3570 specific receptor for VEGF-C, which could be expressed only in Koji T and Nakane PK (1996) Recent advances in molecular histochemical mature lymphatic endothelial cells and could be necessary for the techniques: in situ hybridization and southwestern histochemistry. J Electron Microsc 45: 119–127 increase in lymphatic vessels. Oh S-J, Jeltsch M, Birkenhäger R, McCarthy JEG, Weich HA, Christ B, Alitaro K In the present study, some clinically lymph node-negative prostatic and Wilting J (1997) VEGF and VEGF-C: Specific induction of angiogenesis carcinoma specimens also showed VEGF-C expression. It is possible and lymphangiogenesis in the differentiated avian chorioallantoic membrane. that VEGF-C-positive prostatic carcinoma patients without clinical Dev Biol 188: 96–109 Pajusola K, Aprelikova O, Korhonen J, Kaipainen A, Pertovaara L, Alitalo R and lymph node metastasis in the present study might have lymph node Alitalo K (1992) FLT4 receptor tyrosine kinase contains seven metastasis at microscopic level. Nevertheless, more importantly, the immunoglobulin-like loops and is expressed in multiple human tissues and cell expression of VEGF-C was significantly higher in lymph node- lines. Cancer Res 52: 5738–5743 positive patients than in node-negative patients, suggesting that the Shalabi F, Rossant J, Yamaguchi TP, Gertenstein M, Wu X-F, Breitman ML and examination of VEGF-C expression in prostatic carcinoma tissue Schuh AC (1995) Failure of blood island formation and vasculogenesis in Flk-1 dificient mice. Nature 376: 62–66 may be an indicator of the presence of lymph node metastasis. Slack NH, Lane WW, Priore RL and Murphy GP (1986) Prostatic cancer treated at a categorical center, 1980–1983. Urology 27: 205–213 ACKNOWLEDGEMENTS Steiner MS (1993) Role of peptide growth factors in the prostate: a review. Urology 42: 99–110 We are grateful to Dr Shin-ichi Kiyokawa for the preparation of Tsurusaki T, Koji T, Sakai H, Kanetake H, Nakane PK and Saito Y (1998) Cellular cryostat sections. We also thank Takumi Shimogama and Miki expression of beta-microseminoprotein (b-MSP) mRNA and its protein in Yoshimoto for their outstanding help. This work was supported by untreated prostate cancer. Prostate 35: 109–116 Waltenberger J, Claesson-Welsh L, Siegbahn A, Shibuya M and Heldin C-H (1994) a grant-in-aid for scientific research (A) (No. 06404059) from the Different signal transduction properties of KDR and Flt-1, two receptors for Ministry of Education, Science, Sports and Culture, Japan. vascular endothelial growth factor. J Biol Chem 269: 26988–26995 Yoshii A, Koji T, Ohsawa N and Nakane PK (1995) In situ localization of ribosomal REFERENCES RNAs in a reliable reference for hybridizable RNA in tissue sections. J Histochem Cytochem 43: 321–327 Achen MG, Jeltsch M, Kukk E, Makinen T, Vitali A, Wilks AF, Alitalo K and Stacker SA (1998) Vascular endothelial growth factor D (VEGF-D) is a ligand © Cancer Research Campaign 1999 British Journal of Cancer (1999) 80(1/2), 309–313

Journal

British Journal of Cancer – Springer Journals

Published: Mar 26, 1999

There are no references for this article.