Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Epigenetic Regulation of a Novel Tumor Suppressor Gene (hDAB2IP) in Prostate Cancer Cell Lines

Epigenetic Regulation of a Novel Tumor Suppressor Gene (hDAB2IP) in Prostate Cancer Cell Lines THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 5, Issue of January 31, pp. 3121–3130, 2003 © 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Epigenetic Regulation of a Novel Tumor Suppressor Gene □ S (hDAB2IP) in Prostate Cancer Cell Lines* Received for publication, August 12, 2002, and in revised form, November 20, 2002 Published, JBC Papers in Press, November 21, 2002, DOI 10.1074/jbc.M208230200 Hong Chen‡, Shinichi Toyooka§, Adi F. Gazdar§ , and Jer-Tsong Hsieh‡ From the Departments of ‡Urology and Pathology and the §Hamon Center for Therapeutic Oncology, University of Texas Southwestern Medical Center, Dallas, Texas 75390-9110 tate cancer (PCa) cell lines, and increased expression of hDAB2IP (human DAB2 (also known as DOC-2) inter- active protein) is a novel GTPase-activating protein for these proteins can suppress the growth of PCa (2, 6). modulating the Ras-mediated signal pathway. We dem- We have demonstrated that normal prostatic epithelial cells onstrate that the down-regulation of hDAB2IP mRNA in have elevated hDAB2IP mRNA levels compared with PCa cells, prostate cancer (PCa) cells is regulated by transcrip- which correlate with increased hDAB2IP promoter activity (1). tional levels. Analysis of the hDAB2IP promoter re- These data indicate that transcriptional regulation of vealed that it is a typical TATA-less promoter containing hDAB2IP is responsible for the down-regulation of hDAB2IP many GC-rich sequences. In this study, we delineated expression in PCa cells. However, little is known about the the potential impact of the epigenetic control of the underlying mechanisms for the regulation of hDAB2IP gene hDAB2IP promoter on its gene regulation in PCa. expression in prostatic epithelial cells. Acetylhistone H3 was associated with the hDAB2IP pro- One of the hallmarks of the regulation of gene transcription moter, and CpG islands remained almost unmethylated is local chromatin decondensation mediated by histone acety- in normal prostatic epithelia, but not in PCa cell lines. lation, which leads to a reduced association between chromo- Our data further indicated that trichostatin A (histone somal DNA and histones and subsequently increases the ac- deacetylase inhibitor) and 5-aza-2-deoxycytidine (DNA cession of high molecular mass protein complexes of the hypomethylation agent) acted cooperatively in modulat- transcription machinery. Conversely, histone deacetylation can ing hDAB2IP gene expression in PCa, whereas histone repress transcription by increasing histone-DNA interaction (8, acetylation played a more significant role in this event. 9). Additionally, we have found that the hDAB2IP promoter Moreover, a core promoter sequence from the hDAB2IP does not have a typical TATA box, but contains many GC-rich gene responsible for these treatments was identified. We sequences (1, 2). DNA hypermethylation, particularly in the therefore conclude that epigenetic regulation plays a GC-rich promoter region, results in transcription repression potential role in regulating hDAB2IP expression in PCa and that these results also provide a new therapeutic that is often associated with a number of tumor suppressor strategy for PCa patients. gene promoters, including Rb, p15, and p16 (10, 11). In this study, we delineated the roles of histone acetylation and DNA methylation in the regulation of the hDAB2IP gene in normal prostatic epithelia and PCa cells. The data presented in this hDAB2IP (human DAB2 interactive protein) is a novel work provide strong evidence for underlying mechanisms of the member of the Ras GTPase-activating family (1, 2). Our down-regulation of the hDAB2IP gene mediated by epigenetic recent data indicate that it interacts directly with DAB2 control in PCa cells. (Disabled-2; also known as DOC-2 for differentially expressed EXPERIMENTAL PROCEDURES in ovarian carcinoma-2) (2), which appears to be a tumor suppressor in cancer types (3–7). Both DAB2IP and DOC-2/ Cell Cultures and Treatments—Two human prostate cancer cell lines (LNCaP and PC-3) were maintained in T medium supplemented with DAB2 form a unique protein complex with negative regula- 5% fetal bovine serum as previously described (2). Two normal human tory activity that modulates the Ras-mediated signal path- prostate cell lines (PrEC, a primary prostatic epithelial cell line derived way (2). In the prostate gland, this complex is detected in the from a 17-year-old juvenile prostate; and PZ-HPV-7, an immortalized basal cell population (2, 6) and may orchestrate the differen- cell line derived from the peripheral zone of a normal prostate) were tiation and proliferation potential of these cells during gland maintained in a chemically defined medium (PrEGM) purchased from development. In contrast, loss of expression of DOC-2/DAB2 BioWhittaker, Inc. (Walkersville, MD). Cells were seeded at low density (6  10 /100-mm dish) 16 h prior to and hDAB2IP proteins is often detected in metastatic pros- treatment with different agents at the indicated final concentrations: 25, 100, or 200 nM trichostatin A (TSA; Sigma) or 1, 5, or 10 M 5-aza-2-deoxycytidine (5-Aza; Sigma). For TSA treatment, medium * This work was supported by NIDDK Grant DK-47657 from the containing fresh agent was changed every 24 h for 48 h. For 5-Aza National Institutes of Health and Department of Defense Grant treatment, medium containing fresh agent was changed every 48 h for PC970259. The costs of publication of this article were defrayed in part 96 h. For combined treatment, TSA was added at 24 h and changed at by the payment of page charges. This article must therefore be hereby 72 h, and 5-Aza was replaced at 48 h. Cells were collected at 96 h after marked “advertisement” in accordance with 18 U.S.C. Section 1734 treatment. solely to indicate this fact. Real-time Reverse Transcription-PCR Assay—Total cellular RNA The nucleotide sequence(s) reported in this paper has been submitted TM to the GenBank /EBI Data Bank with accession number(s) AF367051. □ S The on-line version of this article (available at http:/ /www.jbc. org) contains Supplemental Data and Supplemental Figs. 1 and 2. The abbreviations used are: PCa, prostate cancer; TSA, trichostatin To whom correspondence should be addressed: Dept. of Urology, A; 5-Aza, 5-aza-2-deoxycytidine; GAPDH, glyceraldehyde-3-phos- University of Texas Southwestern Medical Center, 5323 Harry Hines phate dehydrogenase; RLA, relative luciferase activity; ChIP, chroma- Blvd., Dallas, TX 75390-9110. Tel.: 214-648-3988; Fax: 214-648-8786; tin immunoprecipitation; PSA, prostate-specific antigen; HDAC, his- E-mail: [email protected]. tone deacetylase. This paper is available on line at http://www.jbc.org 3121 This is an Open Access article under the CC BY license. 3122 Epigenetic Regulation of hDAB2IP Gene Expression TABLE I PCR primers used on bisulfite-treated DNA and in ChIP assays R  AorG;Y  CorT. Genomic PCR target Primer name Primer 5–3 sequence Target size positions bp Bisulfite-treated DNA F-PmIIa GGATTTTTTTAGGTGGGTGT 236 522/503 R-PmIIa CCCTAAACCRCTATTACCTTAAC 236 285/308 F-PmIIb GTTAAGGTAATAGYGGTTTAGGG 397 308/285 R-PmIIb ACRAACTCACCTCTCATTATCC 397 89/68 F-PmI GGTGAGTAGAAGAGAGGAGAGTA 694 282/304 R-PmI CCTAAACCCTAAAAAACTATATCC 694 975/952 Immunoprecipitated DNA (ChIP) F-PII (outer) CGCTCTGGGAAGGAAAGTCG 419 704/685 F-PII (inner) ATTCCTCCAGGTGGGTGTGG 233 520/501 R-PII (inner) CTAAGCCGCTGTTGCCTTGGC 233 287/308 R-PII (outer) CCTAAGCCGCTGTTGCCTTG 419 286/306 F-PI (outer) GGGGAAGGGTGAACATCTGG 486 539/558 F-PI (inner) CCTGCTTTCTGTTTCCTTCTCCTG 105 768/791 R-PI (inner) TTGAACCACCTCCTCCTCCCTCTC 105 873/850 R-PI (outer) GCCTGTGCCTAAGTGGAAAGG 486 1025/1005 was isolated from PC-3, LNCaP, and PZ-HPV-7 cells using RNAzol B activities were assayed as previously described (1, 12). The protein (Tel-Test, Inc., Friendswood, TX) according to the manufacturer’s in- concentration of each extract was measured using the Bio-Rad protein structions. Two micrograms of total cellular RNA were used in each assay. The relative luciferase activity (RLA) was calculated by normal- reaction. cDNA was synthesized and amplified using either the izing both -galactosidase and protein concentrations in each sample, hDAB2IP primer set (2 ng/l) (F-hDAB2IP, 5-TGGACGATGTGCTC- and the data were averaged from RLA in triplicate. TATGCC-3; and R-hDAB2IP, 5-GGATGGTGATGGTTTGGTAG-3)or Acid Extraction of Histone and Western Analysis—Cells were the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer set (6 scraped, centrifuged at 200  g for 10 min, and then suspended in 10 ng/l) (G3P7, 5-GAAGGTGGGTCGGAGTCAACG-3; and G3P4, 5- volumes of phosphate-buffered saline. Cells were spun down; pellets AGTGAGCTTCCCGTTCAGC-3)ina40-l reaction mixture contain- were suspended in 5 volumes of lysis buffer (10 mM HEPES (pH 7.9), ing 20 l of platinum qPCR Supermix-UDG (Invitrogen) and 4 lof 1.5 mM MgCl ,10mM KCl, 0.5 mM dithiothreitol, and 1.5 mM phen- SYBR Green I (final dilution of 1:10,000). The reactions were carried ylmethylsulfonyl fluoride); and sulfuric acid was added to a final out on a 96-well plate, and a PCR amplification protocol was followed concentration of 0.2 M, followed by incubation on ice for 30 min. After (95 °C for 3 min and 40 cycles of amplification at 95 °C for 30 s, 55 °C for centrifugation at 11,000  g for 10 min at 4 °C, the cell supernatant 30 s, and 72 °C for 1 min) using an iCycler iQ machine (Bio-Rad). A containing the acid-soluble fraction was retained. The supernatant quality control was carried out using both electrophoresis analysis on a was dialyzed twice against 200 ml of 0.1 M acetic acid for 1–2hand 2% NuSieve agarose gel (3:1; FMC Corp. BioProducts) and melting then dialyzed overnight against 200 ml of H O using Spectrapor curve analysis performed immediately after the end of amplification at molecular porous membrane tubing (Spectrum Medical Industries, 95 °C for 1 min and 55 °C for 1 min and 80 cycles of 0.5 °C increments Inc., Los Angeles, CA). The protein concentration was measured, and beginning at 55 °C. We also performed the standard curves for proteins were fractionated by SDS-PAGE (15%). Western blotting hDAB2IP and GAPDH to ensure the linearity and efficiency of both was carried out with an anti-acetylhistone H3 antibody (1:3000; 2 9 genes. The linear range of both genes is from 2  10 to 2  10 copies, Upstate Biotechnology, Inc., Lake Placid, NY). The same membrane and the efficiency of each reaction ranges from 92 to 97%. The relative was stripped and reprobed with an anti-histone H3 antibody (1:1000; induction of hDAB2IP mRNA was calculated as follows: C (threshold Upstate Biotechnology, Inc.). cycle) of each sample  mean of C  mean of C . The Chromatin Immunoprecipitation (ChIP) Assay—After treatment, t(hDAB2IP) t(GAPDH) C C t(sample) t(control) -fold induction of each sample  1/2 . formaldehyde was added to the cell medium at a final concentration Construction of Reporter Gene Vectors—To analyze the promoter of 1% for cross-linking proteins to DNA. Cells were washed, scraped region of hDAB2IP, a 7.6-kb fragment from bacterial artificial chromo- off with ice-cold phosphate-buffered saline, and resuspended in SDS TM some (BAC) clone 298A17 (GenBank /EBI accession number lysis buffer containing a mixture of protease inhibitors. An equal AL365274) containing the predicted first exon and additional 5-up- protein concentration of cell lysate from each sample was sonicated to stream sequence of the DAB2IP gene was subcloned into the EcoRI site reduce DNA fragments between 200 and 1000 bp. Once the cell debris of pBluescript SK() (Stratagene) (1). pGL3–1.6S, a 1.6-kb KpnI-XhoI was removed, the supernatant was diluted in ChIP dilution buffer fragment, was subcloned from this 7.6-kb element into the pGL3-Basic (1:10), and 1% of this supernatant (as input DNA) was collected, vector (Promega). Two putative promoter regions (P1, a 0.8-kb SfiI- purified, and subjected to genomic PCR with the primer sets de- XhoI fragment from 229 to 981; and P2, a 0.6-kb KpnI-Kpn2I frag- scribed in Table I. Samples were precleared with salmon sperm ment from 598 to 44) were subcloned into the pGL3-Basic vector (see DNA/protein A-agarose slurry (Upstate Biotechnology, Inc.) and in- Fig. 1A). cubated overnight at 4 °C with or without (as a negative control) To further analyze the regulation of hDAB2IP promoters, two sets of antibody. Immune complexes were collected by adding salmon sperm primers (F-PI (inner, 5-CCTGCTTTCTGTTTCCTTCTCCTG-3) and DNA/protein A-agarose slurry and incubated with 20 lof5 M NaCl R-PI (inner, 5-TTGAACCACCTCCTCCTCCCTCTC-3); F-PII (inner, at 65 °C to reverse DNA-protein cross-linking. DNA was then purified 5-ATTCCTCCAGGTGGGTGTGG-3) and R-PII (inner, 5-CCTAAGC- by proteinase K digestion, phenol extraction, and ethanol CGCTGTTGCCTTG-3)) were used to amplify the PI (768 to 873) precipitation. and PII (520 to 287) fragments. PCR fragments were cloned into The strand-specific nested PCR primers used for amplifying the pCR2.1-TOPO (Invitrogen), sequenced, and then subcloned into the hDAB2IP gene are indicated in Table I. PCR amplifications were per- pGL3-Basic vector using HindIII-XhoI sites. formed in a 50-l reaction mixture containing 2 l of DNA by the TM Cell Transfection and Luciferase Reporter Assay—We plated cells at addition of 2 units of ThermalAce DNA polymerase (Invitrogen). A a density of 1.0  10 cells/well on a six-well plate. After 16 h, we hot start was performed (98 °C for 3 min), followed by 30 cycles at 98 °C transfected the PZ-HPV-7 and PC-3 cell lines with both 0.8 gof for 30 s, 62 °C for 30 s, and 72 °C for 45 s. The PCR product from the PI TM reporter vectors and 0.2 gof -galactosidase vector (pCH110) using region (110 bp) was separated on 4% E-Gel (Invitrogen), and that FuGENE 6 (Roche Molecular Biochemicals). The LNCaP and PrEC from the PII region (230 bp) was separated on a 2% NuSieve agarose cells were transfected with the same amount of DNA with Lipo- gel (3:1). fectAMINE Plus transfection reagent (Invitrogen). Twenty-four hours Bisulfite Genomic Sequencing—High molecular mass genomic DNA after incubation, the transfected cells were treated with TSA for 24 h, was obtained from PrEC, PZ-HPV-7, LNCaP, and PC-3 cell lines and 5-Aza for 48 h, or a combination of both drugs by incubating with subjected to bisulfite modification (13, 14). Briefly, 1–2 g(5–10 l) of 5-Aza for 24 h and then adding TSA for an additional 24 h. After genomic DNA were denatured with NaOH (final concentration of 0.2 M), washing twice with cold phosphate-buffered saline, the cells were har- 30 lof10mM hydroquinone (Sigma), and 520 lof3 M sodium bisulfite vested with lysis buffer (Promega). Both luciferase and -galactosidase (Sigma) at pH 5 for 16 h at 50 °C. The modified samples were purified Epigenetic Regulation of hDAB2IP Gene Expression 3123 using Wizard DNA Clean-Up system desalting columns (Promega), both drugs and the underlying mechanism of the induction, we followed by ethanol precipitation. Bisulfite-modified DNA (100 ng) was transiently transfected PCa cells with pGL3-P1 or pGL3-P2 amplified by PCR in a 25-l reaction mixture containing the primers under the same treatment conditions. In PC-3 cells, TSA could indicated in Table I. A hot start was performed (95 °C for 5 min) by induce P1 promoter activity in a dose-dependent manner; how- adding 0.5 unit of HotStar Taq DNA polymerase (QIAGEN Inc., Valen- ever, 5-Aza only slightly induced this promoter activity (Fig. cia, CA). The PCR products were cloned into the TA cloning vector pCR2.1-TOPO. Four to eight individual clones were sequenced using 2A). The combination treatment exhibited an additive effect reverse and forward M13 primers. only on P1 activity. In contrast, a very different induction pattern was observed in LNCaP cells transfected with pGL3- RESULTS P1; only marginal induction of P1 activity was observed in Identification of Two hDAB2IP Promoters in Prostatic Epi- these cells after the different treatments (Fig. 2B). thelial Cell Lines—Two putative promoters, P1 (229 to 981, By transfecting pGL3-P2 into PC-3 cells, a dose-dependent located within the first intron) and P2 (598 to 44, located induction pattern of P2 activity was observed in these cells 5-upstream of exon Ia) (Fig. 1A), were identified using both the treated with either TSA or 5-Aza (Fig. 2C). In LNCaP cells, P2 TSSW program (human PII recognition using the TRANSFAC activity could also be induced by either TSA or 5-Aza in a Database) and experimental deletion analysis (1) of a 1662-bp dose-dependent manner (Fig. 2D), which differed from P1 ac- hDAB2IP locus surrounding the transcription initiation site tivity induced by these drugs (Fig. 2B). Again, in PC-3 and (1). As shown in Fig. 1B, there are many GC-rich sequences, LNCaP cells, the combined treatment with TSA and 5-Aza and potential transcription factor-binding sites were detected exhibited an additive effect only on P2 activity. In addition, we within this region using MacVector Version 6.5.3. determined both P1 and P2 activities in PC-3 and LNCaP cells To analyze the basal activity of each hDAB2IP promoter in with a different transfection protocol; the overall induction various prostate cells, luciferase reporter vector constructs pattern was consistent (see Fig. 1 in the Supplemental Mate- were generated. Using pGL3–1.6S, we detected the highest rial). Taken together, these results indicate that the P2 pro- luciferase activity in both PrEC and PZ-HPV-7 cells, an inter- moter is responsible for both TSA- and 5-Aza-induced mediate level in LNCaP cells, and the lowest level in PC-3 cells hDAB2IP gene expression in PC-3 and LNCaP cell lines. (Fig. 1C), correlating with the steady-state levels of hDAB2IP To evaluate the possibility of a global gene induction effect of mRNA in each cell line (1). Similar patterns of reporter gene TSA or 5-Aza on PCa cells, we examined the activity of the activity were detected in these four cell lines using either the prostate-specific antigen (PSA) gene promoter in LNCaP and P1 or P2 promoter (Fig. 1C). PC-3 cells treated with either agent. As shown in Fig. 2E,no Induction of hDAB2IP Gene Expression by a Hypomethyla- induction of PSA reporter activity was detected in both cell tion Agent (5-Aza) and/or a Histone Deacetylase Inhibitor lines treated with a single agent or a combination of both (TSA)—Apparently, the decreased hDAB2IP mRNA levels de- agents. In contrast, androgen could induce PSA reporter activ- tected in many human PCa cells (1) could be caused by its ity dramatically in LNCaP cells (androgen receptor-positive), reduced gene promoter activity (Fig. 1C). To understand the but not in PC-3 cells (androgen receptor-negative). Therefore, mechanism leading to the down-regulation of the hDAB2IP we believe that TSA or 5-Aza has a specific effect on regulating gene in human PCa cells, we first examined the role of epige- hDAB2IP gene expression in PCa cell lines. netic regulation of the hDAB2IP gene. The data from a ChIP Increased Levels of Acetylhistone H3 in the hDAB2IP Pro- assay demonstrated that the presence of acetylhistone H3 was moter Induced by TSA—To determine whether the TSA-in- associated with the PI and PII regions of hDAB2IP in both duced hDAB2IP gene expression correlated with the levels of PrEC and PZ-HPV-7 cells, but not in PC-3 and LNCaP cells (Fig. 1D), suggesting that histone acetylation may play a role in histone acetylation associated with the hDAB2IP promoter re- gion, we analyzed the steady-state levels of acetylhistone H3 in modulating hDAB2IP gene expression. Recent data also indi- cate that epigenetic controls such as histone acetylation and/or both PC-3 and LNCaP cells after TSA treatment. As shown in DNA methylation play cooperative roles in modulating gene Fig. 3A, Western blot analysis of PC-3 cells indicated that the expression, particularly genes involved in tumor suppression basal level of acetylhistone H3 was very low, whereas TSA (15, 16). We therefore treated these cells with TSA, 5-Aza, or a induced a dramatic elevation of the ratio between acetylhistone combination of both. The levels of hDAB2IP mRNA expression H3 and total histone H3. Comparing this with the no-treatment were evaluated by real-time reverse transcriptase-PCR using control, TSA induced a dose-dependent (ranging from 8- to GAPDH as an internal control. As shown in Table II, TSA 88-fold) elevation of acetylhistone H3. In contrast, the basal and/or 5-Aza failed to elicit any elevation of hDAB2IP mRNA level of acetylhistone H3 was very high in LNCaP cells (Fig. because the basal activity of the hDAB2IP promoter was very 3B). Therefore, we failed to detect any changes in the steady- high in PZ-HPV-7 cells (Fig. 1C). However, in PC-3 cells (Table state levels of acetylhistone H3 in LNCaP cells treated with II), either TSA or 5-Aza was able to induce hDAB2IP mRNA TSA. Nevertheless, it is still possible that TSA increases the expression. In contrast, the increased hDAB2IP mRNA levels acetylhistone H3 levels associated with the hDAB2IP promoter in LNCaP cells treated with a single agent were lower than region. those in PC-3 cells (Table II) because LNCaP cells had higher To analyze the status of acetylhistone associated with the endogenous hDAB2IP mRNA levels compared with PC-3 cells hDAB2IP promoter, a ChIP assay was performed using the (1). For the combination of both agents, the level of induction sequences corresponding to the PI (768 to 873) and PII exhibited an additive effect only in the PC-3 and LNCaP cell (520 to 287) regions (Fig. 1A). Elevated levels of acetylhis- lines. In some cases, we noticed that the mRNA levels after the tone H3 were clearly associated with the PI region in both PC-3 combination treatment were lower than those after the single- and LNCaP cells treated with TSA or the combination, but not agent treatment, which was caused by the toxicity of the drug with 5-Aza (Fig. 4A). Similarly, an accumulation of acetylhis- combination. tone H3 levels associated with the PII region was also detected Characterization of the hDAB2IP Promoter Regulated by in both cell lines treated with TSA or the combination (Fig. 4B). Histone Acetylation and DNA Methylation—To delineate which Interestingly, we also found that 5-Aza treatment could induce promoter could be induced by TSA, 5-Aza, or a combination of the accumulation of acetylhistone H3 in the PII region, but not in the PI region (Fig. 4B), because P2 (but not P1) activity could Available at genomic.sanger.ac.uk/gf/gf.htm. be induced in both PCa cell lines treated with 5-Aza (Fig. 2). A 3124 Epigenetic Regulation of hDAB2IP Gene Expression FIG.1. Characterization of hDAB2IP gene promoters. A, schematic representation of potential hDAB2IP promoters. The transcription start site (TSS)at 1 was predicted by MacVector Version 6.5.3. P1 (229 to 981) is within the first intron; P2 (598 to 44) is located 5-upstream of exon Ia. The depicted restriction endonucleases sites were used in subsequent cloning. PI (768 to 873) and PII (520 to 287) were used for ChIP assay. B, potential regulatory sequences of the hDAB2IP gene. Exon Ia of the hDAB2IP gene is boxed, and the putative cis-acting elements are underlined. ISRE, interferon-stimulated response element. C, differential promoter activities of the hDAB2IP gene in PrEC, PZ-HPV-7, PC-3, and LNCaP cell. The -fold RLA was calculated from the pGL3-Basic vector (taken as 1). D, determination of the levels of acetylhistone H3 associated with the hDAB2IP gene promoter in normal and malignant prostatic epithelia. The ChIP assay was carried out to determine the status of acetylhistone H3 associated with either the PI or PII region of the hDAB2IP gene promoter in PrEC, PZ-HPV-7, PC-3, and LNCaP cells. M, molecular mass markers; NC, negative control for PCR. similar phenomenon has also been observed in several different Although the ChIP assay provides a unique analysis of the genes treated with 5-Aza (10, 17). Also, some data suggest that specific chromatin DNA region that associates with acetylhis- DNA methylation and histone deacetylation can act coopera- tone proteins, the results need to be confirmed by function tively to silence tumor suppressor genes in cancer cells (18, 20). assays such as a reporter gene assay. Therefore, we investi- Epigenetic Regulation of hDAB2IP Gene Expression 3125 TABLE II methylated DNAs would be amplified equally. For the P1 region, Determination of hDAB2IP mRNA expression induced by TSA and PmI (spanning 35 CpG sites) was designed; and for the P2 region, 5-Aza by real-time reverse transcriptase-PCR PmIIa (spanning 30 CpG sites) and PmIIb (spanning 56 CpG Each data point was averaged from two different experiments per- sites) were designed (Fig. 6A) because we found more CpG sites formed in duplicate using real-time reverse transcriptase-PCR. After in the P2 region (86 sites) than in the P1 region (35 sites). The calculating the mean  S.D. of C for each sample, the S.D. of hDAB2IP from all data was 5% of its mean, and the S.D. of GAPDH from all detailed primer information is summarized in Table I. data was 9% of its mean. The fold induction was calculated as de- In the PmI region, PC-3 cells showed a partial methylation scribed under “Experimental Procedures” using the control (taken as 1) pattern, and LNCaP cells showed an almost completed meth- of each cell line. ND, not determined. ylation pattern. In contrast, PZ-HPV-7 cells showed a com- Cell line pleted unmethylation pattern, and PrEC cells contained very Combination PZ-HPV-7 PC-3 LNCaP few methylation sites (Fig. 6B). The density of methylation of -fold this region correlated inversely with the basal activity of the P1 TSA (nM)/5-Aza (M) promoter in all cells examined (Fig. 1C). 0/0 1.00 1.00 1.00 In the PmIIa region, both normal prostate cell lines showed 25/0 0.83 4.02 1.88 an almost completed unmethylated pattern. However, LNCaP 100/0 0.80 5.05 2.42 cells contained low densities of methylation, whereas PC-3 200/0 0.83 8.31 2.44 showed a significantly higher degree of methylation pattern 0/1 0.83 3.82 3.58 0/5 0.92 4.03 4.47 (Fig. 6C). This evidence indicated that methylation density in 0/10 1.08 4.20 ND the PmIIa region inversely correlated with the basal activity of 25/1 1.07 8.02 5.63 P2 in these cells (Fig. 1C). Interestingly, in the PmIIb region, 100/5 0.97 9.29 6.83 PC-3, PZ-HPV-7, and PrEC cells showed almost completed 200/10 ND 5.34 ND unmethylated patterns, and LNCaP cells contained few meth- ylation sites (data not shown). Taken together, these data gated the luciferase activity of two constructs, pGL3-PI (768 clearly indicate that the PmIIa region (522 to 285) in to 873) and pGL3-PII (520 to 287), in PC-3 and LNCaP hDAB2IP is the key regulatory sequence operative in prostatic cell lines after treatment. As shown in Fig. 5 (A and B), the epithelia. basal luciferase activity of the pGL3-PI construct was much DISCUSSION higher than that of the pGL3-P1 construct in both PC-3 and LNCaP cells (Fig. 2, A and B), suggesting that the deletion of The higher levels of hDAB2IP mRNA detected in normal 5- and 3-flanking sequences from the P1 region may contain prostatic epithelia compared with PCa cells are mainly regu- some negative elements. Overall, we detected a slight increase lated at the transcriptional level (1). In this study, we further in PI activity only in PC-3 cells treated with TSA or a combi- demonstrated that the activity of the hDAB2IP promoter is nation of both TSA and 5-Aza (Fig. 5A); however, no change more active in normal prostatic epithelia than in PCa cells (Fig. in PI activity was detected in LNCaP cells after treatment 1C). We also noticed that the 5-upstream regulatory region of (Fig. 5B). the hDAB2IP gene has GC-rich sequences, but no canonical We observed a dramatic induction of PII activity in PC-3 cells TATA boxes. This is a typical feature of the promoters of many after treatment (10 –18-fold increase with TSA and 14 –30-fold housekeeping genes and of 40% of tissue-specific genes (24). increase with the combination) (Fig. 5C). Using 5-Aza, an Although various mechanisms may underlie this repression in 3-fold induction of PII activity was detected in PC-3 cells. A PCa cells, our data demonstrate that histone acetylation and/or similar induction profile of PII activity was detected in LNCaP DNA methylation plays a crucial role in modulating hDAB2IP cells (Fig. 5D). For example, TSA alone induced an 6 –14-fold gene expression in PCa cells. The treatment of PCa cell lines increase in PII activity, whereas the combination treatment such as PC-3 and LNCaP with TSA, 5-Aza, or a combination of induced an 8 – 44-fold increase in reporter gene activity. An both significantly increased the steady-state levels of hDAB2IP 2-fold induction of PII activity was observed in LNCaP cells mRNA (Table II). In contrast, TSA or 5-Aza could not induce treated with 5 M 5-Aza. In addition, we repeated these ex- hDAB2IP gene expression in normal prostatic epithelia (Table periments with a different transfection protocol; the overall II). These data indicate that both DNA methylation and his- induction pattern was consistent (see Fig. 2 in the Supplemen- tone deacetylation act cooperatively to silence the hDAB2IP tal Material). Taken together, these data suggest that PII gene in PCa cells. Such action is presumably mediated through (520 to 287) within the hDAB2IP promoter is the core a complex chromatin structure in which methyl-CpG-binding regulatory region for modulating hDAB2IP gene transcription. proteins are associated with histone deacetylases (HDACs) Characterization of the Methylation Status of the hDAB2IP (25, 26). Promoters in Prostate Cell Lines—It is known that aberrant Eukaryotic DNA is packed into a highly organized structure methylation (which is associated with gene silencing) in the (27). It has become increasingly clear that gene transcription promoters of tumor suppressor genes is commonly detected in from this tightly packed DNA is regulated by chromatin-re- cancer cells (18 –20). CpG islands appear to be critical sites modeling events, which can render DNA either more or less modulated by DNA methylation (21–23). Because the 5-regu- accessible to transcription factors. One of the key events in the latory region in the hDAB2IP promoter is GC-rich and the DNA regulation of eukaryotic gene expression is the post-transla- hypomethylation agent (5-Aza) can induce hDAB2IP gene ex- tional modification of nucleosomal histones, which convert re- pression, determining the methylation profile of the promoter gions of chromosomes to transcriptionally active or inactive. region in normal and cancerous cells could provide additional The most well studied post-translational modification of his- evidence for the role of DNA methylation in the regulation of tones is the acetylation of -amino groups on positively charged hDAB2IP during PCa development. In this experiment, two lysine residues in histone amino-terminal tail domains (7, 28), PCa cell lines (PC-3 and LNCaP) and two normal prostate cell which can release negatively charged DNA to interact with lines (PrEC and PZ-HPV-7) were subjected to bisulfite genomic transcription factors. The effect of histone acetyltransferases sequencing. With respect to the high GC content in the (29) is counterbalanced by the presence of (HDACs) (30). Ab- hDAB2IP promoter, primers were designed to avoid potential errant acetylation or deacetylation leads to such diverse disor- methylation sites (e.g. CpG) such that both methylated and un- ders as leukemia, epithelial cancers, fragile X syndrome, and 3126 Epigenetic Regulation of hDAB2IP Gene Expression FIG.2. Effect of TSA and/or 5-Aza on hDAB2IP or PSA promoter activity in PCa cell lines. Either PC-3 or LNCaP cells were transfected with pGL3-P1 (A and B), pGL3-P2 (C and D), or pPSA6.1 (E) under different treatment conditions, and luciferase activity was determined as described under “Experimental Procedures.” The -fold RLA was calculated using the pGL3-Basic vector (taken as 1). DHT, dihydrotestosterone. Rubinstein-Taybi syndrome (31). It is also known that HDACs containing both HDACs and ATP-dependent nucleosome-re- can function as transcriptional corepressors and are often pres- modeling activity, suggesting that some chromatin remodeling ent in multisubunit complexes such as Sin3 and Mi2 complexes is mediated by cellular complexes with HDAC activity. In con- (32–34). From recent reports, HDAC-containing complexes are trast, histone acetyltransferases such as CBP (cAMP-respon- involved in DNA methylation-mediated transcriptional silenc- sive element-binding protein-binding protein)/p300, CBP-asso- ing of various tumor suppressor genes (15, 16). Therefore, ciated factor (PCAF), and GCN5 have been identified in the targeting HDAC activity has become a new strategy of cancer protein complex of transcriptional activators (39 – 41). chemotherapy; several inhibitors have been developed and DNA hypermethylation has been implicated in parental gene tested in clinical trials (35). Recent studies by several groups imprinting, X chromosome inactivation, and endogenous retro- (36 –38) have demonstrated the existence of cellular complexes virus silencing (42– 46) as well as in the transcriptional silenc- Epigenetic Regulation of hDAB2IP Gene Expression 3127 FIG.3. Steady-state levels of his- tone H3 acetylation in PCa cells induced by TSA. After TSA treatment, the acid extract of nuclear protein from PC-3 cells (A) or LNCaP cells (B) was subjected to Western blot analysis and probed with an anti-acetylhistone H3 an- tibody (1:3000). The same membrane was stripped and reprobed with an anti-his- tone H3 antibody (1:1000) as an internal control. The values depicted beneath each lane represent the relative levels of acetylhistone H3 determined by normal- izing the amount of acetylhistone H3 pro- teins to that of total histone H3 proteins. FIG.4. Increased levels of histone H3 acetylation associated with the hDAB2IP promoter in PCa cells treated with TSA and/or 5-Aza. The ChIP assay was performed using an anti- acetylhistone H3 antibody. Nested PCR to detect the PI (A) and PII (B) regions was performed using the primer sets summa- rized in Table I. The input DNA (lower panels) was used as a positive control. M, 1-kb plus marker; NC, negative control without antibody. ing of tumor suppressor genes (47, 48). Hypermethylation of that the DNA fragment identified in the ChIP assay had pro- CpG islands is also found in the 3-ends of some genes; how- moter activity and could respond to TSA treatment (Fig. 5, C ever, the density of DNA methylation in promoter or first exon and D). Based on these results, we conclude that the status of regions correlates inversely with gene transcription (22, 49). It acetylhistone in the hDAB2IP promoter is critical for its gene has also been shown that transcription repression mediated by regulation. We also noticed that several potential transcription methyl-CpG-binding proteins involves an HDAC complex (50, factor-binding sites such as AP-1, AP-2, interferon-stimulated 51), indicating that there is a close relationship between DNA response element, CCAAT box-binding transcription factor-nu- methylation and histone deacetylation. clear factor 1 (CTF-NF1), and adenovirus early region 4 pro- Regarding the potential role of histone acetylation, data from moter transcription factor 1 (E4TF1) and a cluster of Sp1- the ChIP assays indicated that acetylhistone H3 was associ- binding sites located in this region (Fig. 1B). In particular, ated with the hDAB2IP promoter in normal epithelial cell lines members of the Sp1 family have been shown to act as positive (PrEC and PZ-HPV-7) expressing hDAB2IP proteins (Fig. 1D). or negative regulators of gene transcription. This mechanism is A dramatic increase in the levels of acetylhistone H3 associated dependent on the competition between the transcription re- with the hDAB2IP promoter was detected in PCa cells in the pressor HDAC1 and the transcription factor E2F1, which ac- presence of TSA (Fig. 4, A and B). We further demonstrated tives histone acetyltransferase (52). The presence of Sp1-bind- 3128 Epigenetic Regulation of hDAB2IP Gene Expression FIG.5. Characterization of the core promoter in the hDAB2IP gene regulated by TSA and/or 5-Aza. Constructs pGL3-PI (A and B) and pGL3-PII (C and D) derived from a ChIP assay were transfected into PC-3 or LNCaP cells under different treatment conditions, and RLA was determined as described under “Experimental Procedures.” The -fold RLA was calculated using the pGL3-Basic vector (taken as 1). ing elements in the proximal hDAB2IP gene promoter could dering the methylated DNA less accessible to transcription underlie the basis of gene repression mediated by histone factors (25). deacetylation (53, 54). Further investigation is warranted. In the hDAB2IP gene, there are two regions with potential Regarding the role of DNA methylation in regulating promoter activity: P1 and P2. In this study, we found that P2 hDAB2IP gene transcription, bisulfite sequencing data indi- promoter activity has a better correlation with the induction of cated that CpG islands remained almost unmethylated in nor- hDAB2IP mRNA in every tested cell line (Fig. 1C). The meth- mal prostate cell lines (PrEC and PZ-HPV-7) expressing the ylation profile of the P2 promoter in each cell line exhibited a transcriptionally active hDAB2IP gene (Fig. 1C) (1). However, reciprocal relationship between P2 reporter gene activity (Fig. in PCa cells (PC-3 and LNCaP), hypermethylation of CpG 5C) and the density of methylated cytosine residues (Fig. 6C). islands was commonly associated with the hDAB2IP promoter Furthermore, the P2 (but not P1) promoter was able to respond region (Fig. 6). 5-Aza could induce the expression of hDAB2IP to both TSA and 5-Aza treatment (Fig. 2). Nevertheless, TSA mRNA in PCa cells (Table II). Our results are consistent with seemed more potent than 5-Aza in eliciting P2 promoter ac- the promoter activity determined by the reporter gene assay tivity (Figs. 2 and 5). Therefore, we believe that the P2 region (Fig. 2). in the hDAB2IP gene represents a core promoter in prostatic Regarding the regulation of the hDAB2IP gene, our data epithelia. Our results also suggest that the deacetylhistone- clearly demonstrate that DNA methylation and histone mediated transcriptional silencing of the hDAB2IP gene may deacetylation can act cooperatively in silencing the hDAB2IP be a critical event during the carcinogenesis of PCa. gene (Table II and Fig. 4). It has been shown that DNA meth- In summary, cytosine methylation and histone deacetylation yltransferases recruited by an oncogene to a gene promoter in the hDAB2IP regulatory regions associated with the silenc- suppress the expression of this gene (55). Also, the binding of ing of hDAB2IP gene expression have been observed in PCa the methyl-CpG-binding protein complex (21) to methyl-CpG cells (PC-3 and LNCaP). Such a phenomenon seems to be islands competes with transcription factors and prevents them specific to cancer because it was not detected in normal pros- from binding to the promoter region. Recent data indicate that tate cells (PZ-HPV-7 and PrEC). Therefore, this gene could the methyl-CpG-binding protein can recruit HDACs, leading to potentially serve as a surrogate marker for early cancer detec- condensation of the local chromatin structure and thereby ren- tion. The outcome of this study also indicates that histone Epigenetic Regulation of hDAB2IP Gene Expression 3129 FIG.6. Characterization of the methylation status of the hDAB2IP gene promoter in human prostatic epithelial cells. A, schematic representation of the three separated positions in the hDAB2IP locus subjected to bisulfite sequencing analysis. B and C, methylation patterns in the PmI (282 to 975) and PmIIa (522 to 285) regions in human prostatic epithelial cells. High molecular mass DNA isolated from each sample was modified with sodium bisulfite and amplified by PCR using the primer sets indicated in Table I. The PCR product was subcloned, and each individual clone (horizontal rows) from every sample was sequenced. The position of each CpG dinucleotide (vertical bars) is labeled with the number representing its location in the hDAB2IP gene. E, unmethylated CpG; , methylated CpG. 3130 Epigenetic Regulation of hDAB2IP Gene Expression (1997) Nature 391, 251–260 deacetylase and DNA methyltransferase can be novel targets 28. Smale, S. T. (1994) in Transcription: Mechanisms and Regulation (Conaway, for PCa therapy. R. C., and Conaway, J. W., eds) pp. 63– 81, Raven Press, New York 29. Roth, S. Y., Denu, J. M., and Allis, C. D. (2001) Annu. Rev. Biochem. 70, 81–120 Acknowledgments—We thank Dr. Trapman for providing the PSA 30. Cress, W. D., and Seto, E. (2000) J. Cell. Physiol. 184, 1–16 reporter gene vector and Richard Hsu for editing this manuscript. 31. Timmermann, S., Lehrmann, H., Polesskaya, A., and Harel-Bellan, A. (2001) Cell. Mol. Life Sci. 58, 728 –736 REFERENCES 32. Wolffe, A. P., Urnov, F. D., and Guschin, D. (2000) Biochem. Soc. Trans. 28, 379 –386 1. Chen, H., Pong, R. C., Wang, Z., and Hsieh, J.-T. (2002) Genomics 79, 573–581 33. Heinzel, T., Lavinsky, R. M., Mullen, T. M., Soderstrom, M., Laherty, C. D., 2. Wang, Z., Tseng, C. P., Pong, R. C., Chen, H., McConnel, J. D., Navone, N., and Torchia, J., Yang, W. M., Brard, G., Ngo, S. D., Davie, J. R., Seto, E., Hsieh, J.-T. (2002) J. Biol. Chem. 277, 12622–12631 Disenman, R. N., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1997) 3. Fulop, V., Colitti, C. V., Genest, D., Berkowitz, R. S., Yiu, G. K., Ng, S. W., Nature 387, 43– 48 Szepesi, J., and Mok, S. C. (1998) Oncogene 17, 419 – 424 34. Zhang, Y., LeRoy, G., Seelig, H. P., Lane, W. S., and Reinberg, D. (1998) Cell 4. Fuzili, Z., Sun, W., Mittellstaedt, S., Cohen, C., and Xu, X. X. (1999) Oncogene 95, 279 –289 18, 3104 –3113 5. Zhou, J., and Hsieh, J.-T. (2001) J. Biol. Chem. 276, 27793–27798 35. Yoshida, M., Furumai, R., Nishiyama, M., Komatsu, Y., Nishino, N., and Horinouchi, S. (2001) Cancer Chemother. Pharmacol. 48, Suppl. 1, S20 –S26 6. Tseng, C. P., Brent, D. E., Li, Y.-M., Pong, R. C., and Hsieh, J.-T. (1998) Endocrinology 139, 3542–3553 36. Tong, J. K., Hassig C. A., Schnitzler, G. R., Kingston, R. E., and Schreiber, S. L. 7. Schwahn, D. J., and Medina, D. (1998) Oncogene 17, 1173–1178 (1998) Nature 395, 917–921 8. Jones, P. A., and Baylin, S. B. (2002) Nat. Rev. 3, 415– 428 37. Zhang, Y., Ng, H. H., Erdjument-Bromage, H., Tenpst, P., Bird, A., and 9. Kadonaga, J. T. (1998) Cell 92, 307–313 Reinberg, D. (1999) Genes Dev. 13, 1924 –1935 10. Jones, P. A., and Laird, P. W. (1999) Nat. Genet. 21, 163–167 38. Narlikar, G. J., Fan, H. Y., and Kingston, R. E. (2002) Cell 108, 475– 487 11. Magdinier, F., and Wolffe, A. P. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 39. Bannister, A. J., and Kouzarides, T. (1996) Nature 384, 641– 643 4990 – 4995 40. Yang, X. J., Ogryzko, V. V., Nishikawa, J., Howard, B. H., and Nakatani, Y. 12. Tseng, C. P., Ely, B. B., Pong, R. C., Wang, Z., Zhou, J., and Hsieh, J.-T. (1999) (1996) Nature 382, 319 –324 J. Biol. Chem. 274, 31981–31986 41. Brownell, J. E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D. G., Roth, 13. Herman, J. D., Graff, J. R., Myohanen, S., Nelkin, B. D., and Baylin, S. B. S. Y., and Allis, C. D. (1996) Cell 84, 843– 851 (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9821–9826 42. Li, E., Beard, C., and Jaenisch, R. (1993) Nature 366, 362–365 14. Clark, S. J., Harrison, J., Paul, C. L., and Frommer, M. (1994) Nucleic Acids 43. Tycko, B. (1997) Mutat. Res. 386, 131–140 Res. 22, 2990 –2997 44. Ferguson-Smith, A. C., and Surani, M. A. (2001) Science 293, 1086 –1089 15. Stimson, K. M., and Vertino, P. M. (2002) J. Biol. Chem. 277, 4951– 4958 45. Lorincz, M. C., Schubeler, D., and Groudine, M. (2001) Mol. Cell. Biol. 21, 16. Torres, L., Avila, M. A., Carretero, M. V., Latasa, M. U., Caballeria, J., 7913–7922 Lopez-Rodas, G., Boukaba, A., Lu, S. C., Franco, L., and Mato, J. M. (2000) 46. Kubota, T. (2001) Brain Dev. 23, Suppl. 1, S177–S181 FASEB J. 14, 95–102 47. Baylin, S. B., Herman, J. G., Graff, J. R., Vertino, P. M., and Issa, J. P. (1998) 17. Nakayama, T., Watanabe, M., Yamanaka, M., Hirokawa, Y., Suzuki, H., Ito, Adv. Cancer Res. 72, 141–196 H., Yatani, R., and Shiraishi, T. (2001) Lab. Invest. 7, 1049 –1056 48. Santourlidis, S., Warskulat, U., Florl, A. R., Maas, S., Pulte, T., Fischer, J., 18. Jones, P. L., Veenstra, G. J., Wade, P. A., Vermaak, D., Kass, S. U., Muller, W., and Schulz, W. A. (2001) Mol Carcinog. 32, 36 – 43 Landsberger, N., Stroubous, J., and Wolffe, A. P. (1998) Nat. Genet. 19, 49. Soria, J. C., Rodriguez, M., Liu, D. D., Lee, J. J., Hong, W. K., and Mao, L. 187–191 (2002) Cancer Res. 62, 351–355 19. Nan, X., Ng, H. H., Johnson, C. A., Laherty, C. D., Turner, B. M., Eisenman, 50. Fuks, F., Burgers, W. A., Brehm, A., Hughes-Davies, L., and Kouzarides, T. R. N., and Bird, A. (1998) Nature 393, 386 –389 (2000) Nat. Genet. 24, 88 –91 20. Ng, H. H., Zhang, Y., Hendrich, B., Johnson, C. A., Turner, B. M., Erdjument- 51. Rountree, M. R., Bachman, K. E., and Baylin, S. B. (2000) Nat. Genet. 25, Bromage, H., Tempst, P., Reinberg, D., and Bird, A. (1999) Nat. Genet. 23, 269 –277 58 – 61 52. Luo, R. X., Postigo, R. A., and Dean, D. C. (1998) Cell 92, 463– 473 21. Bird, A. P., and Wolffe, A. P. (1999) Cell 99, 451– 454 53. Doetzlhofer, A., Rotheneder, H., Lagger, G., Koranda, M., Kurtev, V., Brosch, 22. Jones, P. A., and Takai, D. (2001) Science 293, 1068 –1070 G., Wintersberger, E., and Seiser, C. (1999) Mol. Cell. Biol. 19, 5504 –5511 23. Wolffe, A. P., and Matzke, M. A. (1999) Science 286, 481– 486 54. Huang, L., Sowa, Y., Sakai, T., and Pardee, A. B. (2000) Oncogene 19, 24. Bird, A. P. (1986) Nature 321, 209 –213 5712–5719 25. Leonhardt, H., and Cardoso, M. C. (2000) J. Cell. Biochem. Suppl. 35, 78 – 83 26. Cameron, E. E., Bachman, K. E., Myohanen, S., Herman, J. G., and Baylin, 55. DiCroce, L., Raker, V. A., Corsaro, M., Fazi, F., Fanelli, M., Faretta, M., Fuks, S. B. (1999) Nat. Genet. 21, 103–107 F., LoCoco, F., Kouzarides, T., Nervi, C., Minucci, S., and Pelicci, P. G. 27. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., and Richmond, T. J. (2002) Science 295, 1079 –1082 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Biological Chemistry Unpaywall

Epigenetic Regulation of a Novel Tumor Suppressor Gene (hDAB2IP) in Prostate Cancer Cell Lines

Chen, Hong; Toyooka, Shinichi; Gazdar, Adi F.; Hsieh, Jer-Tsong
Journal of Biological Chemistry – Jan 1, 2003
Download PDF
10 pages

Loading next page...
 
/lp/unpaywall/epigenetic-regulation-of-a-novel-tumor-suppressor-gene-hdab2ip-in-tpaa0wMtvR

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0021-9258
DOI
10.1074/jbc.m208230200
Publisher site
See Article on Publisher Site

Abstract

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 5, Issue of January 31, pp. 3121–3130, 2003 © 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Epigenetic Regulation of a Novel Tumor Suppressor Gene □ S (hDAB2IP) in Prostate Cancer Cell Lines* Received for publication, August 12, 2002, and in revised form, November 20, 2002 Published, JBC Papers in Press, November 21, 2002, DOI 10.1074/jbc.M208230200 Hong Chen‡, Shinichi Toyooka§, Adi F. Gazdar§ , and Jer-Tsong Hsieh‡ From the Departments of ‡Urology and Pathology and the §Hamon Center for Therapeutic Oncology, University of Texas Southwestern Medical Center, Dallas, Texas 75390-9110 tate cancer (PCa) cell lines, and increased expression of hDAB2IP (human DAB2 (also known as DOC-2) inter- active protein) is a novel GTPase-activating protein for these proteins can suppress the growth of PCa (2, 6). modulating the Ras-mediated signal pathway. We dem- We have demonstrated that normal prostatic epithelial cells onstrate that the down-regulation of hDAB2IP mRNA in have elevated hDAB2IP mRNA levels compared with PCa cells, prostate cancer (PCa) cells is regulated by transcrip- which correlate with increased hDAB2IP promoter activity (1). tional levels. Analysis of the hDAB2IP promoter re- These data indicate that transcriptional regulation of vealed that it is a typical TATA-less promoter containing hDAB2IP is responsible for the down-regulation of hDAB2IP many GC-rich sequences. In this study, we delineated expression in PCa cells. However, little is known about the the potential impact of the epigenetic control of the underlying mechanisms for the regulation of hDAB2IP gene hDAB2IP promoter on its gene regulation in PCa. expression in prostatic epithelial cells. Acetylhistone H3 was associated with the hDAB2IP pro- One of the hallmarks of the regulation of gene transcription moter, and CpG islands remained almost unmethylated is local chromatin decondensation mediated by histone acety- in normal prostatic epithelia, but not in PCa cell lines. lation, which leads to a reduced association between chromo- Our data further indicated that trichostatin A (histone somal DNA and histones and subsequently increases the ac- deacetylase inhibitor) and 5-aza-2-deoxycytidine (DNA cession of high molecular mass protein complexes of the hypomethylation agent) acted cooperatively in modulat- transcription machinery. Conversely, histone deacetylation can ing hDAB2IP gene expression in PCa, whereas histone repress transcription by increasing histone-DNA interaction (8, acetylation played a more significant role in this event. 9). Additionally, we have found that the hDAB2IP promoter Moreover, a core promoter sequence from the hDAB2IP does not have a typical TATA box, but contains many GC-rich gene responsible for these treatments was identified. We sequences (1, 2). DNA hypermethylation, particularly in the therefore conclude that epigenetic regulation plays a GC-rich promoter region, results in transcription repression potential role in regulating hDAB2IP expression in PCa and that these results also provide a new therapeutic that is often associated with a number of tumor suppressor strategy for PCa patients. gene promoters, including Rb, p15, and p16 (10, 11). In this study, we delineated the roles of histone acetylation and DNA methylation in the regulation of the hDAB2IP gene in normal prostatic epithelia and PCa cells. The data presented in this hDAB2IP (human DAB2 interactive protein) is a novel work provide strong evidence for underlying mechanisms of the member of the Ras GTPase-activating family (1, 2). Our down-regulation of the hDAB2IP gene mediated by epigenetic recent data indicate that it interacts directly with DAB2 control in PCa cells. (Disabled-2; also known as DOC-2 for differentially expressed EXPERIMENTAL PROCEDURES in ovarian carcinoma-2) (2), which appears to be a tumor suppressor in cancer types (3–7). Both DAB2IP and DOC-2/ Cell Cultures and Treatments—Two human prostate cancer cell lines (LNCaP and PC-3) were maintained in T medium supplemented with DAB2 form a unique protein complex with negative regula- 5% fetal bovine serum as previously described (2). Two normal human tory activity that modulates the Ras-mediated signal path- prostate cell lines (PrEC, a primary prostatic epithelial cell line derived way (2). In the prostate gland, this complex is detected in the from a 17-year-old juvenile prostate; and PZ-HPV-7, an immortalized basal cell population (2, 6) and may orchestrate the differen- cell line derived from the peripheral zone of a normal prostate) were tiation and proliferation potential of these cells during gland maintained in a chemically defined medium (PrEGM) purchased from development. In contrast, loss of expression of DOC-2/DAB2 BioWhittaker, Inc. (Walkersville, MD). Cells were seeded at low density (6  10 /100-mm dish) 16 h prior to and hDAB2IP proteins is often detected in metastatic pros- treatment with different agents at the indicated final concentrations: 25, 100, or 200 nM trichostatin A (TSA; Sigma) or 1, 5, or 10 M 5-aza-2-deoxycytidine (5-Aza; Sigma). For TSA treatment, medium * This work was supported by NIDDK Grant DK-47657 from the containing fresh agent was changed every 24 h for 48 h. For 5-Aza National Institutes of Health and Department of Defense Grant treatment, medium containing fresh agent was changed every 48 h for PC970259. The costs of publication of this article were defrayed in part 96 h. For combined treatment, TSA was added at 24 h and changed at by the payment of page charges. This article must therefore be hereby 72 h, and 5-Aza was replaced at 48 h. Cells were collected at 96 h after marked “advertisement” in accordance with 18 U.S.C. Section 1734 treatment. solely to indicate this fact. Real-time Reverse Transcription-PCR Assay—Total cellular RNA The nucleotide sequence(s) reported in this paper has been submitted TM to the GenBank /EBI Data Bank with accession number(s) AF367051. □ S The on-line version of this article (available at http:/ /www.jbc. org) contains Supplemental Data and Supplemental Figs. 1 and 2. The abbreviations used are: PCa, prostate cancer; TSA, trichostatin To whom correspondence should be addressed: Dept. of Urology, A; 5-Aza, 5-aza-2-deoxycytidine; GAPDH, glyceraldehyde-3-phos- University of Texas Southwestern Medical Center, 5323 Harry Hines phate dehydrogenase; RLA, relative luciferase activity; ChIP, chroma- Blvd., Dallas, TX 75390-9110. Tel.: 214-648-3988; Fax: 214-648-8786; tin immunoprecipitation; PSA, prostate-specific antigen; HDAC, his- E-mail: [email protected]. tone deacetylase. This paper is available on line at http://www.jbc.org 3121 This is an Open Access article under the CC BY license. 3122 Epigenetic Regulation of hDAB2IP Gene Expression TABLE I PCR primers used on bisulfite-treated DNA and in ChIP assays R  AorG;Y  CorT. Genomic PCR target Primer name Primer 5–3 sequence Target size positions bp Bisulfite-treated DNA F-PmIIa GGATTTTTTTAGGTGGGTGT 236 522/503 R-PmIIa CCCTAAACCRCTATTACCTTAAC 236 285/308 F-PmIIb GTTAAGGTAATAGYGGTTTAGGG 397 308/285 R-PmIIb ACRAACTCACCTCTCATTATCC 397 89/68 F-PmI GGTGAGTAGAAGAGAGGAGAGTA 694 282/304 R-PmI CCTAAACCCTAAAAAACTATATCC 694 975/952 Immunoprecipitated DNA (ChIP) F-PII (outer) CGCTCTGGGAAGGAAAGTCG 419 704/685 F-PII (inner) ATTCCTCCAGGTGGGTGTGG 233 520/501 R-PII (inner) CTAAGCCGCTGTTGCCTTGGC 233 287/308 R-PII (outer) CCTAAGCCGCTGTTGCCTTG 419 286/306 F-PI (outer) GGGGAAGGGTGAACATCTGG 486 539/558 F-PI (inner) CCTGCTTTCTGTTTCCTTCTCCTG 105 768/791 R-PI (inner) TTGAACCACCTCCTCCTCCCTCTC 105 873/850 R-PI (outer) GCCTGTGCCTAAGTGGAAAGG 486 1025/1005 was isolated from PC-3, LNCaP, and PZ-HPV-7 cells using RNAzol B activities were assayed as previously described (1, 12). The protein (Tel-Test, Inc., Friendswood, TX) according to the manufacturer’s in- concentration of each extract was measured using the Bio-Rad protein structions. Two micrograms of total cellular RNA were used in each assay. The relative luciferase activity (RLA) was calculated by normal- reaction. cDNA was synthesized and amplified using either the izing both -galactosidase and protein concentrations in each sample, hDAB2IP primer set (2 ng/l) (F-hDAB2IP, 5-TGGACGATGTGCTC- and the data were averaged from RLA in triplicate. TATGCC-3; and R-hDAB2IP, 5-GGATGGTGATGGTTTGGTAG-3)or Acid Extraction of Histone and Western Analysis—Cells were the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer set (6 scraped, centrifuged at 200  g for 10 min, and then suspended in 10 ng/l) (G3P7, 5-GAAGGTGGGTCGGAGTCAACG-3; and G3P4, 5- volumes of phosphate-buffered saline. Cells were spun down; pellets AGTGAGCTTCCCGTTCAGC-3)ina40-l reaction mixture contain- were suspended in 5 volumes of lysis buffer (10 mM HEPES (pH 7.9), ing 20 l of platinum qPCR Supermix-UDG (Invitrogen) and 4 lof 1.5 mM MgCl ,10mM KCl, 0.5 mM dithiothreitol, and 1.5 mM phen- SYBR Green I (final dilution of 1:10,000). The reactions were carried ylmethylsulfonyl fluoride); and sulfuric acid was added to a final out on a 96-well plate, and a PCR amplification protocol was followed concentration of 0.2 M, followed by incubation on ice for 30 min. After (95 °C for 3 min and 40 cycles of amplification at 95 °C for 30 s, 55 °C for centrifugation at 11,000  g for 10 min at 4 °C, the cell supernatant 30 s, and 72 °C for 1 min) using an iCycler iQ machine (Bio-Rad). A containing the acid-soluble fraction was retained. The supernatant quality control was carried out using both electrophoresis analysis on a was dialyzed twice against 200 ml of 0.1 M acetic acid for 1–2hand 2% NuSieve agarose gel (3:1; FMC Corp. BioProducts) and melting then dialyzed overnight against 200 ml of H O using Spectrapor curve analysis performed immediately after the end of amplification at molecular porous membrane tubing (Spectrum Medical Industries, 95 °C for 1 min and 55 °C for 1 min and 80 cycles of 0.5 °C increments Inc., Los Angeles, CA). The protein concentration was measured, and beginning at 55 °C. We also performed the standard curves for proteins were fractionated by SDS-PAGE (15%). Western blotting hDAB2IP and GAPDH to ensure the linearity and efficiency of both was carried out with an anti-acetylhistone H3 antibody (1:3000; 2 9 genes. The linear range of both genes is from 2  10 to 2  10 copies, Upstate Biotechnology, Inc., Lake Placid, NY). The same membrane and the efficiency of each reaction ranges from 92 to 97%. The relative was stripped and reprobed with an anti-histone H3 antibody (1:1000; induction of hDAB2IP mRNA was calculated as follows: C (threshold Upstate Biotechnology, Inc.). cycle) of each sample  mean of C  mean of C . The Chromatin Immunoprecipitation (ChIP) Assay—After treatment, t(hDAB2IP) t(GAPDH) C C t(sample) t(control) -fold induction of each sample  1/2 . formaldehyde was added to the cell medium at a final concentration Construction of Reporter Gene Vectors—To analyze the promoter of 1% for cross-linking proteins to DNA. Cells were washed, scraped region of hDAB2IP, a 7.6-kb fragment from bacterial artificial chromo- off with ice-cold phosphate-buffered saline, and resuspended in SDS TM some (BAC) clone 298A17 (GenBank /EBI accession number lysis buffer containing a mixture of protease inhibitors. An equal AL365274) containing the predicted first exon and additional 5-up- protein concentration of cell lysate from each sample was sonicated to stream sequence of the DAB2IP gene was subcloned into the EcoRI site reduce DNA fragments between 200 and 1000 bp. Once the cell debris of pBluescript SK() (Stratagene) (1). pGL3–1.6S, a 1.6-kb KpnI-XhoI was removed, the supernatant was diluted in ChIP dilution buffer fragment, was subcloned from this 7.6-kb element into the pGL3-Basic (1:10), and 1% of this supernatant (as input DNA) was collected, vector (Promega). Two putative promoter regions (P1, a 0.8-kb SfiI- purified, and subjected to genomic PCR with the primer sets de- XhoI fragment from 229 to 981; and P2, a 0.6-kb KpnI-Kpn2I frag- scribed in Table I. Samples were precleared with salmon sperm ment from 598 to 44) were subcloned into the pGL3-Basic vector (see DNA/protein A-agarose slurry (Upstate Biotechnology, Inc.) and in- Fig. 1A). cubated overnight at 4 °C with or without (as a negative control) To further analyze the regulation of hDAB2IP promoters, two sets of antibody. Immune complexes were collected by adding salmon sperm primers (F-PI (inner, 5-CCTGCTTTCTGTTTCCTTCTCCTG-3) and DNA/protein A-agarose slurry and incubated with 20 lof5 M NaCl R-PI (inner, 5-TTGAACCACCTCCTCCTCCCTCTC-3); F-PII (inner, at 65 °C to reverse DNA-protein cross-linking. DNA was then purified 5-ATTCCTCCAGGTGGGTGTGG-3) and R-PII (inner, 5-CCTAAGC- by proteinase K digestion, phenol extraction, and ethanol CGCTGTTGCCTTG-3)) were used to amplify the PI (768 to 873) precipitation. and PII (520 to 287) fragments. PCR fragments were cloned into The strand-specific nested PCR primers used for amplifying the pCR2.1-TOPO (Invitrogen), sequenced, and then subcloned into the hDAB2IP gene are indicated in Table I. PCR amplifications were per- pGL3-Basic vector using HindIII-XhoI sites. formed in a 50-l reaction mixture containing 2 l of DNA by the TM Cell Transfection and Luciferase Reporter Assay—We plated cells at addition of 2 units of ThermalAce DNA polymerase (Invitrogen). A a density of 1.0  10 cells/well on a six-well plate. After 16 h, we hot start was performed (98 °C for 3 min), followed by 30 cycles at 98 °C transfected the PZ-HPV-7 and PC-3 cell lines with both 0.8 gof for 30 s, 62 °C for 30 s, and 72 °C for 45 s. The PCR product from the PI TM reporter vectors and 0.2 gof -galactosidase vector (pCH110) using region (110 bp) was separated on 4% E-Gel (Invitrogen), and that FuGENE 6 (Roche Molecular Biochemicals). The LNCaP and PrEC from the PII region (230 bp) was separated on a 2% NuSieve agarose cells were transfected with the same amount of DNA with Lipo- gel (3:1). fectAMINE Plus transfection reagent (Invitrogen). Twenty-four hours Bisulfite Genomic Sequencing—High molecular mass genomic DNA after incubation, the transfected cells were treated with TSA for 24 h, was obtained from PrEC, PZ-HPV-7, LNCaP, and PC-3 cell lines and 5-Aza for 48 h, or a combination of both drugs by incubating with subjected to bisulfite modification (13, 14). Briefly, 1–2 g(5–10 l) of 5-Aza for 24 h and then adding TSA for an additional 24 h. After genomic DNA were denatured with NaOH (final concentration of 0.2 M), washing twice with cold phosphate-buffered saline, the cells were har- 30 lof10mM hydroquinone (Sigma), and 520 lof3 M sodium bisulfite vested with lysis buffer (Promega). Both luciferase and -galactosidase (Sigma) at pH 5 for 16 h at 50 °C. The modified samples were purified Epigenetic Regulation of hDAB2IP Gene Expression 3123 using Wizard DNA Clean-Up system desalting columns (Promega), both drugs and the underlying mechanism of the induction, we followed by ethanol precipitation. Bisulfite-modified DNA (100 ng) was transiently transfected PCa cells with pGL3-P1 or pGL3-P2 amplified by PCR in a 25-l reaction mixture containing the primers under the same treatment conditions. In PC-3 cells, TSA could indicated in Table I. A hot start was performed (95 °C for 5 min) by induce P1 promoter activity in a dose-dependent manner; how- adding 0.5 unit of HotStar Taq DNA polymerase (QIAGEN Inc., Valen- ever, 5-Aza only slightly induced this promoter activity (Fig. cia, CA). The PCR products were cloned into the TA cloning vector pCR2.1-TOPO. Four to eight individual clones were sequenced using 2A). The combination treatment exhibited an additive effect reverse and forward M13 primers. only on P1 activity. In contrast, a very different induction pattern was observed in LNCaP cells transfected with pGL3- RESULTS P1; only marginal induction of P1 activity was observed in Identification of Two hDAB2IP Promoters in Prostatic Epi- these cells after the different treatments (Fig. 2B). thelial Cell Lines—Two putative promoters, P1 (229 to 981, By transfecting pGL3-P2 into PC-3 cells, a dose-dependent located within the first intron) and P2 (598 to 44, located induction pattern of P2 activity was observed in these cells 5-upstream of exon Ia) (Fig. 1A), were identified using both the treated with either TSA or 5-Aza (Fig. 2C). In LNCaP cells, P2 TSSW program (human PII recognition using the TRANSFAC activity could also be induced by either TSA or 5-Aza in a Database) and experimental deletion analysis (1) of a 1662-bp dose-dependent manner (Fig. 2D), which differed from P1 ac- hDAB2IP locus surrounding the transcription initiation site tivity induced by these drugs (Fig. 2B). Again, in PC-3 and (1). As shown in Fig. 1B, there are many GC-rich sequences, LNCaP cells, the combined treatment with TSA and 5-Aza and potential transcription factor-binding sites were detected exhibited an additive effect only on P2 activity. In addition, we within this region using MacVector Version 6.5.3. determined both P1 and P2 activities in PC-3 and LNCaP cells To analyze the basal activity of each hDAB2IP promoter in with a different transfection protocol; the overall induction various prostate cells, luciferase reporter vector constructs pattern was consistent (see Fig. 1 in the Supplemental Mate- were generated. Using pGL3–1.6S, we detected the highest rial). Taken together, these results indicate that the P2 pro- luciferase activity in both PrEC and PZ-HPV-7 cells, an inter- moter is responsible for both TSA- and 5-Aza-induced mediate level in LNCaP cells, and the lowest level in PC-3 cells hDAB2IP gene expression in PC-3 and LNCaP cell lines. (Fig. 1C), correlating with the steady-state levels of hDAB2IP To evaluate the possibility of a global gene induction effect of mRNA in each cell line (1). Similar patterns of reporter gene TSA or 5-Aza on PCa cells, we examined the activity of the activity were detected in these four cell lines using either the prostate-specific antigen (PSA) gene promoter in LNCaP and P1 or P2 promoter (Fig. 1C). PC-3 cells treated with either agent. As shown in Fig. 2E,no Induction of hDAB2IP Gene Expression by a Hypomethyla- induction of PSA reporter activity was detected in both cell tion Agent (5-Aza) and/or a Histone Deacetylase Inhibitor lines treated with a single agent or a combination of both (TSA)—Apparently, the decreased hDAB2IP mRNA levels de- agents. In contrast, androgen could induce PSA reporter activ- tected in many human PCa cells (1) could be caused by its ity dramatically in LNCaP cells (androgen receptor-positive), reduced gene promoter activity (Fig. 1C). To understand the but not in PC-3 cells (androgen receptor-negative). Therefore, mechanism leading to the down-regulation of the hDAB2IP we believe that TSA or 5-Aza has a specific effect on regulating gene in human PCa cells, we first examined the role of epige- hDAB2IP gene expression in PCa cell lines. netic regulation of the hDAB2IP gene. The data from a ChIP Increased Levels of Acetylhistone H3 in the hDAB2IP Pro- assay demonstrated that the presence of acetylhistone H3 was moter Induced by TSA—To determine whether the TSA-in- associated with the PI and PII regions of hDAB2IP in both duced hDAB2IP gene expression correlated with the levels of PrEC and PZ-HPV-7 cells, but not in PC-3 and LNCaP cells (Fig. 1D), suggesting that histone acetylation may play a role in histone acetylation associated with the hDAB2IP promoter re- gion, we analyzed the steady-state levels of acetylhistone H3 in modulating hDAB2IP gene expression. Recent data also indi- cate that epigenetic controls such as histone acetylation and/or both PC-3 and LNCaP cells after TSA treatment. As shown in DNA methylation play cooperative roles in modulating gene Fig. 3A, Western blot analysis of PC-3 cells indicated that the expression, particularly genes involved in tumor suppression basal level of acetylhistone H3 was very low, whereas TSA (15, 16). We therefore treated these cells with TSA, 5-Aza, or a induced a dramatic elevation of the ratio between acetylhistone combination of both. The levels of hDAB2IP mRNA expression H3 and total histone H3. Comparing this with the no-treatment were evaluated by real-time reverse transcriptase-PCR using control, TSA induced a dose-dependent (ranging from 8- to GAPDH as an internal control. As shown in Table II, TSA 88-fold) elevation of acetylhistone H3. In contrast, the basal and/or 5-Aza failed to elicit any elevation of hDAB2IP mRNA level of acetylhistone H3 was very high in LNCaP cells (Fig. because the basal activity of the hDAB2IP promoter was very 3B). Therefore, we failed to detect any changes in the steady- high in PZ-HPV-7 cells (Fig. 1C). However, in PC-3 cells (Table state levels of acetylhistone H3 in LNCaP cells treated with II), either TSA or 5-Aza was able to induce hDAB2IP mRNA TSA. Nevertheless, it is still possible that TSA increases the expression. In contrast, the increased hDAB2IP mRNA levels acetylhistone H3 levels associated with the hDAB2IP promoter in LNCaP cells treated with a single agent were lower than region. those in PC-3 cells (Table II) because LNCaP cells had higher To analyze the status of acetylhistone associated with the endogenous hDAB2IP mRNA levels compared with PC-3 cells hDAB2IP promoter, a ChIP assay was performed using the (1). For the combination of both agents, the level of induction sequences corresponding to the PI (768 to 873) and PII exhibited an additive effect only in the PC-3 and LNCaP cell (520 to 287) regions (Fig. 1A). Elevated levels of acetylhis- lines. In some cases, we noticed that the mRNA levels after the tone H3 were clearly associated with the PI region in both PC-3 combination treatment were lower than those after the single- and LNCaP cells treated with TSA or the combination, but not agent treatment, which was caused by the toxicity of the drug with 5-Aza (Fig. 4A). Similarly, an accumulation of acetylhis- combination. tone H3 levels associated with the PII region was also detected Characterization of the hDAB2IP Promoter Regulated by in both cell lines treated with TSA or the combination (Fig. 4B). Histone Acetylation and DNA Methylation—To delineate which Interestingly, we also found that 5-Aza treatment could induce promoter could be induced by TSA, 5-Aza, or a combination of the accumulation of acetylhistone H3 in the PII region, but not in the PI region (Fig. 4B), because P2 (but not P1) activity could Available at genomic.sanger.ac.uk/gf/gf.htm. be induced in both PCa cell lines treated with 5-Aza (Fig. 2). A 3124 Epigenetic Regulation of hDAB2IP Gene Expression FIG.1. Characterization of hDAB2IP gene promoters. A, schematic representation of potential hDAB2IP promoters. The transcription start site (TSS)at 1 was predicted by MacVector Version 6.5.3. P1 (229 to 981) is within the first intron; P2 (598 to 44) is located 5-upstream of exon Ia. The depicted restriction endonucleases sites were used in subsequent cloning. PI (768 to 873) and PII (520 to 287) were used for ChIP assay. B, potential regulatory sequences of the hDAB2IP gene. Exon Ia of the hDAB2IP gene is boxed, and the putative cis-acting elements are underlined. ISRE, interferon-stimulated response element. C, differential promoter activities of the hDAB2IP gene in PrEC, PZ-HPV-7, PC-3, and LNCaP cell. The -fold RLA was calculated from the pGL3-Basic vector (taken as 1). D, determination of the levels of acetylhistone H3 associated with the hDAB2IP gene promoter in normal and malignant prostatic epithelia. The ChIP assay was carried out to determine the status of acetylhistone H3 associated with either the PI or PII region of the hDAB2IP gene promoter in PrEC, PZ-HPV-7, PC-3, and LNCaP cells. M, molecular mass markers; NC, negative control for PCR. similar phenomenon has also been observed in several different Although the ChIP assay provides a unique analysis of the genes treated with 5-Aza (10, 17). Also, some data suggest that specific chromatin DNA region that associates with acetylhis- DNA methylation and histone deacetylation can act coopera- tone proteins, the results need to be confirmed by function tively to silence tumor suppressor genes in cancer cells (18, 20). assays such as a reporter gene assay. Therefore, we investi- Epigenetic Regulation of hDAB2IP Gene Expression 3125 TABLE II methylated DNAs would be amplified equally. For the P1 region, Determination of hDAB2IP mRNA expression induced by TSA and PmI (spanning 35 CpG sites) was designed; and for the P2 region, 5-Aza by real-time reverse transcriptase-PCR PmIIa (spanning 30 CpG sites) and PmIIb (spanning 56 CpG Each data point was averaged from two different experiments per- sites) were designed (Fig. 6A) because we found more CpG sites formed in duplicate using real-time reverse transcriptase-PCR. After in the P2 region (86 sites) than in the P1 region (35 sites). The calculating the mean  S.D. of C for each sample, the S.D. of hDAB2IP from all data was 5% of its mean, and the S.D. of GAPDH from all detailed primer information is summarized in Table I. data was 9% of its mean. The fold induction was calculated as de- In the PmI region, PC-3 cells showed a partial methylation scribed under “Experimental Procedures” using the control (taken as 1) pattern, and LNCaP cells showed an almost completed meth- of each cell line. ND, not determined. ylation pattern. In contrast, PZ-HPV-7 cells showed a com- Cell line pleted unmethylation pattern, and PrEC cells contained very Combination PZ-HPV-7 PC-3 LNCaP few methylation sites (Fig. 6B). The density of methylation of -fold this region correlated inversely with the basal activity of the P1 TSA (nM)/5-Aza (M) promoter in all cells examined (Fig. 1C). 0/0 1.00 1.00 1.00 In the PmIIa region, both normal prostate cell lines showed 25/0 0.83 4.02 1.88 an almost completed unmethylated pattern. However, LNCaP 100/0 0.80 5.05 2.42 cells contained low densities of methylation, whereas PC-3 200/0 0.83 8.31 2.44 showed a significantly higher degree of methylation pattern 0/1 0.83 3.82 3.58 0/5 0.92 4.03 4.47 (Fig. 6C). This evidence indicated that methylation density in 0/10 1.08 4.20 ND the PmIIa region inversely correlated with the basal activity of 25/1 1.07 8.02 5.63 P2 in these cells (Fig. 1C). Interestingly, in the PmIIb region, 100/5 0.97 9.29 6.83 PC-3, PZ-HPV-7, and PrEC cells showed almost completed 200/10 ND 5.34 ND unmethylated patterns, and LNCaP cells contained few meth- ylation sites (data not shown). Taken together, these data gated the luciferase activity of two constructs, pGL3-PI (768 clearly indicate that the PmIIa region (522 to 285) in to 873) and pGL3-PII (520 to 287), in PC-3 and LNCaP hDAB2IP is the key regulatory sequence operative in prostatic cell lines after treatment. As shown in Fig. 5 (A and B), the epithelia. basal luciferase activity of the pGL3-PI construct was much DISCUSSION higher than that of the pGL3-P1 construct in both PC-3 and LNCaP cells (Fig. 2, A and B), suggesting that the deletion of The higher levels of hDAB2IP mRNA detected in normal 5- and 3-flanking sequences from the P1 region may contain prostatic epithelia compared with PCa cells are mainly regu- some negative elements. Overall, we detected a slight increase lated at the transcriptional level (1). In this study, we further in PI activity only in PC-3 cells treated with TSA or a combi- demonstrated that the activity of the hDAB2IP promoter is nation of both TSA and 5-Aza (Fig. 5A); however, no change more active in normal prostatic epithelia than in PCa cells (Fig. in PI activity was detected in LNCaP cells after treatment 1C). We also noticed that the 5-upstream regulatory region of (Fig. 5B). the hDAB2IP gene has GC-rich sequences, but no canonical We observed a dramatic induction of PII activity in PC-3 cells TATA boxes. This is a typical feature of the promoters of many after treatment (10 –18-fold increase with TSA and 14 –30-fold housekeeping genes and of 40% of tissue-specific genes (24). increase with the combination) (Fig. 5C). Using 5-Aza, an Although various mechanisms may underlie this repression in 3-fold induction of PII activity was detected in PC-3 cells. A PCa cells, our data demonstrate that histone acetylation and/or similar induction profile of PII activity was detected in LNCaP DNA methylation plays a crucial role in modulating hDAB2IP cells (Fig. 5D). For example, TSA alone induced an 6 –14-fold gene expression in PCa cells. The treatment of PCa cell lines increase in PII activity, whereas the combination treatment such as PC-3 and LNCaP with TSA, 5-Aza, or a combination of induced an 8 – 44-fold increase in reporter gene activity. An both significantly increased the steady-state levels of hDAB2IP 2-fold induction of PII activity was observed in LNCaP cells mRNA (Table II). In contrast, TSA or 5-Aza could not induce treated with 5 M 5-Aza. In addition, we repeated these ex- hDAB2IP gene expression in normal prostatic epithelia (Table periments with a different transfection protocol; the overall II). These data indicate that both DNA methylation and his- induction pattern was consistent (see Fig. 2 in the Supplemen- tone deacetylation act cooperatively to silence the hDAB2IP tal Material). Taken together, these data suggest that PII gene in PCa cells. Such action is presumably mediated through (520 to 287) within the hDAB2IP promoter is the core a complex chromatin structure in which methyl-CpG-binding regulatory region for modulating hDAB2IP gene transcription. proteins are associated with histone deacetylases (HDACs) Characterization of the Methylation Status of the hDAB2IP (25, 26). Promoters in Prostate Cell Lines—It is known that aberrant Eukaryotic DNA is packed into a highly organized structure methylation (which is associated with gene silencing) in the (27). It has become increasingly clear that gene transcription promoters of tumor suppressor genes is commonly detected in from this tightly packed DNA is regulated by chromatin-re- cancer cells (18 –20). CpG islands appear to be critical sites modeling events, which can render DNA either more or less modulated by DNA methylation (21–23). Because the 5-regu- accessible to transcription factors. One of the key events in the latory region in the hDAB2IP promoter is GC-rich and the DNA regulation of eukaryotic gene expression is the post-transla- hypomethylation agent (5-Aza) can induce hDAB2IP gene ex- tional modification of nucleosomal histones, which convert re- pression, determining the methylation profile of the promoter gions of chromosomes to transcriptionally active or inactive. region in normal and cancerous cells could provide additional The most well studied post-translational modification of his- evidence for the role of DNA methylation in the regulation of tones is the acetylation of -amino groups on positively charged hDAB2IP during PCa development. In this experiment, two lysine residues in histone amino-terminal tail domains (7, 28), PCa cell lines (PC-3 and LNCaP) and two normal prostate cell which can release negatively charged DNA to interact with lines (PrEC and PZ-HPV-7) were subjected to bisulfite genomic transcription factors. The effect of histone acetyltransferases sequencing. With respect to the high GC content in the (29) is counterbalanced by the presence of (HDACs) (30). Ab- hDAB2IP promoter, primers were designed to avoid potential errant acetylation or deacetylation leads to such diverse disor- methylation sites (e.g. CpG) such that both methylated and un- ders as leukemia, epithelial cancers, fragile X syndrome, and 3126 Epigenetic Regulation of hDAB2IP Gene Expression FIG.2. Effect of TSA and/or 5-Aza on hDAB2IP or PSA promoter activity in PCa cell lines. Either PC-3 or LNCaP cells were transfected with pGL3-P1 (A and B), pGL3-P2 (C and D), or pPSA6.1 (E) under different treatment conditions, and luciferase activity was determined as described under “Experimental Procedures.” The -fold RLA was calculated using the pGL3-Basic vector (taken as 1). DHT, dihydrotestosterone. Rubinstein-Taybi syndrome (31). It is also known that HDACs containing both HDACs and ATP-dependent nucleosome-re- can function as transcriptional corepressors and are often pres- modeling activity, suggesting that some chromatin remodeling ent in multisubunit complexes such as Sin3 and Mi2 complexes is mediated by cellular complexes with HDAC activity. In con- (32–34). From recent reports, HDAC-containing complexes are trast, histone acetyltransferases such as CBP (cAMP-respon- involved in DNA methylation-mediated transcriptional silenc- sive element-binding protein-binding protein)/p300, CBP-asso- ing of various tumor suppressor genes (15, 16). Therefore, ciated factor (PCAF), and GCN5 have been identified in the targeting HDAC activity has become a new strategy of cancer protein complex of transcriptional activators (39 – 41). chemotherapy; several inhibitors have been developed and DNA hypermethylation has been implicated in parental gene tested in clinical trials (35). Recent studies by several groups imprinting, X chromosome inactivation, and endogenous retro- (36 –38) have demonstrated the existence of cellular complexes virus silencing (42– 46) as well as in the transcriptional silenc- Epigenetic Regulation of hDAB2IP Gene Expression 3127 FIG.3. Steady-state levels of his- tone H3 acetylation in PCa cells induced by TSA. After TSA treatment, the acid extract of nuclear protein from PC-3 cells (A) or LNCaP cells (B) was subjected to Western blot analysis and probed with an anti-acetylhistone H3 an- tibody (1:3000). The same membrane was stripped and reprobed with an anti-his- tone H3 antibody (1:1000) as an internal control. The values depicted beneath each lane represent the relative levels of acetylhistone H3 determined by normal- izing the amount of acetylhistone H3 pro- teins to that of total histone H3 proteins. FIG.4. Increased levels of histone H3 acetylation associated with the hDAB2IP promoter in PCa cells treated with TSA and/or 5-Aza. The ChIP assay was performed using an anti- acetylhistone H3 antibody. Nested PCR to detect the PI (A) and PII (B) regions was performed using the primer sets summa- rized in Table I. The input DNA (lower panels) was used as a positive control. M, 1-kb plus marker; NC, negative control without antibody. ing of tumor suppressor genes (47, 48). Hypermethylation of that the DNA fragment identified in the ChIP assay had pro- CpG islands is also found in the 3-ends of some genes; how- moter activity and could respond to TSA treatment (Fig. 5, C ever, the density of DNA methylation in promoter or first exon and D). Based on these results, we conclude that the status of regions correlates inversely with gene transcription (22, 49). It acetylhistone in the hDAB2IP promoter is critical for its gene has also been shown that transcription repression mediated by regulation. We also noticed that several potential transcription methyl-CpG-binding proteins involves an HDAC complex (50, factor-binding sites such as AP-1, AP-2, interferon-stimulated 51), indicating that there is a close relationship between DNA response element, CCAAT box-binding transcription factor-nu- methylation and histone deacetylation. clear factor 1 (CTF-NF1), and adenovirus early region 4 pro- Regarding the potential role of histone acetylation, data from moter transcription factor 1 (E4TF1) and a cluster of Sp1- the ChIP assays indicated that acetylhistone H3 was associ- binding sites located in this region (Fig. 1B). In particular, ated with the hDAB2IP promoter in normal epithelial cell lines members of the Sp1 family have been shown to act as positive (PrEC and PZ-HPV-7) expressing hDAB2IP proteins (Fig. 1D). or negative regulators of gene transcription. This mechanism is A dramatic increase in the levels of acetylhistone H3 associated dependent on the competition between the transcription re- with the hDAB2IP promoter was detected in PCa cells in the pressor HDAC1 and the transcription factor E2F1, which ac- presence of TSA (Fig. 4, A and B). We further demonstrated tives histone acetyltransferase (52). The presence of Sp1-bind- 3128 Epigenetic Regulation of hDAB2IP Gene Expression FIG.5. Characterization of the core promoter in the hDAB2IP gene regulated by TSA and/or 5-Aza. Constructs pGL3-PI (A and B) and pGL3-PII (C and D) derived from a ChIP assay were transfected into PC-3 or LNCaP cells under different treatment conditions, and RLA was determined as described under “Experimental Procedures.” The -fold RLA was calculated using the pGL3-Basic vector (taken as 1). ing elements in the proximal hDAB2IP gene promoter could dering the methylated DNA less accessible to transcription underlie the basis of gene repression mediated by histone factors (25). deacetylation (53, 54). Further investigation is warranted. In the hDAB2IP gene, there are two regions with potential Regarding the role of DNA methylation in regulating promoter activity: P1 and P2. In this study, we found that P2 hDAB2IP gene transcription, bisulfite sequencing data indi- promoter activity has a better correlation with the induction of cated that CpG islands remained almost unmethylated in nor- hDAB2IP mRNA in every tested cell line (Fig. 1C). The meth- mal prostate cell lines (PrEC and PZ-HPV-7) expressing the ylation profile of the P2 promoter in each cell line exhibited a transcriptionally active hDAB2IP gene (Fig. 1C) (1). However, reciprocal relationship between P2 reporter gene activity (Fig. in PCa cells (PC-3 and LNCaP), hypermethylation of CpG 5C) and the density of methylated cytosine residues (Fig. 6C). islands was commonly associated with the hDAB2IP promoter Furthermore, the P2 (but not P1) promoter was able to respond region (Fig. 6). 5-Aza could induce the expression of hDAB2IP to both TSA and 5-Aza treatment (Fig. 2). Nevertheless, TSA mRNA in PCa cells (Table II). Our results are consistent with seemed more potent than 5-Aza in eliciting P2 promoter ac- the promoter activity determined by the reporter gene assay tivity (Figs. 2 and 5). Therefore, we believe that the P2 region (Fig. 2). in the hDAB2IP gene represents a core promoter in prostatic Regarding the regulation of the hDAB2IP gene, our data epithelia. Our results also suggest that the deacetylhistone- clearly demonstrate that DNA methylation and histone mediated transcriptional silencing of the hDAB2IP gene may deacetylation can act cooperatively in silencing the hDAB2IP be a critical event during the carcinogenesis of PCa. gene (Table II and Fig. 4). It has been shown that DNA meth- In summary, cytosine methylation and histone deacetylation yltransferases recruited by an oncogene to a gene promoter in the hDAB2IP regulatory regions associated with the silenc- suppress the expression of this gene (55). Also, the binding of ing of hDAB2IP gene expression have been observed in PCa the methyl-CpG-binding protein complex (21) to methyl-CpG cells (PC-3 and LNCaP). Such a phenomenon seems to be islands competes with transcription factors and prevents them specific to cancer because it was not detected in normal pros- from binding to the promoter region. Recent data indicate that tate cells (PZ-HPV-7 and PrEC). Therefore, this gene could the methyl-CpG-binding protein can recruit HDACs, leading to potentially serve as a surrogate marker for early cancer detec- condensation of the local chromatin structure and thereby ren- tion. The outcome of this study also indicates that histone Epigenetic Regulation of hDAB2IP Gene Expression 3129 FIG.6. Characterization of the methylation status of the hDAB2IP gene promoter in human prostatic epithelial cells. A, schematic representation of the three separated positions in the hDAB2IP locus subjected to bisulfite sequencing analysis. B and C, methylation patterns in the PmI (282 to 975) and PmIIa (522 to 285) regions in human prostatic epithelial cells. High molecular mass DNA isolated from each sample was modified with sodium bisulfite and amplified by PCR using the primer sets indicated in Table I. The PCR product was subcloned, and each individual clone (horizontal rows) from every sample was sequenced. The position of each CpG dinucleotide (vertical bars) is labeled with the number representing its location in the hDAB2IP gene. E, unmethylated CpG; , methylated CpG. 3130 Epigenetic Regulation of hDAB2IP Gene Expression (1997) Nature 391, 251–260 deacetylase and DNA methyltransferase can be novel targets 28. Smale, S. T. (1994) in Transcription: Mechanisms and Regulation (Conaway, for PCa therapy. R. C., and Conaway, J. W., eds) pp. 63– 81, Raven Press, New York 29. Roth, S. Y., Denu, J. M., and Allis, C. D. (2001) Annu. Rev. Biochem. 70, 81–120 Acknowledgments—We thank Dr. Trapman for providing the PSA 30. Cress, W. D., and Seto, E. (2000) J. Cell. Physiol. 184, 1–16 reporter gene vector and Richard Hsu for editing this manuscript. 31. Timmermann, S., Lehrmann, H., Polesskaya, A., and Harel-Bellan, A. (2001) Cell. Mol. Life Sci. 58, 728 –736 REFERENCES 32. Wolffe, A. P., Urnov, F. D., and Guschin, D. (2000) Biochem. Soc. Trans. 28, 379 –386 1. Chen, H., Pong, R. C., Wang, Z., and Hsieh, J.-T. (2002) Genomics 79, 573–581 33. Heinzel, T., Lavinsky, R. M., Mullen, T. M., Soderstrom, M., Laherty, C. D., 2. Wang, Z., Tseng, C. P., Pong, R. C., Chen, H., McConnel, J. D., Navone, N., and Torchia, J., Yang, W. M., Brard, G., Ngo, S. D., Davie, J. R., Seto, E., Hsieh, J.-T. (2002) J. Biol. Chem. 277, 12622–12631 Disenman, R. N., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1997) 3. Fulop, V., Colitti, C. V., Genest, D., Berkowitz, R. S., Yiu, G. K., Ng, S. W., Nature 387, 43– 48 Szepesi, J., and Mok, S. C. (1998) Oncogene 17, 419 – 424 34. Zhang, Y., LeRoy, G., Seelig, H. P., Lane, W. S., and Reinberg, D. (1998) Cell 4. Fuzili, Z., Sun, W., Mittellstaedt, S., Cohen, C., and Xu, X. X. (1999) Oncogene 95, 279 –289 18, 3104 –3113 5. Zhou, J., and Hsieh, J.-T. (2001) J. Biol. Chem. 276, 27793–27798 35. Yoshida, M., Furumai, R., Nishiyama, M., Komatsu, Y., Nishino, N., and Horinouchi, S. (2001) Cancer Chemother. Pharmacol. 48, Suppl. 1, S20 –S26 6. Tseng, C. P., Brent, D. E., Li, Y.-M., Pong, R. C., and Hsieh, J.-T. (1998) Endocrinology 139, 3542–3553 36. Tong, J. K., Hassig C. A., Schnitzler, G. R., Kingston, R. E., and Schreiber, S. L. 7. Schwahn, D. J., and Medina, D. (1998) Oncogene 17, 1173–1178 (1998) Nature 395, 917–921 8. Jones, P. A., and Baylin, S. B. (2002) Nat. Rev. 3, 415– 428 37. Zhang, Y., Ng, H. H., Erdjument-Bromage, H., Tenpst, P., Bird, A., and 9. Kadonaga, J. T. (1998) Cell 92, 307–313 Reinberg, D. (1999) Genes Dev. 13, 1924 –1935 10. Jones, P. A., and Laird, P. W. (1999) Nat. Genet. 21, 163–167 38. Narlikar, G. J., Fan, H. Y., and Kingston, R. E. (2002) Cell 108, 475– 487 11. Magdinier, F., and Wolffe, A. P. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 39. Bannister, A. J., and Kouzarides, T. (1996) Nature 384, 641– 643 4990 – 4995 40. Yang, X. J., Ogryzko, V. V., Nishikawa, J., Howard, B. H., and Nakatani, Y. 12. Tseng, C. P., Ely, B. B., Pong, R. C., Wang, Z., Zhou, J., and Hsieh, J.-T. (1999) (1996) Nature 382, 319 –324 J. Biol. Chem. 274, 31981–31986 41. Brownell, J. E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D. G., Roth, 13. Herman, J. D., Graff, J. R., Myohanen, S., Nelkin, B. D., and Baylin, S. B. S. Y., and Allis, C. D. (1996) Cell 84, 843– 851 (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9821–9826 42. Li, E., Beard, C., and Jaenisch, R. (1993) Nature 366, 362–365 14. Clark, S. J., Harrison, J., Paul, C. L., and Frommer, M. (1994) Nucleic Acids 43. Tycko, B. (1997) Mutat. Res. 386, 131–140 Res. 22, 2990 –2997 44. Ferguson-Smith, A. C., and Surani, M. A. (2001) Science 293, 1086 –1089 15. Stimson, K. M., and Vertino, P. M. (2002) J. Biol. Chem. 277, 4951– 4958 45. Lorincz, M. C., Schubeler, D., and Groudine, M. (2001) Mol. Cell. Biol. 21, 16. Torres, L., Avila, M. A., Carretero, M. V., Latasa, M. U., Caballeria, J., 7913–7922 Lopez-Rodas, G., Boukaba, A., Lu, S. C., Franco, L., and Mato, J. M. (2000) 46. Kubota, T. (2001) Brain Dev. 23, Suppl. 1, S177–S181 FASEB J. 14, 95–102 47. Baylin, S. B., Herman, J. G., Graff, J. R., Vertino, P. M., and Issa, J. P. (1998) 17. Nakayama, T., Watanabe, M., Yamanaka, M., Hirokawa, Y., Suzuki, H., Ito, Adv. Cancer Res. 72, 141–196 H., Yatani, R., and Shiraishi, T. (2001) Lab. Invest. 7, 1049 –1056 48. Santourlidis, S., Warskulat, U., Florl, A. R., Maas, S., Pulte, T., Fischer, J., 18. Jones, P. L., Veenstra, G. J., Wade, P. A., Vermaak, D., Kass, S. U., Muller, W., and Schulz, W. A. (2001) Mol Carcinog. 32, 36 – 43 Landsberger, N., Stroubous, J., and Wolffe, A. P. (1998) Nat. Genet. 19, 49. Soria, J. C., Rodriguez, M., Liu, D. D., Lee, J. J., Hong, W. K., and Mao, L. 187–191 (2002) Cancer Res. 62, 351–355 19. Nan, X., Ng, H. H., Johnson, C. A., Laherty, C. D., Turner, B. M., Eisenman, 50. Fuks, F., Burgers, W. A., Brehm, A., Hughes-Davies, L., and Kouzarides, T. R. N., and Bird, A. (1998) Nature 393, 386 –389 (2000) Nat. Genet. 24, 88 –91 20. Ng, H. H., Zhang, Y., Hendrich, B., Johnson, C. A., Turner, B. M., Erdjument- 51. Rountree, M. R., Bachman, K. E., and Baylin, S. B. (2000) Nat. Genet. 25, Bromage, H., Tempst, P., Reinberg, D., and Bird, A. (1999) Nat. Genet. 23, 269 –277 58 – 61 52. Luo, R. X., Postigo, R. A., and Dean, D. C. (1998) Cell 92, 463– 473 21. Bird, A. P., and Wolffe, A. P. (1999) Cell 99, 451– 454 53. Doetzlhofer, A., Rotheneder, H., Lagger, G., Koranda, M., Kurtev, V., Brosch, 22. Jones, P. A., and Takai, D. (2001) Science 293, 1068 –1070 G., Wintersberger, E., and Seiser, C. (1999) Mol. Cell. Biol. 19, 5504 –5511 23. Wolffe, A. P., and Matzke, M. A. (1999) Science 286, 481– 486 54. Huang, L., Sowa, Y., Sakai, T., and Pardee, A. B. (2000) Oncogene 19, 24. Bird, A. P. (1986) Nature 321, 209 –213 5712–5719 25. Leonhardt, H., and Cardoso, M. C. (2000) J. Cell. Biochem. Suppl. 35, 78 – 83 26. Cameron, E. E., Bachman, K. E., Myohanen, S., Herman, J. G., and Baylin, 55. DiCroce, L., Raker, V. A., Corsaro, M., Fazi, F., Fanelli, M., Faretta, M., Fuks, S. B. (1999) Nat. Genet. 21, 103–107 F., LoCoco, F., Kouzarides, T., Nervi, C., Minucci, S., and Pelicci, P. G. 27. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., and Richmond, T. J. (2002) Science 295, 1079 –1082

Journal

Journal of Biological Chemistry – Unpaywall

Published: Jan 1, 2003

There are no references for this article.