Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Cord Blood-Derived Macrophage-Lineage Cells Rapidly Stimulate Osteoblastic Maturation in Mesenchymal Stem Cells in a Glycoprotein-130 Dependent Manner

Cord Blood-Derived Macrophage-Lineage Cells Rapidly Stimulate Osteoblastic Maturation in... In bone, depletion of osteoclasts reduces bone formation in vivo, as does osteal macrophage depletion. How osteoclasts and macrophages promote the action of bone forming osteoblasts is, however, unclear. Since recruitment and differentiation of multi-potential stromal cells/mesenchymal stem cells (MSC) generates new active osteoblasts, we investigated whether human osteoclasts and macrophages (generated from cord blood-derived hematopoietic progenitors) induce osteoblastic maturation in adipose tissue-derived MSC. When treated with an osteogenic stimulus (ascorbate, dexamethasone and b-glycerophosphate) these MSC form matrix-mineralising, alkaline phosphatase-expressing osteoblas- tic cells. Cord blood-derived progenitors were treated with macrophage colony stimulating factor (M-CSF) to form immature proliferating macrophages, or with M-CSF plus receptor activator of NFkB ligand (RANKL) to form osteoclasts; culture medium was conditioned for 3 days by these cells to study their production of osteoblastic factors. Both osteoclast- and macrophage-conditioned medium (CM) greatly enhanced MSC osteoblastic differentiation in both the presence and absence of osteogenic medium, evident by increased alkaline phosphatase levels within 4 days and increased mineralisation within 14 days. These CM effects were completely ablated by antibodies blocking gp130 or oncostatin M (OSM), and OSM was detectable in both CM. Recombinant OSM very potently stimulated osteoblastic maturation of these MSC and enhanced bone morphogenetic protein-2 (BMP-2) actions on MSC. To determine the influence of macrophage activation on this OSM-dependent activity, CM was collected from macrophage populations treated with M-CSF plus IL-4 (to induce alternative activation) or with GM-CSF, IFNc and LPS to cause classical activation. CM from IL-4 treated macrophages stimulated osteoblastic maturation in MSC, while CM from classically-activated macrophages did not. Thus, macrophage- lineage cells, including osteoclasts but not classically activated macrophages, can strongly drive MSC-osteoblastic commitment in OSM-dependent manner. This supports the notion that eliciting gp130-dependent signals in human MSC would be a useful approach to increase bone formation. Citation: Fernandes TJ, Hodge JM, Singh PP, Eeles DG, Collier FM, et al. (2013) Cord Blood-Derived Macrophage-Lineage Cells Rapidly Stimulate Osteoblastic Maturation in Mesenchymal Stem Cells in a Glycoprotein-130 Dependent Manner. PLoS ONE 8(9): e73266. doi:10.1371/journal.pone.0073266 Editor: Luc Malaval, INSERM U1059/LBTO, Universite´ Jean Monnet, France Received January 1, 2013; Accepted July 22, 2013; Published September 12, 2013 Copyright:  2013 Fernandes et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by an Australian National Health and Medical Research Council Project Grant, number 611805 (http://www.nhmrc.gov.au) and by the Victorian Government Operational Infrastructure Support Program (http://www.vic.gov.au/business-industry/science-research.html). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. "GCN and JMWQ are joint senior authors. * E-mail: [email protected] understood, the appropriate enhancement of such a process might Introduction form the basis of therapies that increase bone formation in patients Osteoblasts are specialised bone forming cells that derive from with low bone mass. local mesenchymal progenitors through multi-step commitment Maintenance of bone strength requires bone remodelling, and maturation processes that are dependent on transcription whereby old or damaged bone is removed by osteoclasts factors Runx2 and osterix [1]. Such progenitors include MSC (multinucleated bone resorbing cells of the myelomonocytic populations found in bone and in extraosseous tissues [2], highly lineage) [9–11] and the bone removed by osteoclasts subsequently proliferative cells expressing CD73, CD90 and CD105 but lacking replaced by osteoblast action. This, and the impairment of bone hematopoietic markers [3,4]. When purified, these cells can form formation following anti-osteoclastic therapies [12], suggest a functional osteoblasts both in vitro and in vivo [5–7] but also have functional link between osteoclast and osteoblast activity. Howev- the capacity to form other types of stromal cells, such as adipocytes er, osteoclast stimulation of mature osteoblast activity has not been [2,7,8]. While the MSC transition to osteoblasts is not fully convincingly demonstrated. An alternative possibility is that PLOS ONE | www.plosone.org 1 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation osteoclasts exert their influence on osteoblast progenitors, such as under protocols approved by Barwon Health Human Research local MSC. Indeed, MSC are chemotactically attracted to bone and Ethics Committee. sites undergoing remodelling [13]. It is notable, however, that, not all bone formation requires osteoclast action; osteal macrophages, Cell media and reagents + + a locally resident CD11b F4/80 cell population closely related to Eagle’s minimum essential medium (MEM), Dulbecco’s Modified osteoclasts, also exert a significant regulatory influence on bone Eagle’s Medium (DMEM), penicillin/streptomycin solutions, para- formation [14,15]. Osteal macrophages are located in close formaldehyde, Fast Garnet GBC, naphthol AS-BI-phosphate, proximity to osteoblasts and their removal greatly decreases bone collagenase-type-1, p-nitrophenylphosphate, p-nitrophenyl, dietha- formation [16], but the nature of their influence on osteoblasts is nolamine, Alizarin Red, cetylpyridinium chloride, dexamethasone, also unclear. Macrophages display many diverse functions central dimethyl sulphoxide (DMSO) and 3-(4,5-Dimethylthiazol-2-yl)-2,5- to innate immunity and adaptive immune responses, especially via diphenyltetrazolium bromide, insulin, 3-Isobutyl-1-methylxanthine antigen presentation and cytokine production, but also play (IBMX) and indomethacin were purchased from Sigma-Aldrich (St. regulatory and cytokine secretory roles in many tissues. Macro- Louis, USA). b-glycerophosphate disodium salt was purchased from phages respond to environmental stimuli by altering their Merck Millipore (Kilsyth, Australia). L-Ascorbic acid phosphate was behaviour and excitation states, notably their phenotype can be purchased from NovaChem Pty Ltd (Melbourne, Australia). Non- polarised by Th -cytokines towards classical activation and by essential amino acids (100X) and fetal bovine serum (FBS) were Th -cytokines towards a number of alternative activation states. 2 purchased from Bovogen (Melbourne, Australia). Human oncosta- An abundance of classically activated macrophages in the bone, tin-M (OSM) ELISA, anti-OSM and anti-gp130 blocking mono- typically seen in inflammatory joint diseases, is generally associated clonal antibodies and recombinant OSM, Wnt3A, GM-CSF, IL-4, with impaired bone formation, perhaps related to suppression of interferon-c (IFNc) and BMP-2 proteins were purchased from R&D osteoblastic Wnt responses [17]. Therefore, understanding the Systems (Minneapolis, USA). Ready-SET-Go human TNF, IL-1b influence of macrophages in different activation states on and IL-10 ELISAs were obtained from eBioscience (San Diego, CA). immature osteoblast-lineage cells is of great interest in bone Ficoll-Paque was purchased from GE Healthcare Life Sciences biology. (Rydalmere, Australia). MethoCult GF H4534 (Iscove’s medium We have previously employed cord blood-derived immature containing 1% methylcellulose, 30% FBS, 1% bovine serum myelomonocytic-lineage cells rich in colony forming units (CFU)- albumin, 10 M 2-mercaptoethanol, 2 mM L-glutamine, 10 ng/ GM as an excellent source of human osteoclast-forming cells mL recombinant human GM-CSF, 10 ng/mL IL-3, and 50 ng/mL [18,19]. Such cord blood mononuclear cells contain populations stem cell factor) was purchased from Stem-Cell Technologies 158–316 (Tullamarine, Australia). Soluble RANKL -GST fusion pro- broadly similar to immature myelomonocytic populations found in bone marrow. They are a rich source of immature macrophages tein (RANKL) was produced in-house from a construct kindly supplied by Dr. F. Patrick Ross (Hospital for Special Surgery, NY) as that proliferate with M-CSF or GM-CSF treatment [18,20] and, when treated with M-CSF plus RANKL, they form large numbers previously described [24]. All other reagents were analytical grade. of bone resorbing osteoclasts. Circulating adult CD14 monocytes also form osteoclasts with RANKL/M-CSF stimulus but do so far Generation of macrophages and osteoclasts more slowly and with much lower yield [20,21], reflecting their Collection of human umbilical cord blood, isolation of a preponderance of mature cells. We therefore employed the superior mononuclear cell fraction, expansion of CFU-GM-derived oste- cord blood-derived progenitors to generate both macrophages and oclast precursors and differentiation of mature human osteoclast osteoclast-rich cultures to study their effects on osteoblastic have been previously described [18]. Briefly, cord blood mono- differentiation in human MSC. A related approach was employed nuclear cell fraction (CBMC) was isolated by Ficoll-Paque density in the recent work of Guihard et al. [22] and Nicolaidou et al. [23] gradient centrifugation and the cells (3610 cells/culture) were who both found that CD14 adult monocytes enhanced osteoblastic suspended in 3.0 mL Methocult GF H4534 in 35 mm diameter (6- differentiation of MSC in a manner at least partly dependent on the well) plates and incubated at 37uC in humidified atmosphere of IL-6 family cytokine oncostatin M (OSM). Their observations 5% CO -air for 11 days to generate CFU-GM colonies (.80%) differed in certain key respects, however. Guihard et al. [22] found and CFU-M colonies (5–10%); hereafter these CBMC-derived that medium conditioned by CD14 (especially classically activated populations are referred to as CFU-GM, as previously described CD14 cells) strongly enhanced MSC maturation, while Nicolaidou [19]. These cell populations were pooled in PBS, centrifuged, and et al. [23] observed macrophage-MSC contact was essential for such resuspended in DMEM containing 10% heat inactivated (55uC for pro-osteoblastic activity. While these are seminal pieces of work, 30 minutes) FBS, non-essential amino acids, penicillin 50 U/mL; clearly further studies are needed that employ other macrophage streptomycin 50 mg/mL and 2 mM L-glutamine (DMEM/FBS) 6 2 lineage cells that MSC encounter in bone. In our studies we found and then cultured (7610 cells/175 cm flask) for 14 days with M- that both cord-blood derived macrophage and osteoclast popula- CSF (25 ng/mL) alone to generate proliferating macrophages, or tions produce soluble factors that very rapidly (within 4 days) drive M-CSF and RANKL (125 ng/mL) to generate osteoclasts. osteoblastic maturation in these MSC populations. This activity was To generate classically activated macrophages [25] CFU-GM 6 2 dependent upon OSM secretion but neither cell contact nor (7610 cells/175 cm flask) were cultured in MEM/FBS with one classical activation (in macrophages) was required for osteoblastic of the three following stimulations: (i) GM-CSF (10 ng/mL) for maturation of MSC. This provides further evidence for the role of 20 days, (ii) GM-CSF (10 ng/mL) for 14 days, followed by GM- osteoclasts, macrophages and OSM in the regulation of bone CSF (10 ng/mL) and interferon-gamma (IFNc) (1?? ng/mL) for metabolism. 6 days, or (iii) GM-CSF (10 ng/mL) for 14 days, followed by GM- CSF (10 ng/mL) and IFNc (100 ng/mL) for 3 days, then GM- CSF (10 ng/mL) and lipopolysaccharide (LPS; 100 ng/mL) for Materials and Methods 3 days. To generate macrophages undergoing alternative activa- 6 2 Ethics Statement tion, CFU-GM (7610 cells/175 cm flask) were cultured in Human umbilical cord blood and adipose tissue samples were MEM/FBS with M-CSF (25 ng/mL) for 11 days, then M-CSF obtained with informed, written consent from healthy donors (25 ng/mL) and IL-4 (100 ng/mL) for 6 days. PLOS ONE | www.plosone.org 2 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 1. Generating and characterising CFU-GM and CFU-GM-derived populations. (A) Schematic of CM generation as outlined in Materials and Methods: CFU-GM expanded from cord blood mononuclear cells (by incubation for 10 days in semi-solid medium and growth factors) were used to generate osteoclast and macrophage populations. CM from these cells were then used to treat MSC in experiments. (B) CFU-GM and macrophage populations (after CM collection) were analysed for CD45 expression by flow cytometry and these CD45 cells examined for CD14 and CD16 expression. (C) Representative photomicrographs of macrophage cultures showing phase contrast image (plastic substrate), nonspecific esterase (NSE) histochemical staining (dentine substrate), TRAP histochemical staining (dentine substrate), and dentine substrate of macrophage culture after the macrophages have been removed to reveal a complete lack of pit formation. (D) Photomicrographs of osteoclastic cultures, showing phase contrast image (plastic substrate, red arrowhead indicating osteoclasts), TRAP histochemical staining (dentine substrate, including expanded view with osteoclasts indicated by red arrowhead), and dentine substrate of osteoclast cultures after the osteoclasts were removed, which has been stained to reveal extensive pit formation. All scale bars = 100 mm. doi:10.1371/journal.pone.0073266.g001 as per manufacturer’s instructions (Sigma-Aldrich, Catalogue Confirmation of macrophage and osteoclast identity number 91A-1KT). Cells were also scraped from the culture Adherent macrophages were identified by a-napthyl acetate surface and incubated with phycoerythrin labelled anti-CD14 esterase (non-specific esterase; NSE) histochemistry. Cell were (anti-CD14-PE) or anti-CD16-FITC (BD Australia, North Ryde, fixed in 4% paraformaldehyde for 10 mins, then incubated in Fast Australia) antibodies and analysed by flow cytometry as below. Blue BB-based substrate solution prepared from a commercial kit PLOS ONE | www.plosone.org 3 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation in 200 mL DMEM/FBS plus M-CSF (25 ng/mL) and RANKL Table 1. Characterisation of CFU-GM and CFU-GM-derived M- (125 ng/mL) for 14 days, with medium and mediators replaced CSF-dependent macrophages by flow cytometry. twice weekly. After 14 days the cells were fixed in 1% formalin and histochemically reacted to confirm TRAP expression, then cells were removed from dentine slices by brief sonication in CFU-GM Cells M-CSF Treated Cells chloroform:methanol 2:1. Xylene-free black ink was applied to the CD45 57.46.4260.17% 94.9460.38% resorbed surface of each slice and residual ink removed by wiping CD14 35.4260.39% 98.0360.33% the dentine surface against absorbent paper, leaving resorption pits CD16 6.7760.61% 46.2861.06% stained black for assessment by transmission light microscopy [18]. + + CD14 /CD16 6.9260.51% 45.9560.39% + + Conditioned medium collection CD14 /CD86 0% 81.8560.92% After 14 days culture in either M-CSF (25 ng/mL), or M-CSF CD206 31.9260.29% 71.8960.86% (25 ng/mL) and RANKL (125 ng/mL) to produce macrophages + + CD14 /CD206 28.8460.27% 72.8960.40% and osteoclasts respectively, cells were cultured for a further 3 days CD34 3.7061.85% 1.9261.21% in DMEM/FBS with M-CSF (25 ng/mL) (Fig. 1A). This macrophage (MW-CM) and osteoclast conditioned medium (OC- CFU-GM cells taken immediately after their expansion in semi-solid medium CM) was filtered (0.22 mm pore size filters; Corning, Lowell, MA) were fluorescently stained by primary labelled antibodies for CD45, CD14, CD16, CD34, CD86 and CD206, and the proportion of positive cells estimated. and stored at 280uC until further use. For activated macrophages, These cells were compared with macrophages generated from CFU-GM cells by conditioned medium was collected from the last 3 days from each treatment with M-CSF (17 days); two independent experiments analysed in of the stimulated culture conditions. Cell culture medium triplicate, mean 6SEM shown. containing the same mediators was also incubated in the absence doi:10.1371/journal.pone.0073266.t001 of cells for 3 days and this aged medium subsequently used as the experimental control medium. Osteoclasts were identified by tartrate-resistant acid phosphatase (TRAP) expression and multinuclearity (.2 nuclei) [26]. To Isolation and culture of adipose tissue-derived MSC confirm the formation of functional osteoclasts, CFU-GM were Human adipose tissue was collected during elective surgery. To seeded (4610 /well) into 6 mm diameter tissue culture wells (96- isolate MSC, tissue was teased from blood vessels, minced with a well tissue culture plates) containing 28.3 mm slices of sperm scalpel blade, and digested for 30–45 min with 0.075% collage- whale dentine prepared as previously described [25] and cultured nase at 37uC with gentle agitation. Enzyme activity was Figure 2. Characterisation of MSCs and their differentiation. (A) FACS analysis of expanded adipose stromal cells in culture revealed a high proportion of cells expressing CD90, CD73 and CD105, indicating a population enriched in MSC; PE = phycoerythrin label, FITC = fluoroscein isothiocyanate label. To assess their osteogenic capacity, cells were cultured in medium with or without osteogenic factors (OSG; ascorbate, dexamethasone and b-glycerophosphate) for 7, 14 and 21 days and assessed (B) for ALP activity; (C) Photomicrograph ALP histochemical staining of MSC cultures after 0 and 21 days of OSG stimulus, the latter showing clusters of strongly ALP positive (blue) cells; bars = 100 mm. (D) The ability of the cells to form mineralised matrix was determined by Alizarin Red binding assay. Data displayed as mean 6 SEM with statistical significance determined by two-way ANOVA, General Linear Model, and Tukey’s post hoc test, n = 6, **p#0.01, ***p#0.001 relative to respective (no OSG) controls. doi:10.1371/journal.pone.0073266.g002 PLOS ONE | www.plosone.org 4 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 3. The effects of MW-CM and OC-CM on MSC mineralisation and metabolic activity. 10 MSC were cultured in 50% OC-CM or MW- CM with osteogenic factors for 14 days. (A) Metabolic activity of cultures assessed by MTT assay. (B) Matrix mineralisation, assessed by quantification of bound Alizarin Red, was greatly enhanced by OC-CM or MW-CM treatment of MSC cultured in osteogenic medium. (C) Representative photomicrographs of stained cultures from B; scale bars = 100 mm. Data displayed as mean 6 SEM. Statistical significance relative to controls (adjoining grey columns) determined by Two-Way ANOVA, GLM (A) and One-Way ANOVA, Tukey’s post hoc test (B), n = 6, *p#0.05, ***p#0.001 difference from control medium or as indicated with capped line. Control = 50% medium conditioned in the absence of cells. doi:10.1371/journal.pone.0073266.g003 neutralised with basal medium (DMEM containing 10% FBS and Differentiation of MSC in medium containing osteogenic penicillin 50 U/mL; streptomycin 50 mg/mL) and the cells were (OSG) factors centrifuged at 12006g for 10 mins, resuspended and filtered MSC (10 cells/well) were seeded in 6 mm diameter culture through a 100 mm cell strainer to remove remaining tissue debris. wells in DMEM/FBS and cultured overnight. For MSC differen- Cells were pelleted by centrifugation and seeded (10 cells) in tissue tiation time-course, cells were then cultured in osteogenic medium culture flasks in basal medium, then incubated at 37uCin (DMEM/FBS containing dexamethasone (100 nM) b-glycero- humidified atmosphere of 5% CO -air. Cells were passaged by phosphate (10 mM) and ascorbate-2-phosphate (100 mM)) and treatment with 0.025% trypsin/EDTA in PBS and diluted 1:10 in assessed for ALP activity and matrix mineralisation at 7, 14 and DMEM/FBS. MSC derived from individuals (unpooled) were 21 days of incubation. For conditioned medium experiments, employed in assays after 5 passages. MSC (10 cells/well) were seeded in 6 mm diameter culture wells and cultured in 50% conditioned medium plus 50% osteogenic medium; final concentrations in MSC cultures of dexamethasone b-glycerophosphate and ascorbate-2-phosphate were thus 50 nM, 5 mM and 50 mM respectively. Cells were assessed for ALP Figure 4. MW-CM and OC-CM stimulate MSC osteoblastic maturation. 10 MSC were cultured with 50% OC-CM, MW-CM or control medium as noted with osteogenic factors for 14 days and osteoblastic differentiation characteristics (other than matrix mineralisation) were assessed. (A) ALP activity in CM-treated MSC in the presence or absence of osteogenic factors (OSG; ascorbate and dexamethasone); n = 6. Effects of 14 days of MW-CM treatment (with OSG), on MSC mRNA levels of (B) Runx2 (C) OSX (D) PTH1R, determined by real-time RT-PCR. Data displayed as mean 6 SEM. Statistical significance determined by t-test (B,C,D) or One-Way ANOVA (Tukey’s post hoc test), (A, *p#0.05, **p#0.01, ***p#0.001 difference from untreated controls or as indicated with capped line; n = 3 or as indicated. Control = 50% medium conditioned in the absence of cells. doi:10.1371/journal.pone.0073266.g004 PLOS ONE | www.plosone.org 5 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 5. The effects of MW-CM and OC-CM on osteoblastic maturation of MSC are gp130 and OSM dependent. MSC were cultured in either 50% MW-CM (A-C, F,G) or OC-CM (D, E, H) in osteogenic media in the presence of anti-gp130 (1 mg/mL) or anti-OSM (10 mg/mL) antibodies or IgG (10 mg/ml; control) as indicated. MSC were cultured for 4 days and assessed for ALP activity (A-E), or cultured for 10 days and mineralisation assessed by Alizarin Red binding assay (F-H). Data displayed as mean 6 SEM; statistical significance determined by one-way ANOVA (Tukey’s post hoc test), all data n = 4; *p#0.05 **p#0.01, ***p#0.001 relative to controls (grey columns) or as indicated by capped lines. doi:10.1371/journal.pone.0073266.g005 activity at 4 days and matrix mineralisation at 14 days or as (OD) measured at 570 nm using a Tecan Genios Pro photo- indicated. For antibody neutralisation assays, MSC were cultured spectrometer. in 50% conditioned medium plus osteogenic medium containing (final concentration) 1 mg/mL anti-gp130 or 10 mg/mL anti-OSM Alkaline Phosphatase (ALP) activity assay monoclonal antibodies or mouse IgG control, then assessed for To determine cellular ALP activity, cells were lysed in 0.1% ALP at 4 days and matrix mineralisation and metabolic activity by Triton X-100 for 30 m at room temperature. A pre-warmed MTT assay at 14 days. solution containing 10 mg/mL p-nitrophenylphosphate (pNPP) in 10% v/v diethanolamine buffer; 0.5 mM MgCl pH 9.8 was then MTT metabolic activity assay added to the lysates and optical density of samples were assessed After culture, media was completely removed from appropriate using a Tecan Genios Pro photospectrometer, OD measured at wells and MTT solution containing 1.2 mM 3-(4,5-Dimethylthia- 410 nm at 37C. This was measured at 2.5 min intervals for zol-2-yl)-2,5-diphenyltetrazolium bromide in DMEM was added, 30 mins. Results were converted to standard international units and then incubated for 37uC for 4 hours. The supernatant was (SIU), equivalent to the conversion by ALP of 1 mM of pNPP to completely removed and the cells containing the formazan p-nitrophenyl (pNP) per minute. A standard curve was generated product were solubilised in DMSO for 30 mins. The solubilised by serially diluting 1 mM pNP in diethanolamine buffer and data solution was transferred to a fresh 96-well plate and optical density presented as relative SIU. PLOS ONE | www.plosone.org 6 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 6. OSM production by macrophages, osteoclasts and MSCs. (A) Levels of OSM protein in MW-CM and OC-CM assessed by ELISA. (B) Relative OSM gene expression in macrophage and OC cultures assessed by RT-PCR. (C) Lack of OSM mRNA detection in CM-treated (4 days) MSC cultures; ‘Pos. Cont’ shows macrophage mRNA data as a method positive control. Data displayed as mean 6 SEM and statistical significance relative to controls (or as indicated by capped bars) determined by one-way ANOVA (Tukey’s post hoc test) or Student’s t-test, n = 4, *p#0.05, ***p#0.001 or as indicated by capped lines. doi:10.1371/journal.pone.0073266.g006 ManH Gene Expression Assays using standard commercially Quantification of in vitro matrix mineralisation available primer/probe mixtures (Applied Biosystems catalogue MSC were fixed in 1% formalin for 30 minutes and then Hs00231692_m1, Hs01866874_s1 and Hs00171165_m1 respec- treated with 40 mM Alizarin Red (ALZ) for 15 min at RT. For tively). Relative gene expression units were determined using the quantification of staining, a protocol was adapted from that 2DCt formula 2 61000, where DCt values represent the difference described by Stanford et al. [27]. Cells were washed repeatedly between the Ct of the gene of interest and b-actin. For analysis of with distilled water and the stain was then solubilised in 3% IL-6, TNF and the classical parathyroid hormone (PTH) receptor cetylpyridinium chloride (CPC) in 20 mM sodium phosphate buffer for 45 min. The solubilised supernatant was transferred to a (PTH1R) mRNA expression real time PCR analysis (Stratagene H H Mx3000P) of cDNA was performed using Platinum SYBR new 6 mm diameter wells and OD measured at 570 nm using a Tecan Genios Pro photospectrometer. A standard curve was Green qPCR supermix UDG (Invitrogen) according to manufac- turer’s instructions and the following conditions: 1 cycle 10 mins generated for ALZ by serially diluting 1 mM ALZ in 3% CPC. OD readings were converted to CaCl mg/well. CaCl per well is 95uC; 40 cycles 30 seconds at 95uC, 1 min at 60uC, 30 seconds at 2 2 based on molar equivalent of ALZ to Ca (1:1); 1 mM (mmol/L) is 72uC; 1 cycle 1 min at 95uC, 30 seconds at 55uC, 0 seconds at equivalent to 22.196 ng/L CaCl 95uC) normalized to hypoxanthine phosphoribosyltransferase (HPRT). Primer oligo nucleotide sequences used for real time RT-PCR using the SYBR Green qPCR-based method were as Flow cytometric analysis follows: Flow cytometry analyses of adipose tissue derived cells, CFU- HPRT (GenBank accession NM_000194.2) 59-GACCAGT- GM and CFU-GM-derived cells were performed using FacsCa- CAACAGGGGACAT-39, reverse 59-CGACCTTGACCATGT- libur and CELLquest software (Becton Dickinson, NJ). Approx- TTGGA-39; imately 1610 cells from each population were labelled with appropriate phycoerythrin (PE), fluoroscein isothyocyanate (FITC) Human TNF (GenBank accession NM_000594.3) forward 59- ATCTTCTCGAACCCCGAGTGA-39, reverse 59- CGGTTCA- and peridinin-chlorophyll protein (PerCP) labelled antibodies including anti-CD45-FITC, anti-CD14-PE, anti-CD16-FITC, GCCACTGGAGC T-39; anti-CD34-PE, anti-CD-34–PerCP, anti-CD86-PercP, anti- Human IL-6 (GenBank NM_000600.3) forward 59- AAAT- CD206-FITC, anti-CD73-PE, anti-CD90-FITC (BD Australia, TCGGTACATCCTCGACGG-39, reverse 59- GGAAGGTTCA- North Ryde, Australia) and anti-CD105-FITC (Abcam plc, GGTTGTTTTCTGC-39; Cambridge, UK) according to manufacturer instructions. As Human PTH1R (GenBank accession NM_000316.2) forward negative controls for the fluorescent cell labelling we employed 59- ACCTGCACAGCCTCATCTTCA-39, reverse 59- CACA- appropriate isotype controls for the antibodies employed. includ- CAGCCACGAAGACAGC-39. ing anti-IgG-FITC, anti-IgG-PE, anti-IgG-PerCP (BD Australia) To assess human BSP mRNA expression we employed semi- or anti-IgG2a-FITC (Abcam). quantitative RT-PCR analysis. cDNA was prepared as above and PCR reactions employed KAPA2G Robust Hotstart PCR kits Real time RT-PCR and semiquantitative RT-PCR analysis (KAPA Biosystems, Woburn, MA) according to manufacturer’s instructions using an Applied Biosystems Veriti thermal cycler of mRNA expression machine (Life Technologies, Carlsbad, CA). Glyceraldehyde-3 Cellular RNA was isolated by lysing cells in Trizol and using the phosphate dehydrogenase (GAPDH) mRNA was used as a illustra RNAspin Mini Kit (GE Healthcare, Melbourne Australia). housekeeping gene expression reference. For BSP the following RNA concentration was determined by spectrophotometer conditions were used: after 10 mins at 95uC, we used 32 thermal (Nanodrop ND1000). cDNA was synthesized from RNA using cycles (30 seconds at 95uC, 30 seconds at 58uC, 60 seconds at the SuperscriptH III First Strand Synthesis SuperMix system (Life 72uC) followed finally by 10 min at 72uC. GAPDH analysis used Technologies) as per manufacturer’s instructions. To quantify the expression of human Runx2, osterix and OSM mRNA levels we similar conditions with 30 thermal cycles. PCR generated products employed real-time PCR analysis of cDNA performed in a 7500 were separated by electrophoresis on a 1.5% agarose gel Fast Real-Time PCR System (Applied Biosystems), using Taq- containing Sybr Safe DNA stain (Invitrogen) then visualised PLOS ONE | www.plosone.org 7 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 7. The effects of OSM on osteoblastic maturation of MSC. To confirm OSM actions, MSC were cultured in osteogenic media with recombinant OSM (10 ng/mL) for 4 days and assessed for (A) ALP activity, or for 10 days and assessed for (B) mineralisation, by Alizarin Red binding assays; blocking of recombinant OSM actions by antibodies to gp130 and OSM was confirmed; n = 4. (C) OSM dose response of MSC ALP levels (at day 4) and (E) photomicrographs ALP histochemical stain in control and OSM treated MSC, day 4; bars = 100 mm. (E) BMP-2 dose response of MSC ALP levels, day 4. (F) Synergistic actions of OSM with BMP-2 but not Wnt3A co-treatment on MSC ALP levels at 4 days of incubation (with osteogenic factors). Data displayed as mean 6 SEM and statistical significance relative to controls (grey columns), or as indicated by capped bars, determined by one-way ANOVA (Tukey’s post hoc test), n = 3 unless noted, *p#0.05 **p#0.01, ***p#0.001. doi:10.1371/journal.pone.0073266.g007 under ultraviolet light using a Biorad (Gladesville, Australia) Gel Measurement of BMP and canonical Wnt activity TM Doc 2000 imaging system. Primer oligo nucleotide sequences To detect BMP and Wnt activity in conditioned medium we used for semi-quantitative RT-PCR were as follows: employed luciferase reporter transfection assays. BMP-response BSP (GenBank accession NM_004967.3; IBSP) forward 59- element (BMP-RE) [28] and TOPflash TCF/LEF (with a b- CCTTCTCTGCCCTCTCACTCC-39, and reverse 59- AT- catenin-sensitive promoter to detect canonical Wnt signals) GAGTCACTACTGCCCTGAAC-39, product size of 205 base Upstate Biotechnology, NY) reporter construct DNA (0.1 mg/ pairs;GAPDH (GenBank accession NM_001256799.1) forward 59- well) was co-transfected with pRL Renilla luciferase construct CACTGACACGTTGGCAGTGG -39 and reverse 59- CATG- (0.1 mg/well; Promega), into UMR106.01 osteoblast-like cells [29] GAGAAGGCTGGGGCTC -39, product size 405 base pairs. with Fugene 6 transfection reagent (Promega) according to manufacturer instructions. Cell cultures were treated in triplicate PLOS ONE | www.plosone.org 8 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 8. The influence of IL-4 on CFU-GM-derived macrophage stimulation of MSC osteoblastic differentiation. CM was generated from macrophages cultured in M-CSF (25 ng/mL) or M-CSF plus IL-4 (100 ng/mL) for 14 days, and medium conditioned in these cells for a further 3 days. (A) IL-10 levels in CM determined by ELISA; ‘Control’ = medium (with M-CSF) conditioned without cells. (B) MSC were exposed to CM for 4 days and assessed for ALP activity or (C) exposed to CM for 14 days and mineralisation assessed by staining by Alizarin Red binding assays. (D) Levels of OSM in CM assessed by ELISA. Data displayed as mean 6 SEM; statistical significance determined by one-way ANOVA (Tukey’s post hoc test), n = 4, **p#0.01, ***p#0.001 compared to controls (grey columns) or as indicated (capped line). doi:10.1371/journal.pone.0073266.g008 Figure 9. The effects of classical activation on the ability of macrophages to stimulate osteoblastic commitment of MSC. CFU-GM populations were cultured in GM-CSF (10 ng/mL) for 14 days, then stimulated with the following: GM-CSF (‘GM’) alone; GM-CSF plus IFNc (‘‘GM+IFNc’’); or GM-CSF plus IFNc followed by 3 days in GM-CSF plus LPS (‘‘GM+IFNc+LPS’’). (A) Higher IL-6 and TNF mRNA expression in macrophages generated in GM-CSF than M-CSF (determined by RT-PCR). (B) TNF protein was determined (by ELISA) in conditioned medium from M- CSF, GM, GM+IFNc and GM+IFNc+LPS treated macrophages. ‘Cont.’ = medium (containing GM-CSF) conditioned without cells. (C) MSC were exposed to CM from the cells indicated and MSC cultures assessed for ALP activity after 4 days and (D) mineralisation (Alizarin Red binding assay) at 14 days. (E) Levels of OSM in CM assessed by ELISA. Data displayed as mean 6SEM; statistical significance determined by one-way ANOVA (Tukey’s post hoc test); A,B n = 3, C-E n = 4. *p#0.05, **p#0.01, ***p#0.001 compared to their controls (in adjoining grey columns) or as indicated by capped lines. doi:10.1371/journal.pone.0073266.g009 PLOS ONE | www.plosone.org 9 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation with CM for 24h, PBS rinsed then lysed wth Passive Lysis Buffer CM or OC-CM addition greatly increased the levels of (Promega) for 24h at 4uC. Lysates were transferred to a white flat mineralization in the MSC, by five-fold and three-fold respectively bottomed 96 well microplate (Corning, Lowell, MA) and signal (Fig. 3B,C, Fig. S1). In such cultures ALP levels were also strongly measured using firefly Luciferase substrate and Stop and Glo elevated (Fig. 4A), consistent with enhanced osteoblastic differen- reagents (Promega) as per manufacturer instructions using a tiation. In contrast, conditioned medium from M-CSF-starved EnVision multilabel (PerkinElmer, Waltham, MA) plate reader. macrophages did not induce mineralisation in MSC (data not shown). Surprisingly, we noted that the presence of osteogenic medium (i.e., medium containing ascorbate, dexamethasone and Statistical analyses b-glycerophosphate) was not necessary for the pro-osteoblastic Data are expressed as the mean 6 SEM where applicable. actions of MW-CM and OC-CM. Omission of osteogenic Differences between groups were determined using either components from the culture medium resulted in lower levels of Student’s t-test (for 2 way comparison), or by one-way ANOVA MSC ALP levels after 14 days, but ALP levels were still greatly or two-way ANOVA (GLM), followed by Tukey’s post hoc test as indicated. Statistical significance is indicated thus: * p,0.05, ** enhanced by the conditioned media (Fig. 4A); indeed the responses to CM were similar to those of cultures in osteogenic medium in p,0.01, *** p,0.001. Statistical significance indicated on graphs is relative to control cultures or between groups connected with terms of fold change relative to baseline. Thus, pro-osteoblastic capped line. actions of these conditioned media were not dependent on osteogenic supplements and may arise through a different mechanism. Since MW-CM was able to elicit the highest levels Results of osteoblastic differentiation in MSC we investigated how quickly Characterisation of cell populations this occurred compared to conventional 14-day osteogenic Macrophages: Flow cytometric analysis showed that most M-CSF treatment. As high ALP levels were induced within 4 days expanded CFU-GM cells expressed high levels of leukocyte (Fig. S1) this culture period was employed in the ALP analyses common antigen (CD45) and 98% expressed CD14 (Fig. 1B, below. Table 1), confirming them as macrophages. A large proportion of To further characterise the effects of MW secreted factors on + + these cells were also CD14 /CD16 (Table 1), resembling the MSC osteoblastic commitment we investigated the expression of ‘non-classical’ subpopulation of monocytes [30,31]. A majority of Runx2 and osterix (transcription factors critical for osteoblastic these macrophages (81% and 72% respectively) expressed antigen commitment and differentiation), as well as the classical PTH presentation co-stimulatory molecule CD86 and mannose receptor receptor (PTH1R) and bone sialoprotein (BSP) which are CD206 (Table 1). Populations of macrophages generated by characteristically expressed by mature osteoblasts. Indeed, MW- treating cord blood-derived CFU-GM with M-CSF for 14 days CM treatment of MSC caused mRNA levels these four factors to expressed NSE but little or no TRAP activity, and did not resorb rise significantly (Fig. 4B,C,D and Fig. S1C), consistent with dentine substrate (Fig. 1C). Conditioned medium from these enhanced osteoblastic maturation. macrophages showed no detectable human IL-1b and TNF (ELISA, data not shown), while IL-10 levels were detectable but Osteoblastic stimuli produced by CFU-GM-derived generally low (83.2612.2pg/ml, mean6SEM). macrophages and osteoclasts act in a gp130- and OSM- Osteoclasts: Multinucleated osteoclasts were generated by treating dependent manner CFU-GM with M-CSF and RANKL for 14 days. All cells in these We investigated the involvement of gp130-dependent cytokines cultures expressed TRAP, and produced extensive resorption pits, on the pro-osteoblastic effects of MW-CM and OC-CM using anti- demonstrating their functional osteoclastic status (Fig. 1D). gp130 and anti-OSM monoclonal antibodies. Increased ALP MSC: MSC populations were isolated from adipose tissue for levels induced by MW-CM treatment of MSC cultures for 4 days long term culture. Flow cytometric analysis indicated that MSC was abolished by anti-gp130 antibody (1 mg/mL) but unaffected populations passaged .5 times contained .95% of cells that were + + + + by control IgG1 (Fig. 5A,B). Anti-OSM (10 mg/mL) also CD73 , CD90 and CD105 (Fig. 2A). CD45 cells were not completely abolished the MW-CM-elicited rise in ALP (Fig. 5C). detected, indicating that leukocytes were not present. Cells were Increases in ALP elicited by OC-CM treatment were similarly seeded 10 cells/6 mm diameter culture well for long term culture. abolished by anti-gp130 and anti-OSM antibodies (Fig. 5D, E). The OB-forming potential of MSC (after 5 passages) was Consistent with these observations, induction of matrix mineral- confirmed by culture in osteogenic medium; these cells expressed isation by MW-CM and OC-CM treatment of MSC over 14 days little ALP by day 14, but expressed high levels by day 21 was also blocked by anti-gp130 and by anti-OSM antibodies (Fig. 2B,C). MSC cultures in osteogenic medium formed only low (Fig. 5F, G, H) further confirming that this phenomena are OSM- levels of mineralised matrix by day 14 but very high levels by day dependent. 21 (Fig. 2D). MSC formed large numbers of adipocytes stained by Oil Red O when incubated with a standard adipogenic stimulus (1 mM dexamethasone plus 175 nM insulin, 450 mM IBMX and Production of OSM by CFU-GM-derived macrophages 100 mM indomethacin) for 14 days (data not shown), confirming and osteoclasts, and by MSC the multipotential nature of these MSC populations. Having shown that the effects of MW-CM and OC-CM were OSM dependent, we determined by ELISA methods that OSM Effects of macrophage- and osteoclast-conditioned was indeed detectable in MW-CM and in OC-CM (Fig. 6A); RT- PCR analysis also confirmed that our macrophage and osteoclast media on osteoblastic differentiation of MSC populations expressed OSM mRNA (Fig. 6B) although the Cell metabolism levels in MSC cultures were raised by the presence of M-CSF itself did not have a large effect on OSM presence of osteogenic medium but were otherwise unaffected by mRNA levels. addition of 50% MW-CM or OC-CM in cultures (Fig. 3A), suggesting such CM has little or no overall effect on cell growth or In our differentiating MSC cultures, the added conditioned activity (Fig. 2D). Nevertheless, after 14 days incubation (in the medium is not the only possible source of OSM, since the MSC presence of base osteogenic medium) the presence of either MW- themselves may produce it, indeed, MW-CM may contain factors PLOS ONE | www.plosone.org 10 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation that induce OSM production in MSC cultures. However, by RT- cell density after 14 days. GM-CSF-expanded cells (GM-MW) PCR methods OSM mRNA was undetectable in the MSC and did expressed higher levels of IL-6 mRNA than M-CSF expanded cells not become evident with MW-CM treatment (Fig. 6C). Further to (Fig. 9A). IL-1b, IL-10 or TNF were not detectable in conditioned this, medium taken from MSC cultures after 4 days of incubation medium of these cells but activation by IFNc or IFNc plus LPS contained very low (indeed, barely detectable) levels of OSM significantly induced TNF production (Fig. 9B). These IFNc plus protein as did medium from MSC exposed to MW-CM for this LPS-activated cell populations analysed by FACS had far fewer period (Fig. S2A). These observations suggest autocrine actions of CD16 cells (1.0160.99%) than M-CSF-expanded macrophage MSC-derived OSM are unlikely to contribute to osteoblastic populations (Table 1); the IFNc plus LPS-activated cell contained + + + + differentiation responses in MW-CM-stimulated MSC cultures. no CD14 /CD16 and very few CD14 /CD206 cells + + (2.060.90%), while CD14 /CD86 were numerous (26.2960.89% of cells). The effects of recombinant OSM on MSC cultures, and The CM from these activated macrophage-containing popula- OSM interactions with osteogenic factors BMP-2 and tions (GM-MW,GM+ IFNc-MW and GM+ IFNc+LPS-MW) all Wnt3A failed to increase MSC ALP and mineralisation levels in MSC Since OSM activity is essential for the osteoblastic actions of relative to negative controls (Fig. 9C,D). OSM levels in medium MW-CM and OC-CM on our human adipose tissue MSC, we conditioned by these activated macrophage populations were also confirmed that, as previously described, [32] 10 ng/mL recom- lower than medium conditioned by M-CSF-treated macrophages binant human OSM strongly induces ALP and mineralisation in (MW-CM; Fig. 9E). MSC cultures (Fig. 7A,B). However, our ELISA data in Fig. 6 indicated that the OSM levels in MW-CM and OC-CM were very Discussion low, around 0.1 ng/ml. We thus tested the effects of recombinant OSM levels in this range on MSC ALP levels. We found that One of the most significant puzzles in bone biology is how 0.1 ng/ml recombinant OSM was indeed sufficiently potent to osteoblast formation and activity is controlled in normal healthy greatly increase these ALP levels, with an almost 5-fold increase bone and in disease states. The need for improved anabolic (observed over 4 days) and higher ALP levels with greater OSM therapies for bone makes identifying the mechanisms that underlie concentrations (Fig. 7C,D); matrix mineralisation was also osteoblast recruitment an important goal. Currently the main significantly increased by 0.2 ng/ml OSM (Fig. S2B). Since bone anabolic therapy that is employed clinically is injected PTH. OSM is likely to be found in microenvironments where other This treatment stimulates bone formation through several osteogenic factors are present we examined the interaction of low mechanisms, including enhancement of osteoblast survival and concentrations of OSM with BMP-2 and Wnt3A on MSC reduction of sclerostin production by osteocytes [12]. However, cultures; note that we did not find significant BMP or Wnt PTH anabolic action can be blunted by anti-resorptive drugs that activity in MW-CM itself using luciferase reporter assays reduce osteoclast number [12,33]. This, and the coupling of (Fig. S2C,D). BMP-2 100 ng/ml significantly induced our adipose resorption and formation in bone remodelling suggest that tissue MSC ALP levels (4 day cultures; Fig. 7E), though much less osteoclasts stimulate osteoblast action, although how this may potently than OSM; Wnt3A treatment had no detectable effects occur is not understood. We have presented here evidence (Fig. S2E). Co-treatment with 50 ng/ml BMP-2 and 0.025 ng/ml suggesting that human osteoclastic cells stimulate osteoblastic OSM (both concentrations without significant effects on MSC) differentiation of MSC. However, this capacity was shared by caused a sizable increase in ALP levels, suggesting synergistic macrophage populations from which our osteoclasts were derived, interactions between these two factors (Fig. 7F). The effects of showing that it is not osteoclast specific. Nevertheless, our work 2 ng/ml OSM also showed significant enhancement by 50 ng/ml (and that of Guihard et al [22]) suggest that not all types of and 100 ng/ml BMP-2 (Fig. S2F). Recombinant Wnt3A did not macrophages have this action and those with a close ontogenic detectably influence OSM actions on MSC (Fig. 7F). relationship with osteoclasts may be particularly pro-osteoblastic. We found that this activity was not due to production of bone The effects of activation on CFU-GM-derived morphogenetic protein (BMP) or Wnt activity (two well char- macrophage pro-osteoblastic stimulation of MSC acterised factors that drive osteoblast differentiation), but depend- To investigate the influence of macrophage activation we first ed entirely on macrophage or osteoclast production of OSM, an investigated the effect of alternative activation of macrophages IL-6 cytokine family member. using IL-4 (10 ng/mL) treatment applied for 3 days. IL-4 OSM is an anabolic factor for bone in vivo that, in addition to its treatment of the macrophages for 3 days did not elicit TNF or effects on MSC [32], suppresses osteocytes production of IL-1b levels but, consistent with alternative activation, significantly sclerostin, [34], a Wnt-inhibiting factor that is under active study increased levels of human IL-10 produced (Fig. 8A). IL-4 as a therapeutic target. We previously found that OSM has strong treatment of macrophages did not significantly affect the ability bone anabolic effects in mice in vivo, but OSM can be produced by of CM generated from these cells to enhance MSC ALP a number of local cell types, including mature osteoblasts expression and matrix mineralization (Fig. 8B,C). OSM levels in themselves [34,35] and it is unclear to what degree OSM directly CM generated from IL-4-treated cells were slightly greater than causes murine MSC maturation. While an OSM-dependent positive controls (Fig. 8D), although we could not detect any action of osteoclasts and macrophages may be significant for difference in OSM mRNA expression between M-CSF- and M- MSC recruitment it is unlikely to explain how bone formation is CSF+IL-4-treated macrophages (data not shown). stimulated by osteoclast-initiated remodelling unless other factors To investigate the effects of classical activation, CFU-GM- either direct MSC to the site of osteoclast activity or provide an derived cells were expanded with GM-CSF 10 ng/mL (rather amplifying co-stimulus for OSM action. In this regard it is also than M-CSF) for 14 days (GM-MW); some GM-CSF expanded notable that mice deficient in the OSM receptor do not have cells were also further activated by treatment with IFNc (1 ng/ disordered bone formation [34]; OSM null mice have been also mL) or a combination of IFNc plus 100 ng/mL LPS (Fig. 9). Both been studied, particularly for haematopoiesis defects [36] but no GM-CSF and M-CSF expansion produced cell cultures of similar gross bone abnormality reported. We previously found that mice PLOS ONE | www.plosone.org 11 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation lacking gp130-SHP2/ERK signalling (but not gp130-STAT3 blastic stimuli. This indicates that alternative macrophage signals) do have reduced bone mass but not disordered remod- activation maintained their pro-osteoblastic activity, again unlike elling [37]. Clearly, OSM cannot therefore be essential for normal the CD14 adult monocyte derived populations studied by murine bone remodelling, although its actions are likely to overlap Guihard et al. [22]. In general, these data collectively suggest with other related cytokines [38] and interact with other there may be significant differences between our CFU-GM- derived macrophages and monocyte-derived macrophages. It osteogenic factors, as we found with BMP-2. These considerations, and the fact that the degree of MSC recruitment in normal bone seems reasonable to assume that a pro-osteoblastic or anti- osteoblastic outcome of a given stimulus could depend greatly on modelling and remodelling is unclear, currently makes it difficult to assess the importance of OSM in bone metabolism. features of the macrophage populations. This suggests that determining the profile of macrophages present in bone and bone Our data is clearly consistent with an influence of macrophages lesions (which would presumably include both monoctyes and on MSC, but the nature of macrophage influence on bone CFU-GM) is critical for understanding the outcome of a particular formation remains controversial. Striking observations were made stimulus. A detailed comparison of our experimental system with by Alexander et al. [16] in a fracture model where they noted that that used by Guihard et al. [22] and Nicolaidou et al [23] may also depletion of c-fms cells (principally macrophages, but also clarify how macrophages affect bone formation. It is notable that osteoclasts) greatly reduced osteoblast numbers and bone forma- classically activated macrophages in vivo are associated with tion. Due to the location of resident macrophages near the bone chronic inflammation and low bone formation, and since surface and the effects of macrophage depletion they proposed a inflammation commonly drives osteolysis this can make inflam- central role for macrophages in enhancing or maintaining bone matory lesions very destructive to bone. However, inflammation formation, involving osteal macrophages in close contact with can have a pro-osteoblastic outcome, as commonly observed in osteoblasts [14]. Given the many varied functions of macrophages ankylosing spondylitis. The reasons for this are unclear but and the abundance of macrophages in bone and bone marrow, properties of the recruited macrophages in these lesions could play this is certainly plausible. It also suggests that factors that stimulate an influential role. Such contrasting effects on local bone or recruit macrophages could indirectly influence bone formation, metabolism can also be seen in cancer invasion – for example, and a role here for OSM is possible. Furthermore, we noted that although breast cancers are typically osteolytic, osteoblastic lesions not only was OSM extremely potent in its effects on MSC but it also occur. acted synergistically with BMP-2. The possibility that OSM In summary, we have found that macrophage- and osteoclast- cooperates with this and other factors to increase bone formation, derived OSM stimulates MSC differentiation to osteoblasts. This in addition to the ability of OSM to suppress sclerostin and induce stimulation occurs more rapidly (within 4 days of incubation), than production of osteoblastic factors like IL-33 [39], suggest that widely used ascorbate/dexamethasone treatment, making this a further scrutiny of macrophage (and OSM) actions in bone are very useful experimental system. This OSM-mediated interaction, warranted. consistent with the observations of Song et al. [32], may play a The work of Guihard et al. [22] and more recently Nicolaidou significant role in stimulating and maintaining osteoblastic activity et al. [23] identified that MSC (derived from human bone marrow in bone, at least where this dependent on MSC differentiation. We stroma) also undergo enhanced osteoblastic differentiation in found that immature M-CSF-dependent macrophages (which are response to mature macrophages derived from human CD14 abundant in bone marrow), including those exposed to IL-4 to circulating monocytes; this occurred in a manner at least partly induce alternative activation, are a good source of this pro- dependent on OSM. The conclusions of these studies otherwise osteoblastic activity. However this activity is significantly reduced differ markedly in many respects, and differ in some respects to or abolished by GM-CSF exposure or classical activation, our study. Guihard et al. [22] found that conditioned medium although whether this is solely due to their reduced OSM from GM-CSF- and IFNc-stimulated monocyte-derived CD14 production or whether they produce anti-osteoblastic factors is cells (classically activated macrophages) drive osteoblastic differ- unclear. This work confirms that macrophages and osteoclasts can entiation of MSC, and that this is enhanced by LPS treatment, have a major effect on osteoblastic cell recruitment from MSC, while conditioned medium from CD14 monocytes treated with although the specific phenotype of the macrophages present is alternative activators IL-4 or IL-10 did not. In contrast, clearly important. Nicolaidou et al. [23] found that medium conditioned by human monocytes did not drive MSC osteoblastic differentiation at all unless co-cultured with the MSC; consistent with this, conditioned Supporting Information medium from monocyte/MSC co-cultures stimulated osteoblast Figure S1 Time course of MW-CM effects on MSC maturation in other MSC cultures. In our work we employed maturation. MSC were cultured in medium containing proliferating macrophages derived from progenitors that resemble osteogenic factors (ascorbate, dexamethasone and b–glycerophos- immature bone marrow macrophages rather more than adult phate) for 4, 7 and 14 days, with or without addition of 50% MW- monocytes; our M-CSF-treated cord blood-derived macrophages CM as indicated, then assessed for (A) ALP activity and (B) expressed CD14 but also CD16, suggesting a ‘non classical’ mineralisation. Data displayed as mean 6 SEM; statistical monocyte phenotype [30]. Classical activation of these cells (which significance determined by one-way ANOVA (Tukey’s post hoc reduced CD16 expression) resulted in lower OSM levels, also test), n = 4, **p#0.01 and ***p#0.001 compared to respective indicating that these macrophages differ markedly from adult control cultures. (C) BSP and GAPDH mRNA levels were monocytes employed by Guihard et al. We found that cord blood- examined (by semi-quantitative RT-PCR) in MSC cultured for derived macrophages directly co-cultured with MSC induced only 14 days with osteogenic factors alone (Control) or with addition of a weak action on ALP expression compared to MW-CM (data not 50% MW-CM; representative of 3 independent cultures. shown). We are uncertain why this is the case, but it may be due to (PDF) technical aspects that require further study, as these immature macrophages did not appear to thrive in such co-cultures. Our Figure S2 The lack of production of OSM by MSC, BMP studies also indicated that macrophages treated with either M-CSF and Wnt activity in MW-CM, and the influence of BMP-2, or M-CSF plus IL-4 produced strong (OSM-dependent) osteo- Wnt3A and OSM on MSC maturation. (A) MSC were PLOS ONE | www.plosone.org 12 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation cultured in 50% MW-CM or control medium (‘Cont-Med’) osteogenic factors; n = 3. Data displayed as mean 6 SEM; for 4 days. OSM levels in the resulting MSC-exposed culture statistical significance determined by one-way ANOVA (Tukey’s medium were assessed by ELISA but showed only very low post hoc test), all n = 3. *p#0.05, **p#0.01 and ***p#0.001 levels, much lower than MW-CM (‘Pos. Cont.’) alone. (B) compared to control cultures (grey columns). Detailed dose response of MSC matrix mineralisation (at day 7) (PDF) to OSM treatment. To detect BMP and Wnt protein activity in MW-CM (50%), luciferase reporter-based assays were em- Acknowledgments ployed, using BMP-RE and TOPFlash reporters respectively. (C) The authors would like to thank Drs Nicole Horwood and Vicky UMR106.01 osteoblastic cells transiently co-transfected with Nicolaidou (Kennedy Institute of Rheumatology, University of Oxford, BMP-RE luciferase and Renilla reporter constructs, 24h incuba- United Kingdom) for helpful advice and discussion of this work. tion; ‘Cont.’ = control medium conditioned without cells, BMP-2 = 100 ng/mL. (D) UMR106.01 cells were used as in B, but with Author Contributions TOPflash luciferase constructs and Renilla reporter construct; Wnt3A = 100 ng/mL. (E) Lack of effects on ALP responses of Conceived and designed the experiments: TJF PRE GCN JMWQ. Wnt3A (100 ng/mL) after 4 days of incubation. (F) Co-operative Performed the experiments: TJF JMH PPS DE FMC JMWQ. Analyzed the data: TJF JMH PPS JMWQ. Contributed reagents/materials/analysis actions of 2 ng/ml OSM with BMP-2 (but not Wnt3A) co- tools: TJF JMH PRE IH JMWQ. Wrote the paper: TJF GCN JMWQ. treatment on MSC ALP levels at 4 days of incubation with References 1. Long F (2012) Building strong bones: molecular regulation of the osteoblast 21. Quinn JM, Elliott J, Gillespie MT, Martin TJ (1998) A combination of osteoclast lineage. Nat Rev Mol Cell Biol 13: 27–38. differentiation factor and macrophage-colony stimulating factor is sufficient for both 2. Lee RH, Kim B, Choi I, Kim H, Choi HS, et al. (2004) Characterization and human and mouse osteoclast formation in vitro. Endocrinology 139: 4424–4427. expression analysis of mesenchymal stem cells from human bone marrow and 22. Guihard P, Danger Y, Brounais B, David E, Brion R, et al. (2012) Induction of adipose tissue. Cell Physiol Biochem 14: 311–324. osteogenesis in mesenchymal stem cells by activated monocytes/macrophages 3. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, et al. (2006) depends on oncostatin M signaling. Stem Cells 30: 762–772. Minimal criteria for defining multipotent mesenchymal stromal cells. The 23. Nicolaidou V, Wong MM, Redpath AN, Ersek A, Baban DF, et al. (2012) International Society for Cellular Therapy position statement. Cytotherapy 8: Monocytes induce STAT3 activation in human mesenchymal stem cells to 315–317. promote osteoblast formation. PLoS One 7: e39871. 4. Kern S, Eichler H, Stoeve J, Kluter H, Bieback K (2006) Comparative analysis 24. Quinn JM, Sims NA, Saleh H, Mirosa D, Thompson K, et al. (2008) IL-23 of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose inhibits osteoclastogenesis indirectly through lymphocytes and is required for the tissue. Stem Cells 24: 1294–1301. maintenance of bone mass in mice. J Immunol 181: 5720–5729. 5. Hattori H, Sato M, Masuoka K, Ishihara M, Kikuchi T, et al. (2004) Osteogenic 25. Mosser DM (2003) The many faces of macrophage activation. J Leukoc Biol 73: potential of human adipose tissue-derived stromal cells as an alternative stem cell 209–212. source. Cells Tissues Organs 178: 2–12. 26. Quinn JM, Morfis M, Lam MH, Elliott J, Kartsogiannis V, et al. (1999) 6. Majors AK, Boehm CA, Nitto H, Midura RJ, Muschler GF (1997) Calcitonin receptor antibodies in the identification of osteoclasts. Bone 25: 1–8. Characterization of human bone marrow stromal cells with respect to 27. Stanford CM, Jacobson PA, Eanes ED, Lembke LA, Midura RJ (1995) Rapidly osteoblastic differentiation. J Orthop Res 15: 546–557. forming apatitic mineral in an osteoblastic cell line (UMR 106-01 BSP). J Biol 7. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, et al. (1999) Mul- Chem 270: 9420–9428. tilineage potential of adult human mesenchymal stem cells. Science 284: 143–147. 28. Korchynskyi O, ten Dijke P (2002) Identification and functional characterization 8. Seong JM, Kim BC, Park JH, Kwon IK, Mantalaris A, et al. (2010) Stem cells in of distinct critically important bone morphogenetic protein-specific response bone tissue engineering. Biomed Mater 5: 062001. elements in the Id1 promoter. J Biol Chem 277: 4883–4891. 9. Akagawa KS, Takasuka N, Nozaki Y, Komuro I, Azuma M, et al. (1996) 29. Allan EH, Hausler KD, Wei T, Gooi JH, Quinn JM, et al. (2008) EphrinB2 Generation of CD1+RelB+ dendritic cells and tartrate-resistant acid phospha- regulation by PTH and PTHrP revealed by molecular profiling in differentiating tase-positive osteoclast-like multinucleated giant cells from human monocytes. osteoblasts. J Bone Miner Res 23: 1170–1181. Blood 88: 4029–4039. 30. Passlick B, Flieger D, Ziegler-Heitbrock HW (1989) Identification and 10. Ash P, Loutit JF, Townsend KM (1980) Osteoclasts derived from haematopoi- characterization of a novel monocyte subpopulation in human peripheral etic stem cells. Nature 283: 669–670. blood. Blood 74: 2527–2534. 11. Scheven BA, Visser JW, Nijweide PJ (1986) In vitro osteoclast generation from 31. Tacke F, Randolph GJ (2006) Migratory fate and differentiation of blood different bone marrow fractions, including a highly enriched haematopoietic monocyte subsets. Immunobiology 211: 609–618. stem cell population. Nature 321: 79–81. 32. Song HY, Jeon ES, Kim JI, Jung JS, Kim JH (2007) Oncostatin M promotes 12. Martin TJ, Quinn JM, Gillespie MT, Ng KW, Karsdal MA, et al. (2006) osteogenesis and suppresses adipogenic differentiation of human adipose tissue- Mechanisms involved in skeletal anabolic therapies. Ann N Y Acad Sci 1068: derived mesenchymal stem cells. J Cell Biochem 101: 1238–1251. 458–470. 33. Delmas PD, Vergnaud P, Arlot ME, Pastoureau P, Meunier PJ, et al. (1995) The 13. Tang Y, Wu X, Lei W, Pang L, Wan C, et al. (2009) TGF-beta1-induced anabolic effect of human PTH (1–34) on bone formation is blunted when bone migration of bone mesenchymal stem cells couples bone resorption with resorption is inhibited by the bisphosphonate tiludronate–is activated resorption formation. Nat Med 15: 757–765. a prerequisite for the in vivo effect of PTH on formation in a remodeling system? 14. Chang MK, Raggatt LJ, Alexander KA, Kuliwaba JS, Fazzalari NL, et al. (2008) Bone 16: 603–610. Osteal tissue macrophages are intercalated throughout human and mouse bone 34. Walker EC, McGregor NE, Poulton IJ, Solano M, Pompolo S, et al. (2010) lining tissues and regulate osteoblast function in vitro and in vivo. J Immunol Oncostatin M promotes bone formation independently of resorption when 181: 1232–1244. signaling through leukemia inhibitory factor receptor in mice. J Clin Invest 120: 15. Winkler IG, Sims NA, Pettit AR, Barbier V, Nowlan B, et al. (2010) Bone 582–592. marrow macrophages maintain hematopoietic stem cell (HSC) niches and their 35. Walker EC, Poulton IJ, McGregor NE, Ho PW, Allan EH, et al. (2012) depletion mobilizes HSCs. Blood 116: 4815–4828. Sustained RANKL response to parathyroid hormone in oncostatin M receptor- 16. Alexander KA, Chang MK, Maylin ER, Kohler T, Muller R, et al. (2011) deficient osteoblasts converts anabolic treatment to a catabolic effect in vivo. Osteal macrophages promote in vivo intramembranous bone healing in a mouse J Bone Miner Res 27: 902–912. tibial injury model. J Bone Miner Res 26: 1517–1532. 36. Minehata K, Takeuchi M, Hirabayashi Y, Inoue T, Donovan PJ, et al. (2006) 17. Walsh NC, Reinwald S, Manning CA, Condon KW, Iwata K, et al. (2009) Oncostatin m maintains the hematopoietic microenvironment and retains Osteoblast function is compromised at sites of focal bone erosion in hematopoietic progenitors in the bone marrow. Int J Hematol 84: 319–327. inflammatory arthritis. J Bone Miner Res 24: 1572–1585. 37. Sims NA, Jenkins BJ, Quinn JM, Nakamura A, Glatt M, et al. (2004) 18. Hodge JM, Kirkland MA, Aitken CJ, Waugh CM, Myers DE, et al. (2004) Glycoprotein 130 regulates bone turnover and bone size by distinct downstream Osteoclastic potential of human CFU-GM: biphasic effect of GM-CSF. J Bone signaling pathways. J Clin Invest 113: 379–389. Miner Res 19: 190–199. 38. Sims NA (2009) gp130 signaling in bone cell biology: multiple roles revealed by 19. Aitken CJ, Hodge JM, Nishinaka Y, Vaughan T, Yodoi J, et al. (2004) analysis of genetically altered mice. Mol Cell Endocrinol 310: 30–39. Regulation of human osteoclast differentiation by thioredoxin binding protein-2 39. Saleh H, Eeles D, Hodge JM, Nicholson GC, Gu R, et al. (2011) Interleukin-33, and redox-sensitive signaling. J Bone Miner Res 19: 2057–2064. a target of parathyroid hormone and oncostatin m, increases osteoblastic matrix 20. Hodge JM, Kirkland MA, Nicholson GC (2007) Multiple roles of M-CSF in mineral deposition and inhibits osteoclast formation in vitro. Endocrinology 152: human osteoclastogenesis. J Cell Biochem 102: 759–768. 1911–1922. PLOS ONE | www.plosone.org 13 September 2013 | Volume 8 | Issue 9 | e73266 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png PLoS ONE Pubmed Central

Cord Blood-Derived Macrophage-Lineage Cells Rapidly Stimulate Osteoblastic Maturation in Mesenchymal Stem Cells in a Glycoprotein-130 Dependent Manner

Download PDF
13 pages

Loading next page...
 
/lp/pubmed-central/cord-blood-derived-macrophage-lineage-cells-rapidly-stimulate-yALBBCerdK

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Pubmed Central
Copyright
© 2013 Fernandes et al
ISSN
1932-6203
eISSN
1932-6203
DOI
10.1371/journal.pone.0073266
Publisher site
See Article on Publisher Site

Abstract

In bone, depletion of osteoclasts reduces bone formation in vivo, as does osteal macrophage depletion. How osteoclasts and macrophages promote the action of bone forming osteoblasts is, however, unclear. Since recruitment and differentiation of multi-potential stromal cells/mesenchymal stem cells (MSC) generates new active osteoblasts, we investigated whether human osteoclasts and macrophages (generated from cord blood-derived hematopoietic progenitors) induce osteoblastic maturation in adipose tissue-derived MSC. When treated with an osteogenic stimulus (ascorbate, dexamethasone and b-glycerophosphate) these MSC form matrix-mineralising, alkaline phosphatase-expressing osteoblas- tic cells. Cord blood-derived progenitors were treated with macrophage colony stimulating factor (M-CSF) to form immature proliferating macrophages, or with M-CSF plus receptor activator of NFkB ligand (RANKL) to form osteoclasts; culture medium was conditioned for 3 days by these cells to study their production of osteoblastic factors. Both osteoclast- and macrophage-conditioned medium (CM) greatly enhanced MSC osteoblastic differentiation in both the presence and absence of osteogenic medium, evident by increased alkaline phosphatase levels within 4 days and increased mineralisation within 14 days. These CM effects were completely ablated by antibodies blocking gp130 or oncostatin M (OSM), and OSM was detectable in both CM. Recombinant OSM very potently stimulated osteoblastic maturation of these MSC and enhanced bone morphogenetic protein-2 (BMP-2) actions on MSC. To determine the influence of macrophage activation on this OSM-dependent activity, CM was collected from macrophage populations treated with M-CSF plus IL-4 (to induce alternative activation) or with GM-CSF, IFNc and LPS to cause classical activation. CM from IL-4 treated macrophages stimulated osteoblastic maturation in MSC, while CM from classically-activated macrophages did not. Thus, macrophage- lineage cells, including osteoclasts but not classically activated macrophages, can strongly drive MSC-osteoblastic commitment in OSM-dependent manner. This supports the notion that eliciting gp130-dependent signals in human MSC would be a useful approach to increase bone formation. Citation: Fernandes TJ, Hodge JM, Singh PP, Eeles DG, Collier FM, et al. (2013) Cord Blood-Derived Macrophage-Lineage Cells Rapidly Stimulate Osteoblastic Maturation in Mesenchymal Stem Cells in a Glycoprotein-130 Dependent Manner. PLoS ONE 8(9): e73266. doi:10.1371/journal.pone.0073266 Editor: Luc Malaval, INSERM U1059/LBTO, Universite´ Jean Monnet, France Received January 1, 2013; Accepted July 22, 2013; Published September 12, 2013 Copyright:  2013 Fernandes et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by an Australian National Health and Medical Research Council Project Grant, number 611805 (http://www.nhmrc.gov.au) and by the Victorian Government Operational Infrastructure Support Program (http://www.vic.gov.au/business-industry/science-research.html). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. "GCN and JMWQ are joint senior authors. * E-mail: [email protected] understood, the appropriate enhancement of such a process might Introduction form the basis of therapies that increase bone formation in patients Osteoblasts are specialised bone forming cells that derive from with low bone mass. local mesenchymal progenitors through multi-step commitment Maintenance of bone strength requires bone remodelling, and maturation processes that are dependent on transcription whereby old or damaged bone is removed by osteoclasts factors Runx2 and osterix [1]. Such progenitors include MSC (multinucleated bone resorbing cells of the myelomonocytic populations found in bone and in extraosseous tissues [2], highly lineage) [9–11] and the bone removed by osteoclasts subsequently proliferative cells expressing CD73, CD90 and CD105 but lacking replaced by osteoblast action. This, and the impairment of bone hematopoietic markers [3,4]. When purified, these cells can form formation following anti-osteoclastic therapies [12], suggest a functional osteoblasts both in vitro and in vivo [5–7] but also have functional link between osteoclast and osteoblast activity. Howev- the capacity to form other types of stromal cells, such as adipocytes er, osteoclast stimulation of mature osteoblast activity has not been [2,7,8]. While the MSC transition to osteoblasts is not fully convincingly demonstrated. An alternative possibility is that PLOS ONE | www.plosone.org 1 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation osteoclasts exert their influence on osteoblast progenitors, such as under protocols approved by Barwon Health Human Research local MSC. Indeed, MSC are chemotactically attracted to bone and Ethics Committee. sites undergoing remodelling [13]. It is notable, however, that, not all bone formation requires osteoclast action; osteal macrophages, Cell media and reagents + + a locally resident CD11b F4/80 cell population closely related to Eagle’s minimum essential medium (MEM), Dulbecco’s Modified osteoclasts, also exert a significant regulatory influence on bone Eagle’s Medium (DMEM), penicillin/streptomycin solutions, para- formation [14,15]. Osteal macrophages are located in close formaldehyde, Fast Garnet GBC, naphthol AS-BI-phosphate, proximity to osteoblasts and their removal greatly decreases bone collagenase-type-1, p-nitrophenylphosphate, p-nitrophenyl, dietha- formation [16], but the nature of their influence on osteoblasts is nolamine, Alizarin Red, cetylpyridinium chloride, dexamethasone, also unclear. Macrophages display many diverse functions central dimethyl sulphoxide (DMSO) and 3-(4,5-Dimethylthiazol-2-yl)-2,5- to innate immunity and adaptive immune responses, especially via diphenyltetrazolium bromide, insulin, 3-Isobutyl-1-methylxanthine antigen presentation and cytokine production, but also play (IBMX) and indomethacin were purchased from Sigma-Aldrich (St. regulatory and cytokine secretory roles in many tissues. Macro- Louis, USA). b-glycerophosphate disodium salt was purchased from phages respond to environmental stimuli by altering their Merck Millipore (Kilsyth, Australia). L-Ascorbic acid phosphate was behaviour and excitation states, notably their phenotype can be purchased from NovaChem Pty Ltd (Melbourne, Australia). Non- polarised by Th -cytokines towards classical activation and by essential amino acids (100X) and fetal bovine serum (FBS) were Th -cytokines towards a number of alternative activation states. 2 purchased from Bovogen (Melbourne, Australia). Human oncosta- An abundance of classically activated macrophages in the bone, tin-M (OSM) ELISA, anti-OSM and anti-gp130 blocking mono- typically seen in inflammatory joint diseases, is generally associated clonal antibodies and recombinant OSM, Wnt3A, GM-CSF, IL-4, with impaired bone formation, perhaps related to suppression of interferon-c (IFNc) and BMP-2 proteins were purchased from R&D osteoblastic Wnt responses [17]. Therefore, understanding the Systems (Minneapolis, USA). Ready-SET-Go human TNF, IL-1b influence of macrophages in different activation states on and IL-10 ELISAs were obtained from eBioscience (San Diego, CA). immature osteoblast-lineage cells is of great interest in bone Ficoll-Paque was purchased from GE Healthcare Life Sciences biology. (Rydalmere, Australia). MethoCult GF H4534 (Iscove’s medium We have previously employed cord blood-derived immature containing 1% methylcellulose, 30% FBS, 1% bovine serum myelomonocytic-lineage cells rich in colony forming units (CFU)- albumin, 10 M 2-mercaptoethanol, 2 mM L-glutamine, 10 ng/ GM as an excellent source of human osteoclast-forming cells mL recombinant human GM-CSF, 10 ng/mL IL-3, and 50 ng/mL [18,19]. Such cord blood mononuclear cells contain populations stem cell factor) was purchased from Stem-Cell Technologies 158–316 (Tullamarine, Australia). Soluble RANKL -GST fusion pro- broadly similar to immature myelomonocytic populations found in bone marrow. They are a rich source of immature macrophages tein (RANKL) was produced in-house from a construct kindly supplied by Dr. F. Patrick Ross (Hospital for Special Surgery, NY) as that proliferate with M-CSF or GM-CSF treatment [18,20] and, when treated with M-CSF plus RANKL, they form large numbers previously described [24]. All other reagents were analytical grade. of bone resorbing osteoclasts. Circulating adult CD14 monocytes also form osteoclasts with RANKL/M-CSF stimulus but do so far Generation of macrophages and osteoclasts more slowly and with much lower yield [20,21], reflecting their Collection of human umbilical cord blood, isolation of a preponderance of mature cells. We therefore employed the superior mononuclear cell fraction, expansion of CFU-GM-derived oste- cord blood-derived progenitors to generate both macrophages and oclast precursors and differentiation of mature human osteoclast osteoclast-rich cultures to study their effects on osteoblastic have been previously described [18]. Briefly, cord blood mono- differentiation in human MSC. A related approach was employed nuclear cell fraction (CBMC) was isolated by Ficoll-Paque density in the recent work of Guihard et al. [22] and Nicolaidou et al. [23] gradient centrifugation and the cells (3610 cells/culture) were who both found that CD14 adult monocytes enhanced osteoblastic suspended in 3.0 mL Methocult GF H4534 in 35 mm diameter (6- differentiation of MSC in a manner at least partly dependent on the well) plates and incubated at 37uC in humidified atmosphere of IL-6 family cytokine oncostatin M (OSM). Their observations 5% CO -air for 11 days to generate CFU-GM colonies (.80%) differed in certain key respects, however. Guihard et al. [22] found and CFU-M colonies (5–10%); hereafter these CBMC-derived that medium conditioned by CD14 (especially classically activated populations are referred to as CFU-GM, as previously described CD14 cells) strongly enhanced MSC maturation, while Nicolaidou [19]. These cell populations were pooled in PBS, centrifuged, and et al. [23] observed macrophage-MSC contact was essential for such resuspended in DMEM containing 10% heat inactivated (55uC for pro-osteoblastic activity. While these are seminal pieces of work, 30 minutes) FBS, non-essential amino acids, penicillin 50 U/mL; clearly further studies are needed that employ other macrophage streptomycin 50 mg/mL and 2 mM L-glutamine (DMEM/FBS) 6 2 lineage cells that MSC encounter in bone. In our studies we found and then cultured (7610 cells/175 cm flask) for 14 days with M- that both cord-blood derived macrophage and osteoclast popula- CSF (25 ng/mL) alone to generate proliferating macrophages, or tions produce soluble factors that very rapidly (within 4 days) drive M-CSF and RANKL (125 ng/mL) to generate osteoclasts. osteoblastic maturation in these MSC populations. This activity was To generate classically activated macrophages [25] CFU-GM 6 2 dependent upon OSM secretion but neither cell contact nor (7610 cells/175 cm flask) were cultured in MEM/FBS with one classical activation (in macrophages) was required for osteoblastic of the three following stimulations: (i) GM-CSF (10 ng/mL) for maturation of MSC. This provides further evidence for the role of 20 days, (ii) GM-CSF (10 ng/mL) for 14 days, followed by GM- osteoclasts, macrophages and OSM in the regulation of bone CSF (10 ng/mL) and interferon-gamma (IFNc) (1?? ng/mL) for metabolism. 6 days, or (iii) GM-CSF (10 ng/mL) for 14 days, followed by GM- CSF (10 ng/mL) and IFNc (100 ng/mL) for 3 days, then GM- CSF (10 ng/mL) and lipopolysaccharide (LPS; 100 ng/mL) for Materials and Methods 3 days. To generate macrophages undergoing alternative activa- 6 2 Ethics Statement tion, CFU-GM (7610 cells/175 cm flask) were cultured in Human umbilical cord blood and adipose tissue samples were MEM/FBS with M-CSF (25 ng/mL) for 11 days, then M-CSF obtained with informed, written consent from healthy donors (25 ng/mL) and IL-4 (100 ng/mL) for 6 days. PLOS ONE | www.plosone.org 2 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 1. Generating and characterising CFU-GM and CFU-GM-derived populations. (A) Schematic of CM generation as outlined in Materials and Methods: CFU-GM expanded from cord blood mononuclear cells (by incubation for 10 days in semi-solid medium and growth factors) were used to generate osteoclast and macrophage populations. CM from these cells were then used to treat MSC in experiments. (B) CFU-GM and macrophage populations (after CM collection) were analysed for CD45 expression by flow cytometry and these CD45 cells examined for CD14 and CD16 expression. (C) Representative photomicrographs of macrophage cultures showing phase contrast image (plastic substrate), nonspecific esterase (NSE) histochemical staining (dentine substrate), TRAP histochemical staining (dentine substrate), and dentine substrate of macrophage culture after the macrophages have been removed to reveal a complete lack of pit formation. (D) Photomicrographs of osteoclastic cultures, showing phase contrast image (plastic substrate, red arrowhead indicating osteoclasts), TRAP histochemical staining (dentine substrate, including expanded view with osteoclasts indicated by red arrowhead), and dentine substrate of osteoclast cultures after the osteoclasts were removed, which has been stained to reveal extensive pit formation. All scale bars = 100 mm. doi:10.1371/journal.pone.0073266.g001 as per manufacturer’s instructions (Sigma-Aldrich, Catalogue Confirmation of macrophage and osteoclast identity number 91A-1KT). Cells were also scraped from the culture Adherent macrophages were identified by a-napthyl acetate surface and incubated with phycoerythrin labelled anti-CD14 esterase (non-specific esterase; NSE) histochemistry. Cell were (anti-CD14-PE) or anti-CD16-FITC (BD Australia, North Ryde, fixed in 4% paraformaldehyde for 10 mins, then incubated in Fast Australia) antibodies and analysed by flow cytometry as below. Blue BB-based substrate solution prepared from a commercial kit PLOS ONE | www.plosone.org 3 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation in 200 mL DMEM/FBS plus M-CSF (25 ng/mL) and RANKL Table 1. Characterisation of CFU-GM and CFU-GM-derived M- (125 ng/mL) for 14 days, with medium and mediators replaced CSF-dependent macrophages by flow cytometry. twice weekly. After 14 days the cells were fixed in 1% formalin and histochemically reacted to confirm TRAP expression, then cells were removed from dentine slices by brief sonication in CFU-GM Cells M-CSF Treated Cells chloroform:methanol 2:1. Xylene-free black ink was applied to the CD45 57.46.4260.17% 94.9460.38% resorbed surface of each slice and residual ink removed by wiping CD14 35.4260.39% 98.0360.33% the dentine surface against absorbent paper, leaving resorption pits CD16 6.7760.61% 46.2861.06% stained black for assessment by transmission light microscopy [18]. + + CD14 /CD16 6.9260.51% 45.9560.39% + + Conditioned medium collection CD14 /CD86 0% 81.8560.92% After 14 days culture in either M-CSF (25 ng/mL), or M-CSF CD206 31.9260.29% 71.8960.86% (25 ng/mL) and RANKL (125 ng/mL) to produce macrophages + + CD14 /CD206 28.8460.27% 72.8960.40% and osteoclasts respectively, cells were cultured for a further 3 days CD34 3.7061.85% 1.9261.21% in DMEM/FBS with M-CSF (25 ng/mL) (Fig. 1A). This macrophage (MW-CM) and osteoclast conditioned medium (OC- CFU-GM cells taken immediately after their expansion in semi-solid medium CM) was filtered (0.22 mm pore size filters; Corning, Lowell, MA) were fluorescently stained by primary labelled antibodies for CD45, CD14, CD16, CD34, CD86 and CD206, and the proportion of positive cells estimated. and stored at 280uC until further use. For activated macrophages, These cells were compared with macrophages generated from CFU-GM cells by conditioned medium was collected from the last 3 days from each treatment with M-CSF (17 days); two independent experiments analysed in of the stimulated culture conditions. Cell culture medium triplicate, mean 6SEM shown. containing the same mediators was also incubated in the absence doi:10.1371/journal.pone.0073266.t001 of cells for 3 days and this aged medium subsequently used as the experimental control medium. Osteoclasts were identified by tartrate-resistant acid phosphatase (TRAP) expression and multinuclearity (.2 nuclei) [26]. To Isolation and culture of adipose tissue-derived MSC confirm the formation of functional osteoclasts, CFU-GM were Human adipose tissue was collected during elective surgery. To seeded (4610 /well) into 6 mm diameter tissue culture wells (96- isolate MSC, tissue was teased from blood vessels, minced with a well tissue culture plates) containing 28.3 mm slices of sperm scalpel blade, and digested for 30–45 min with 0.075% collage- whale dentine prepared as previously described [25] and cultured nase at 37uC with gentle agitation. Enzyme activity was Figure 2. Characterisation of MSCs and their differentiation. (A) FACS analysis of expanded adipose stromal cells in culture revealed a high proportion of cells expressing CD90, CD73 and CD105, indicating a population enriched in MSC; PE = phycoerythrin label, FITC = fluoroscein isothiocyanate label. To assess their osteogenic capacity, cells were cultured in medium with or without osteogenic factors (OSG; ascorbate, dexamethasone and b-glycerophosphate) for 7, 14 and 21 days and assessed (B) for ALP activity; (C) Photomicrograph ALP histochemical staining of MSC cultures after 0 and 21 days of OSG stimulus, the latter showing clusters of strongly ALP positive (blue) cells; bars = 100 mm. (D) The ability of the cells to form mineralised matrix was determined by Alizarin Red binding assay. Data displayed as mean 6 SEM with statistical significance determined by two-way ANOVA, General Linear Model, and Tukey’s post hoc test, n = 6, **p#0.01, ***p#0.001 relative to respective (no OSG) controls. doi:10.1371/journal.pone.0073266.g002 PLOS ONE | www.plosone.org 4 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 3. The effects of MW-CM and OC-CM on MSC mineralisation and metabolic activity. 10 MSC were cultured in 50% OC-CM or MW- CM with osteogenic factors for 14 days. (A) Metabolic activity of cultures assessed by MTT assay. (B) Matrix mineralisation, assessed by quantification of bound Alizarin Red, was greatly enhanced by OC-CM or MW-CM treatment of MSC cultured in osteogenic medium. (C) Representative photomicrographs of stained cultures from B; scale bars = 100 mm. Data displayed as mean 6 SEM. Statistical significance relative to controls (adjoining grey columns) determined by Two-Way ANOVA, GLM (A) and One-Way ANOVA, Tukey’s post hoc test (B), n = 6, *p#0.05, ***p#0.001 difference from control medium or as indicated with capped line. Control = 50% medium conditioned in the absence of cells. doi:10.1371/journal.pone.0073266.g003 neutralised with basal medium (DMEM containing 10% FBS and Differentiation of MSC in medium containing osteogenic penicillin 50 U/mL; streptomycin 50 mg/mL) and the cells were (OSG) factors centrifuged at 12006g for 10 mins, resuspended and filtered MSC (10 cells/well) were seeded in 6 mm diameter culture through a 100 mm cell strainer to remove remaining tissue debris. wells in DMEM/FBS and cultured overnight. For MSC differen- Cells were pelleted by centrifugation and seeded (10 cells) in tissue tiation time-course, cells were then cultured in osteogenic medium culture flasks in basal medium, then incubated at 37uCin (DMEM/FBS containing dexamethasone (100 nM) b-glycero- humidified atmosphere of 5% CO -air. Cells were passaged by phosphate (10 mM) and ascorbate-2-phosphate (100 mM)) and treatment with 0.025% trypsin/EDTA in PBS and diluted 1:10 in assessed for ALP activity and matrix mineralisation at 7, 14 and DMEM/FBS. MSC derived from individuals (unpooled) were 21 days of incubation. For conditioned medium experiments, employed in assays after 5 passages. MSC (10 cells/well) were seeded in 6 mm diameter culture wells and cultured in 50% conditioned medium plus 50% osteogenic medium; final concentrations in MSC cultures of dexamethasone b-glycerophosphate and ascorbate-2-phosphate were thus 50 nM, 5 mM and 50 mM respectively. Cells were assessed for ALP Figure 4. MW-CM and OC-CM stimulate MSC osteoblastic maturation. 10 MSC were cultured with 50% OC-CM, MW-CM or control medium as noted with osteogenic factors for 14 days and osteoblastic differentiation characteristics (other than matrix mineralisation) were assessed. (A) ALP activity in CM-treated MSC in the presence or absence of osteogenic factors (OSG; ascorbate and dexamethasone); n = 6. Effects of 14 days of MW-CM treatment (with OSG), on MSC mRNA levels of (B) Runx2 (C) OSX (D) PTH1R, determined by real-time RT-PCR. Data displayed as mean 6 SEM. Statistical significance determined by t-test (B,C,D) or One-Way ANOVA (Tukey’s post hoc test), (A, *p#0.05, **p#0.01, ***p#0.001 difference from untreated controls or as indicated with capped line; n = 3 or as indicated. Control = 50% medium conditioned in the absence of cells. doi:10.1371/journal.pone.0073266.g004 PLOS ONE | www.plosone.org 5 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 5. The effects of MW-CM and OC-CM on osteoblastic maturation of MSC are gp130 and OSM dependent. MSC were cultured in either 50% MW-CM (A-C, F,G) or OC-CM (D, E, H) in osteogenic media in the presence of anti-gp130 (1 mg/mL) or anti-OSM (10 mg/mL) antibodies or IgG (10 mg/ml; control) as indicated. MSC were cultured for 4 days and assessed for ALP activity (A-E), or cultured for 10 days and mineralisation assessed by Alizarin Red binding assay (F-H). Data displayed as mean 6 SEM; statistical significance determined by one-way ANOVA (Tukey’s post hoc test), all data n = 4; *p#0.05 **p#0.01, ***p#0.001 relative to controls (grey columns) or as indicated by capped lines. doi:10.1371/journal.pone.0073266.g005 activity at 4 days and matrix mineralisation at 14 days or as (OD) measured at 570 nm using a Tecan Genios Pro photo- indicated. For antibody neutralisation assays, MSC were cultured spectrometer. in 50% conditioned medium plus osteogenic medium containing (final concentration) 1 mg/mL anti-gp130 or 10 mg/mL anti-OSM Alkaline Phosphatase (ALP) activity assay monoclonal antibodies or mouse IgG control, then assessed for To determine cellular ALP activity, cells were lysed in 0.1% ALP at 4 days and matrix mineralisation and metabolic activity by Triton X-100 for 30 m at room temperature. A pre-warmed MTT assay at 14 days. solution containing 10 mg/mL p-nitrophenylphosphate (pNPP) in 10% v/v diethanolamine buffer; 0.5 mM MgCl pH 9.8 was then MTT metabolic activity assay added to the lysates and optical density of samples were assessed After culture, media was completely removed from appropriate using a Tecan Genios Pro photospectrometer, OD measured at wells and MTT solution containing 1.2 mM 3-(4,5-Dimethylthia- 410 nm at 37C. This was measured at 2.5 min intervals for zol-2-yl)-2,5-diphenyltetrazolium bromide in DMEM was added, 30 mins. Results were converted to standard international units and then incubated for 37uC for 4 hours. The supernatant was (SIU), equivalent to the conversion by ALP of 1 mM of pNPP to completely removed and the cells containing the formazan p-nitrophenyl (pNP) per minute. A standard curve was generated product were solubilised in DMSO for 30 mins. The solubilised by serially diluting 1 mM pNP in diethanolamine buffer and data solution was transferred to a fresh 96-well plate and optical density presented as relative SIU. PLOS ONE | www.plosone.org 6 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 6. OSM production by macrophages, osteoclasts and MSCs. (A) Levels of OSM protein in MW-CM and OC-CM assessed by ELISA. (B) Relative OSM gene expression in macrophage and OC cultures assessed by RT-PCR. (C) Lack of OSM mRNA detection in CM-treated (4 days) MSC cultures; ‘Pos. Cont’ shows macrophage mRNA data as a method positive control. Data displayed as mean 6 SEM and statistical significance relative to controls (or as indicated by capped bars) determined by one-way ANOVA (Tukey’s post hoc test) or Student’s t-test, n = 4, *p#0.05, ***p#0.001 or as indicated by capped lines. doi:10.1371/journal.pone.0073266.g006 ManH Gene Expression Assays using standard commercially Quantification of in vitro matrix mineralisation available primer/probe mixtures (Applied Biosystems catalogue MSC were fixed in 1% formalin for 30 minutes and then Hs00231692_m1, Hs01866874_s1 and Hs00171165_m1 respec- treated with 40 mM Alizarin Red (ALZ) for 15 min at RT. For tively). Relative gene expression units were determined using the quantification of staining, a protocol was adapted from that 2DCt formula 2 61000, where DCt values represent the difference described by Stanford et al. [27]. Cells were washed repeatedly between the Ct of the gene of interest and b-actin. For analysis of with distilled water and the stain was then solubilised in 3% IL-6, TNF and the classical parathyroid hormone (PTH) receptor cetylpyridinium chloride (CPC) in 20 mM sodium phosphate buffer for 45 min. The solubilised supernatant was transferred to a (PTH1R) mRNA expression real time PCR analysis (Stratagene H H Mx3000P) of cDNA was performed using Platinum SYBR new 6 mm diameter wells and OD measured at 570 nm using a Tecan Genios Pro photospectrometer. A standard curve was Green qPCR supermix UDG (Invitrogen) according to manufac- turer’s instructions and the following conditions: 1 cycle 10 mins generated for ALZ by serially diluting 1 mM ALZ in 3% CPC. OD readings were converted to CaCl mg/well. CaCl per well is 95uC; 40 cycles 30 seconds at 95uC, 1 min at 60uC, 30 seconds at 2 2 based on molar equivalent of ALZ to Ca (1:1); 1 mM (mmol/L) is 72uC; 1 cycle 1 min at 95uC, 30 seconds at 55uC, 0 seconds at equivalent to 22.196 ng/L CaCl 95uC) normalized to hypoxanthine phosphoribosyltransferase (HPRT). Primer oligo nucleotide sequences used for real time RT-PCR using the SYBR Green qPCR-based method were as Flow cytometric analysis follows: Flow cytometry analyses of adipose tissue derived cells, CFU- HPRT (GenBank accession NM_000194.2) 59-GACCAGT- GM and CFU-GM-derived cells were performed using FacsCa- CAACAGGGGACAT-39, reverse 59-CGACCTTGACCATGT- libur and CELLquest software (Becton Dickinson, NJ). Approx- TTGGA-39; imately 1610 cells from each population were labelled with appropriate phycoerythrin (PE), fluoroscein isothyocyanate (FITC) Human TNF (GenBank accession NM_000594.3) forward 59- ATCTTCTCGAACCCCGAGTGA-39, reverse 59- CGGTTCA- and peridinin-chlorophyll protein (PerCP) labelled antibodies including anti-CD45-FITC, anti-CD14-PE, anti-CD16-FITC, GCCACTGGAGC T-39; anti-CD34-PE, anti-CD-34–PerCP, anti-CD86-PercP, anti- Human IL-6 (GenBank NM_000600.3) forward 59- AAAT- CD206-FITC, anti-CD73-PE, anti-CD90-FITC (BD Australia, TCGGTACATCCTCGACGG-39, reverse 59- GGAAGGTTCA- North Ryde, Australia) and anti-CD105-FITC (Abcam plc, GGTTGTTTTCTGC-39; Cambridge, UK) according to manufacturer instructions. As Human PTH1R (GenBank accession NM_000316.2) forward negative controls for the fluorescent cell labelling we employed 59- ACCTGCACAGCCTCATCTTCA-39, reverse 59- CACA- appropriate isotype controls for the antibodies employed. includ- CAGCCACGAAGACAGC-39. ing anti-IgG-FITC, anti-IgG-PE, anti-IgG-PerCP (BD Australia) To assess human BSP mRNA expression we employed semi- or anti-IgG2a-FITC (Abcam). quantitative RT-PCR analysis. cDNA was prepared as above and PCR reactions employed KAPA2G Robust Hotstart PCR kits Real time RT-PCR and semiquantitative RT-PCR analysis (KAPA Biosystems, Woburn, MA) according to manufacturer’s instructions using an Applied Biosystems Veriti thermal cycler of mRNA expression machine (Life Technologies, Carlsbad, CA). Glyceraldehyde-3 Cellular RNA was isolated by lysing cells in Trizol and using the phosphate dehydrogenase (GAPDH) mRNA was used as a illustra RNAspin Mini Kit (GE Healthcare, Melbourne Australia). housekeeping gene expression reference. For BSP the following RNA concentration was determined by spectrophotometer conditions were used: after 10 mins at 95uC, we used 32 thermal (Nanodrop ND1000). cDNA was synthesized from RNA using cycles (30 seconds at 95uC, 30 seconds at 58uC, 60 seconds at the SuperscriptH III First Strand Synthesis SuperMix system (Life 72uC) followed finally by 10 min at 72uC. GAPDH analysis used Technologies) as per manufacturer’s instructions. To quantify the expression of human Runx2, osterix and OSM mRNA levels we similar conditions with 30 thermal cycles. PCR generated products employed real-time PCR analysis of cDNA performed in a 7500 were separated by electrophoresis on a 1.5% agarose gel Fast Real-Time PCR System (Applied Biosystems), using Taq- containing Sybr Safe DNA stain (Invitrogen) then visualised PLOS ONE | www.plosone.org 7 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 7. The effects of OSM on osteoblastic maturation of MSC. To confirm OSM actions, MSC were cultured in osteogenic media with recombinant OSM (10 ng/mL) for 4 days and assessed for (A) ALP activity, or for 10 days and assessed for (B) mineralisation, by Alizarin Red binding assays; blocking of recombinant OSM actions by antibodies to gp130 and OSM was confirmed; n = 4. (C) OSM dose response of MSC ALP levels (at day 4) and (E) photomicrographs ALP histochemical stain in control and OSM treated MSC, day 4; bars = 100 mm. (E) BMP-2 dose response of MSC ALP levels, day 4. (F) Synergistic actions of OSM with BMP-2 but not Wnt3A co-treatment on MSC ALP levels at 4 days of incubation (with osteogenic factors). Data displayed as mean 6 SEM and statistical significance relative to controls (grey columns), or as indicated by capped bars, determined by one-way ANOVA (Tukey’s post hoc test), n = 3 unless noted, *p#0.05 **p#0.01, ***p#0.001. doi:10.1371/journal.pone.0073266.g007 under ultraviolet light using a Biorad (Gladesville, Australia) Gel Measurement of BMP and canonical Wnt activity TM Doc 2000 imaging system. Primer oligo nucleotide sequences To detect BMP and Wnt activity in conditioned medium we used for semi-quantitative RT-PCR were as follows: employed luciferase reporter transfection assays. BMP-response BSP (GenBank accession NM_004967.3; IBSP) forward 59- element (BMP-RE) [28] and TOPflash TCF/LEF (with a b- CCTTCTCTGCCCTCTCACTCC-39, and reverse 59- AT- catenin-sensitive promoter to detect canonical Wnt signals) GAGTCACTACTGCCCTGAAC-39, product size of 205 base Upstate Biotechnology, NY) reporter construct DNA (0.1 mg/ pairs;GAPDH (GenBank accession NM_001256799.1) forward 59- well) was co-transfected with pRL Renilla luciferase construct CACTGACACGTTGGCAGTGG -39 and reverse 59- CATG- (0.1 mg/well; Promega), into UMR106.01 osteoblast-like cells [29] GAGAAGGCTGGGGCTC -39, product size 405 base pairs. with Fugene 6 transfection reagent (Promega) according to manufacturer instructions. Cell cultures were treated in triplicate PLOS ONE | www.plosone.org 8 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation Figure 8. The influence of IL-4 on CFU-GM-derived macrophage stimulation of MSC osteoblastic differentiation. CM was generated from macrophages cultured in M-CSF (25 ng/mL) or M-CSF plus IL-4 (100 ng/mL) for 14 days, and medium conditioned in these cells for a further 3 days. (A) IL-10 levels in CM determined by ELISA; ‘Control’ = medium (with M-CSF) conditioned without cells. (B) MSC were exposed to CM for 4 days and assessed for ALP activity or (C) exposed to CM for 14 days and mineralisation assessed by staining by Alizarin Red binding assays. (D) Levels of OSM in CM assessed by ELISA. Data displayed as mean 6 SEM; statistical significance determined by one-way ANOVA (Tukey’s post hoc test), n = 4, **p#0.01, ***p#0.001 compared to controls (grey columns) or as indicated (capped line). doi:10.1371/journal.pone.0073266.g008 Figure 9. The effects of classical activation on the ability of macrophages to stimulate osteoblastic commitment of MSC. CFU-GM populations were cultured in GM-CSF (10 ng/mL) for 14 days, then stimulated with the following: GM-CSF (‘GM’) alone; GM-CSF plus IFNc (‘‘GM+IFNc’’); or GM-CSF plus IFNc followed by 3 days in GM-CSF plus LPS (‘‘GM+IFNc+LPS’’). (A) Higher IL-6 and TNF mRNA expression in macrophages generated in GM-CSF than M-CSF (determined by RT-PCR). (B) TNF protein was determined (by ELISA) in conditioned medium from M- CSF, GM, GM+IFNc and GM+IFNc+LPS treated macrophages. ‘Cont.’ = medium (containing GM-CSF) conditioned without cells. (C) MSC were exposed to CM from the cells indicated and MSC cultures assessed for ALP activity after 4 days and (D) mineralisation (Alizarin Red binding assay) at 14 days. (E) Levels of OSM in CM assessed by ELISA. Data displayed as mean 6SEM; statistical significance determined by one-way ANOVA (Tukey’s post hoc test); A,B n = 3, C-E n = 4. *p#0.05, **p#0.01, ***p#0.001 compared to their controls (in adjoining grey columns) or as indicated by capped lines. doi:10.1371/journal.pone.0073266.g009 PLOS ONE | www.plosone.org 9 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation with CM for 24h, PBS rinsed then lysed wth Passive Lysis Buffer CM or OC-CM addition greatly increased the levels of (Promega) for 24h at 4uC. Lysates were transferred to a white flat mineralization in the MSC, by five-fold and three-fold respectively bottomed 96 well microplate (Corning, Lowell, MA) and signal (Fig. 3B,C, Fig. S1). In such cultures ALP levels were also strongly measured using firefly Luciferase substrate and Stop and Glo elevated (Fig. 4A), consistent with enhanced osteoblastic differen- reagents (Promega) as per manufacturer instructions using a tiation. In contrast, conditioned medium from M-CSF-starved EnVision multilabel (PerkinElmer, Waltham, MA) plate reader. macrophages did not induce mineralisation in MSC (data not shown). Surprisingly, we noted that the presence of osteogenic medium (i.e., medium containing ascorbate, dexamethasone and Statistical analyses b-glycerophosphate) was not necessary for the pro-osteoblastic Data are expressed as the mean 6 SEM where applicable. actions of MW-CM and OC-CM. Omission of osteogenic Differences between groups were determined using either components from the culture medium resulted in lower levels of Student’s t-test (for 2 way comparison), or by one-way ANOVA MSC ALP levels after 14 days, but ALP levels were still greatly or two-way ANOVA (GLM), followed by Tukey’s post hoc test as indicated. Statistical significance is indicated thus: * p,0.05, ** enhanced by the conditioned media (Fig. 4A); indeed the responses to CM were similar to those of cultures in osteogenic medium in p,0.01, *** p,0.001. Statistical significance indicated on graphs is relative to control cultures or between groups connected with terms of fold change relative to baseline. Thus, pro-osteoblastic capped line. actions of these conditioned media were not dependent on osteogenic supplements and may arise through a different mechanism. Since MW-CM was able to elicit the highest levels Results of osteoblastic differentiation in MSC we investigated how quickly Characterisation of cell populations this occurred compared to conventional 14-day osteogenic Macrophages: Flow cytometric analysis showed that most M-CSF treatment. As high ALP levels were induced within 4 days expanded CFU-GM cells expressed high levels of leukocyte (Fig. S1) this culture period was employed in the ALP analyses common antigen (CD45) and 98% expressed CD14 (Fig. 1B, below. Table 1), confirming them as macrophages. A large proportion of To further characterise the effects of MW secreted factors on + + these cells were also CD14 /CD16 (Table 1), resembling the MSC osteoblastic commitment we investigated the expression of ‘non-classical’ subpopulation of monocytes [30,31]. A majority of Runx2 and osterix (transcription factors critical for osteoblastic these macrophages (81% and 72% respectively) expressed antigen commitment and differentiation), as well as the classical PTH presentation co-stimulatory molecule CD86 and mannose receptor receptor (PTH1R) and bone sialoprotein (BSP) which are CD206 (Table 1). Populations of macrophages generated by characteristically expressed by mature osteoblasts. Indeed, MW- treating cord blood-derived CFU-GM with M-CSF for 14 days CM treatment of MSC caused mRNA levels these four factors to expressed NSE but little or no TRAP activity, and did not resorb rise significantly (Fig. 4B,C,D and Fig. S1C), consistent with dentine substrate (Fig. 1C). Conditioned medium from these enhanced osteoblastic maturation. macrophages showed no detectable human IL-1b and TNF (ELISA, data not shown), while IL-10 levels were detectable but Osteoblastic stimuli produced by CFU-GM-derived generally low (83.2612.2pg/ml, mean6SEM). macrophages and osteoclasts act in a gp130- and OSM- Osteoclasts: Multinucleated osteoclasts were generated by treating dependent manner CFU-GM with M-CSF and RANKL for 14 days. All cells in these We investigated the involvement of gp130-dependent cytokines cultures expressed TRAP, and produced extensive resorption pits, on the pro-osteoblastic effects of MW-CM and OC-CM using anti- demonstrating their functional osteoclastic status (Fig. 1D). gp130 and anti-OSM monoclonal antibodies. Increased ALP MSC: MSC populations were isolated from adipose tissue for levels induced by MW-CM treatment of MSC cultures for 4 days long term culture. Flow cytometric analysis indicated that MSC was abolished by anti-gp130 antibody (1 mg/mL) but unaffected populations passaged .5 times contained .95% of cells that were + + + + by control IgG1 (Fig. 5A,B). Anti-OSM (10 mg/mL) also CD73 , CD90 and CD105 (Fig. 2A). CD45 cells were not completely abolished the MW-CM-elicited rise in ALP (Fig. 5C). detected, indicating that leukocytes were not present. Cells were Increases in ALP elicited by OC-CM treatment were similarly seeded 10 cells/6 mm diameter culture well for long term culture. abolished by anti-gp130 and anti-OSM antibodies (Fig. 5D, E). The OB-forming potential of MSC (after 5 passages) was Consistent with these observations, induction of matrix mineral- confirmed by culture in osteogenic medium; these cells expressed isation by MW-CM and OC-CM treatment of MSC over 14 days little ALP by day 14, but expressed high levels by day 21 was also blocked by anti-gp130 and by anti-OSM antibodies (Fig. 2B,C). MSC cultures in osteogenic medium formed only low (Fig. 5F, G, H) further confirming that this phenomena are OSM- levels of mineralised matrix by day 14 but very high levels by day dependent. 21 (Fig. 2D). MSC formed large numbers of adipocytes stained by Oil Red O when incubated with a standard adipogenic stimulus (1 mM dexamethasone plus 175 nM insulin, 450 mM IBMX and Production of OSM by CFU-GM-derived macrophages 100 mM indomethacin) for 14 days (data not shown), confirming and osteoclasts, and by MSC the multipotential nature of these MSC populations. Having shown that the effects of MW-CM and OC-CM were OSM dependent, we determined by ELISA methods that OSM Effects of macrophage- and osteoclast-conditioned was indeed detectable in MW-CM and in OC-CM (Fig. 6A); RT- PCR analysis also confirmed that our macrophage and osteoclast media on osteoblastic differentiation of MSC populations expressed OSM mRNA (Fig. 6B) although the Cell metabolism levels in MSC cultures were raised by the presence of M-CSF itself did not have a large effect on OSM presence of osteogenic medium but were otherwise unaffected by mRNA levels. addition of 50% MW-CM or OC-CM in cultures (Fig. 3A), suggesting such CM has little or no overall effect on cell growth or In our differentiating MSC cultures, the added conditioned activity (Fig. 2D). Nevertheless, after 14 days incubation (in the medium is not the only possible source of OSM, since the MSC presence of base osteogenic medium) the presence of either MW- themselves may produce it, indeed, MW-CM may contain factors PLOS ONE | www.plosone.org 10 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation that induce OSM production in MSC cultures. However, by RT- cell density after 14 days. GM-CSF-expanded cells (GM-MW) PCR methods OSM mRNA was undetectable in the MSC and did expressed higher levels of IL-6 mRNA than M-CSF expanded cells not become evident with MW-CM treatment (Fig. 6C). Further to (Fig. 9A). IL-1b, IL-10 or TNF were not detectable in conditioned this, medium taken from MSC cultures after 4 days of incubation medium of these cells but activation by IFNc or IFNc plus LPS contained very low (indeed, barely detectable) levels of OSM significantly induced TNF production (Fig. 9B). These IFNc plus protein as did medium from MSC exposed to MW-CM for this LPS-activated cell populations analysed by FACS had far fewer period (Fig. S2A). These observations suggest autocrine actions of CD16 cells (1.0160.99%) than M-CSF-expanded macrophage MSC-derived OSM are unlikely to contribute to osteoblastic populations (Table 1); the IFNc plus LPS-activated cell contained + + + + differentiation responses in MW-CM-stimulated MSC cultures. no CD14 /CD16 and very few CD14 /CD206 cells + + (2.060.90%), while CD14 /CD86 were numerous (26.2960.89% of cells). The effects of recombinant OSM on MSC cultures, and The CM from these activated macrophage-containing popula- OSM interactions with osteogenic factors BMP-2 and tions (GM-MW,GM+ IFNc-MW and GM+ IFNc+LPS-MW) all Wnt3A failed to increase MSC ALP and mineralisation levels in MSC Since OSM activity is essential for the osteoblastic actions of relative to negative controls (Fig. 9C,D). OSM levels in medium MW-CM and OC-CM on our human adipose tissue MSC, we conditioned by these activated macrophage populations were also confirmed that, as previously described, [32] 10 ng/mL recom- lower than medium conditioned by M-CSF-treated macrophages binant human OSM strongly induces ALP and mineralisation in (MW-CM; Fig. 9E). MSC cultures (Fig. 7A,B). However, our ELISA data in Fig. 6 indicated that the OSM levels in MW-CM and OC-CM were very Discussion low, around 0.1 ng/ml. We thus tested the effects of recombinant OSM levels in this range on MSC ALP levels. We found that One of the most significant puzzles in bone biology is how 0.1 ng/ml recombinant OSM was indeed sufficiently potent to osteoblast formation and activity is controlled in normal healthy greatly increase these ALP levels, with an almost 5-fold increase bone and in disease states. The need for improved anabolic (observed over 4 days) and higher ALP levels with greater OSM therapies for bone makes identifying the mechanisms that underlie concentrations (Fig. 7C,D); matrix mineralisation was also osteoblast recruitment an important goal. Currently the main significantly increased by 0.2 ng/ml OSM (Fig. S2B). Since bone anabolic therapy that is employed clinically is injected PTH. OSM is likely to be found in microenvironments where other This treatment stimulates bone formation through several osteogenic factors are present we examined the interaction of low mechanisms, including enhancement of osteoblast survival and concentrations of OSM with BMP-2 and Wnt3A on MSC reduction of sclerostin production by osteocytes [12]. However, cultures; note that we did not find significant BMP or Wnt PTH anabolic action can be blunted by anti-resorptive drugs that activity in MW-CM itself using luciferase reporter assays reduce osteoclast number [12,33]. This, and the coupling of (Fig. S2C,D). BMP-2 100 ng/ml significantly induced our adipose resorption and formation in bone remodelling suggest that tissue MSC ALP levels (4 day cultures; Fig. 7E), though much less osteoclasts stimulate osteoblast action, although how this may potently than OSM; Wnt3A treatment had no detectable effects occur is not understood. We have presented here evidence (Fig. S2E). Co-treatment with 50 ng/ml BMP-2 and 0.025 ng/ml suggesting that human osteoclastic cells stimulate osteoblastic OSM (both concentrations without significant effects on MSC) differentiation of MSC. However, this capacity was shared by caused a sizable increase in ALP levels, suggesting synergistic macrophage populations from which our osteoclasts were derived, interactions between these two factors (Fig. 7F). The effects of showing that it is not osteoclast specific. Nevertheless, our work 2 ng/ml OSM also showed significant enhancement by 50 ng/ml (and that of Guihard et al [22]) suggest that not all types of and 100 ng/ml BMP-2 (Fig. S2F). Recombinant Wnt3A did not macrophages have this action and those with a close ontogenic detectably influence OSM actions on MSC (Fig. 7F). relationship with osteoclasts may be particularly pro-osteoblastic. We found that this activity was not due to production of bone The effects of activation on CFU-GM-derived morphogenetic protein (BMP) or Wnt activity (two well char- macrophage pro-osteoblastic stimulation of MSC acterised factors that drive osteoblast differentiation), but depend- To investigate the influence of macrophage activation we first ed entirely on macrophage or osteoclast production of OSM, an investigated the effect of alternative activation of macrophages IL-6 cytokine family member. using IL-4 (10 ng/mL) treatment applied for 3 days. IL-4 OSM is an anabolic factor for bone in vivo that, in addition to its treatment of the macrophages for 3 days did not elicit TNF or effects on MSC [32], suppresses osteocytes production of IL-1b levels but, consistent with alternative activation, significantly sclerostin, [34], a Wnt-inhibiting factor that is under active study increased levels of human IL-10 produced (Fig. 8A). IL-4 as a therapeutic target. We previously found that OSM has strong treatment of macrophages did not significantly affect the ability bone anabolic effects in mice in vivo, but OSM can be produced by of CM generated from these cells to enhance MSC ALP a number of local cell types, including mature osteoblasts expression and matrix mineralization (Fig. 8B,C). OSM levels in themselves [34,35] and it is unclear to what degree OSM directly CM generated from IL-4-treated cells were slightly greater than causes murine MSC maturation. While an OSM-dependent positive controls (Fig. 8D), although we could not detect any action of osteoclasts and macrophages may be significant for difference in OSM mRNA expression between M-CSF- and M- MSC recruitment it is unlikely to explain how bone formation is CSF+IL-4-treated macrophages (data not shown). stimulated by osteoclast-initiated remodelling unless other factors To investigate the effects of classical activation, CFU-GM- either direct MSC to the site of osteoclast activity or provide an derived cells were expanded with GM-CSF 10 ng/mL (rather amplifying co-stimulus for OSM action. In this regard it is also than M-CSF) for 14 days (GM-MW); some GM-CSF expanded notable that mice deficient in the OSM receptor do not have cells were also further activated by treatment with IFNc (1 ng/ disordered bone formation [34]; OSM null mice have been also mL) or a combination of IFNc plus 100 ng/mL LPS (Fig. 9). Both been studied, particularly for haematopoiesis defects [36] but no GM-CSF and M-CSF expansion produced cell cultures of similar gross bone abnormality reported. We previously found that mice PLOS ONE | www.plosone.org 11 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation lacking gp130-SHP2/ERK signalling (but not gp130-STAT3 blastic stimuli. This indicates that alternative macrophage signals) do have reduced bone mass but not disordered remod- activation maintained their pro-osteoblastic activity, again unlike elling [37]. Clearly, OSM cannot therefore be essential for normal the CD14 adult monocyte derived populations studied by murine bone remodelling, although its actions are likely to overlap Guihard et al. [22]. In general, these data collectively suggest with other related cytokines [38] and interact with other there may be significant differences between our CFU-GM- derived macrophages and monocyte-derived macrophages. It osteogenic factors, as we found with BMP-2. These considerations, and the fact that the degree of MSC recruitment in normal bone seems reasonable to assume that a pro-osteoblastic or anti- osteoblastic outcome of a given stimulus could depend greatly on modelling and remodelling is unclear, currently makes it difficult to assess the importance of OSM in bone metabolism. features of the macrophage populations. This suggests that determining the profile of macrophages present in bone and bone Our data is clearly consistent with an influence of macrophages lesions (which would presumably include both monoctyes and on MSC, but the nature of macrophage influence on bone CFU-GM) is critical for understanding the outcome of a particular formation remains controversial. Striking observations were made stimulus. A detailed comparison of our experimental system with by Alexander et al. [16] in a fracture model where they noted that that used by Guihard et al. [22] and Nicolaidou et al [23] may also depletion of c-fms cells (principally macrophages, but also clarify how macrophages affect bone formation. It is notable that osteoclasts) greatly reduced osteoblast numbers and bone forma- classically activated macrophages in vivo are associated with tion. Due to the location of resident macrophages near the bone chronic inflammation and low bone formation, and since surface and the effects of macrophage depletion they proposed a inflammation commonly drives osteolysis this can make inflam- central role for macrophages in enhancing or maintaining bone matory lesions very destructive to bone. However, inflammation formation, involving osteal macrophages in close contact with can have a pro-osteoblastic outcome, as commonly observed in osteoblasts [14]. Given the many varied functions of macrophages ankylosing spondylitis. The reasons for this are unclear but and the abundance of macrophages in bone and bone marrow, properties of the recruited macrophages in these lesions could play this is certainly plausible. It also suggests that factors that stimulate an influential role. Such contrasting effects on local bone or recruit macrophages could indirectly influence bone formation, metabolism can also be seen in cancer invasion – for example, and a role here for OSM is possible. Furthermore, we noted that although breast cancers are typically osteolytic, osteoblastic lesions not only was OSM extremely potent in its effects on MSC but it also occur. acted synergistically with BMP-2. The possibility that OSM In summary, we have found that macrophage- and osteoclast- cooperates with this and other factors to increase bone formation, derived OSM stimulates MSC differentiation to osteoblasts. This in addition to the ability of OSM to suppress sclerostin and induce stimulation occurs more rapidly (within 4 days of incubation), than production of osteoblastic factors like IL-33 [39], suggest that widely used ascorbate/dexamethasone treatment, making this a further scrutiny of macrophage (and OSM) actions in bone are very useful experimental system. This OSM-mediated interaction, warranted. consistent with the observations of Song et al. [32], may play a The work of Guihard et al. [22] and more recently Nicolaidou significant role in stimulating and maintaining osteoblastic activity et al. [23] identified that MSC (derived from human bone marrow in bone, at least where this dependent on MSC differentiation. We stroma) also undergo enhanced osteoblastic differentiation in found that immature M-CSF-dependent macrophages (which are response to mature macrophages derived from human CD14 abundant in bone marrow), including those exposed to IL-4 to circulating monocytes; this occurred in a manner at least partly induce alternative activation, are a good source of this pro- dependent on OSM. The conclusions of these studies otherwise osteoblastic activity. However this activity is significantly reduced differ markedly in many respects, and differ in some respects to or abolished by GM-CSF exposure or classical activation, our study. Guihard et al. [22] found that conditioned medium although whether this is solely due to their reduced OSM from GM-CSF- and IFNc-stimulated monocyte-derived CD14 production or whether they produce anti-osteoblastic factors is cells (classically activated macrophages) drive osteoblastic differ- unclear. This work confirms that macrophages and osteoclasts can entiation of MSC, and that this is enhanced by LPS treatment, have a major effect on osteoblastic cell recruitment from MSC, while conditioned medium from CD14 monocytes treated with although the specific phenotype of the macrophages present is alternative activators IL-4 or IL-10 did not. In contrast, clearly important. Nicolaidou et al. [23] found that medium conditioned by human monocytes did not drive MSC osteoblastic differentiation at all unless co-cultured with the MSC; consistent with this, conditioned Supporting Information medium from monocyte/MSC co-cultures stimulated osteoblast Figure S1 Time course of MW-CM effects on MSC maturation in other MSC cultures. In our work we employed maturation. MSC were cultured in medium containing proliferating macrophages derived from progenitors that resemble osteogenic factors (ascorbate, dexamethasone and b–glycerophos- immature bone marrow macrophages rather more than adult phate) for 4, 7 and 14 days, with or without addition of 50% MW- monocytes; our M-CSF-treated cord blood-derived macrophages CM as indicated, then assessed for (A) ALP activity and (B) expressed CD14 but also CD16, suggesting a ‘non classical’ mineralisation. Data displayed as mean 6 SEM; statistical monocyte phenotype [30]. Classical activation of these cells (which significance determined by one-way ANOVA (Tukey’s post hoc reduced CD16 expression) resulted in lower OSM levels, also test), n = 4, **p#0.01 and ***p#0.001 compared to respective indicating that these macrophages differ markedly from adult control cultures. (C) BSP and GAPDH mRNA levels were monocytes employed by Guihard et al. We found that cord blood- examined (by semi-quantitative RT-PCR) in MSC cultured for derived macrophages directly co-cultured with MSC induced only 14 days with osteogenic factors alone (Control) or with addition of a weak action on ALP expression compared to MW-CM (data not 50% MW-CM; representative of 3 independent cultures. shown). We are uncertain why this is the case, but it may be due to (PDF) technical aspects that require further study, as these immature macrophages did not appear to thrive in such co-cultures. Our Figure S2 The lack of production of OSM by MSC, BMP studies also indicated that macrophages treated with either M-CSF and Wnt activity in MW-CM, and the influence of BMP-2, or M-CSF plus IL-4 produced strong (OSM-dependent) osteo- Wnt3A and OSM on MSC maturation. (A) MSC were PLOS ONE | www.plosone.org 12 September 2013 | Volume 8 | Issue 9 | e73266 Macrophages Regulate Osteoblastic Maturation cultured in 50% MW-CM or control medium (‘Cont-Med’) osteogenic factors; n = 3. Data displayed as mean 6 SEM; for 4 days. OSM levels in the resulting MSC-exposed culture statistical significance determined by one-way ANOVA (Tukey’s medium were assessed by ELISA but showed only very low post hoc test), all n = 3. *p#0.05, **p#0.01 and ***p#0.001 levels, much lower than MW-CM (‘Pos. Cont.’) alone. (B) compared to control cultures (grey columns). Detailed dose response of MSC matrix mineralisation (at day 7) (PDF) to OSM treatment. To detect BMP and Wnt protein activity in MW-CM (50%), luciferase reporter-based assays were em- Acknowledgments ployed, using BMP-RE and TOPFlash reporters respectively. (C) The authors would like to thank Drs Nicole Horwood and Vicky UMR106.01 osteoblastic cells transiently co-transfected with Nicolaidou (Kennedy Institute of Rheumatology, University of Oxford, BMP-RE luciferase and Renilla reporter constructs, 24h incuba- United Kingdom) for helpful advice and discussion of this work. tion; ‘Cont.’ = control medium conditioned without cells, BMP-2 = 100 ng/mL. (D) UMR106.01 cells were used as in B, but with Author Contributions TOPflash luciferase constructs and Renilla reporter construct; Wnt3A = 100 ng/mL. (E) Lack of effects on ALP responses of Conceived and designed the experiments: TJF PRE GCN JMWQ. Wnt3A (100 ng/mL) after 4 days of incubation. (F) Co-operative Performed the experiments: TJF JMH PPS DE FMC JMWQ. Analyzed the data: TJF JMH PPS JMWQ. Contributed reagents/materials/analysis actions of 2 ng/ml OSM with BMP-2 (but not Wnt3A) co- tools: TJF JMH PRE IH JMWQ. Wrote the paper: TJF GCN JMWQ. treatment on MSC ALP levels at 4 days of incubation with References 1. Long F (2012) Building strong bones: molecular regulation of the osteoblast 21. Quinn JM, Elliott J, Gillespie MT, Martin TJ (1998) A combination of osteoclast lineage. Nat Rev Mol Cell Biol 13: 27–38. differentiation factor and macrophage-colony stimulating factor is sufficient for both 2. Lee RH, Kim B, Choi I, Kim H, Choi HS, et al. (2004) Characterization and human and mouse osteoclast formation in vitro. Endocrinology 139: 4424–4427. expression analysis of mesenchymal stem cells from human bone marrow and 22. Guihard P, Danger Y, Brounais B, David E, Brion R, et al. (2012) Induction of adipose tissue. Cell Physiol Biochem 14: 311–324. osteogenesis in mesenchymal stem cells by activated monocytes/macrophages 3. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, et al. (2006) depends on oncostatin M signaling. Stem Cells 30: 762–772. Minimal criteria for defining multipotent mesenchymal stromal cells. The 23. Nicolaidou V, Wong MM, Redpath AN, Ersek A, Baban DF, et al. (2012) International Society for Cellular Therapy position statement. Cytotherapy 8: Monocytes induce STAT3 activation in human mesenchymal stem cells to 315–317. promote osteoblast formation. PLoS One 7: e39871. 4. Kern S, Eichler H, Stoeve J, Kluter H, Bieback K (2006) Comparative analysis 24. Quinn JM, Sims NA, Saleh H, Mirosa D, Thompson K, et al. (2008) IL-23 of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose inhibits osteoclastogenesis indirectly through lymphocytes and is required for the tissue. Stem Cells 24: 1294–1301. maintenance of bone mass in mice. J Immunol 181: 5720–5729. 5. Hattori H, Sato M, Masuoka K, Ishihara M, Kikuchi T, et al. (2004) Osteogenic 25. Mosser DM (2003) The many faces of macrophage activation. J Leukoc Biol 73: potential of human adipose tissue-derived stromal cells as an alternative stem cell 209–212. source. Cells Tissues Organs 178: 2–12. 26. Quinn JM, Morfis M, Lam MH, Elliott J, Kartsogiannis V, et al. (1999) 6. Majors AK, Boehm CA, Nitto H, Midura RJ, Muschler GF (1997) Calcitonin receptor antibodies in the identification of osteoclasts. Bone 25: 1–8. Characterization of human bone marrow stromal cells with respect to 27. Stanford CM, Jacobson PA, Eanes ED, Lembke LA, Midura RJ (1995) Rapidly osteoblastic differentiation. J Orthop Res 15: 546–557. forming apatitic mineral in an osteoblastic cell line (UMR 106-01 BSP). J Biol 7. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, et al. (1999) Mul- Chem 270: 9420–9428. tilineage potential of adult human mesenchymal stem cells. Science 284: 143–147. 28. Korchynskyi O, ten Dijke P (2002) Identification and functional characterization 8. Seong JM, Kim BC, Park JH, Kwon IK, Mantalaris A, et al. (2010) Stem cells in of distinct critically important bone morphogenetic protein-specific response bone tissue engineering. Biomed Mater 5: 062001. elements in the Id1 promoter. J Biol Chem 277: 4883–4891. 9. Akagawa KS, Takasuka N, Nozaki Y, Komuro I, Azuma M, et al. (1996) 29. Allan EH, Hausler KD, Wei T, Gooi JH, Quinn JM, et al. (2008) EphrinB2 Generation of CD1+RelB+ dendritic cells and tartrate-resistant acid phospha- regulation by PTH and PTHrP revealed by molecular profiling in differentiating tase-positive osteoclast-like multinucleated giant cells from human monocytes. osteoblasts. J Bone Miner Res 23: 1170–1181. Blood 88: 4029–4039. 30. Passlick B, Flieger D, Ziegler-Heitbrock HW (1989) Identification and 10. Ash P, Loutit JF, Townsend KM (1980) Osteoclasts derived from haematopoi- characterization of a novel monocyte subpopulation in human peripheral etic stem cells. Nature 283: 669–670. blood. Blood 74: 2527–2534. 11. Scheven BA, Visser JW, Nijweide PJ (1986) In vitro osteoclast generation from 31. Tacke F, Randolph GJ (2006) Migratory fate and differentiation of blood different bone marrow fractions, including a highly enriched haematopoietic monocyte subsets. Immunobiology 211: 609–618. stem cell population. Nature 321: 79–81. 32. Song HY, Jeon ES, Kim JI, Jung JS, Kim JH (2007) Oncostatin M promotes 12. Martin TJ, Quinn JM, Gillespie MT, Ng KW, Karsdal MA, et al. (2006) osteogenesis and suppresses adipogenic differentiation of human adipose tissue- Mechanisms involved in skeletal anabolic therapies. Ann N Y Acad Sci 1068: derived mesenchymal stem cells. J Cell Biochem 101: 1238–1251. 458–470. 33. Delmas PD, Vergnaud P, Arlot ME, Pastoureau P, Meunier PJ, et al. (1995) The 13. Tang Y, Wu X, Lei W, Pang L, Wan C, et al. (2009) TGF-beta1-induced anabolic effect of human PTH (1–34) on bone formation is blunted when bone migration of bone mesenchymal stem cells couples bone resorption with resorption is inhibited by the bisphosphonate tiludronate–is activated resorption formation. Nat Med 15: 757–765. a prerequisite for the in vivo effect of PTH on formation in a remodeling system? 14. Chang MK, Raggatt LJ, Alexander KA, Kuliwaba JS, Fazzalari NL, et al. (2008) Bone 16: 603–610. Osteal tissue macrophages are intercalated throughout human and mouse bone 34. Walker EC, McGregor NE, Poulton IJ, Solano M, Pompolo S, et al. (2010) lining tissues and regulate osteoblast function in vitro and in vivo. J Immunol Oncostatin M promotes bone formation independently of resorption when 181: 1232–1244. signaling through leukemia inhibitory factor receptor in mice. J Clin Invest 120: 15. Winkler IG, Sims NA, Pettit AR, Barbier V, Nowlan B, et al. (2010) Bone 582–592. marrow macrophages maintain hematopoietic stem cell (HSC) niches and their 35. Walker EC, Poulton IJ, McGregor NE, Ho PW, Allan EH, et al. (2012) depletion mobilizes HSCs. Blood 116: 4815–4828. Sustained RANKL response to parathyroid hormone in oncostatin M receptor- 16. Alexander KA, Chang MK, Maylin ER, Kohler T, Muller R, et al. (2011) deficient osteoblasts converts anabolic treatment to a catabolic effect in vivo. Osteal macrophages promote in vivo intramembranous bone healing in a mouse J Bone Miner Res 27: 902–912. tibial injury model. J Bone Miner Res 26: 1517–1532. 36. Minehata K, Takeuchi M, Hirabayashi Y, Inoue T, Donovan PJ, et al. (2006) 17. Walsh NC, Reinwald S, Manning CA, Condon KW, Iwata K, et al. (2009) Oncostatin m maintains the hematopoietic microenvironment and retains Osteoblast function is compromised at sites of focal bone erosion in hematopoietic progenitors in the bone marrow. Int J Hematol 84: 319–327. inflammatory arthritis. J Bone Miner Res 24: 1572–1585. 37. Sims NA, Jenkins BJ, Quinn JM, Nakamura A, Glatt M, et al. (2004) 18. Hodge JM, Kirkland MA, Aitken CJ, Waugh CM, Myers DE, et al. (2004) Glycoprotein 130 regulates bone turnover and bone size by distinct downstream Osteoclastic potential of human CFU-GM: biphasic effect of GM-CSF. J Bone signaling pathways. J Clin Invest 113: 379–389. Miner Res 19: 190–199. 38. Sims NA (2009) gp130 signaling in bone cell biology: multiple roles revealed by 19. Aitken CJ, Hodge JM, Nishinaka Y, Vaughan T, Yodoi J, et al. (2004) analysis of genetically altered mice. Mol Cell Endocrinol 310: 30–39. Regulation of human osteoclast differentiation by thioredoxin binding protein-2 39. Saleh H, Eeles D, Hodge JM, Nicholson GC, Gu R, et al. (2011) Interleukin-33, and redox-sensitive signaling. J Bone Miner Res 19: 2057–2064. a target of parathyroid hormone and oncostatin m, increases osteoblastic matrix 20. Hodge JM, Kirkland MA, Nicholson GC (2007) Multiple roles of M-CSF in mineral deposition and inhibits osteoclast formation in vitro. Endocrinology 152: human osteoclastogenesis. J Cell Biochem 102: 759–768. 1911–1922. PLOS ONE | www.plosone.org 13 September 2013 | Volume 8 | Issue 9 | e73266

Journal

PLoS ONE – Pubmed Central

Published: Sep 12, 2013

There are no references for this article.