Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Mangrove sediment, a new source of potential biosurfactant-producing bacteria

Mangrove sediment, a new source of potential biosurfactant-producing bacteria Ann Microbiol (2012) 62:1669–1679 DOI 10.1007/s13213-012-0424-9 ORIGINAL ARTICLE Mangrove sediment, a new source of potential biosurfactant-producing bacteria Atipan Saimmai & Akio Tani & Vorasan Sobhon & Suppasil Maneerat Received: 2 June 2011 /Accepted: 30 January 2012 /Published online: 23 February 2012 Springer-Verlag and the University of Milan 2012 Abstract Biosurfactant-producing bacteria were isolated strains L. komagatae 183 and Ochrobactrum anthropi 11/6 from mangrove sediment samples collected in the southern exhibited emulsification activities comparable to those of part of Thailand by an enrichment-culture technique in synthetic surfactants. Overall, the new biosurfactant- which lubricating oil was the sole carbon source. A total producing strains isolated in this study display promising of 1,600 colonies were obtained, which were screened for features for the future development and use in economically biosurfactant production using the qualitative drop- efficient industrial-scale biotechnological processes. collapsing test in a mineral salts medium containing 1% of . . different carbon sources (commercial sugar, glucose, molas- Keywords Biosurfactant Bioemulsifier Mangrove . . ses, and used lubricating oil). Ninety-five isolates were sediment Screening Renewable substrate positive for biosurfactant production based on the results of this test, among which 20 could reduce the surface tension of the 48-h culture supernatant. The phylogenetic Introduction position of these 20 isolates was evaluated by 16S rRNA gene sequence analysis. The production of biosurfactants Mangroves, dominant inter-tidal wetlands found along was determined for strains representative of eight different coastlines of tropical and subtropical regions, are considered bacterial genera. Leucobacter komagatae 183, one of the to be significant sinks for pollution from freshwater dis- newly isolated strains showing biosurfactant production, charges as well as from contaminated tidal water (Bernard produced extracellular biosurfactants which reduced the et al. 1996). The wetlands are also particularly susceptible to surface tension of the culture supernatant from 72.0 to oil pollution since they are usually situated in regions active 32.0 m/Nm. Eighteen strains released extracellular emulsi- in oil production, transportation, and other anthropogenic fiers able to stabilize the emulsion formed. Among these, the activities generating spilled and stranded oil (Burns et al. 1993). When oil spreads in an environment, low-molecular- weight hydrocarbons are volatilized while polar components A. Saimmai are dissolved in water. However, most of the oil hydrocarbons Department of Food Science Technology, Faculty of Agriculture remain on the water surface or adhere to soil particles due to Technology, Phuket Rajabhat University, their low solubility (Karanth et al. 1999). Evaporation and Phuket 83000, Thailand photo-oxidation play an important role in oil detoxification, A. Tani with ultimate and complete degradation being accomplished Institute of Plant Science and Resources, Okayama University, mainly by microbial activity (Batista et al. 2006). 2-20-1 Chuo, Diverse groups of indigenous microorganisms capable of Kurashiki 710-0046, Japan utilizing and degrading contaminants such as hydrocarbons V. Sobhon S. Maneerat (*) and polycyclic aromatic hydrocarbons (PAHs) might be Department of Industrial Biotechnology, Faculty of Agro-Industry, present in contaminated sediment (Ke et al. 2003). Prince of Songkla University, Hydrocarbon-degrading bacteria release biosurfactants that Hat Yai 90112, Thailand facilitate the assimilation of these insoluble substrates e-mail: [email protected] 1670 Ann Microbiol (2012) 62:1669–1679 (Bicca et al. 1999). However, intrinsic biodegradation under the same conditions as described above. This procedure often takes a long time to complete because of the low was repeated five times. water solubility of hydrocarbon (Snape et al. 2006). The Sediment-enriched cultures were diluted in a sterile biodegradation process is maximized when the water- 0.85% saline solution and plated on MSM agar using glu- insoluble substrate is dissolved or emulsified, which are cose (1%, w/v) or ULO (1%, w/v) as the carbon source for the mechanisms by which biosurfactants are capable of the isolation of microorganisms. Morphologically distinct increasing the bioavailability of hydrocarbons that dis- colonies were re-isolated by transfer onto fresh glucose- or solve poorly. ULO-containing agar plates at least three times to obtain Biosurfactants are either extracellular compounds or pure cultures and subsequently Gram-stained. Pure cultures localized on the cell surface (Chayabutra et al. 2001). were stored at −20°C in MSM mixed with sterile glycerol at In the latter case, the microbial cell itself is a biosurfac- a final concentration of 30%. tant and adheres to hydrocarbon (Maneerat 2005). There are many areas of application where biosurfactants can Screening of potential biosurfactant-producing strains be used, such as in industries and environmental restora- tion, including the removal of heavy metal and organic In total, 1,600 isolates were streaked on MSM agar containing compounds from soil and water. Biosurfactants also in- 1% (w/v) of ULO or glucose for 48 h at 30°C. One loop of crease both the water-insoluble uptake of microorganisms each isolate was then transferred to test tubes containing 5 ml and the efficiency of bioremediation. Whereas many of nutrient broth (NB) and shaken (150 rpm) at 30°C for 24 h. studies on biosurfactants have been performed in the last A100-μl sample of each cell culture was transferred to few decades (Maneerat et al. 2006; Rodrigues et al. 5 ml of MSM medium supplemented with 1% (w/v) of 2006; Maneerat and Phetrong 2007; Kebbouche-Gana et different carbon sources [commercial sugar (CS, su- al. 2009; Anandaraj and Thivakaran 2010; Gudina et al. crose), glucose, molasses, and ULO) in a rotary shaker 2010; Burgos-Diaz et al. 2011;Darvishiet al. 2011), (Vision Scientific, Daejon, Korea) at 30°C and 150 rpm relatively fewer reports have been published on biosur- for 24 h. Screening for biosurfactant-producing isolates factants produced by mangrove sediment microorgan- was performed by using the qualitative drop-collapsing isms. The objectives of this study were to isolate and test andbytesting forthe emulsificationactivity(E24) of characterize new biosurfactant-producing bacteria from the culture supernatant after centrifugation at 8,500 rpm mangrove sediments. The utilization of renewable and and4°C for10min. cheap carbon sources for biosurfactant production by isolated strains was also studied. Evaluation of biosurfactant production Twenty bacterial isolates were evaluated for biosurfactant Materials and methods production in 250-ml Erlenmeyer flasks containing 50 ml of MSM supplemented with 1% (w/v) of the chosen carbon Microorganism isolation source. The carbon sources used when testing for biosurfac- tant production were CS, glucose, glycerol, molasses, n- Samples (100 g) of mangrove sediment (depth: 0–5 cm) hexadecane, and ULO. The isolates were activated by grow- were collected from five different sites (10 samples/site) ing them on MSM agar containing 1% (w/v) of ULO or along the east and west coast of southern Thailand: (1) Palain glucose for 48 h at 30°C. One loop of each isolate was then District, Trang Province; (2) Sikao District, Trang Province; transferred to test tubes containing 5 ml of NB and shaken (3) Thungwa District, Satun Province; (4) Ranot District, (150 rpm) at 30°C for 24 h. Cell suspensions were adjusted Songkhla Province; (5) Huasai District, Nakhonsrithammarat to an optical density (OD) at 600 nm of 0.10±0.05 Province. The enrichment and isolation of the biosurfactant- (10 CFU/ml), and 1 ml of each suspension was used as producing bacterial consortium was performed by using used the starter. The flasks were incubated at 30°C, and growth lubricating oil (ULO) as the sole carbon and energy source. wasmonitoredbyreadingthe OD on a Libra S22 Initially, the bacterial consortium was enriched by adding 1 g spectrophotometer (Biochrom, Cambridge, UK). Biosur- of soil sample to 50 ml of minimal salt medium [MSM (g/l): factant activities were measured by using the qualitative K HPO ,0.8;KH PO ,0.2; CaCl , 0.05; MgCl , 0.5; FeCl , drop-collapsing test and by testing for the E24 and sur- 2 4 2 4 2 2 2 0.01; (NH ) SO , 1.0; NaCl, 5.0; ULO, 10; Yin et al. 2005]in face tension by the duNouy method using a ring tensi- 4 2 4 a 250-ml Erlenmeyer flask. This mixture was shaken ometer (OS; Torsion Balance, Warwickshire, UK). The (150 rpm) at 30°C for 5 days or until an oil emulsion was activity of the synthetic surfactants sodium dodecyl sul- observed. A 1-ml aliquot of the culture broth was then trans- fate (SDS; Sigma Chemicals, St. Louis, MO) and Tween 80 ferred to 50 ml of fresh MSM in a 250-ml flask and incubated (Sigma Chemicals) (10 g/l) was tested at concentrations Ann Microbiol (2012) 62:1669–1679 1671 higher than their critical micelle concentrations (2.0 and Results 0.16 g/l, respectively). MSM medium supplemented with the different carbon sources without inocula was used as a Microorganism isolation negative control. The 89 sediment samples screened for biosurfactant pro- 16S rRNA gene sequence analysis ducers were collected from the east and west coasts of southern Thailand by an enrichment-culture technique using Selected isolates were incubated for 48 h at 30°C on MSM ULO as a sole carbon source. The enrichment-culture tech- agar supplemented with 1% (w/v) of ULO or glucose and nique was repeated five times, resulting in the isolation of subsequently Gram-stained. For 16S rRNA gene amplifica- 1,600 colonies by spreading on MSM supplemented with tion, selected bacterial isolate chromosomal DNA was 1% of glucose or ULO as the carbon source. These 1,600 isolated using a Roche kit (Roche Applied Science, isolates were screened for biosurfactant production in MSM Mannheim, Germany) following the manufacturer’s containing 1% of the different carbon sources (CS, glucose, instructions. The 16S rRNA gene was amplified using a molasses, or ULO). Ninety-five isolates tested positive for PCR method with 1 U of Taq DNA polymerase (Bio-Lab, biosurfactant production according to the qualitative drop- Auckland, New Zealand) and universal bacterial primers collapsing test. These 95 isolates also showed promising UFUL (GCCTAACACATGCAAGTCGA) and URUL biosurfactant activity by exhibiting a surface tension reduc- (CGTATTACCGCGGC TGCTGG) (Nilsson and Strom tion of more than 10 mN/m. Accordingly, 20 isolates were 2002). These two primers target two highly conserved regions selected for further testing: 19 of these grew on MSM of the prokaryotic 16S rRNA gene (Phalakornkule and containing glucose or molasses as the sole carbon source, Tanasupawat 2006) and produced a PCR product of 18 grew on MSM supplemented with CS or ULO as the sole about 450–500 bp. The 16S rRNA gene was sequenced by carbon source, and only three grew on MSM containing n- using the ABI Prism BigDye terminator kit (Perkin-Elmer hexadecane (Table 1). Applied Biosystems, Waltham, MA), according to the manu- Of these 20 bacterial isolates, 16 (80%) were Gram- facturer’s protocol, with UFUL as primer. The 500-bp 16S negative bacteria. This result is in accordance with previous rRNA gene sequences obtained were aligned along with the reports that most bacteria isolated from sites with a history sequences of type strains obtained from the GenBank by using of contamination by oil or its byproducts are Gram-negative the program ClustalW (Thompson et al. 1997). Sequence bacteria due to the presence of outer membranes which act homologies were examined using BLAST ver. 2.2.12 of the as biosurfactants (Bicca et al. 1999; Bodour et al. 2003; National Center for Biotechnology Information (NCBI), and a Batista et al. 2006). However, we found that selected iso- lates produced extracellular biosurfactants since culture consensus neighbor-joining tree was constructed using Molecular Evolutionary Genetics Analysis (MEGA) software supernatants exhibited biosurfactant activity based on the ver. 4.0 (Tamura et al. 2007). The 16S rRNA gene sequence results of the drop-collapsing and E24 tests (Table 1). was submitted to GenBank with an accession number. 16S rRNA gene sequence analysis Analytical methods The 20 strains selected for further testing were genetically Growth Growth was monitored by measuring the OD of the characterized as belonging to eight different genera culture broth at 600 nm. (Table 2). Their sequences were deposited in DDBJ/ EMBL/GenBank (accession numbers are given in parenthesis Drop-collapsing test The drop collapse test was performed in Fig. 1) and compared to those of the biosurfactant- as described by Youssef et al. (2004). producing strains described in the literature. A phylogenetic tree was reconstructed (Fig. 1). Among the analyzed strains, Emulsification activity (E24) assay The E24 assay was 19 isolates (2/3, 7, 9/4, 11, 11/6, 33, 54, 57 79, 213, 318, 319, performed as described by Plaza et al. (2006). 418, 1106, 1033, 1291, 1297, 1310, and 1457) belonged to genera that have been previously been reported and charac- Surface tension measurement Assessment of surface tension terized for the production of biosurfactants or bioemulsifiers was performed as described by Jachimska et al. (1995). (Kebbouche-Gana et al. 2009; Anandaraj and Thivakaran 2010;Gudina et al. 2010; Burgos-Diaz et al. 2011;Darvishi Statistical analysis All experiments were carried out at et al. 2011). One isolate (183) belonged to the genus Leuco- least in triplicate. Statistical analysis was performed using bacter. To the best of our knowledge, this is the first report on Statistical Package for Social Science ver. 10.0 for Windows the capacity of the genus Leucobacter to produce a (SPSS, Chicago, IL). biosurfactant. 1672 Ann Microbiol (2012) 62:1669–1679 Table 1 Growth of bacterial a b c c Strain Gram stain Growth DCT EA strains on different carbon sources and biosurfactant CS Glucose n-Hexadecane Molasses ULO production in culture supernatants Thungwa, Satun sediment 2/3 N + + − ++ + + 7N + + − ++ + + 9/4 N − + − ++ + + 11 N + + −− ++ − 11/6 N + + − ++ + + Palain, Trang sediment 33 N + − ++ + + + 54 P + + − ++ + + 57 N + + − ++ + + 79 N + + − ++ + + Sikao, Trang sediment 183 P + + − + − ++ CS, Commercial sugar; ULO, 213 N + + − ++ + + used lubricating oil; 318 P + + − ++ + + EA, small-scale emulsification 319 N + + − ++ + + assay; DCT, qualitative 418 N − + − ++ + + drop-collapsing test Ranot, Songkhla sediment Gram stain: P, Gram-positive; N, Gram-negative 1033 N + + + + + + + +, Biomass increase of >10-fold 1106 N + + + + + + + compared to the inoculum; 1291 N + + − ++ + + –, biomass increase of the tested Huasai, Nakhonsrithammarat sediment strain of <10-fold (OD <1.0) 1297 N + + − + − ++ +, Positive test at least with one carbon source; –, negative 1310 P + + − ++ + − test with the five tested 1457 N + + − ++ + + carbon sources Evaluation of biosurfactant production molasses, or ULO. Emulsification activities significantly higher than those of the culture medium supplemented with The 20 strains testing positive for biosurfactant production each carbon sources were found in all strains (Table 3). were further examined for their capability to grow and Among the 20 selected isolates, the emulsification activity produce biosurfactants in shake flasks using the same car- evaluated by the E24 ranged from 5.5 to 69.8%. Most of bon sources used for the small-scale assay. The same results isolates demonstrated 20–50% of emulsification. The were obtained under the two cultural conditions, thus dem- highest emulsification activity was observed in Ochro- onstrating the reliability of the small-scale growth test to bactrum anthropi 11/6. In our study, the specificity of screen for substrates supporting the growth of the isolates emulsion formation was highly variable, depending on (Table 3). Among the five tested carbon sources, n-hexade- the carbon source used in the growth medium of the cane supported the growth of a small number of strains after culture. 48 h of incubation. It was noted that only Acinetobacter sp. Biosurfactants produced by the selected 20 bacterial iso- 33, Enterobacter sp. 1033, and Pseudomonas putida 1106 lates were affected by type of carbon source. When the grew on n-hexadecane (Table 1). In order to widen the medium contained a water-insoluble substrate (ULO), 18 spectrum of substrates, glycerol, a waste from biodiesel isolates produced bioemusifiers which were capable of sta- production, was also tested in a flask culture as a carbon bilizing emulsions toward xylene. Ochrobactrum anthropi source for biosurfactant production. 2/3, Acinetobacter sp. 33, Bacillus cereus 54, Acinetobacter Table 3 shows the emulsification activity and the surface sp. 57, and Acinetobacter sp. 79 exhibited either surface tension of the culture supernatants of the 20 strains testing tension reduction or E24. The highest surface tension reduction positive for biosurfactant production in the preliminary was obtained from Acinetobacter sp. 79 (25.8 mN/m) when screening. These were grown on CS, glucose, glycerol, ULO was used as a carbon source. However, some isolates Ann Microbiol (2012) 62:1669–1679 1673 Table 2 Identification of Strain Most closely related species based Accession no. Sequence identity selected biosurfactant-producing on 16S rRNA sequence comparison bacterial isolates by 16S rRNA gene sequence Thungwa, Satun sediment 2/3 Ochrobactrum anthropi GQ368700 100 7 Acinetobacter calcoaceticus GQ844972 100 9/4 Ochrobactrum tritici FN392630 100 11 Klebsiella sp. FJ789765 99 11/6 Ochrobactrum anthropi GQ368700 100 Palain, Trang sediment 33 Acinetobacter sp. GQ475503 100 54 Bacillus cereus GU011950 100 57 Acinetobacter sp. GQ475503 100 79 Acinetobacter sp. GU201827 100 Sikao, Trang sediment 183 Leucobacter komagatae AB007419 100 213 Acinetobacter sp. GU201827 100 318 Bacillus subtilis GU191916 100 319 Klebsiella pneumoniae AP006725 100 418 Acinetobacter calcoaceticus GQ844972 100 Ranot, Songkhla sediment 1033 Enterobacter sp. GQ284539 100 1106 Pseudomonas putida AM411058 100 1291 Acinetobacter calcoaceticus GQ844972 100 Huasai, Nakhonsrithammarat sediment 1297 Acinetobacter calcoaceticus GQ844972 100 1310 Bacillus cereus GU011950 100 1457 Enterobacter sp. GQ284539 100 (isolate 7, 9/4, 11, 11/6, 33, 54, 57, 213, 318, 319, 418, (strains: Leucobacter komagatae 183) were not generally 1033, 1106, 1291, 1297, 1310, and 1457) showed only E24, able to form the emulsions with xylene when glucose and the highest E24 was obtained from A. calcoaceticus 418 was used as the sole carbon source (Table 3). According (64.3%). to Cooper (1986), a microorganism is considered to be a When the medium was a single phase one (CS, glucose, promising biosurfactant producer if it is able to reduce glycerol, or molasses was used as the carbon source), with the surface tension to values of <40 mN/m. A decrease no requirement for an emulsifier to make an insoluble sub- in surface tension below this threshold was found in strate more accessible, few isolates produced a potent extra- some of the culture supernatants, namely, those of A. calcoa- cellular bioemulsifier. Among the latter strains, O. anthropi ceticus 7, Acinetobacter sp. 79, L. komagatae 183, Bacillus 11/6, B. cereus 54, L. komagatae 183, and P. putida 1106 subtilis 318, and P. putida 1106 when molasses, ULO, CS and produced stable xylene-supernatant emulsions showing an glucose, molasses, and glucose were used as the sole carbon E24 comparable to those of the synthetic surfactants SDS source, respectively. (63%) and Tween 80 (61%) when CS was used as the carbon source. The highest E24 was obtained from O. anthropi 11/6 (69.8%) when CS was used as carbon source. Discussion The surface tension of the culture supernatants of four (isolate 183, 318, 1291, and 1297), 13 (isolate 9/4, 11, 11/6, Microbial molecules which exhibit a high surface and emul- 183, 213, 319, 418, 1033, 1106, 1291, 1297, 1310, and 1457), sifying activity are classified as biosurfactants/bioemulsi- two (isolate 183 and 318), and three isolates (isolate 7, fiers. These molecules reduce the surface and interfacial 79, and 318) were reduced when CS, glucose, glycerol, tensions in both aqueous solutions and hydrocarbon mix- and molasses were used as the carbon source, respectively. tures making them potential agents for bioremediation Strains which had a high surface tension reduction ability (Banat et al. 2000). With the advantage of environmental 1674 Ann Microbiol (2012) 62:1669–1679 Fig. 1 Unrooted phylogenetic Acinetobacter calcoaceticus 1297 (AB542946) tree based on 16S rRNA gene Acinetobacter calcoaceticus 7(AB542935) comparison of the bacterial Acinetobacter calcoaceticus 1291 (AB542945) strains featured in this study Acinetobacter calcoaceticus 418 (AB542943) (bold) and microorganisms 94 previously described in Acinetobacter sp. 213 (AB513733) literature for biosurfactant Acinetobacter sp. 79 (AB513732) production. Bootstrap Acinetobacter sp. RAG-1 (AF542963) probability values of <50% were omitted from the figure. Acinetobacter sp. 57 (AB542941) Scale bar indicates Acinetobacter sp. 33 (AB542939) substitutions per nucleotide Serratia marcescens (M59160) position. GenBank accession numbers are given in Klebsiella pneumoniae 319 (AB513734) parenthesis 99 Enterobacter sp. 1033 (AB542944) Enterobacter sp. 1457 (AB542948) Enterobacter cancerogenus LMG2693 (Z96078) Klebsiella sp. 11 (AB542937) Cobetia sp. PA5 (EU647563) Alcanivorax borkumensis SK (12579) Halomonas sp. ANT-3b (AY616755) Pseudomonas aeruginosa SSC2 (EU259891) Pseudomonas aeruginosa (EF151192) Pseudomonas putida 1106 (AB513735) Pseudomonas sp. ML2 (AF378011) Pseudoxanthomonas sp. PNK04 (EU025131) Acidithiobacillus thiooxidans (Y11596) Burkholderia cepacia (U96927) Alcaligenes sp. (AJ00281275) Antarctobacter sp. TG22 (EF489005) Ochrobactrum tritici 9/4 (AB542936) Ochrobactrum sp. (U70978) Ochrobactrum anthropi 11/6 (AB542938) 89 Ochrobactrum anthropi 2/3 (AB542934) Arthrobacter sulfonivorans (AF235091) Leucobacter komagatae 183 (AB542942) Microbacterium sp. MC3B-10 (AY83357) Gordonia sp. BS29 (EF064796) Rhodococcus erythropolis 51T7 (DQ395329) Rhodococcus erythropolis 3C-9 (DQ000156) Corynebacterium kutscheri (D37802) Mycobacterium tuberculosis (AJ131120) Brevibacillus brevis HOB1 (EU327889) Brevibacillus brevis (AB101593) Planococcus maitriensis (EF467308) Bacillus cereus 1310 (AB542947) Bacillus cereus 54 (AB542940) 63 Bacillus licheniformis AC01 (DQ228696) Bacillus subtilis 318 (AB513731) 0.02 Bacillus subtilis 09 (AF287011) compatibility, the demand for biosurfactants has been producing isolates from terrestrial and marine environ- steadily increasing and may eventually replace their ments (Das et al. 2009; Gandhimathi et al. 2009;Das et chemically synthesized counterparts. Several recent stud- al. 2010). However, few studies have addressed the di- ies have reported the screening of new biosurfactant- versity of biosurfactant-producing bacteria (Ruggeri et al. Ann Microbiol (2012) 62:1669–1679 1675 Table 3 Emulsification activity and surface tension of supernatants obtained from bacterial cultures grown in shake flasks in MSM medium supplemented with the indicated carbon sources (1%, w/v) for 48 h at 30°C Strain CS Glucose Glycerol Molasses ULO a b ST E24 ST E24 ST E24 ST E24 ST E24 Thungwa, Satun sediment Ochrobactrum anthropi 2/3 71.4±0.6 a 0 72.8±2.8 a 8.5±2.1 f nd nd 56.3±3.1 a 0 50.8±1.0 d 25.8±0.8 d Acinetobacter calcoaceticus 7 69.8±1.1 a 45.3±5.8 d 71.8±3.1 a 0 69.3±3.2 a 0 30.0±0.5 c 54.8±3.0 a 65.3±1.1 a 31.2±3.3 c Ochrobactrum tritici 9/4 nd nd 58.5±0.5 c 35.0±4.3 d 70.8±3.1 a 41±2.1 a 57.0±1.9 a 15.5±3.1 c 64.9±0.9 ab 41.1±1.7 b Klebsiella sp. 11 71.6±1.0 a 0 61.2±0.5 b 10.6±3.5 f 72.0±0.3 a 0 nd nd 65.5±2.2 a 26.7±3.2 d Ochrobactrum anthropi 11/6 72.6±0.5 a 69.8±3.4 a 61.0±1.0 b 0 nd nd 56.8±2.1 a 0 66.0±1.0 a 30.2±2.8 c Palain, Trang sediment Acinetobacter sp. 33 68.9±0.8 a 0 nd nd 69.9±1.1 a 0 55.5±0.3 a 22.3±1.8 b 54.5±0.5 c 40.3±2.4 b Bacillus cereus 54 68.1±1.1 a 62.0±2.7 b 71.4±1.1 a 0 nd nd 54.3±0.5 ab 0 55.0±0.5 c 28.6±2.1 d Acinetobacter sp. 57 70.7±2.1 a 55.3±4.1 c 72.3±3.1 a 0 70.6±2.1 a 0 55.4±0.4 ab 57.0±5.5 a 54.0±1.0 c 10.5±1.40 f Acinetobacter sp. 79 68.9±1.8 a 0 71.0±1.0 a 0 71.6±2.2 a 0 51.2±0.6 b 0 38.8±0.5 e 20.4±2.3 e Sikao, Trang sediment Leucobacter komagatae 183 30.2±0.5 d 67.8±3.8 a 32.0±0.5 f 0 66.5±1.4 b 38±5.0 a 52.0±0.3 b 5.5±3.1 e nd nd Acinetobacter sp. 213 70.9±1.1 a 17.3±3.3 f 56.2±0.5 d 58.0±5.8 a 70.8±2.3 a 0 54.4±1.3 a 0 64.0±2.2 ab 10.5±1.4 f Bacillus subtilis 318 65.0±0.5 b 0 69.8±0.4 a 0 65.5±0.5 b 30±3.2 b 30.7±0.5 c 55.8±5.0 a 67.0±0.8 a 24.2±3.2 d Klebsiella pneumoniae 319 69.3±2.0 a 30.9±4.5 e 55.5±0.5 d 10.4±1.5 f 68.9±3.1 a 40±2.4 a 57.2±0.4 a 0 65.8±3.2 a 12.7±2.1 f Acinetobacter calcoaceticus 418 nd nd 60.0±0.5 b 0 73.1±1.5 a 42±2.1 a 56.4±1.7 a 10.5±2.1 d 66.0±1.1 a 64.3±3.5 a Ranot, Songkhla sediment Enterobacter sp. 1033 71.2±1.1 a 58.4±1.4 b 59.3±0.5 bc 48.7±2.5 b 72.4±1.2 a 0 55.2±0.5 ab 0 65.8±2.0 a 20.5±2.2 e Pseudomonas putida 1106 71.0±1.9 a 61.5±2.3 b 37.2±1.0 e 60.5±2.8 a 68.2±2.1 a 20±3.2 c 50.4±2.1 b 0 68.2±1.8 a 10.5±0.8 f Acinetobacter calcoaceticus 1291 57.5±1.0 c 0 58.2±0.5 c 20.8±2.3 e 71.4±1.6 a 0 56.8±1.9 a 0 63.3±0.6 b 19.4±2.0 e Huasai, Nakhonsrithammarat sediment Acinetobacter calcoaceticus 1297 56.5±2.1 c 0 63.0±0.5 b 40.5±2.1 c 70.5±2.5 a 32±4.1 b 57.6±2.2 a 18.3±3.1 c nd nd Bacillus cereus 1310 71.8±0.6 a 0 60.0±1.0 b 0 72.3±0.5 a 12±2.0 d 57.4±1.0 a 0 64.5±3.1 ab 12.1±2.3 f Enterobacter sp. 1457 70.8±2.1 a 48.2±2.0 d 62.0±0.5 b 0 71.8±0.2 a 0 58.2±2.1 a 20.5±2.8 b 66.1±2.1 a 20.3±3.0 e MSM with carbon source 72.0±0.4 a 0 71.2±0.5 a 0 72.5±0.3 a 0 55.5±1.1 ab 0 64.6±0.1 ab 0 nd, Not determined because the biomass increase of the tested strain was <10-fold (OD <1.00) Values followed by different lower-case letters in the same column are significantly different at p<0.05 ST, Surface tension (mN/m) of sodium dodecyl sulfate (10 g/l) is 42.0±0.9 and of Tween 80 (10 g/l), 40.5±0.5 . Each value is the average of three determinations E24, Emulsification activity; expressed as the percentage of that of SDS (10 g/l; 63.0±0.5 ) and Tween 80 (10 g/l; 61.3±0.3). Each value is the average of three determinations 1676 Ann Microbiol (2012) 62:1669–1679 2009), particularly those isolated from mangrove sedi- produced by a number of bacteria, Archaea, and yeast ment. In this work, we used an experimental approach (Bodour and Maier 2002). In general, polymeric biosur- which reduced the time and costs for screening new factants do not significantly lower the surface tension. biosurfactant-producing bacteria. Rational choices were The polymeric biosurfactant with the best characteristics made for the different samples and enrichment procedures is the complex acylated polysaccharide emulsan, which is that were carried out in order to broaden the spectrum of the produced by Acinetobacter calcoaceticus RAG I. Rosenberg isolates. After isolation, strains were phylogenetically charac- et al. (1979) identified a protein associated with the polymers terized and their capability to produce molecules with surface that is required for emulsification activity. The production of and emulsifying activity were analyzed. The biosurfactant extracellular polymers has been extensively demonstrated production by strains belonging to well-characterized genera in rhizobia, even though the surface properties and ap- gave results comparable to those previously reported in the plicability of these compounds have not yet been inves- literature (Gudina et al. 2010; Burgos-Diaz et al. 2011; tigated (Skorupska et al. 2006). Darvishi et al. 2011). According to Willumsen and Karlson (1997), a good An estimate of the frequency of biosurfactant-producing bioemulsifier had an E24 of >50%. In our study, we strains within a microbial population cannot be easily deter- obtained an E24 of >50% with O. anthropi 11/6, B. cereus mined as it depends on the experimental procedures used. It 54, Acinetobacter sp. 57, L. komagatae 183, Acinetobacter has been reported that 2–3% of screened populations in sp. 213, B. subtilis 318, A. calcoaceticus 418, Enterobacter uncontaminated soils are biosurfactant-producing microor- sp. 1033, and P. putida 1106. The stability of the ganisms and that this increases to 25% in polluted soils emulsions has been reported to be important for both (Bodour et al. 2003). However, enrichment culture techni- the performance and the effectiveness of the emulsifier ques specific for hydrocarbon-degrading bacteria may lead (Willumsen and Karlson 1997). In this study, stable and to a much higher detection of biosurfactant producers, with compact emulsions of xylene-supernatant were observed estimates of up to 80% (Rahman et al. 2002). The principle after 1 hour and they were found to be stable for up to of enrichment culture is to provide growth conditions that 48 h (O. anthropi 11/6, B. cereus 54, L. komagatae 183, A. are very favorable for the organisms of interest and as calcoaceticus 418, and P. putida 1106) (data not shown). unfavorable as possible for competing organisms. Thus, Based on these results, it is possible to suggest that the bio- the microbes of interest are selected and enriched. In our emulsifier from this study would be useful in applications study, we obtained isolates showing a large reduction in designed for the biodegradation of hydrocarbons or other surface tension and emulsification activity by an enrichment water-immiscible substrates and for the enhancement of oil culture technique. recovery. These properties are important in order to be able to Biosurfactant activity can be measured by changes in reduce the capillary forces that are entrapping oil within the surface and interfacial tensions and emulsification/emulsion pores of rocks. They can also be considered for use as a stabilization. Microbial candidates for biosurfactant produc- mobility control agent to improve the sweep efficiency of a tion are expected to reduce surface tension to around 40 water flood in the petroleum industry (De Acevedo and mN/m or lower (Cooper 1986; Olivera et al. 2003). In our McInerney 1996). Consequently, we suggest that we have work, we achieved a reduction in surface tension that was isolated another promising microbial candidate for use in lower than that threshold with A. calcoaceticus 7, Acineto- biosurfactant/bioemulsifier production. bacter sp. 79, L. komagatae 183, B. subtilis 318, and P. Bacillus subtilis 318 and Pseudomonas putida 1106, both putida 1106. Another approach for screening potential isolated in this study, displayed a substantial capacity to biosurfactant-producing microorganisms is to estimate the decrease surface tension and increase emulsification activi- emulsification activity (E24). All isolates could form an ty, respectively. Members of Bacillus species are some of emulsion with xylene, but this depended on the carbon the most studied industrial microorganisms. Saimmai et al. source. Some strains reduced the surface tension to <40 (2011) reported that a Bacillus spp. isolated from mangrove mN/m but could not emulsify xylene. Our results show that sediment by using only molasses as a whole medium low- the reduction of surface tension and emulsion formation ered the water surface tension to 28.5 mN/m. This Bacillus were not correlated. Among the strains tested, three released isolate produced two surface active agents, namely, a polymer emulsifiers, O. anthropi 11/6, L. komatagae 183, and P. containing D-glucosamine, which stabilized thick oil-in-water putida 1106 These strains efficiently stabilized emulsion emulsions, and a mixture of saturated monoglycerides, which forms even if they did not reduce the surface tension of lowered the surface tension of water (Cooper et al. 1979). the medium when CS was used as the carbon source Among the major types of biosurfactants produced by (Table 2). These results are similar to those reported by microorganisms, surfactin is one of the best known products Willumsen and Karlson (1997)and Plazaetal. (2006). with a commercial application. Bacillus amyloliquefaciens Polymeric biosurfactants with emulsification abilities are (Singh et al. 2011), B. licheniformis (Rivardo et al. Ann Microbiol (2012) 62:1669–1679 1677 2009), B. mojavensis (From et al. 2007), B. pumilus, aeruginosa SP4 (Pansiripatetal. 2010)and Pseudozyma and B. subtilis (Banat et al. 2000) have been reported as hubeiensis SY62 (Konishietal. 2011). We found that 13 surfactin producers. The majority of hydrocarbon-degrading isolates were able to reduce the surface tension of the bacteria reported in the literature belong to the genus P. culture supernatant when glucose was used as the carbon (Widada et al. 2002). In our study, isolate 1106 was source. In addition, the highest surface tension reduction similar to P. putida (Table 2), and isolate 57 was similar (41.8 mN/m from L. komagatae 183) and E24 (69.8% to Acinetobacter sp.; members of both of these genera from O. anthropi 11/6) were obtained when CS was used have been reported to produce surface-active polymers as the carbon source. (Rosenberg and Ron 1998) and surface active agents Overall, the new biosurfactant-producing strains charac- (Huy et al. 1999). terized in our study display important characteristics which Among the bacteria tested, L. komagatae 183 produced make them potential candidates for use in the development extracellular biosurfactants which reduced the surface of economically efficient industrial-scale biotechnological tension of culture supernatant from 72.0 to 32.0 m/Nm. processes. These strains were able to produce and release The strain also produced extracellular emulsifiers able to extracellular biosurfactant into the culture medium, which stabilize xylene-supernatant emulsions. To the best our should simplify recovery procedures. In addition, bacterial knowledge, our work provides the first description of a growth and biosurfactant production were supported by biosurfactant-producing strain belonging to the genus low-cost renewable substrates, such as molasses and Leucobacter. Interestingly, terrestrial subsurface environ- glycerol, both of which are wastes from biodiesel pro- ments have been reported as a source of new micro- duction. The use of cheap raw materials and wastes will organisms even if they have not been previously contribute to the reduction of processing costs. Finally, investigated for biosurfactant production (Blume et al. our results should stimulate further evaluation of poten- 2002). The majority of the biosurfactant-producing tial applications of biosurfactants and bioemulsifiers syn- strains identified in this work were assigned to the alpha thesized by the new strains. subdivision of Proteobacteria, a division which includes Gram-negative bacteria. In fact, it is well documented Acknowledgments The last author would like to thank the Office of that the majority of bacteria isolated from contaminated the Higher Education Commission, Thailand for financial support for this work through a grant funded under the program Strategic Scholar- environments are Gram-negative bacteria (Batista et al. ships for Frontier Research Network for the Ph.D. Program Thai Doctoral 2006; Ruggeri et al. 2009). Biosurfactants exhibit prop- degree. This work was also funded by the Faculty of Agro-Industry and erties as emulsifying or dispersing agents, favoring the Graduate School, Prince of Songkla University, and further supported release of hydrophobic contaminants absorbed in organic by the TRF/BIOTEC Special Program for Biodiversity Research and Training grant BRT R651178. matter or increasing the surface area of the contaminant avail- able as the substrate (Mercade et al. 1996). These may be a characteristics that contribute to the survival of Gram-negative bacteria in harsh environments (Batista et al. 2006). References The carbon source generally used in biosurfactant pro- duction can be divided into two categories, namely, water- Abouseoud M, Maachi R, Amrane A, Boudergua S, Nabi A (2008) insoluble and water-soluble carbon sources (Desai and Evaluation of different carbon and nitrogen sources in production of biosurfactant by Pseudomonas fluorescens. Desalination Banat 1997). Water-insoluble carbon sources, such as oil 223:143–151 or hydrocarbon compounds, are widely used for biosurfac- Anandaraj B, Thivakaran P (2010) Isolation and production of tant production. Abouseoud et al. (2008) reported the biosurfactant producing organism from oil spilled soil. J Biosci Tech production of biosurfactant by Pseudomonas fluorescens 1:120–126 Banat IM, Makkar RS, Cameotra SS (2000) Potential commercial only in the presence of water-insoluble carbon, such as applications of microbial surfactants. Appl Microbiol Biotechnol hexadecane and olive oil. This strain was able to utilize 53:495–508 glucose as a substrate but without biosurfactant synthesis. Batista SB, Mounteer AH, Amorim FR, Totola MR (2006) Isolation Darvishi et al. (2011) also found that the presence of and characterization of biosurfactant/bioemulsifier-producing bacteria from petroleum contaminated sites. Bioresource Technol olive oil supports the biosurfactant production from 97:868–875 Enterobacter cloacae and Pseudomonas sp. In our study, Bernard D, Pascaline H, Jeremie JJ (1996) Distribution and origin of we found that some strains (O. anthropi 2/3 and Acine- hydrocarbons in sediments from lagoons with fringing mangrove tobacter sp. 79) preferred ULO as the carbon source to communities. Mar Pollut Bull 32:734–739 Bicca FC, Fleck LC, Ayub MAZ (1999) Production of biosurfactant by produce biosurfactant/bioemulsifier over a water-soluble hydrocarbon degrading Rhodococcus ruber and Rhodococcus carbon source (CS, glucose, glycerol, or molasses). Al- erythropolis. Rev Microbiol 30:231–236 ternatively, many studies have shown that a water-soluble Blume E, Bischoff M, Reichert JM, Moorman T, Konopka A, Turco substrate is suitable for biosurfactant production by P. RF (2002) Surface and subsurface microbial biomass, community 1678 Ann Microbiol (2012) 62:1669–1679 structure and metabolic activity as a function of soil depth and Konishi M, Nagahama T, Fukuoka T, Morita T, Imura T, Kitamoto D, season. Appl Soil Ecol 20:171–181 Hatada Y (2011) Yeast extract stimulates production of glycolipid Bodour AA, Maier RM (2002) Biosurfactants: types, screening biosurfactants, mannosylerythritol lipids, by Pseudozyma methods and application. In: Bitton G (ed) Encyclopedia of hubeiensis SY62. J Biosci Bioeng 111:702–705 environmental microbiology. Wiley, New York, pp 750–769 Maneerat S (2005) Biosurfactants from marine microorganisms. Bodour AA, Drees KP, Raina MM (2003) Distribution of Songklanakarin J Sci Technol 27:1263–1272 biosurfactant-producing bacteria in undisturbed and contaminated Maneerat S, Phetrong K (2007) Isolation of biosurfactant-producing arid Southwestern soils. Appl Environ Microbiol 69:3280–3287 marine bacteria and characteristics of selected biosurfactant. Burgos-Diaz C, Pons R, Espuny MJ, Aranda FJ, Teruel JA, Manresa A, Songklanakarin J Sci Technol 29:781–791 Ortiz A, Marques AM (2011) Isolation and partial characteriza- Maneerat S, Bamba T, Harada K, Kobayashi A, Yamada H, Kawai K tion of a biosurfactant mixture produced by Sphingobacterium sp. (2006) A novel crude oil emulsifier extracted in the culture isolated from soil. J Colloid Interf Sci 361:195–204 supernatant of a marine bacterium, Myroides sp. SM7. Appl Burns KA, Garrity SD, Levings SC (1993) How many years until Microbiol Biotechnol 70:254–259 mangrove ecosystems recover from catastrophic oil-spills. Mar Mercade ME, Monleon L, de Andres C, Rodon I, Martinez E, Espuny MJ, Pollut Bull 26:239–248 Manresa A (1996) Screening and selection of surfactant-producing Chayabutra C, Wu J, Ju LK (2001) Rhamnolipid production by bacteria from waste lubricating oil. J Appl Bacteriol 81:161–166 Pseudomonas aeruginosa under denitrification: effects of lim- Nilsson WB, Strom MS (2002) Detection and identification of bacte- iting nutrients and carbon substrates. Biotechnol Bioeng rial pathogens of fish in kidney tissue using terminal restriction 72:25–33 length polymorphism (T-RFLP) analysis of 16S rRNA genes. Dis Cooper DG (1986) Biosurfactants. Microbiol Sci 3:145–149 Aquat Org 48:175–185 Cooper DG, Zajic JE, Gerson DF (1979) Production of surface Olivera NL, Commendatore MG, Delgado O, Esteves JL (2003) active lipids by Corynebacterium lepus. Appl Environ Micro- Microbial characterization and hydrocarbon biodegradation po- biol 37:4–10 tential of natural bilge waste microflora. J Ind Microbiol Darvishi P, Ayatollahi S, Mowla D, Niazi A (2011) Biosurfactant Biotechnol 30:542–548 production under extreme environmental conditions by an effi- Pansiripat S, Pornsunthorntaweea O, Rujiravanit R, Kitiyanana B, cient microbial consortium, ERCPPI-2. Colloid Surface B Somboonthanate P, Chavadej S (2010) Biosurfactant production 84:292–300 by Pseudomonas aeruginosa SP4 using sequencing batch reac- Das P, Mukherjee S, Sen R (2009) Substrate dependent production of tors: effect of oil-to-glucose ratio. Biochem Eng J 49:185–191 extracelullar biosurfactant by a marine bacterium. Bioresouce Phalakornkule C, Tanasupawat S (2006) Characterization of lactic acid Technol 100:1015–1019 bacteria from traditional Thai sausages. J Cult Collect 5:46–57 Das P, Mukherjee S, Sivapathasekaran S, Sen R (2010) Microbial Plaza GA, Zjawiony I, Banat IM (2006) Use of different methods for surfactants of marine origin: potentials and prospects. Adv Exp detection of thermophilic biosurfactant-producing bacteria from Med Biol 672:88–101 hydrocarbon contaminated and bioremediated soils. J Pet Sci Eng Desai JD, Banat IM (1997) Microbial production of surfactants and 50:71–77 their commercial potential. Microbiol Mol Biol Rev 61:47–64 Rahman KSM, Banat IM, Thahira J, Thayumanvan T, De Acevedo GT, McInerney MJ (1996) Emulsifying activity in ther- Akshmanaperumalsamy P (2002) Bioremediation of gasoline mophilic and extremely thermophilic microorganisms. J Ind contaminated soil by a bacterial consortium amended with Microbiol 16:1–7 poultry litter, coir pith and rhamnolipid biosurfactant. Biore- From C, Hormazabal V, Hardy SP, Granum PE (2007) Cytotoxicity in source Technol 81:25–32 Bacillus mojavensis is abolished following loss of surfactin syn- Rivardo F, Turner RJ, Allegrone G, Ceri H, Martinotti MG (2009) thesis: Implications for assessment of toxicity and food poisoning Anti-adhesion activity of two biosurfactants produced by Bacillus potential. Int J Food Microbiol 117:43–49 spp. prevents biofilm formation of human bacterial pathogens. Gandhimathi R, Kiran GS, Hema TA, Selvin J, Raviji TR, Appl Microbiol Biotechnol 83:541–553 Shanmughapriya S (2009) Production and characterization Rodrigues LR, Teixeira JA, van der Meib HC, Oliveira R (2006) of lipopeptide biosurfactant by a sponge-associated marine Isolation and partial characterization of a biosurfactant produced actinomycetes Nocardiopsis alba MSA10. Bioprocess Biosyst Eng by Streptococcus thermophilus A. Colloid Surface B 53:105–112 32:825–835 Rosenberg E, Ron EZ (1998) Surface active polymers from the genus Gudina EJ, Teixeira JA, Rodrigues LR (2010) Isolation and functional Acinetobacter. In: Kaplan DL (ed) Biopolymers from renewable characterization of a biosurfactant produced by Lactobacillus resources. Springer, Berlin, pp 281–291 paracasei. Colloid Surface B 76:298–304 Rosenberg E, Ziclerberg A, Rubinowitz C, Gutnick DL (1979) Emul- Huy NQ, Jin S, Amada K, Haruki M, Huu NB, Hang DT, Ha DT, sifier of Arthrobacter RAG-1: isolation and emulsifying proper- Imanaka T, Morikawa M, Kanaya S (1999) Characterization of ties. Appl Environ Microbiol 37:402–408 petroleum degrading bacteria from oil-contaminated sites in Ruggeri C, Franzetti A, Bestetti G, Caredda P, La Colla P, Pintus M, Vietnam. J Biosci Bioeng 88:100–102 Sergi S, Tamburini E (2009) Isolation and characterization of Jachimska B, Lunkenheimer K, Malysa K (1995) Effect of position of surface active compound-producing bacteria from hydrocarbon- the functional group on the equilibrium and surface properties of contaminated environments. Int Biodeter Biodegr 63:936–942 butyl alcohols. J Colloid Interf Sci 176:31–38 Saimmai A, Sobhon V, Maneerat S (2011) Molasses a whole medium Karanth NGK, Deo PG, Veenanadig NK (1999) Microbial production for bosurfactants production by Bacillus strains and their applica- of biosurfactant and their importance. Curr Sci 77:126–166 tion. Appl Biochem Biotech 165:315–335 Ke L, Wang WQ, Wong TW, Wong YS, Tam NF (2003) Removal of Singh BR, Dwivedi S, Al-Khedhairy AA, Musarrat J (2011) Synthesis pyrene from contaminated sediments by mangrove microcosms. of stable cadmium sulfide nanoparticles using surfactin produced Chemosphere 52:1581–1591 by Bacillus amyloliquifaciens strain KSU-109. Colloid Surface B Kebbouche-Gana K, Gana ML, Khemili S, Naimi FF, Bouanane NA, 85:207–213 Penninckx M, Hacene H (2009) Isolation and characterization of Skorupska A, Janczarek M, Marczak M, Mazur A, Krol J (2006) halophilic archaea able to produce biosurfactants. J Ind Microbiol Rhizobial exopolysaccharides: genetic control and symbiotic Biotechnol 36:727–738 functions. Microb Cell Fact 16:5–7 Ann Microbiol (2012) 62:1669–1679 1679 Snape I, Ferguson SH, Harvey PM, Riddle MJ (2006) Investigation of hydrocarbon-degrading bacteria isolated from geographically evaporation and biodegradation of fuel spills in Antarctica: II Extent diverse sites. Appl Microbiol Biotechnol 58:202–209 of natural attenuation at Casey Station. Chemosphere 63:89–98 Willumsen PA, Karlson U (1997) Screening of bacteria isolated from Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular PAH-contaminated soils for production of biosurfactants and evolutionary genetics analysis (MEGA) software version 4.0. Mol bioemulsifiers. Biodegradation 7:415–423 Biol Evol 24:1596–1599 Yin B, Gua JD, Wana N (2005) Degradation of indole by enrichment Thompson JD, Gibbons TJ, Plewniak F, Jeanmougin F, Higgins DG culture and Pseudomonas aeruginosa Gs isolated from mangrove (1997) The CLUSTALX Windows interface: flexible strategies sediment. Int Biodeter Biodegr 56:243–248 for multiple sequence alignment aided by quality analysis tools. Youssef NH, Dunacn KE, Nagle DP, Savage KN, Knapp RM, Nucleic Acids Res 25:4876–4882 McInerney MJ (2004) Comparison of methods to detect bio- Widada J, Nojiri H, Kasuga K, Yoshida T, Habe H, Omori T (2002) surfactant production by diverse microorganism. J Microbiol Molecular detection and diversity of polycyclic aromatic Meth 56:339–347 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Annals of Microbiology Springer Journals

Mangrove sediment, a new source of potential biosurfactant-producing bacteria

Download PDF
11 pages

Loading next page...
 
/lp/springer-journals/mangrove-sediment-a-new-source-of-potential-biosurfactant-producing-EJpru0dJiy

References (63)

Publisher
Springer Journals
Copyright
Copyright © 2012 by Springer-Verlag and the University of Milan
Subject
Life Sciences; Microbiology; Microbial Genetics and Genomics; Microbial Ecology; Mycology; Medical Microbiology; Applied Microbiology
ISSN
1590-4261
eISSN
1869-2044
DOI
10.1007/s13213-012-0424-9
Publisher site
See Article on Publisher Site

Abstract

Ann Microbiol (2012) 62:1669–1679 DOI 10.1007/s13213-012-0424-9 ORIGINAL ARTICLE Mangrove sediment, a new source of potential biosurfactant-producing bacteria Atipan Saimmai & Akio Tani & Vorasan Sobhon & Suppasil Maneerat Received: 2 June 2011 /Accepted: 30 January 2012 /Published online: 23 February 2012 Springer-Verlag and the University of Milan 2012 Abstract Biosurfactant-producing bacteria were isolated strains L. komagatae 183 and Ochrobactrum anthropi 11/6 from mangrove sediment samples collected in the southern exhibited emulsification activities comparable to those of part of Thailand by an enrichment-culture technique in synthetic surfactants. Overall, the new biosurfactant- which lubricating oil was the sole carbon source. A total producing strains isolated in this study display promising of 1,600 colonies were obtained, which were screened for features for the future development and use in economically biosurfactant production using the qualitative drop- efficient industrial-scale biotechnological processes. collapsing test in a mineral salts medium containing 1% of . . different carbon sources (commercial sugar, glucose, molas- Keywords Biosurfactant Bioemulsifier Mangrove . . ses, and used lubricating oil). Ninety-five isolates were sediment Screening Renewable substrate positive for biosurfactant production based on the results of this test, among which 20 could reduce the surface tension of the 48-h culture supernatant. The phylogenetic Introduction position of these 20 isolates was evaluated by 16S rRNA gene sequence analysis. The production of biosurfactants Mangroves, dominant inter-tidal wetlands found along was determined for strains representative of eight different coastlines of tropical and subtropical regions, are considered bacterial genera. Leucobacter komagatae 183, one of the to be significant sinks for pollution from freshwater dis- newly isolated strains showing biosurfactant production, charges as well as from contaminated tidal water (Bernard produced extracellular biosurfactants which reduced the et al. 1996). The wetlands are also particularly susceptible to surface tension of the culture supernatant from 72.0 to oil pollution since they are usually situated in regions active 32.0 m/Nm. Eighteen strains released extracellular emulsi- in oil production, transportation, and other anthropogenic fiers able to stabilize the emulsion formed. Among these, the activities generating spilled and stranded oil (Burns et al. 1993). When oil spreads in an environment, low-molecular- weight hydrocarbons are volatilized while polar components A. Saimmai are dissolved in water. However, most of the oil hydrocarbons Department of Food Science Technology, Faculty of Agriculture remain on the water surface or adhere to soil particles due to Technology, Phuket Rajabhat University, their low solubility (Karanth et al. 1999). Evaporation and Phuket 83000, Thailand photo-oxidation play an important role in oil detoxification, A. Tani with ultimate and complete degradation being accomplished Institute of Plant Science and Resources, Okayama University, mainly by microbial activity (Batista et al. 2006). 2-20-1 Chuo, Diverse groups of indigenous microorganisms capable of Kurashiki 710-0046, Japan utilizing and degrading contaminants such as hydrocarbons V. Sobhon S. Maneerat (*) and polycyclic aromatic hydrocarbons (PAHs) might be Department of Industrial Biotechnology, Faculty of Agro-Industry, present in contaminated sediment (Ke et al. 2003). Prince of Songkla University, Hydrocarbon-degrading bacteria release biosurfactants that Hat Yai 90112, Thailand facilitate the assimilation of these insoluble substrates e-mail: [email protected] 1670 Ann Microbiol (2012) 62:1669–1679 (Bicca et al. 1999). However, intrinsic biodegradation under the same conditions as described above. This procedure often takes a long time to complete because of the low was repeated five times. water solubility of hydrocarbon (Snape et al. 2006). The Sediment-enriched cultures were diluted in a sterile biodegradation process is maximized when the water- 0.85% saline solution and plated on MSM agar using glu- insoluble substrate is dissolved or emulsified, which are cose (1%, w/v) or ULO (1%, w/v) as the carbon source for the mechanisms by which biosurfactants are capable of the isolation of microorganisms. Morphologically distinct increasing the bioavailability of hydrocarbons that dis- colonies were re-isolated by transfer onto fresh glucose- or solve poorly. ULO-containing agar plates at least three times to obtain Biosurfactants are either extracellular compounds or pure cultures and subsequently Gram-stained. Pure cultures localized on the cell surface (Chayabutra et al. 2001). were stored at −20°C in MSM mixed with sterile glycerol at In the latter case, the microbial cell itself is a biosurfac- a final concentration of 30%. tant and adheres to hydrocarbon (Maneerat 2005). There are many areas of application where biosurfactants can Screening of potential biosurfactant-producing strains be used, such as in industries and environmental restora- tion, including the removal of heavy metal and organic In total, 1,600 isolates were streaked on MSM agar containing compounds from soil and water. Biosurfactants also in- 1% (w/v) of ULO or glucose for 48 h at 30°C. One loop of crease both the water-insoluble uptake of microorganisms each isolate was then transferred to test tubes containing 5 ml and the efficiency of bioremediation. Whereas many of nutrient broth (NB) and shaken (150 rpm) at 30°C for 24 h. studies on biosurfactants have been performed in the last A100-μl sample of each cell culture was transferred to few decades (Maneerat et al. 2006; Rodrigues et al. 5 ml of MSM medium supplemented with 1% (w/v) of 2006; Maneerat and Phetrong 2007; Kebbouche-Gana et different carbon sources [commercial sugar (CS, su- al. 2009; Anandaraj and Thivakaran 2010; Gudina et al. crose), glucose, molasses, and ULO) in a rotary shaker 2010; Burgos-Diaz et al. 2011;Darvishiet al. 2011), (Vision Scientific, Daejon, Korea) at 30°C and 150 rpm relatively fewer reports have been published on biosur- for 24 h. Screening for biosurfactant-producing isolates factants produced by mangrove sediment microorgan- was performed by using the qualitative drop-collapsing isms. The objectives of this study were to isolate and test andbytesting forthe emulsificationactivity(E24) of characterize new biosurfactant-producing bacteria from the culture supernatant after centrifugation at 8,500 rpm mangrove sediments. The utilization of renewable and and4°C for10min. cheap carbon sources for biosurfactant production by isolated strains was also studied. Evaluation of biosurfactant production Twenty bacterial isolates were evaluated for biosurfactant Materials and methods production in 250-ml Erlenmeyer flasks containing 50 ml of MSM supplemented with 1% (w/v) of the chosen carbon Microorganism isolation source. The carbon sources used when testing for biosurfac- tant production were CS, glucose, glycerol, molasses, n- Samples (100 g) of mangrove sediment (depth: 0–5 cm) hexadecane, and ULO. The isolates were activated by grow- were collected from five different sites (10 samples/site) ing them on MSM agar containing 1% (w/v) of ULO or along the east and west coast of southern Thailand: (1) Palain glucose for 48 h at 30°C. One loop of each isolate was then District, Trang Province; (2) Sikao District, Trang Province; transferred to test tubes containing 5 ml of NB and shaken (3) Thungwa District, Satun Province; (4) Ranot District, (150 rpm) at 30°C for 24 h. Cell suspensions were adjusted Songkhla Province; (5) Huasai District, Nakhonsrithammarat to an optical density (OD) at 600 nm of 0.10±0.05 Province. The enrichment and isolation of the biosurfactant- (10 CFU/ml), and 1 ml of each suspension was used as producing bacterial consortium was performed by using used the starter. The flasks were incubated at 30°C, and growth lubricating oil (ULO) as the sole carbon and energy source. wasmonitoredbyreadingthe OD on a Libra S22 Initially, the bacterial consortium was enriched by adding 1 g spectrophotometer (Biochrom, Cambridge, UK). Biosur- of soil sample to 50 ml of minimal salt medium [MSM (g/l): factant activities were measured by using the qualitative K HPO ,0.8;KH PO ,0.2; CaCl , 0.05; MgCl , 0.5; FeCl , drop-collapsing test and by testing for the E24 and sur- 2 4 2 4 2 2 2 0.01; (NH ) SO , 1.0; NaCl, 5.0; ULO, 10; Yin et al. 2005]in face tension by the duNouy method using a ring tensi- 4 2 4 a 250-ml Erlenmeyer flask. This mixture was shaken ometer (OS; Torsion Balance, Warwickshire, UK). The (150 rpm) at 30°C for 5 days or until an oil emulsion was activity of the synthetic surfactants sodium dodecyl sul- observed. A 1-ml aliquot of the culture broth was then trans- fate (SDS; Sigma Chemicals, St. Louis, MO) and Tween 80 ferred to 50 ml of fresh MSM in a 250-ml flask and incubated (Sigma Chemicals) (10 g/l) was tested at concentrations Ann Microbiol (2012) 62:1669–1679 1671 higher than their critical micelle concentrations (2.0 and Results 0.16 g/l, respectively). MSM medium supplemented with the different carbon sources without inocula was used as a Microorganism isolation negative control. The 89 sediment samples screened for biosurfactant pro- 16S rRNA gene sequence analysis ducers were collected from the east and west coasts of southern Thailand by an enrichment-culture technique using Selected isolates were incubated for 48 h at 30°C on MSM ULO as a sole carbon source. The enrichment-culture tech- agar supplemented with 1% (w/v) of ULO or glucose and nique was repeated five times, resulting in the isolation of subsequently Gram-stained. For 16S rRNA gene amplifica- 1,600 colonies by spreading on MSM supplemented with tion, selected bacterial isolate chromosomal DNA was 1% of glucose or ULO as the carbon source. These 1,600 isolated using a Roche kit (Roche Applied Science, isolates were screened for biosurfactant production in MSM Mannheim, Germany) following the manufacturer’s containing 1% of the different carbon sources (CS, glucose, instructions. The 16S rRNA gene was amplified using a molasses, or ULO). Ninety-five isolates tested positive for PCR method with 1 U of Taq DNA polymerase (Bio-Lab, biosurfactant production according to the qualitative drop- Auckland, New Zealand) and universal bacterial primers collapsing test. These 95 isolates also showed promising UFUL (GCCTAACACATGCAAGTCGA) and URUL biosurfactant activity by exhibiting a surface tension reduc- (CGTATTACCGCGGC TGCTGG) (Nilsson and Strom tion of more than 10 mN/m. Accordingly, 20 isolates were 2002). These two primers target two highly conserved regions selected for further testing: 19 of these grew on MSM of the prokaryotic 16S rRNA gene (Phalakornkule and containing glucose or molasses as the sole carbon source, Tanasupawat 2006) and produced a PCR product of 18 grew on MSM supplemented with CS or ULO as the sole about 450–500 bp. The 16S rRNA gene was sequenced by carbon source, and only three grew on MSM containing n- using the ABI Prism BigDye terminator kit (Perkin-Elmer hexadecane (Table 1). Applied Biosystems, Waltham, MA), according to the manu- Of these 20 bacterial isolates, 16 (80%) were Gram- facturer’s protocol, with UFUL as primer. The 500-bp 16S negative bacteria. This result is in accordance with previous rRNA gene sequences obtained were aligned along with the reports that most bacteria isolated from sites with a history sequences of type strains obtained from the GenBank by using of contamination by oil or its byproducts are Gram-negative the program ClustalW (Thompson et al. 1997). Sequence bacteria due to the presence of outer membranes which act homologies were examined using BLAST ver. 2.2.12 of the as biosurfactants (Bicca et al. 1999; Bodour et al. 2003; National Center for Biotechnology Information (NCBI), and a Batista et al. 2006). However, we found that selected iso- lates produced extracellular biosurfactants since culture consensus neighbor-joining tree was constructed using Molecular Evolutionary Genetics Analysis (MEGA) software supernatants exhibited biosurfactant activity based on the ver. 4.0 (Tamura et al. 2007). The 16S rRNA gene sequence results of the drop-collapsing and E24 tests (Table 1). was submitted to GenBank with an accession number. 16S rRNA gene sequence analysis Analytical methods The 20 strains selected for further testing were genetically Growth Growth was monitored by measuring the OD of the characterized as belonging to eight different genera culture broth at 600 nm. (Table 2). Their sequences were deposited in DDBJ/ EMBL/GenBank (accession numbers are given in parenthesis Drop-collapsing test The drop collapse test was performed in Fig. 1) and compared to those of the biosurfactant- as described by Youssef et al. (2004). producing strains described in the literature. A phylogenetic tree was reconstructed (Fig. 1). Among the analyzed strains, Emulsification activity (E24) assay The E24 assay was 19 isolates (2/3, 7, 9/4, 11, 11/6, 33, 54, 57 79, 213, 318, 319, performed as described by Plaza et al. (2006). 418, 1106, 1033, 1291, 1297, 1310, and 1457) belonged to genera that have been previously been reported and charac- Surface tension measurement Assessment of surface tension terized for the production of biosurfactants or bioemulsifiers was performed as described by Jachimska et al. (1995). (Kebbouche-Gana et al. 2009; Anandaraj and Thivakaran 2010;Gudina et al. 2010; Burgos-Diaz et al. 2011;Darvishi Statistical analysis All experiments were carried out at et al. 2011). One isolate (183) belonged to the genus Leuco- least in triplicate. Statistical analysis was performed using bacter. To the best of our knowledge, this is the first report on Statistical Package for Social Science ver. 10.0 for Windows the capacity of the genus Leucobacter to produce a (SPSS, Chicago, IL). biosurfactant. 1672 Ann Microbiol (2012) 62:1669–1679 Table 1 Growth of bacterial a b c c Strain Gram stain Growth DCT EA strains on different carbon sources and biosurfactant CS Glucose n-Hexadecane Molasses ULO production in culture supernatants Thungwa, Satun sediment 2/3 N + + − ++ + + 7N + + − ++ + + 9/4 N − + − ++ + + 11 N + + −− ++ − 11/6 N + + − ++ + + Palain, Trang sediment 33 N + − ++ + + + 54 P + + − ++ + + 57 N + + − ++ + + 79 N + + − ++ + + Sikao, Trang sediment 183 P + + − + − ++ CS, Commercial sugar; ULO, 213 N + + − ++ + + used lubricating oil; 318 P + + − ++ + + EA, small-scale emulsification 319 N + + − ++ + + assay; DCT, qualitative 418 N − + − ++ + + drop-collapsing test Ranot, Songkhla sediment Gram stain: P, Gram-positive; N, Gram-negative 1033 N + + + + + + + +, Biomass increase of >10-fold 1106 N + + + + + + + compared to the inoculum; 1291 N + + − ++ + + –, biomass increase of the tested Huasai, Nakhonsrithammarat sediment strain of <10-fold (OD <1.0) 1297 N + + − + − ++ +, Positive test at least with one carbon source; –, negative 1310 P + + − ++ + − test with the five tested 1457 N + + − ++ + + carbon sources Evaluation of biosurfactant production molasses, or ULO. Emulsification activities significantly higher than those of the culture medium supplemented with The 20 strains testing positive for biosurfactant production each carbon sources were found in all strains (Table 3). were further examined for their capability to grow and Among the 20 selected isolates, the emulsification activity produce biosurfactants in shake flasks using the same car- evaluated by the E24 ranged from 5.5 to 69.8%. Most of bon sources used for the small-scale assay. The same results isolates demonstrated 20–50% of emulsification. The were obtained under the two cultural conditions, thus dem- highest emulsification activity was observed in Ochro- onstrating the reliability of the small-scale growth test to bactrum anthropi 11/6. In our study, the specificity of screen for substrates supporting the growth of the isolates emulsion formation was highly variable, depending on (Table 3). Among the five tested carbon sources, n-hexade- the carbon source used in the growth medium of the cane supported the growth of a small number of strains after culture. 48 h of incubation. It was noted that only Acinetobacter sp. Biosurfactants produced by the selected 20 bacterial iso- 33, Enterobacter sp. 1033, and Pseudomonas putida 1106 lates were affected by type of carbon source. When the grew on n-hexadecane (Table 1). In order to widen the medium contained a water-insoluble substrate (ULO), 18 spectrum of substrates, glycerol, a waste from biodiesel isolates produced bioemusifiers which were capable of sta- production, was also tested in a flask culture as a carbon bilizing emulsions toward xylene. Ochrobactrum anthropi source for biosurfactant production. 2/3, Acinetobacter sp. 33, Bacillus cereus 54, Acinetobacter Table 3 shows the emulsification activity and the surface sp. 57, and Acinetobacter sp. 79 exhibited either surface tension of the culture supernatants of the 20 strains testing tension reduction or E24. The highest surface tension reduction positive for biosurfactant production in the preliminary was obtained from Acinetobacter sp. 79 (25.8 mN/m) when screening. These were grown on CS, glucose, glycerol, ULO was used as a carbon source. However, some isolates Ann Microbiol (2012) 62:1669–1679 1673 Table 2 Identification of Strain Most closely related species based Accession no. Sequence identity selected biosurfactant-producing on 16S rRNA sequence comparison bacterial isolates by 16S rRNA gene sequence Thungwa, Satun sediment 2/3 Ochrobactrum anthropi GQ368700 100 7 Acinetobacter calcoaceticus GQ844972 100 9/4 Ochrobactrum tritici FN392630 100 11 Klebsiella sp. FJ789765 99 11/6 Ochrobactrum anthropi GQ368700 100 Palain, Trang sediment 33 Acinetobacter sp. GQ475503 100 54 Bacillus cereus GU011950 100 57 Acinetobacter sp. GQ475503 100 79 Acinetobacter sp. GU201827 100 Sikao, Trang sediment 183 Leucobacter komagatae AB007419 100 213 Acinetobacter sp. GU201827 100 318 Bacillus subtilis GU191916 100 319 Klebsiella pneumoniae AP006725 100 418 Acinetobacter calcoaceticus GQ844972 100 Ranot, Songkhla sediment 1033 Enterobacter sp. GQ284539 100 1106 Pseudomonas putida AM411058 100 1291 Acinetobacter calcoaceticus GQ844972 100 Huasai, Nakhonsrithammarat sediment 1297 Acinetobacter calcoaceticus GQ844972 100 1310 Bacillus cereus GU011950 100 1457 Enterobacter sp. GQ284539 100 (isolate 7, 9/4, 11, 11/6, 33, 54, 57, 213, 318, 319, 418, (strains: Leucobacter komagatae 183) were not generally 1033, 1106, 1291, 1297, 1310, and 1457) showed only E24, able to form the emulsions with xylene when glucose and the highest E24 was obtained from A. calcoaceticus 418 was used as the sole carbon source (Table 3). According (64.3%). to Cooper (1986), a microorganism is considered to be a When the medium was a single phase one (CS, glucose, promising biosurfactant producer if it is able to reduce glycerol, or molasses was used as the carbon source), with the surface tension to values of <40 mN/m. A decrease no requirement for an emulsifier to make an insoluble sub- in surface tension below this threshold was found in strate more accessible, few isolates produced a potent extra- some of the culture supernatants, namely, those of A. calcoa- cellular bioemulsifier. Among the latter strains, O. anthropi ceticus 7, Acinetobacter sp. 79, L. komagatae 183, Bacillus 11/6, B. cereus 54, L. komagatae 183, and P. putida 1106 subtilis 318, and P. putida 1106 when molasses, ULO, CS and produced stable xylene-supernatant emulsions showing an glucose, molasses, and glucose were used as the sole carbon E24 comparable to those of the synthetic surfactants SDS source, respectively. (63%) and Tween 80 (61%) when CS was used as the carbon source. The highest E24 was obtained from O. anthropi 11/6 (69.8%) when CS was used as carbon source. Discussion The surface tension of the culture supernatants of four (isolate 183, 318, 1291, and 1297), 13 (isolate 9/4, 11, 11/6, Microbial molecules which exhibit a high surface and emul- 183, 213, 319, 418, 1033, 1106, 1291, 1297, 1310, and 1457), sifying activity are classified as biosurfactants/bioemulsi- two (isolate 183 and 318), and three isolates (isolate 7, fiers. These molecules reduce the surface and interfacial 79, and 318) were reduced when CS, glucose, glycerol, tensions in both aqueous solutions and hydrocarbon mix- and molasses were used as the carbon source, respectively. tures making them potential agents for bioremediation Strains which had a high surface tension reduction ability (Banat et al. 2000). With the advantage of environmental 1674 Ann Microbiol (2012) 62:1669–1679 Fig. 1 Unrooted phylogenetic Acinetobacter calcoaceticus 1297 (AB542946) tree based on 16S rRNA gene Acinetobacter calcoaceticus 7(AB542935) comparison of the bacterial Acinetobacter calcoaceticus 1291 (AB542945) strains featured in this study Acinetobacter calcoaceticus 418 (AB542943) (bold) and microorganisms 94 previously described in Acinetobacter sp. 213 (AB513733) literature for biosurfactant Acinetobacter sp. 79 (AB513732) production. Bootstrap Acinetobacter sp. RAG-1 (AF542963) probability values of <50% were omitted from the figure. Acinetobacter sp. 57 (AB542941) Scale bar indicates Acinetobacter sp. 33 (AB542939) substitutions per nucleotide Serratia marcescens (M59160) position. GenBank accession numbers are given in Klebsiella pneumoniae 319 (AB513734) parenthesis 99 Enterobacter sp. 1033 (AB542944) Enterobacter sp. 1457 (AB542948) Enterobacter cancerogenus LMG2693 (Z96078) Klebsiella sp. 11 (AB542937) Cobetia sp. PA5 (EU647563) Alcanivorax borkumensis SK (12579) Halomonas sp. ANT-3b (AY616755) Pseudomonas aeruginosa SSC2 (EU259891) Pseudomonas aeruginosa (EF151192) Pseudomonas putida 1106 (AB513735) Pseudomonas sp. ML2 (AF378011) Pseudoxanthomonas sp. PNK04 (EU025131) Acidithiobacillus thiooxidans (Y11596) Burkholderia cepacia (U96927) Alcaligenes sp. (AJ00281275) Antarctobacter sp. TG22 (EF489005) Ochrobactrum tritici 9/4 (AB542936) Ochrobactrum sp. (U70978) Ochrobactrum anthropi 11/6 (AB542938) 89 Ochrobactrum anthropi 2/3 (AB542934) Arthrobacter sulfonivorans (AF235091) Leucobacter komagatae 183 (AB542942) Microbacterium sp. MC3B-10 (AY83357) Gordonia sp. BS29 (EF064796) Rhodococcus erythropolis 51T7 (DQ395329) Rhodococcus erythropolis 3C-9 (DQ000156) Corynebacterium kutscheri (D37802) Mycobacterium tuberculosis (AJ131120) Brevibacillus brevis HOB1 (EU327889) Brevibacillus brevis (AB101593) Planococcus maitriensis (EF467308) Bacillus cereus 1310 (AB542947) Bacillus cereus 54 (AB542940) 63 Bacillus licheniformis AC01 (DQ228696) Bacillus subtilis 318 (AB513731) 0.02 Bacillus subtilis 09 (AF287011) compatibility, the demand for biosurfactants has been producing isolates from terrestrial and marine environ- steadily increasing and may eventually replace their ments (Das et al. 2009; Gandhimathi et al. 2009;Das et chemically synthesized counterparts. Several recent stud- al. 2010). However, few studies have addressed the di- ies have reported the screening of new biosurfactant- versity of biosurfactant-producing bacteria (Ruggeri et al. Ann Microbiol (2012) 62:1669–1679 1675 Table 3 Emulsification activity and surface tension of supernatants obtained from bacterial cultures grown in shake flasks in MSM medium supplemented with the indicated carbon sources (1%, w/v) for 48 h at 30°C Strain CS Glucose Glycerol Molasses ULO a b ST E24 ST E24 ST E24 ST E24 ST E24 Thungwa, Satun sediment Ochrobactrum anthropi 2/3 71.4±0.6 a 0 72.8±2.8 a 8.5±2.1 f nd nd 56.3±3.1 a 0 50.8±1.0 d 25.8±0.8 d Acinetobacter calcoaceticus 7 69.8±1.1 a 45.3±5.8 d 71.8±3.1 a 0 69.3±3.2 a 0 30.0±0.5 c 54.8±3.0 a 65.3±1.1 a 31.2±3.3 c Ochrobactrum tritici 9/4 nd nd 58.5±0.5 c 35.0±4.3 d 70.8±3.1 a 41±2.1 a 57.0±1.9 a 15.5±3.1 c 64.9±0.9 ab 41.1±1.7 b Klebsiella sp. 11 71.6±1.0 a 0 61.2±0.5 b 10.6±3.5 f 72.0±0.3 a 0 nd nd 65.5±2.2 a 26.7±3.2 d Ochrobactrum anthropi 11/6 72.6±0.5 a 69.8±3.4 a 61.0±1.0 b 0 nd nd 56.8±2.1 a 0 66.0±1.0 a 30.2±2.8 c Palain, Trang sediment Acinetobacter sp. 33 68.9±0.8 a 0 nd nd 69.9±1.1 a 0 55.5±0.3 a 22.3±1.8 b 54.5±0.5 c 40.3±2.4 b Bacillus cereus 54 68.1±1.1 a 62.0±2.7 b 71.4±1.1 a 0 nd nd 54.3±0.5 ab 0 55.0±0.5 c 28.6±2.1 d Acinetobacter sp. 57 70.7±2.1 a 55.3±4.1 c 72.3±3.1 a 0 70.6±2.1 a 0 55.4±0.4 ab 57.0±5.5 a 54.0±1.0 c 10.5±1.40 f Acinetobacter sp. 79 68.9±1.8 a 0 71.0±1.0 a 0 71.6±2.2 a 0 51.2±0.6 b 0 38.8±0.5 e 20.4±2.3 e Sikao, Trang sediment Leucobacter komagatae 183 30.2±0.5 d 67.8±3.8 a 32.0±0.5 f 0 66.5±1.4 b 38±5.0 a 52.0±0.3 b 5.5±3.1 e nd nd Acinetobacter sp. 213 70.9±1.1 a 17.3±3.3 f 56.2±0.5 d 58.0±5.8 a 70.8±2.3 a 0 54.4±1.3 a 0 64.0±2.2 ab 10.5±1.4 f Bacillus subtilis 318 65.0±0.5 b 0 69.8±0.4 a 0 65.5±0.5 b 30±3.2 b 30.7±0.5 c 55.8±5.0 a 67.0±0.8 a 24.2±3.2 d Klebsiella pneumoniae 319 69.3±2.0 a 30.9±4.5 e 55.5±0.5 d 10.4±1.5 f 68.9±3.1 a 40±2.4 a 57.2±0.4 a 0 65.8±3.2 a 12.7±2.1 f Acinetobacter calcoaceticus 418 nd nd 60.0±0.5 b 0 73.1±1.5 a 42±2.1 a 56.4±1.7 a 10.5±2.1 d 66.0±1.1 a 64.3±3.5 a Ranot, Songkhla sediment Enterobacter sp. 1033 71.2±1.1 a 58.4±1.4 b 59.3±0.5 bc 48.7±2.5 b 72.4±1.2 a 0 55.2±0.5 ab 0 65.8±2.0 a 20.5±2.2 e Pseudomonas putida 1106 71.0±1.9 a 61.5±2.3 b 37.2±1.0 e 60.5±2.8 a 68.2±2.1 a 20±3.2 c 50.4±2.1 b 0 68.2±1.8 a 10.5±0.8 f Acinetobacter calcoaceticus 1291 57.5±1.0 c 0 58.2±0.5 c 20.8±2.3 e 71.4±1.6 a 0 56.8±1.9 a 0 63.3±0.6 b 19.4±2.0 e Huasai, Nakhonsrithammarat sediment Acinetobacter calcoaceticus 1297 56.5±2.1 c 0 63.0±0.5 b 40.5±2.1 c 70.5±2.5 a 32±4.1 b 57.6±2.2 a 18.3±3.1 c nd nd Bacillus cereus 1310 71.8±0.6 a 0 60.0±1.0 b 0 72.3±0.5 a 12±2.0 d 57.4±1.0 a 0 64.5±3.1 ab 12.1±2.3 f Enterobacter sp. 1457 70.8±2.1 a 48.2±2.0 d 62.0±0.5 b 0 71.8±0.2 a 0 58.2±2.1 a 20.5±2.8 b 66.1±2.1 a 20.3±3.0 e MSM with carbon source 72.0±0.4 a 0 71.2±0.5 a 0 72.5±0.3 a 0 55.5±1.1 ab 0 64.6±0.1 ab 0 nd, Not determined because the biomass increase of the tested strain was <10-fold (OD <1.00) Values followed by different lower-case letters in the same column are significantly different at p<0.05 ST, Surface tension (mN/m) of sodium dodecyl sulfate (10 g/l) is 42.0±0.9 and of Tween 80 (10 g/l), 40.5±0.5 . Each value is the average of three determinations E24, Emulsification activity; expressed as the percentage of that of SDS (10 g/l; 63.0±0.5 ) and Tween 80 (10 g/l; 61.3±0.3). Each value is the average of three determinations 1676 Ann Microbiol (2012) 62:1669–1679 2009), particularly those isolated from mangrove sedi- produced by a number of bacteria, Archaea, and yeast ment. In this work, we used an experimental approach (Bodour and Maier 2002). In general, polymeric biosur- which reduced the time and costs for screening new factants do not significantly lower the surface tension. biosurfactant-producing bacteria. Rational choices were The polymeric biosurfactant with the best characteristics made for the different samples and enrichment procedures is the complex acylated polysaccharide emulsan, which is that were carried out in order to broaden the spectrum of the produced by Acinetobacter calcoaceticus RAG I. Rosenberg isolates. After isolation, strains were phylogenetically charac- et al. (1979) identified a protein associated with the polymers terized and their capability to produce molecules with surface that is required for emulsification activity. The production of and emulsifying activity were analyzed. The biosurfactant extracellular polymers has been extensively demonstrated production by strains belonging to well-characterized genera in rhizobia, even though the surface properties and ap- gave results comparable to those previously reported in the plicability of these compounds have not yet been inves- literature (Gudina et al. 2010; Burgos-Diaz et al. 2011; tigated (Skorupska et al. 2006). Darvishi et al. 2011). According to Willumsen and Karlson (1997), a good An estimate of the frequency of biosurfactant-producing bioemulsifier had an E24 of >50%. In our study, we strains within a microbial population cannot be easily deter- obtained an E24 of >50% with O. anthropi 11/6, B. cereus mined as it depends on the experimental procedures used. It 54, Acinetobacter sp. 57, L. komagatae 183, Acinetobacter has been reported that 2–3% of screened populations in sp. 213, B. subtilis 318, A. calcoaceticus 418, Enterobacter uncontaminated soils are biosurfactant-producing microor- sp. 1033, and P. putida 1106. The stability of the ganisms and that this increases to 25% in polluted soils emulsions has been reported to be important for both (Bodour et al. 2003). However, enrichment culture techni- the performance and the effectiveness of the emulsifier ques specific for hydrocarbon-degrading bacteria may lead (Willumsen and Karlson 1997). In this study, stable and to a much higher detection of biosurfactant producers, with compact emulsions of xylene-supernatant were observed estimates of up to 80% (Rahman et al. 2002). The principle after 1 hour and they were found to be stable for up to of enrichment culture is to provide growth conditions that 48 h (O. anthropi 11/6, B. cereus 54, L. komagatae 183, A. are very favorable for the organisms of interest and as calcoaceticus 418, and P. putida 1106) (data not shown). unfavorable as possible for competing organisms. Thus, Based on these results, it is possible to suggest that the bio- the microbes of interest are selected and enriched. In our emulsifier from this study would be useful in applications study, we obtained isolates showing a large reduction in designed for the biodegradation of hydrocarbons or other surface tension and emulsification activity by an enrichment water-immiscible substrates and for the enhancement of oil culture technique. recovery. These properties are important in order to be able to Biosurfactant activity can be measured by changes in reduce the capillary forces that are entrapping oil within the surface and interfacial tensions and emulsification/emulsion pores of rocks. They can also be considered for use as a stabilization. Microbial candidates for biosurfactant produc- mobility control agent to improve the sweep efficiency of a tion are expected to reduce surface tension to around 40 water flood in the petroleum industry (De Acevedo and mN/m or lower (Cooper 1986; Olivera et al. 2003). In our McInerney 1996). Consequently, we suggest that we have work, we achieved a reduction in surface tension that was isolated another promising microbial candidate for use in lower than that threshold with A. calcoaceticus 7, Acineto- biosurfactant/bioemulsifier production. bacter sp. 79, L. komagatae 183, B. subtilis 318, and P. Bacillus subtilis 318 and Pseudomonas putida 1106, both putida 1106. Another approach for screening potential isolated in this study, displayed a substantial capacity to biosurfactant-producing microorganisms is to estimate the decrease surface tension and increase emulsification activi- emulsification activity (E24). All isolates could form an ty, respectively. Members of Bacillus species are some of emulsion with xylene, but this depended on the carbon the most studied industrial microorganisms. Saimmai et al. source. Some strains reduced the surface tension to <40 (2011) reported that a Bacillus spp. isolated from mangrove mN/m but could not emulsify xylene. Our results show that sediment by using only molasses as a whole medium low- the reduction of surface tension and emulsion formation ered the water surface tension to 28.5 mN/m. This Bacillus were not correlated. Among the strains tested, three released isolate produced two surface active agents, namely, a polymer emulsifiers, O. anthropi 11/6, L. komatagae 183, and P. containing D-glucosamine, which stabilized thick oil-in-water putida 1106 These strains efficiently stabilized emulsion emulsions, and a mixture of saturated monoglycerides, which forms even if they did not reduce the surface tension of lowered the surface tension of water (Cooper et al. 1979). the medium when CS was used as the carbon source Among the major types of biosurfactants produced by (Table 2). These results are similar to those reported by microorganisms, surfactin is one of the best known products Willumsen and Karlson (1997)and Plazaetal. (2006). with a commercial application. Bacillus amyloliquefaciens Polymeric biosurfactants with emulsification abilities are (Singh et al. 2011), B. licheniformis (Rivardo et al. Ann Microbiol (2012) 62:1669–1679 1677 2009), B. mojavensis (From et al. 2007), B. pumilus, aeruginosa SP4 (Pansiripatetal. 2010)and Pseudozyma and B. subtilis (Banat et al. 2000) have been reported as hubeiensis SY62 (Konishietal. 2011). We found that 13 surfactin producers. The majority of hydrocarbon-degrading isolates were able to reduce the surface tension of the bacteria reported in the literature belong to the genus P. culture supernatant when glucose was used as the carbon (Widada et al. 2002). In our study, isolate 1106 was source. In addition, the highest surface tension reduction similar to P. putida (Table 2), and isolate 57 was similar (41.8 mN/m from L. komagatae 183) and E24 (69.8% to Acinetobacter sp.; members of both of these genera from O. anthropi 11/6) were obtained when CS was used have been reported to produce surface-active polymers as the carbon source. (Rosenberg and Ron 1998) and surface active agents Overall, the new biosurfactant-producing strains charac- (Huy et al. 1999). terized in our study display important characteristics which Among the bacteria tested, L. komagatae 183 produced make them potential candidates for use in the development extracellular biosurfactants which reduced the surface of economically efficient industrial-scale biotechnological tension of culture supernatant from 72.0 to 32.0 m/Nm. processes. These strains were able to produce and release The strain also produced extracellular emulsifiers able to extracellular biosurfactant into the culture medium, which stabilize xylene-supernatant emulsions. To the best our should simplify recovery procedures. In addition, bacterial knowledge, our work provides the first description of a growth and biosurfactant production were supported by biosurfactant-producing strain belonging to the genus low-cost renewable substrates, such as molasses and Leucobacter. Interestingly, terrestrial subsurface environ- glycerol, both of which are wastes from biodiesel pro- ments have been reported as a source of new micro- duction. The use of cheap raw materials and wastes will organisms even if they have not been previously contribute to the reduction of processing costs. Finally, investigated for biosurfactant production (Blume et al. our results should stimulate further evaluation of poten- 2002). The majority of the biosurfactant-producing tial applications of biosurfactants and bioemulsifiers syn- strains identified in this work were assigned to the alpha thesized by the new strains. subdivision of Proteobacteria, a division which includes Gram-negative bacteria. In fact, it is well documented Acknowledgments The last author would like to thank the Office of that the majority of bacteria isolated from contaminated the Higher Education Commission, Thailand for financial support for this work through a grant funded under the program Strategic Scholar- environments are Gram-negative bacteria (Batista et al. ships for Frontier Research Network for the Ph.D. Program Thai Doctoral 2006; Ruggeri et al. 2009). Biosurfactants exhibit prop- degree. This work was also funded by the Faculty of Agro-Industry and erties as emulsifying or dispersing agents, favoring the Graduate School, Prince of Songkla University, and further supported release of hydrophobic contaminants absorbed in organic by the TRF/BIOTEC Special Program for Biodiversity Research and Training grant BRT R651178. matter or increasing the surface area of the contaminant avail- able as the substrate (Mercade et al. 1996). These may be a characteristics that contribute to the survival of Gram-negative bacteria in harsh environments (Batista et al. 2006). References The carbon source generally used in biosurfactant pro- duction can be divided into two categories, namely, water- Abouseoud M, Maachi R, Amrane A, Boudergua S, Nabi A (2008) insoluble and water-soluble carbon sources (Desai and Evaluation of different carbon and nitrogen sources in production of biosurfactant by Pseudomonas fluorescens. Desalination Banat 1997). Water-insoluble carbon sources, such as oil 223:143–151 or hydrocarbon compounds, are widely used for biosurfac- Anandaraj B, Thivakaran P (2010) Isolation and production of tant production. Abouseoud et al. (2008) reported the biosurfactant producing organism from oil spilled soil. J Biosci Tech production of biosurfactant by Pseudomonas fluorescens 1:120–126 Banat IM, Makkar RS, Cameotra SS (2000) Potential commercial only in the presence of water-insoluble carbon, such as applications of microbial surfactants. Appl Microbiol Biotechnol hexadecane and olive oil. This strain was able to utilize 53:495–508 glucose as a substrate but without biosurfactant synthesis. Batista SB, Mounteer AH, Amorim FR, Totola MR (2006) Isolation Darvishi et al. (2011) also found that the presence of and characterization of biosurfactant/bioemulsifier-producing bacteria from petroleum contaminated sites. Bioresource Technol olive oil supports the biosurfactant production from 97:868–875 Enterobacter cloacae and Pseudomonas sp. In our study, Bernard D, Pascaline H, Jeremie JJ (1996) Distribution and origin of we found that some strains (O. anthropi 2/3 and Acine- hydrocarbons in sediments from lagoons with fringing mangrove tobacter sp. 79) preferred ULO as the carbon source to communities. Mar Pollut Bull 32:734–739 Bicca FC, Fleck LC, Ayub MAZ (1999) Production of biosurfactant by produce biosurfactant/bioemulsifier over a water-soluble hydrocarbon degrading Rhodococcus ruber and Rhodococcus carbon source (CS, glucose, glycerol, or molasses). Al- erythropolis. Rev Microbiol 30:231–236 ternatively, many studies have shown that a water-soluble Blume E, Bischoff M, Reichert JM, Moorman T, Konopka A, Turco substrate is suitable for biosurfactant production by P. RF (2002) Surface and subsurface microbial biomass, community 1678 Ann Microbiol (2012) 62:1669–1679 structure and metabolic activity as a function of soil depth and Konishi M, Nagahama T, Fukuoka T, Morita T, Imura T, Kitamoto D, season. Appl Soil Ecol 20:171–181 Hatada Y (2011) Yeast extract stimulates production of glycolipid Bodour AA, Maier RM (2002) Biosurfactants: types, screening biosurfactants, mannosylerythritol lipids, by Pseudozyma methods and application. In: Bitton G (ed) Encyclopedia of hubeiensis SY62. J Biosci Bioeng 111:702–705 environmental microbiology. Wiley, New York, pp 750–769 Maneerat S (2005) Biosurfactants from marine microorganisms. Bodour AA, Drees KP, Raina MM (2003) Distribution of Songklanakarin J Sci Technol 27:1263–1272 biosurfactant-producing bacteria in undisturbed and contaminated Maneerat S, Phetrong K (2007) Isolation of biosurfactant-producing arid Southwestern soils. Appl Environ Microbiol 69:3280–3287 marine bacteria and characteristics of selected biosurfactant. Burgos-Diaz C, Pons R, Espuny MJ, Aranda FJ, Teruel JA, Manresa A, Songklanakarin J Sci Technol 29:781–791 Ortiz A, Marques AM (2011) Isolation and partial characteriza- Maneerat S, Bamba T, Harada K, Kobayashi A, Yamada H, Kawai K tion of a biosurfactant mixture produced by Sphingobacterium sp. (2006) A novel crude oil emulsifier extracted in the culture isolated from soil. J Colloid Interf Sci 361:195–204 supernatant of a marine bacterium, Myroides sp. SM7. Appl Burns KA, Garrity SD, Levings SC (1993) How many years until Microbiol Biotechnol 70:254–259 mangrove ecosystems recover from catastrophic oil-spills. Mar Mercade ME, Monleon L, de Andres C, Rodon I, Martinez E, Espuny MJ, Pollut Bull 26:239–248 Manresa A (1996) Screening and selection of surfactant-producing Chayabutra C, Wu J, Ju LK (2001) Rhamnolipid production by bacteria from waste lubricating oil. J Appl Bacteriol 81:161–166 Pseudomonas aeruginosa under denitrification: effects of lim- Nilsson WB, Strom MS (2002) Detection and identification of bacte- iting nutrients and carbon substrates. Biotechnol Bioeng rial pathogens of fish in kidney tissue using terminal restriction 72:25–33 length polymorphism (T-RFLP) analysis of 16S rRNA genes. Dis Cooper DG (1986) Biosurfactants. Microbiol Sci 3:145–149 Aquat Org 48:175–185 Cooper DG, Zajic JE, Gerson DF (1979) Production of surface Olivera NL, Commendatore MG, Delgado O, Esteves JL (2003) active lipids by Corynebacterium lepus. Appl Environ Micro- Microbial characterization and hydrocarbon biodegradation po- biol 37:4–10 tential of natural bilge waste microflora. J Ind Microbiol Darvishi P, Ayatollahi S, Mowla D, Niazi A (2011) Biosurfactant Biotechnol 30:542–548 production under extreme environmental conditions by an effi- Pansiripat S, Pornsunthorntaweea O, Rujiravanit R, Kitiyanana B, cient microbial consortium, ERCPPI-2. Colloid Surface B Somboonthanate P, Chavadej S (2010) Biosurfactant production 84:292–300 by Pseudomonas aeruginosa SP4 using sequencing batch reac- Das P, Mukherjee S, Sen R (2009) Substrate dependent production of tors: effect of oil-to-glucose ratio. Biochem Eng J 49:185–191 extracelullar biosurfactant by a marine bacterium. Bioresouce Phalakornkule C, Tanasupawat S (2006) Characterization of lactic acid Technol 100:1015–1019 bacteria from traditional Thai sausages. J Cult Collect 5:46–57 Das P, Mukherjee S, Sivapathasekaran S, Sen R (2010) Microbial Plaza GA, Zjawiony I, Banat IM (2006) Use of different methods for surfactants of marine origin: potentials and prospects. Adv Exp detection of thermophilic biosurfactant-producing bacteria from Med Biol 672:88–101 hydrocarbon contaminated and bioremediated soils. J Pet Sci Eng Desai JD, Banat IM (1997) Microbial production of surfactants and 50:71–77 their commercial potential. Microbiol Mol Biol Rev 61:47–64 Rahman KSM, Banat IM, Thahira J, Thayumanvan T, De Acevedo GT, McInerney MJ (1996) Emulsifying activity in ther- Akshmanaperumalsamy P (2002) Bioremediation of gasoline mophilic and extremely thermophilic microorganisms. J Ind contaminated soil by a bacterial consortium amended with Microbiol 16:1–7 poultry litter, coir pith and rhamnolipid biosurfactant. Biore- From C, Hormazabal V, Hardy SP, Granum PE (2007) Cytotoxicity in source Technol 81:25–32 Bacillus mojavensis is abolished following loss of surfactin syn- Rivardo F, Turner RJ, Allegrone G, Ceri H, Martinotti MG (2009) thesis: Implications for assessment of toxicity and food poisoning Anti-adhesion activity of two biosurfactants produced by Bacillus potential. Int J Food Microbiol 117:43–49 spp. prevents biofilm formation of human bacterial pathogens. Gandhimathi R, Kiran GS, Hema TA, Selvin J, Raviji TR, Appl Microbiol Biotechnol 83:541–553 Shanmughapriya S (2009) Production and characterization Rodrigues LR, Teixeira JA, van der Meib HC, Oliveira R (2006) of lipopeptide biosurfactant by a sponge-associated marine Isolation and partial characterization of a biosurfactant produced actinomycetes Nocardiopsis alba MSA10. Bioprocess Biosyst Eng by Streptococcus thermophilus A. Colloid Surface B 53:105–112 32:825–835 Rosenberg E, Ron EZ (1998) Surface active polymers from the genus Gudina EJ, Teixeira JA, Rodrigues LR (2010) Isolation and functional Acinetobacter. In: Kaplan DL (ed) Biopolymers from renewable characterization of a biosurfactant produced by Lactobacillus resources. Springer, Berlin, pp 281–291 paracasei. Colloid Surface B 76:298–304 Rosenberg E, Ziclerberg A, Rubinowitz C, Gutnick DL (1979) Emul- Huy NQ, Jin S, Amada K, Haruki M, Huu NB, Hang DT, Ha DT, sifier of Arthrobacter RAG-1: isolation and emulsifying proper- Imanaka T, Morikawa M, Kanaya S (1999) Characterization of ties. Appl Environ Microbiol 37:402–408 petroleum degrading bacteria from oil-contaminated sites in Ruggeri C, Franzetti A, Bestetti G, Caredda P, La Colla P, Pintus M, Vietnam. J Biosci Bioeng 88:100–102 Sergi S, Tamburini E (2009) Isolation and characterization of Jachimska B, Lunkenheimer K, Malysa K (1995) Effect of position of surface active compound-producing bacteria from hydrocarbon- the functional group on the equilibrium and surface properties of contaminated environments. Int Biodeter Biodegr 63:936–942 butyl alcohols. J Colloid Interf Sci 176:31–38 Saimmai A, Sobhon V, Maneerat S (2011) Molasses a whole medium Karanth NGK, Deo PG, Veenanadig NK (1999) Microbial production for bosurfactants production by Bacillus strains and their applica- of biosurfactant and their importance. Curr Sci 77:126–166 tion. Appl Biochem Biotech 165:315–335 Ke L, Wang WQ, Wong TW, Wong YS, Tam NF (2003) Removal of Singh BR, Dwivedi S, Al-Khedhairy AA, Musarrat J (2011) Synthesis pyrene from contaminated sediments by mangrove microcosms. of stable cadmium sulfide nanoparticles using surfactin produced Chemosphere 52:1581–1591 by Bacillus amyloliquifaciens strain KSU-109. Colloid Surface B Kebbouche-Gana K, Gana ML, Khemili S, Naimi FF, Bouanane NA, 85:207–213 Penninckx M, Hacene H (2009) Isolation and characterization of Skorupska A, Janczarek M, Marczak M, Mazur A, Krol J (2006) halophilic archaea able to produce biosurfactants. J Ind Microbiol Rhizobial exopolysaccharides: genetic control and symbiotic Biotechnol 36:727–738 functions. Microb Cell Fact 16:5–7 Ann Microbiol (2012) 62:1669–1679 1679 Snape I, Ferguson SH, Harvey PM, Riddle MJ (2006) Investigation of hydrocarbon-degrading bacteria isolated from geographically evaporation and biodegradation of fuel spills in Antarctica: II Extent diverse sites. Appl Microbiol Biotechnol 58:202–209 of natural attenuation at Casey Station. Chemosphere 63:89–98 Willumsen PA, Karlson U (1997) Screening of bacteria isolated from Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular PAH-contaminated soils for production of biosurfactants and evolutionary genetics analysis (MEGA) software version 4.0. Mol bioemulsifiers. Biodegradation 7:415–423 Biol Evol 24:1596–1599 Yin B, Gua JD, Wana N (2005) Degradation of indole by enrichment Thompson JD, Gibbons TJ, Plewniak F, Jeanmougin F, Higgins DG culture and Pseudomonas aeruginosa Gs isolated from mangrove (1997) The CLUSTALX Windows interface: flexible strategies sediment. Int Biodeter Biodegr 56:243–248 for multiple sequence alignment aided by quality analysis tools. Youssef NH, Dunacn KE, Nagle DP, Savage KN, Knapp RM, Nucleic Acids Res 25:4876–4882 McInerney MJ (2004) Comparison of methods to detect bio- Widada J, Nojiri H, Kasuga K, Yoshida T, Habe H, Omori T (2002) surfactant production by diverse microorganism. J Microbiol Molecular detection and diversity of polycyclic aromatic Meth 56:339–347

Journal

Annals of Microbiology – Springer Journals

Published: Feb 23, 2012

There are no references for this article.