Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

Processing of Branched DNA Intermediates by a Complex of Human FEN-1 and PCNA

Processing of Branched DNA Intermediates by a Complex of Human FEN-1 and PCNA 2036–2043 Nucleic Acids Research, 1996, Vol. 24, No. 11  1996 Oxford University Press Processing of branched DNA intermediates by a complex of human FEN-1 and PCNA 1,2 1,2 2 2 2 Xiantuo Wu , Jun Li , Xiangyang Li , Chih-Lin Hsieh , Peter M. J. Burgers 1,2, and Michael R. Lieber * 1 2 Departments of Pathology and Biochemistry and Molecular Biophysics, Division of Molecular Oncology, Washington University School of Medicine, 660 S. Euclid Avenue, Campus Box 8118, St Louis, MO 63110, USA Received March 1, 1996; Revised and Accepted April 18, 1996 ABSTRACT DNA replication in cell-free systems (7,8). FEN-1 also appears to be important in mismatch repair (9). Other DNA repair and In eukaryotic cells, a 5′ flap DNA endonuclease activity recombination pathways are being examined to determine the extent and a ds DNA 5′-exonuclease activity exist within a of FEN-1 involvement in branched DNA processing in other DNA single enzyme called FEN-1 [flap endo-nuclease and transactions. Bambara and colleagues have published a study of calf 5(five)′-exo-nuclease]. This 42 kDa endo-/exonuclease, thymus FEN-1 on various 5′ flap substrates (10) showing that FEN-1, is highly homologous to human XP-G, double-stranded regions along an otherwise single-stranded 5′ flap Saccharomyces cerevisiae RAD2 and S.cerevisiae block entry and sliding of FEN-1 to the branch point. In addition, the RTH1. These structure-specific nucleases recognize phosphorylation status at the 5′ flap terminus did not affect cleavage, and cleave a branched DNA structure called a DNA though absence of a 5′-phosphate at a nick was inhibitory for flap, and its derivative called a pseudo Y-structure. exonucleolytic FEN-1 action. FEN-1 is essential for lagging strand DNA synthesis in The yeast proliferating cell nuclear antigen (PCNA) is the Okazaki fragment joining. FEN-1 also appears to be processivity factor for DNA polymerases δ and ε. Like FEN-1, important in mismatch repair. Here we find that human PCNA is one of the 10 essential proteins for DNA replication (7). PCNA, the processivity factor for eukaryotic polymer- PCNA is also important in nucleotide excision repair (11). It is a ases, physically associates with human FEN-1 and homotrimer with a subunit molecular weight of 29 kDa and is stimulates its endonucleolytic activity at branched highly conserved from yeast to mammalian cells. Based on the DNA structures and its exonucleolytic activity at nick crystal structure, trimeric yeast PCNA forms a closed ring which and gap structures. Structural requirements for FEN-1 appears to encircle double-stranded DNA (12). Processivity in and PCNA loading provide an interesting picture of this DNA synthesis is achieved by PCNA binding to the polymerase, stimulation. PCNA loads on to substrates at double- thereby tethering the DNA polymerase at the primer terminus stranded DNA ends. In contrast, FEN-1 requires a free (13). In addition to this structural function in DNA replication, single-stranded 5′ terminus and appears to load by mammalian PCNA, through its interactions with the cyclin- tracking along the single-stranded DNA branch. These dependent protein kinase inhibitor p21 (CIP1/WAF1/SDI1), has physical constraints define the range of DNA repli- also been implicated in cell cycle control (14). cation, recombination and repair processes in which Recently, we found that yeast PCNA and yeast FEN-1 interact this family of structure-specific nucleases participate. (15). We were interested in verifying this interaction in the most A model explaining the exonucleolytic activity of distant multicellular eukaryote, human. Here we report that FEN-1 in terms of its endonucleolytic activity is human PCNA binds to FEN-1 and stimulates the endonucleolytic proposed based on these observations. cleavage of FEN-1 at flap structures and its exonucleolytic activity at nicks. In this ternary interaction between DNA INTRODUCTION substrate, FEN-1 and PCNA, it is interesting to consider how these three components assemble and interact. Does the mode of In all eukaryotic cells, an enzyme called FEN-1 [flap endo-nuclease assembly influence the range of substrates cleaved? Here, we and 5(five)′-exo-nuclease] appears to function as both a 5′ flap DNA describe studies using recombinant human FEN-1 confirming endonuclease and a ds DNA 5′-exonuclease (1,2). This 42 kDa that it requires a fully single-stranded 5′ terminus and flap for endo-/exonuclease, FEN-1, has been shown to be highly homolo- gous to human XP-G, Saccharomyces cerevisiae RAD2 and cleavage at the single- to double-stranded DNA junction. This is S.cerevisiae RTH1 (3). These structure-specific nucleases recognize despite the insensitivity of FEN-1 to the phosphorylation state of and cleave a branched DNA structure called a DNA flap, and its the 5′ terminus and to the base in the 5′ terminal nucleotide in derivative called a pseudo Y-structure (4). FEN-1 and its correspon- endonucleolytic assays. Deviations from single-stranded char- ding S.cerevisiae homologue, RTH1, are important for DNA acter anywhere between the 5′ terminus and the cleavage junction replication based on genetic studies (5,6), and FEN-1 is essential for prevent cutting. Hence, heterologous loops and DNA bubbles, To whom correspondence should be addressed 2037 Nucleic Acids Research, 1996, Vol. 24, No. 11 2037 Nucleic Acids Research, 1994, Vol. 22, No. 1 potentially important intermediates in a variety of processes in FEN-1. Recombinant human FEN-1 was purified as described for DNA metabolism, are not recognized. These observations have recombinant murine FEN-1 (3). important implications for the physiologic role of FEN-1 in DNA replication, DNA recombination, and DNA repair. These studies Physical interaction between FEN-1 and PCNA indicate that FEN-1 and PCNA may load onto different portions Protein G (Pharmacia) beads (10 μl) were washed twice 0.4 ml of branched DNA structures in assembly of the ternary complex Buffer A (40 mM HEPES pH 7.4; 2 mM MgCl ) containing of these two proteins with DNA. PCNA does not alter the 150 mM NaCl (designated buffer B when it includes the 150 mM substrate specificity at all. Based on the insensitivity of the NaCl). Anti-human c-myc (anti-myc) or anti-human PCNA endonucleolytic activity of FEN-1 to the 5′ phosphorylation (2 μg) monoclonal antibodies (mouse IgG1) were added to the status of the ss-DNA flap, but its sensitivity to the 5′ phosphoryla- beads in 100 μl buffer B and incubated at 4C for 14 h. The loaded tion status at a DNA nick (where FEN-1 previously has been beads were washed three times with 400 μl buffer B. Human considered to act exonucleolytically), we describe a unified FEN-1 (60 ng) was added to the beads in buffer B and incubated model that explains the exonucleolytic activity of FEN-1 in terms 2 h at 4C. The beads were washed with 400 μl buffer B three of its endonucleolytic activity. times. Any bound protein (FEN-1) was eluted with two washes of 10 μl buffer A containing either 300 or 600 mM NaCl. This MATERIALS AND METHODS 20 μl was mixed with 20 μl 2× SDS loading buffer and fractionated on an 8% PAGE. Immunoblotting used rabbit Two-hybrid analysis polyclonal anti-human FEN-1 anti-sera at a 1:100 dilution. The secondary antibody was goat anti-rabbit coupled to horse radish Plasmid and strains. The plasmids, pJG4-5 and pEG202, have peroxidase at a 1:400 dilution. Enhanced chemiluminescence been described previously (16). The human PCNA acidic (ECL) was used for detection. activation constructs, contain the entire human PCNA structural gene and is the result of ligation of an NdeI blunt fragment from FEN-1 endonuclease activity on flap substrates p3038 2xT (17) into pEG202 digested with EcoRI and blunted. Lex A-Ku86 contains the carboxy-terminal 210 amino acids of Oligonucleotides are SC1, CAGCAACGCAAGCTTG (strand human Ku86 protein, which was cloned as an EcoRI–XhoI adjacent to the flap strand); SC3, GTCGACCTGCAGCCCAAG- fragment into pEG202 after polymerase chain reaction amplifica- CTTGCGTTGCTG (bridge strand, which is annealed to the flap tion. Lex A-bicoid was a gift of Roger Brent. The junctions of all and the adjacent strand); and SC5, ATGTGGAAAATCTCTAGC- constructs were sequenced. All strains were derived from the AGGCTGCAGGTCGAC (flap strand, which is the one cleaved parent S.cerevisiae strain EGY48 (MATa trp1 ura3 his3 leu2:: by FEN-1). Additional flap substrates were composed of pLexAop6-leu2). YPH499 (MAT ura3-52 trp 1-63 his3-200 HJ41 (bridge strand), 43 (flap adjacent strand), and 86 (flap leu2-1 lys-801 ade 2-101). strand). HJ41, GGACTCTGCCTCAAGACGGTAGTCAACGTG (30mer). HJ43, CACGTTGACTACCGTC (16mer). HJ86, Modified two-hybrid screening. We developed a yeast liquid GCCGCCGCCGCCGCCTTTTTTTTTTTTTTTTTGAGGCAG- mating strategy to screen libraries with the yeast interaction trap AGTCC (44mer); note that upon Klenow fill-in, this 44mer of Brent (16). The prey strain, YPH499, was transformed with a becomes 46 nt long. The blocking oligo HJ87 is used in some HeLa cDNA expression library. The transformants, selected on experiments to anneal to the flap strand, HJ86. HJ87, tryptophan dropout plates, are harvested, aliquoted and then GGCGGCGGCGGCGGC (15mer). Some structures use a differ- stored at –80C in 32.5% glycerol, 12.5 mM Tris–HCl pH 8.0, 50 6 ent blocking oligo in place of HJ87. This is HJ88. HJ88, mM MgSO . The resulting library strain consists of 1.8 × 10 AAAAAAAGGCGGCGG (15mer). In cases where we wanted to independent YPH499 transformants. The bait strain, EGY48, was label the flap strand at the 3′ end, we needed to make the bridge transformed with a lacZ reportor plasmid pSH 18-34 and strand longer than HJ41. This longer version is HJ89 lexA-hPCNA (human PCNA) fusion plasmid pEG202-hPCNA. [TTGGACTCTGCCTCAAGACGGTAGTCAACGTG (32mer)]. Screening is performed by mating of library and bait strains 7 FEN-1 activity on loop substrates. For heterologous loops, we followed by selection of leucine prototrophy. In brief, 5 × 10 paired MY2 with HJ90. MY2, GTATCTGCCGAAACTGATCC- colony forming units of the library strain are combined with 7 AGTTACAAGGCTGTGTCCTCAGAGGATC (48mer). HJ90, 5 × 10 cells from the bait strain. This mixture is pelleted, GATCCTCTGAGGACACAGATCAGTTTCGGCAGATAC resuspended in 2 ml YPAD media, divided into 20 aliquots, and (36mer). For a bubble structure, we paired MY2 with HJ91 then incubated for 12–16 h at 30C. Yeast were thoroughly washed [GATCCTCTGAGGACACTTTTTTCAGTTTCGGCAGATAC with sterile water and resuspended in CM/-ura/-his/-trp/2%galac- (38 mer)]. tose/1% raffinose. Incubation in the latter medium for 3–4 h at The endonuclease assay was done in a 15 μl total volume 30C permits induction of the galactose inducible promotor of the containing 50 mM Tris–HCl (pH 8.0), 10 mM MgCl , 25 mM library plasmids. To screen the library for interaction, the mixture NaCl, 0.5 mM β-mercaptoethanol, 500 μg/ml BSA, 10 fmol of containing complete media/-ura/-his/-trp/-leu/2% galactose/1% flap substrate, FEN-1 at specified amounts (10 fmol = 0.4 ng = raffinose. After 3–4 days of incubation at 30C, the largest colonies 20 U as defined in ref. 1), and, if present, PCNA trimer at were picked and further analyzed as described (16,18). specified amounts. Protein purification FEN-1 exonuclease activity on DNA nicks PCNA. Recombinant human PCNA was purified as described Assays were as described for the flap substrates, except for previously (17). adjustment to 10 mM Tris (pH 8), 5 mM MgCl and 8 mM NaCl. 2038 Nucleic Acids Research, 1996, Vol. 24, No. 11 Figure 1. Genetic and physical interaction between human PCNA and human FEN-1. (A) Identity of matings (left), and growth of various matings (right) on agar plate of CM/-ura/-his/-leu/-trp/galactose/raffinose. (B) Binding of soluble recombinant human FEN-1 to protein G beads bearing anti-human c-myc (lanes 1 and 2) or anti-human PCNA (lanes 3 and 4) IgG monoclonal antibodies. After Figure 2. Human PCNA stimulates FEN-1 endonucleolytic cleavage at 5′ DNA the binding incubation, any binding was challenged with 300 mM NaCl (lanes flap structures. Flap substrate (0.01 pmol) [oligos SC 1(16mer), 3(30mer), 1 and 3) or 600 mM NaCl (lanes 2 and 4). Remaining protein was solubilized 5(33mer)] was incubated with 0.01 pmol of human FEN-1 in a 15 μl total in denaturing SDS loading buffer, run on 8% PAGE, and immunoblotted to allow volume containing 50 mM Tris–HCl (pH 8.0), 10 mM MgCl , 25 mM NaCl, detection of human FEN-1 (see Materials and Methods). 0.5 mM β-mercaptoethanol, 500 μg/ml BSA. Human PCNA was added as indicated in pmol units of trimer. BSA is used to maintain the protein concentration constant. The arrow indicates the product, which is 20 nt in Oligonucleotides are CLH2 (24mer) GTAGGAGATGTCCCTT- length. The top band is the flap strand (SC5), which is 33 nt in length. Controls GATGAATT; CLH3 (16mer) CGAACCCAGATACGGC and AI4 in which PCNA was added in the absence of FEN-1 demonstrated the absence of any contaminating nuclease activities (not shown). (41mer) GGCCGTATCTGGGTTCGAATTCATCAAGGGACA- TCTCCTAC. In cases where we wanted to 3′ label the oligonucleo- tide downstream of a nick, we used HJ95, which is identical to vector, pEG202. The diploid progeny were streaked onto a CLH3 except that it is one nucleotide shorter at its 3′ end, permiting glucose/-ura/-his/-trp master plate, and then replica plated onto a fill-in with the Klenow fragment of DNA pol I using labeled galactose/-ura/-his/-trp/-leu plate. Interaction results in activation [α- P]dCTP. Control experiments showed no nuclease activity in of the Lex A op-Leu2 reporter and growth in the absence of all analogous experiments lacking FEN-1 (data not shown). leucine. Human FEN-1 causes strong growth in the presence of the human PCNA bait, and weak growth in the presence of the RESULTS Ku86 bait, bicoid bait, and pEG202 bait (Fig. 1A). Isolation and identification of human FEN-1 cDNA in a Physical interaction of human PCNA and human FEN-1 two-hybrid analysis using the human PCNA gene To test whether the strong genetic indication of an interaction could The modified yeast two-hybrid system was used to identify be documented physically, we bound human PCNA to protein G proteins encoded in the HeLa cell library that interact with human beads via an anti-human PCNA monoclonal antibody. As a control, PCNA. 700 000 diploids were screened. The 86 largest colonies we used anti-human c-myc antibodies. Soluble FEN-1 was then from galactose/-leu plates were gridded onto master plates and incubated with the beads and found to associate with the PCNA then tested on -ura/-his/-trp/X-gal/glucose plates and on galac- beads to a greater extent than to the anti-myc control beads (Fig. 1B). tose/raffinose plates to determine whether the leu+ phenotype is The interaction was stable at 300 mM NaCl and required 600 mM galactose-dependent and whether it correlates with galactose to elute. Hence, the physical interaction is detectable even at salt dependent β-galactosidase activity. Fifty-five colonies passed concentrations more than twice physiologic. these tests. The plasmids were extracted by a rapid yeast minipreparation method. A polymerase chain reaction was used to amplify the cDNA with primers derived from the vector Human PCNA stimulates FEN-1 endonucleolytic pJG4-5. The resulting PCR products were digested with HaeIII activity at 5′ DNA flap structures and MboI to identify those that contain identical library plasmids. In order to test the functional significance of this interaction, we All of the plasmids sequenced were human FEN-1. examined human FEN-1 cleavage at 5′-flap structures. In the various DNA metabolic transactions in which FEN-1 is known to Specific interaction of human PCNA with human FEN-1 function, DNA flap structures, nicks and gaps are involved. In the To prove that the human FEN1 specifically interacts with human first structures examined, we tested for endonucleolytic activity. PCNA, we transformed pJG-hFEN1 into the YPH499 strain and We found that human PCNA stimulates FEN-1 cleavage nearly mated with human PCNA bait and other strains expressing 10-fold at 5′ DNA flaps (Fig. 2). Stimulation begins to be unrelated baits, such as LexA-bicoid, LexA-Ku86 and the parent apparent at 12-fold molar excess of PCNA over FEN-1. The 2039 Nucleic Acids Research, 1996, Vol. 24, No. 11 2039 Nucleic Acids Research, 1994, Vol. 22, No. 1 Figure 4. Human PCNA stimulates yeast FEN-1 activity but yeast PCNA does Figure 3. Human PCNA stimulates FEN-1 exonucleolytic activity at nicks. not stimulate human FEN-1 activity. (A) Ten fmol of substrate were treated with Assays were as described for the flap substrates (Fig. 2), except for adjustment 50 fmol of yFEN-1 under the same conditions as in Figure 2, except in the to 10 mM Tris (pH 8), 5 mM MgCl and 8 mM NaCl. In addition, the amount 2 presence or absence of yeast or human PCNA (5 pmol). BSA is used to maintain of human FEN-1 was 62.5 fmol, and the amount of human PCNA was 2.5 pmol. the protein concentration constant in the absence of PCNA. Other experiments The oligonucleotides forming a nick configuration are CLH2, CLH3 and AI4. show that the amount of product increases with increasing FEN-1 addition The long arrow shows the position of mononucleotides, and the short arrow above what is used here (not shown). The arrow shows the position of the 20mer shows the position of dinucleotides. BSA is used to maintain the protein flap cleavage product. (B) Same as in (A), except with 50 fmol human FEN-1 concentration constant. in the presence or absence of 5 pmol yPCNA. highest levels of stimulation occur at the highest stoichiometric 5′ end could function as FEN-1 substrates when PCNA is ratios of the PCNA trimer to FEN-1 (800-fold). Equal concentra- provided. We tested heterologous DNA loops (Fig. 5). At the site tions of BSA in place of PCNA had absolutely no effect. where the loop departs from double-stranded DNA conformation, these substrates share some features with 5′ flap structures and Human PCNA stimulates FEN-1 exonucleolytic activity pseudo-Y branched DNA structures. Specifically, if the heterolo- at DNA nicks gous loop were nicked at its upstream attachment point to the double-stranded DNA, then it would become the 5′ flap structure FEN-1 is also a ds DNA exonuclease that is most active at nicks. optimal for FEN-1 cutting. The only difference then is that there Its activity and binding at gaps decreases with increasing gap size. is no free 5′ flap terminus. When tested, FEN-1 is able to We were interested in whether PCNA stimulates FEN-1 distinguish the heterologous loop from the 5′ flap structure, and exonucleolytic activity at a DNA nick. We find that it does. it does not cut the loop. We reasoned that in the cell, FEN-1 is However, the magnitude of the stimulation is somewhat smaller acting in the presence of PCNA. We wondered if this failure to cut than for the endonucleolytic activity (Fig. 3). The products are such a similar structure could be overcome by PCNA stimulation. predominantly mononucleotides but dinucleotides exonucleoly- We find that PCNA does not help FEN-1 to cleave heterologous tic products are also generated. loops. Hence, a free 5′ terminus is necessary for FEN-1 cleavage. The bubble structure (right side of Fig. 5) is similar to a branched Human PCNA stimulates yeast FEN-1 activity but pseudo-Y structure but with the two single-stranded arms annealed yeast PCNA does not stimulate human FEN-1 activity at there most distal points. We find that FEN-1 is sensitive to this difference also and does not cleave it. As was the case for Yeast PCNA stimulates yeast FEN-1. FEN-1 is 61% identical and heterologous loops, PCNA is unable to stimulate FEN-1 to 78% similar between yeast and human (3). PCNA is 30% identical between yeast and human. Hence, we were interested in overcome this structural requirement for a free 5′ terminus (Fig. 5). the extent to which these were interchangeable. We find that human PCNA can stimulate yeast FEN-1 to an extent that is Do FEN-1 and PCNA load from different portions of equivalent to human FEN-1 (Fig. 4A). However, yeast PCNA branched DNA substrates? does not stimulate human FEN-1 (Fig. 4B). PCNA loads onto linear DNA substrates by diffusion onto the double-stranded DNA termini (19). For FEN-1 loading, we Does PCNA broaden the substrate specificity of FEN-1? wondered if the 5′ flap had to be single-stranded over its entire FEN-1 acts on substrates with 5′ flaps as an endonuclease and at length, only near the site of cleavage, or only at its most 5′ nicks or recessed 5′ DNA ends as a 5′→3′ exonuclease. We were terminal end. Escherichia coli polymerase I has a 5′→3′ nuclease interested in whether substrates that lack a 5′ flap or a recessed domain that has very similar endonucleolytic and exonucleolytic 2040 Nucleic Acids Research, 1996, Vol. 24, No. 11 Figure 6. Human FEN-1 cleavage is prevented by double-stranded regions along the otherwise single-stranded DNA flap. In all lanes, the 44mer is HJ86 (labeled at its 5′-P), the 16mer is HJ43 and the 30mer is HJ41. A fourth oligonucleotide, shown in bold, is a 15mer; it is HJ87 in the case where it is positioned at the most distal end of the DNA flap (lanes 3 and 4 from the left), and it is HJ88 where it is annealed in the middle of the DNA flap (lanes 5 and Figure 5. Human FEN-1 fails to cleave at heterologous loops and DNA bubble 6 from the left). The total reaction volume was 15 μl, the amount of substrate structures with or without PCNA. The left three lanes show the analysis of a was 10 fmol, the amount of FEN-1 was 50 fmol, the amount of PCNA was 2.8 heterologous loop and the right three lanes show analysis of DNA bubble. The pmol. The substrate used in Figures 2 and 4 generates one predominant labeled reaction total volume was 15 μl, the amount of substrate was 10 fmol, the amount cleavage product that begins one nucleotide into the double-stranded region of FEN-1 where used was 50 fmol, and the amount of PCNA trimer where used adjacent to the elbow of the flap strand; in contrast, this substrate generates one was 2.8 pmol. The label was at the 5′-P of the 48mer. The oligonucleotides were predominant but several larger and smaller cleavage products, and overall, this gel purified. The 48mer is MY2, the 36mer is HJ90 and the 38mer is HJ91. substrate cleaves with lower efficiency. These qualitative and quantitative Human FEN-1 and PCNA are abbreviated as hFEN-1 and hPCNA in this and variations appear to be a function of the sequence at the elbow of the flap strand the remaining figures. Controls done in parallel demonstrate that the FEN-1 (i.e., at the junction of the single-stranded and the double-stranded portions of preparation is active on standard flap substrates (see Fig. 6). Except for a small the flap strand), as we have described previously (1). amount of liberated 5′-P label release to generate mononucleotide, there are no lower molecular weight cleavage products, indicating that there is no cleavage of the heterologous loop and DNA bubble structures. single-stranded DNA on each side, with the duplex portion located in the middle of the flap. We find that cleavage is still blocked (not properties to FEN-1. In fact, FEN-1 is the counterpart of this shown). Hence, FEN-1, like the 5′ nuclease domain of E.coli pol I domain for eukaryotic polymerases (1,7,20,21). There is signifi- (22) and unlike S.cerevisiae Rad2 (23), requires fully single- cant amino acid homology between the FEN-1 and E.coli pol I 5′ stranded character between the 5′ terminus and the branch point. nuclease domain (24% overall and 52% in a selected 63 aa region) Rad2 is able to circumvent the requirement for a fully (4). The 5′ nuclease of E.coli pol I appears to slide down the single-stranded region 5′ of the cleavage site, perhaps by binding single-stranded flap until it reaches the branch point where it more tightly to the branch point (23). If PCNA were to stabilize cleaves. Double-stranded character along this 5′ flap is known to FEN-1 sufficiently at its cleavage site, we considered that it might prevent E.coli pol I from acting (22). One might assume that convert FEN-1 to a Rad2-type of loading, thereby allowing it to FEN-1 would function in a similar fashion. However, S.cerevisiae circumvent the requirement for a fully single-stranded 5′ flap. RAD2 is a member of the highly conserved FEN-1 family of However, we find that this is not the case (Fig. 6). Hence, the nucleases (3), and it does not require a free 5′ terminus to cut at physiologic mechanism of FEN-1 loading onto its substrates the corresponding position as FEN-1 (23). appears to require an energy-independent (hence, nondirectional) We wondered which mechanism of loading FEN-1 uses and tracking along the entire length of the single-stranded region. This whether the manner of loading is modified by PCNA. In order to also means that FEN-1 and PCNA load from different portions of examine this issue, we generated 5′ flap structures as we have the substrate and meet at the branch point. described previously, and we tested the ability of oligonucleotides annealed to various locations along this flap to prevent FEN-1 action Interactions between FEN-1 and the 5′ terminus of (Fig. 6). In these cases, the flap is 30 nt long. The oligonucleotide DNA strands at flaps and nicks being annealed to the flap is 15 nt. When we anneal the 15 nt oligonucleotide to the most distal portion of the flap, cleavage is The data above indicate that FEN-1 loads at DNA flaps by entirely blocked. When we anneal in the middle of the flap 7 nt from energy-independent tracking from the 5′ terminus to the branch the 5′ terminus and leaving 8 nt of single-stranded character before point rather than by binding to the terminus and relying on the branch point, cleavage is also entirely blocked. We have done the collisional interaction with the DNA branch point. Given that same experiments with a 65 nt flap and a 15 nt oligonucleotide FEN-1 loads from the 5′ terminus, we considered what structural annealed in the middle of its length. This leaves 25 nt of features are critical for FEN-1 recognition there. We know that 2041 Nucleic Acids Research, 1996, Vol. 24, No. 11 2041 Nucleic Acids Research, 1994, Vol. 22, No. 1 Figure 8. Human FEN-1 exonucleolytic activity demonstrates limited sensitiv- ity to the phosphorylation status at a DNA nick. The total reaction volume was 15 μl, the amount of substrate was 10 fmol, the amount of FEN-1 was 0.1 pmol, and the amount of PCNA trimer where used was 5.6 pmol. The oligonucleotides were as follows: 24mer, CLH2; 15mer, HJ95; and 41mer, AI4. The 15mer was labeled at the 3′ end by Klenow fill-in of one nucleotide. The 5′ end of this now 16mer was either left unphosphorylated or was phosphorylated with unlabeled ATP and polynucleotide kinase prior to being annealed. Reaction conditions were 30C for 30 min in 10 mM Tris (pH 8), 5 mM MgCl , 0.5 mM β-mercaptoethanol. The top band is substrate and cleavage products migrate at the faster mobilities. The phosphorylated substrate has a slightly faster mobility than the unphosphorylated substrate. The ratio of product divided by (substrate + product) was determined by phosphorimager quantitation; these are 0, 5, 8; 0, 16 and 66% from left to right. conditions. [If the endonucleolytic activity were much greater, then one would see accummulation of the 15 nt flap cleavage product. If Figure 7. Human FEN-1 activity shows only limited sensitivitiy to the phosphorylation status of the single-stranded DNA flap with or without PCNA. the exonucleolytic activity were much greater, then one would see The total reaction volume was 15 μl, the amount of substrate was 10 fmol, the this 15 nt product rapidly chased predominantly to mononucleotides. amount of FEN-1 was 25 fmol, and the amount of PCNA trimer where used was The ratio of the endonucleolytic and exonucleolytic activities can 5.6 pmol. The oligonucleotides were as follows: 44mer, HJ86; 16mer, HJ43; vary dramatically, depending on the ionic conditions (1).] Therefore, and 32mer, HJ89. The 44mer (flap strand) was labeled at the 3′ end by Klenow fill-in of two nucleotides, making it a 46mer after labeling. The 5′ end of this FEN-1 recognizes the 5′ terminus and requires it for loading, yet it flap strand was either left unphosphorylated or was phosphorylated with has only limited sensitivity to the base and the 5′ phosphate regions unlabeled ATP and polynucleotide kinase. It is important to note that FEN-1, of the terminus. in addition to its endonucleolytic activity, has 5′→3′ exonucleolytic activity, [as In considering the similarities and differences in how FEN-1 illustrated in Fig. 3 and previously by us (1) and others (2,8,20,21)]. Therefore, loads onto substrates in its endo- and exonucleolytic modes, we with 3′-end-labeling of the flap strand, it is expected that one will see not only an initial set of endonucleolytic cleavage products (as in Fig. 6), but also the wondered if the exonucleolytic activity is also insensitive to the secondary products due to exonucleolytic shortening of these 3′-end-labeled 5′ phosphorylation status. We used a substrate identical to that strands. The exonucleolytic shortening can progress all the way until the flap described in Figure 3, except that we replaced the 16mer used in strand oligonucleotide dissociates because it becomes so short that it melts off that study with a 15mer (HJ95) and then used the Klenow at the temperature of these enzyme reactions. The arrow indicates the position of the largest of the range of cleavage products (15mer). The ratio of product fragment of DNA pol I to label the 3′ end with radioactive (integrated over the entire range of product bands) divided by (substrate + [α- P]dNTP. (Prior to this step, we either kinased the 5′ terminus product) was determined by phosphorimager quantitation; these are 2.1, 10.2, with cold phosphate or left it as a 5′-OH.) We find that the 3.3 and 12.4% from left to right. phosphorylated form is cleaved ~ 2.7–8-fold more efficiently under the reaction conditions of this study (Fig. 8). (As indicated in Figure 3, PCNA stimulates FEN-1 exonucleolytic activity to FEN-1 is insensitive to the base at the 5′ terminal flap position (1). some extent.) Hence, FEN-1 requires a free 5′ terminus for We wondered if FEN-1 is sensitive to the phosphorylation status of branched DNA substrate loading. However, it shows only limited the 5′ terminus. To test this, we used a flap substrate similar to that sensitivity to the phosphorylation status of the 5′ terminus at described in Figure 6. We radiolabeled the 3′ end of the flap strand which it loads. This limited sensitivity is greater for FEN-1 and then phosphorylated the 5′ flap terminus with cold phosphate or loading at a DNA nick. This may have its basis in isomerization left it as a 5′-OH (Fig. 7). We find that the percentage of substrate of the nicked substrate to a flap configuration (see Discussion). converted to product is similar regardless of the 5′ flap terminus phosphorylation status, though the phosphorylated form shows DISCUSSION ~ 1.2–1.5-fold greater cleavage. The arrow indicates cleavage at the branch point, one nucleotide into the double-stranded region. The Human FEN-1 and PCNA functional interaction in lower cleavage bands represent FEN-1 exonucleolytic processing of DNA metabolism the gapped product left after the flap cleavage. One can see from the exonucleolytic processing that the endonucleolytic and exonucleoly- In a two-hybrid search using human PCNA, we found that human tic activities are not dramatically dissimilar under these ionic FEN-1 is detected as the predominant interactor. However, does 2042 Nucleic Acids Research, 1996, Vol. 24, No. 11 this binding reflect a functional interaction in the nucleus? Based FEN-1 mutants are adversely affected in mismatch DNA repair on the enzymatic stimulation of FEN-1 by PCNA, we infer that (9). The specific enzymatic steps in eukaryotic mismatch repair it does. PCNA stimulates the endonucleolytic activity at 5′ DNA are not yet sufficiently well-defined to permit specification of the flap structures. It also stimulates the exonucleolytic activity of precise step for FEN-1 activity or the involvement of PCNA. FEN-1 at DNA nicks. However, the result is marked instability of dinucleotide repeats, Human FEN-1 in the absence of PCNA is markedly inhibited by just as is the case for the other mismatch repair components. In increasing concentrations of monovalent salt. The binding between another DNA repair process, nucleotide excision repair, PCNA is FEN-1 and PCNA results in substantially more endonucleolytic known to be important (24,25). Although FEN-1 itself has not and exonucleolytic activity than would otherwise occur at these salt been shown to be involved in this reaction, RAD2 (XP-G in concentrations (1). Therefore, the functional binding with PCNA higher eukaryotes) is absolutely required (26). Based on the explains how FEN-1 can be active at higher salt concentrations. involvement of PCNA in nucleotide excision repair and the In DNA replication, PCNA is localized to the 3′-OH of the primer presence of homology between FEN-1 and RAD2, it is possible DNA strand by RF-C (19). At the replication fork, there is no free that PCNA may also interact with RAD2 to facilitate its loading and thereby excision of damaged nucleotides. Though RAD2 has ds DNA end onto which PCNA can diffuse. Therefore, RF-C binds not specifically been shown to be the target of PCNA stimulation to the 3′-OH and then catalyzes PCNA assembly from monomer to in nucleotide excision repair, the work of Nichols and Sancar trimer around the axis of the ds DNA. It is reasonable that PCNA (1992) makes it clear that PCNA is stimulating some form of would then bind FEN-1 because this nuclease is required for nucleolytic activity in excision repair. Thus, there may be a Okazaki fragment processing. Specifically, RNase H degrades the common theme in various aspects of DNA metabolism, in addition RNA primer of each lagging strand down to a point where the last to DNA replication, in which a processivity factor stimulates a ribonucleotide remains (20,21). Pol δ extends the upstream strand structure-specific nuclease in processing nicked and branched to a nick. At that point, either of two pathways achieve the same DNA intermediates. We are currently investigating the role of result. In one pathway, the polymerase extends further to displace the FEN-1 in DNA end joining (double-strand break repair). In this downstream strand. This generates a 5′ flap structure, which FEN-1 case, PCNA could diffuse onto the free ds DNA end and stimulate can then cleave endonucleolytically. In the second pathway, FEN-1 FEN-1 action at a nick, gap or flap. The fact that PCNA stimulation functions exonucleolytically, cleaving the last ribo- and deoxy- of FEN-1 exonucleolytic activity can occur on linear substrates in ribonucleotide off exonucleolytically as a dinucleotide. The localiz- the absence of RF-C in human cells is potentially important in ation of FEN-1 to the replication fork by PCNA and the stimulation DNA end joining. We did not find such stimulation in yeast for this of FEN-1 activity by PCNA are consistent with their functions in particular substrate configuration. It is interesting that in yeast the replication. predominant mode of DNA end joining is different from We start to see endonucleolytic stimulation of FEN-1 by PCNA mammalian cells and procedes by homologous recombination at a molar ratio of 12 PCNA trimer molecules per each FEN-1 involving the homologous chromosome as a template. molecule. The stimulation continues for as far as we carried out the titration, which was a ratio of 800 PCNA trimers per FEN-1. In the absence of RF-C, PCNA loads onto DNA as a toroid Substrate structural features and the human diffuses onto the end of a rod. This is a diffusion-limited process FEN-1–PCNA interaction that has obvious steric requirements. This type of PCNA loading is much less efficient than that catalyzed by RF-C. The PCNA trimer loads diffusionally onto the end of double-stranded requirement for stoichiometric excess of PCNA under conditions DNA (19). Monomeric PCNA is unable to stimulate FEN-1 (15). for diffusional loading has been extensively documented (19). Therefore, the assembled trimer is important for FEN-1 stimula- Hence, it is not surprising that FEN-1 stimulation by PCNA tion. In the absence of a DNA terminus, RF-C catalyzes the would require a large stoichiometric excess and that it would assembly of PCNA monomers into trimers at a 3′-OH (19). increase progressively with increasing PCNA. Based on the failure of FEN-1 to cleave at DNA bubbles and It is noteworthy that this PCNA–FEN-1 interaction extends from heterologous loops, we inferred that a free 5′ terminus is yeast (15) to humans. The features of the stimulation are similar important for FEN-1 substrate recognition. We confirmed this by overall. However, there is one interesting difference that we have annealing oligonucleotides at various positions along the single- noted. We did not detect stimulation of yeast FEN-1 exonucleolytic stranded DNA flap. Whether annealed to the most 5′ portion of activity at linear ds nick sites by yeast PCNA even in the presence the flap or along the middle of the flap, FEN-1 endonucleolytic of yeast RF-C. We could only detect stimulation of yeast FEN-1 by activity was eliminated. Therefore, it appears that FEN-1 tracks PCNA and RF-C at nick sites on circular M13 molecules. We along the single-stranded DNA from the 5′ terminus to the reasoned that this was because the PCNA molecules diffused off cleavage point. of the linear DNA molecules too quickly. For human FEN-1 and Given these observations, it appears that FEN-1 and PCNA may PCNA, we do detect some stimulation of FEN-1 exonucleolytic load from different points of a branched DNA substrate (Fig. 9A), activity at simple nicked ds linear DNA molecules (this expands with PCNA loading from one end and FEN-1 loading along the the nick to a gap). Hence, the residence time of the human PCNA single-stranded 5′ flap. The simplest model is that PCNA stabilizes may be longer, allowing for stimulation of FEN-1. This could be FEN-1 at the branch point, increasing its residence time there, this due to a difference between yeast and human PCNA or a difference being the basis for PCNA stimulation of FEN-1 activity. between yeast and human FEN-1. The human PCNA may diffuse Within the E.coli pol I/FEN-1 nuclease family, there appear to across the nicked linear DNA slower or the human FEN-1 may be two mechanims of loading. One mechanism is by energy- bind more tightly to the nick site than the yeast FEN-1. independent diffusion down the single-stranded flap (Fig. 9A). The In addition to replication, the interaction between FEN-1 and second is direct binding to a DNA branch point. The first PCNA may have broader implications in DNA metabolism. mechanism appears to be used by E.coli pol I and by FEN-1. The 2043 Nucleic Acids Research, 1996, Vol. 24, No. 11 2043 Nucleic Acids Research, 1994, Vol. 22, No. 1 adjacent strand or primer) (27). This is also the case for E.coli pol I (28). Although a 5′ OH terminus is a good substrate for FEN-1 loading onto a 5′ flap substrate, it serves as a poor substrate when part of a double-stranded DNA nick. The electrostatic repulsion by the terminal phosphate may allow increased breathing of the substrate into a pseudo-flap configuration, providing the active form of the substrate for FEN-1 (Fig. 9B). Such an explanation would indicate a single active site and a single mechanism of loading of FEN-1 onto the 5′ ss-DNA terminus of the flap or pseudo-flap configuration of the nick. Consistent with this model are our observations that optimal activity at a nick requires very 2+ low Mg and monovalent salt, which destabilize base-pairing, 2+ whereas flap cleavage is optimal at moderate Mg and monovalent salt concentrations. Furthermore, we have previously shown that one nucleotide flaps are efficient substrates (1). ACKNOWLEDGEMENTS This work was supported by NIH grants CA51105 and GM43236 to M.R.L. and GM32431 to P.M.J.B. M.R.L. is a Leukemia Society of America Scholar. REFERENCES 1 Harrington,J.J. and Lieber,M.R. (1994) EMBO J. 13, 1235–1246. 2 Murante,R., Huang,L. Turchi,J. and Bambara,R. (1994) J. Biol. Chem. 269, 1191–1196. 3 Harrington,J.J. and Lieber,M.R. (1994) Genes Dev. 8, 1344–1355. 4 Robins,P., Pappin,D., Wood,R.D. and Lindahl,T. (1994) J. Biol. Chem. 269, 28535–28538. 5 Reagan,M.S., Pittenberger,C., Siede,W. and Friedberg,E.C. (1995) J. Bacteriol. 177, 364–371. 6 Sommers,C., Miller,E., Dujon,B., Prakash,S. and Prakash,L. (1995) J. Biol. Figure 9. Model for FEN-1 and PCNA loading onto DNA substrates. Chem. 270, 4193–4196. (A) FEN-1 tracks along the single-stranded 5′ flap of a branched DNA 7 Waga,S., Bauer,G. and Stillman,B. (1994) J. Biol. Chem. 269, structure. Without this 5′ single-stranded DNA entry point, FEN-1 is unable to 10923–10934. localize to the DNA branch point. Double-stranded interruptions of the 8 Ishimi,Y., Claude,A., Bullock,P. and Hurwitz,J. (1988) J. Biol. Chem. 263, single-stranded character at any point along the flap prevent FEN-1 from 19723–19733. reaching the branch point and cleavage is prevented. PCNA loads onto 9 Johnson,R., Kovvali,G., Prakash,L. and Prakash,S. (1995) Science 269, double-stranded DNA termini by diffusion. (PCNA is also able to load onto 238–240. long linear DNAs and circular DNA by PCNA monomer assembly into trimers 10 Murante,R.S., Rust,L. and Bambara,R.A. (1995) J. Biol. Chem. 270, catalyzed by RF-C and ATP.) PCNA stimulates FEN-1 by increasing the 30377–30383. residence time at the branch point. (B) FEN-1 action at a nick may occur by 11 Aboussekhra,A. and Wood,R.D. (1994) Curr. Opin. Genet. Dev. 4, 1–24. initial recognition and binding of the breathing pseudo-flap form of the nick. By 12 Krishna,T., Kong,X., Gary,S., Burgers,P.M. and Kuriyan,J. (1994) Cell 79, this model, cleavage at nicks would actually be flap cleavage that occurs as the 1233–1243. nick breathes, forming a transient 5′ flap. 13 Bauer,G. and Burgers,P.M.J. (1988) Biochim. Biophys. Acta 951, 274–279. 14 Li,R., Waga,S., Hannnon,G., Beach,D. and Stillman,B. (1994) Nature 371, 534–537. second appears to be used by S.cerevisiae Rad2. The only 15 Li,X., Li,J., Harrington,J., Lieber,M.R. and Burgers,P.M.J. (1995) J. Biol. substantial sequence difference between yeast FEN-1 and Rad2 is Chem. 270, 22109–22112. 16 Zervos,A., Gyuris,J. and Brent,R. (1993) Cell 72, 223–232. what we have previously termed the S region, which is located 17 Fien,K. and Stillman,B.(1992) Mol. Cell Biol. 12, 155–163. between two of the remaining three highly conserved regions. It 18 Bendixen,C., Gangloff,S. and Rothstein,R. (1994) Nucleic Acids Res. 22, may be that this region increases the affinity of Rad2 for the branch 1778–1779. point, making tracking down the single-stranded tail unnecessary. 19 Burgers,P.M. and Yoder,B.L. (1993) J. Biol. Chem. 268, 19923–19936. 20 Turchi,J.J. and Bambara,R.A. (1993) J. Biol. Chem. 268, 15136–15141. 21 Goulian,M., Richards,S.H., Heard,C.J. and Bigsby,B.M. (1990) J. Biol. Separability of the endonucleolytic and exonucleolytic Chem. 265, 18461–18571. activities of FEN-1 22 Lyamichev,V., Brow,M. and Dahlberg,J.E. (1993) Science 260, 778–783. 23 Habraken,Y., Sung,P., Prakash,L. and Prakash,S. (1995) J. Biol. Chem. Are the endonucleolytic and exonucleolytic activities of FEN-1 270, 30194–30198. related or distinct activities? One way of answering this question 24 Shivji,K., Kenny,M. and Wood,R. (1992) Cell 69, 367–374. is by considering the similarities and differences in binding and 25 Nichols,A.F. and Sancar,A. (1992) Nucleic Acids Res. 20, 2441–2446. 26 Guzder,S.N., Habraken,Y., Sung,P., Prakash,L. and Prakash,S. (1995) cleavage of exo- versus endonucleolytic substrates. Both activities J. Biol. Chem. 270, 12973–12976. show little sensitivity to the base at the 5′ most position at the flap 27 Harrington,J.J. and Lieber,M.R. (1995) J. Biol. Chem. 270, 4503–4508. or nick. Both FEN-1 endo- and exonucleolytic substrate binding 28 Cozzarelli,N.R., Kelly,R.B. and Kornberg,A. (1969) J. Mol. Biol. 45, and cutting are stimulated by an upstream oligonucleotide (flap 513–531. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nucleic Acids Research Oxford University Press

Processing of Branched DNA Intermediates by a Complex of Human FEN-1 and PCNA

Download PDF
8 pages

Loading next page...
 
/lp/oxford-university-press/processing-of-branched-dna-intermediates-by-a-complex-of-human-fen-1-G5ixkRL1eI

References (39)

Publisher
Oxford University Press
Copyright
© 1996 Oxford University Press
ISSN
0305-1048
eISSN
1362-4962
DOI
10.1093/nar/24.11.2036
Publisher site
See Article on Publisher Site

Abstract

2036–2043 Nucleic Acids Research, 1996, Vol. 24, No. 11  1996 Oxford University Press Processing of branched DNA intermediates by a complex of human FEN-1 and PCNA 1,2 1,2 2 2 2 Xiantuo Wu , Jun Li , Xiangyang Li , Chih-Lin Hsieh , Peter M. J. Burgers 1,2, and Michael R. Lieber * 1 2 Departments of Pathology and Biochemistry and Molecular Biophysics, Division of Molecular Oncology, Washington University School of Medicine, 660 S. Euclid Avenue, Campus Box 8118, St Louis, MO 63110, USA Received March 1, 1996; Revised and Accepted April 18, 1996 ABSTRACT DNA replication in cell-free systems (7,8). FEN-1 also appears to be important in mismatch repair (9). Other DNA repair and In eukaryotic cells, a 5′ flap DNA endonuclease activity recombination pathways are being examined to determine the extent and a ds DNA 5′-exonuclease activity exist within a of FEN-1 involvement in branched DNA processing in other DNA single enzyme called FEN-1 [flap endo-nuclease and transactions. Bambara and colleagues have published a study of calf 5(five)′-exo-nuclease]. This 42 kDa endo-/exonuclease, thymus FEN-1 on various 5′ flap substrates (10) showing that FEN-1, is highly homologous to human XP-G, double-stranded regions along an otherwise single-stranded 5′ flap Saccharomyces cerevisiae RAD2 and S.cerevisiae block entry and sliding of FEN-1 to the branch point. In addition, the RTH1. These structure-specific nucleases recognize phosphorylation status at the 5′ flap terminus did not affect cleavage, and cleave a branched DNA structure called a DNA though absence of a 5′-phosphate at a nick was inhibitory for flap, and its derivative called a pseudo Y-structure. exonucleolytic FEN-1 action. FEN-1 is essential for lagging strand DNA synthesis in The yeast proliferating cell nuclear antigen (PCNA) is the Okazaki fragment joining. FEN-1 also appears to be processivity factor for DNA polymerases δ and ε. Like FEN-1, important in mismatch repair. Here we find that human PCNA is one of the 10 essential proteins for DNA replication (7). PCNA, the processivity factor for eukaryotic polymer- PCNA is also important in nucleotide excision repair (11). It is a ases, physically associates with human FEN-1 and homotrimer with a subunit molecular weight of 29 kDa and is stimulates its endonucleolytic activity at branched highly conserved from yeast to mammalian cells. Based on the DNA structures and its exonucleolytic activity at nick crystal structure, trimeric yeast PCNA forms a closed ring which and gap structures. Structural requirements for FEN-1 appears to encircle double-stranded DNA (12). Processivity in and PCNA loading provide an interesting picture of this DNA synthesis is achieved by PCNA binding to the polymerase, stimulation. PCNA loads on to substrates at double- thereby tethering the DNA polymerase at the primer terminus stranded DNA ends. In contrast, FEN-1 requires a free (13). In addition to this structural function in DNA replication, single-stranded 5′ terminus and appears to load by mammalian PCNA, through its interactions with the cyclin- tracking along the single-stranded DNA branch. These dependent protein kinase inhibitor p21 (CIP1/WAF1/SDI1), has physical constraints define the range of DNA repli- also been implicated in cell cycle control (14). cation, recombination and repair processes in which Recently, we found that yeast PCNA and yeast FEN-1 interact this family of structure-specific nucleases participate. (15). We were interested in verifying this interaction in the most A model explaining the exonucleolytic activity of distant multicellular eukaryote, human. Here we report that FEN-1 in terms of its endonucleolytic activity is human PCNA binds to FEN-1 and stimulates the endonucleolytic proposed based on these observations. cleavage of FEN-1 at flap structures and its exonucleolytic activity at nicks. In this ternary interaction between DNA INTRODUCTION substrate, FEN-1 and PCNA, it is interesting to consider how these three components assemble and interact. Does the mode of In all eukaryotic cells, an enzyme called FEN-1 [flap endo-nuclease assembly influence the range of substrates cleaved? Here, we and 5(five)′-exo-nuclease] appears to function as both a 5′ flap DNA describe studies using recombinant human FEN-1 confirming endonuclease and a ds DNA 5′-exonuclease (1,2). This 42 kDa that it requires a fully single-stranded 5′ terminus and flap for endo-/exonuclease, FEN-1, has been shown to be highly homolo- gous to human XP-G, Saccharomyces cerevisiae RAD2 and cleavage at the single- to double-stranded DNA junction. This is S.cerevisiae RTH1 (3). These structure-specific nucleases recognize despite the insensitivity of FEN-1 to the phosphorylation state of and cleave a branched DNA structure called a DNA flap, and its the 5′ terminus and to the base in the 5′ terminal nucleotide in derivative called a pseudo Y-structure (4). FEN-1 and its correspon- endonucleolytic assays. Deviations from single-stranded char- ding S.cerevisiae homologue, RTH1, are important for DNA acter anywhere between the 5′ terminus and the cleavage junction replication based on genetic studies (5,6), and FEN-1 is essential for prevent cutting. Hence, heterologous loops and DNA bubbles, To whom correspondence should be addressed 2037 Nucleic Acids Research, 1996, Vol. 24, No. 11 2037 Nucleic Acids Research, 1994, Vol. 22, No. 1 potentially important intermediates in a variety of processes in FEN-1. Recombinant human FEN-1 was purified as described for DNA metabolism, are not recognized. These observations have recombinant murine FEN-1 (3). important implications for the physiologic role of FEN-1 in DNA replication, DNA recombination, and DNA repair. These studies Physical interaction between FEN-1 and PCNA indicate that FEN-1 and PCNA may load onto different portions Protein G (Pharmacia) beads (10 μl) were washed twice 0.4 ml of branched DNA structures in assembly of the ternary complex Buffer A (40 mM HEPES pH 7.4; 2 mM MgCl ) containing of these two proteins with DNA. PCNA does not alter the 150 mM NaCl (designated buffer B when it includes the 150 mM substrate specificity at all. Based on the insensitivity of the NaCl). Anti-human c-myc (anti-myc) or anti-human PCNA endonucleolytic activity of FEN-1 to the 5′ phosphorylation (2 μg) monoclonal antibodies (mouse IgG1) were added to the status of the ss-DNA flap, but its sensitivity to the 5′ phosphoryla- beads in 100 μl buffer B and incubated at 4C for 14 h. The loaded tion status at a DNA nick (where FEN-1 previously has been beads were washed three times with 400 μl buffer B. Human considered to act exonucleolytically), we describe a unified FEN-1 (60 ng) was added to the beads in buffer B and incubated model that explains the exonucleolytic activity of FEN-1 in terms 2 h at 4C. The beads were washed with 400 μl buffer B three of its endonucleolytic activity. times. Any bound protein (FEN-1) was eluted with two washes of 10 μl buffer A containing either 300 or 600 mM NaCl. This MATERIALS AND METHODS 20 μl was mixed with 20 μl 2× SDS loading buffer and fractionated on an 8% PAGE. Immunoblotting used rabbit Two-hybrid analysis polyclonal anti-human FEN-1 anti-sera at a 1:100 dilution. The secondary antibody was goat anti-rabbit coupled to horse radish Plasmid and strains. The plasmids, pJG4-5 and pEG202, have peroxidase at a 1:400 dilution. Enhanced chemiluminescence been described previously (16). The human PCNA acidic (ECL) was used for detection. activation constructs, contain the entire human PCNA structural gene and is the result of ligation of an NdeI blunt fragment from FEN-1 endonuclease activity on flap substrates p3038 2xT (17) into pEG202 digested with EcoRI and blunted. Lex A-Ku86 contains the carboxy-terminal 210 amino acids of Oligonucleotides are SC1, CAGCAACGCAAGCTTG (strand human Ku86 protein, which was cloned as an EcoRI–XhoI adjacent to the flap strand); SC3, GTCGACCTGCAGCCCAAG- fragment into pEG202 after polymerase chain reaction amplifica- CTTGCGTTGCTG (bridge strand, which is annealed to the flap tion. Lex A-bicoid was a gift of Roger Brent. The junctions of all and the adjacent strand); and SC5, ATGTGGAAAATCTCTAGC- constructs were sequenced. All strains were derived from the AGGCTGCAGGTCGAC (flap strand, which is the one cleaved parent S.cerevisiae strain EGY48 (MATa trp1 ura3 his3 leu2:: by FEN-1). Additional flap substrates were composed of pLexAop6-leu2). YPH499 (MAT ura3-52 trp 1-63 his3-200 HJ41 (bridge strand), 43 (flap adjacent strand), and 86 (flap leu2-1 lys-801 ade 2-101). strand). HJ41, GGACTCTGCCTCAAGACGGTAGTCAACGTG (30mer). HJ43, CACGTTGACTACCGTC (16mer). HJ86, Modified two-hybrid screening. We developed a yeast liquid GCCGCCGCCGCCGCCTTTTTTTTTTTTTTTTTGAGGCAG- mating strategy to screen libraries with the yeast interaction trap AGTCC (44mer); note that upon Klenow fill-in, this 44mer of Brent (16). The prey strain, YPH499, was transformed with a becomes 46 nt long. The blocking oligo HJ87 is used in some HeLa cDNA expression library. The transformants, selected on experiments to anneal to the flap strand, HJ86. HJ87, tryptophan dropout plates, are harvested, aliquoted and then GGCGGCGGCGGCGGC (15mer). Some structures use a differ- stored at –80C in 32.5% glycerol, 12.5 mM Tris–HCl pH 8.0, 50 6 ent blocking oligo in place of HJ87. This is HJ88. HJ88, mM MgSO . The resulting library strain consists of 1.8 × 10 AAAAAAAGGCGGCGG (15mer). In cases where we wanted to independent YPH499 transformants. The bait strain, EGY48, was label the flap strand at the 3′ end, we needed to make the bridge transformed with a lacZ reportor plasmid pSH 18-34 and strand longer than HJ41. This longer version is HJ89 lexA-hPCNA (human PCNA) fusion plasmid pEG202-hPCNA. [TTGGACTCTGCCTCAAGACGGTAGTCAACGTG (32mer)]. Screening is performed by mating of library and bait strains 7 FEN-1 activity on loop substrates. For heterologous loops, we followed by selection of leucine prototrophy. In brief, 5 × 10 paired MY2 with HJ90. MY2, GTATCTGCCGAAACTGATCC- colony forming units of the library strain are combined with 7 AGTTACAAGGCTGTGTCCTCAGAGGATC (48mer). HJ90, 5 × 10 cells from the bait strain. This mixture is pelleted, GATCCTCTGAGGACACAGATCAGTTTCGGCAGATAC resuspended in 2 ml YPAD media, divided into 20 aliquots, and (36mer). For a bubble structure, we paired MY2 with HJ91 then incubated for 12–16 h at 30C. Yeast were thoroughly washed [GATCCTCTGAGGACACTTTTTTCAGTTTCGGCAGATAC with sterile water and resuspended in CM/-ura/-his/-trp/2%galac- (38 mer)]. tose/1% raffinose. Incubation in the latter medium for 3–4 h at The endonuclease assay was done in a 15 μl total volume 30C permits induction of the galactose inducible promotor of the containing 50 mM Tris–HCl (pH 8.0), 10 mM MgCl , 25 mM library plasmids. To screen the library for interaction, the mixture NaCl, 0.5 mM β-mercaptoethanol, 500 μg/ml BSA, 10 fmol of containing complete media/-ura/-his/-trp/-leu/2% galactose/1% flap substrate, FEN-1 at specified amounts (10 fmol = 0.4 ng = raffinose. After 3–4 days of incubation at 30C, the largest colonies 20 U as defined in ref. 1), and, if present, PCNA trimer at were picked and further analyzed as described (16,18). specified amounts. Protein purification FEN-1 exonuclease activity on DNA nicks PCNA. Recombinant human PCNA was purified as described Assays were as described for the flap substrates, except for previously (17). adjustment to 10 mM Tris (pH 8), 5 mM MgCl and 8 mM NaCl. 2038 Nucleic Acids Research, 1996, Vol. 24, No. 11 Figure 1. Genetic and physical interaction between human PCNA and human FEN-1. (A) Identity of matings (left), and growth of various matings (right) on agar plate of CM/-ura/-his/-leu/-trp/galactose/raffinose. (B) Binding of soluble recombinant human FEN-1 to protein G beads bearing anti-human c-myc (lanes 1 and 2) or anti-human PCNA (lanes 3 and 4) IgG monoclonal antibodies. After Figure 2. Human PCNA stimulates FEN-1 endonucleolytic cleavage at 5′ DNA the binding incubation, any binding was challenged with 300 mM NaCl (lanes flap structures. Flap substrate (0.01 pmol) [oligos SC 1(16mer), 3(30mer), 1 and 3) or 600 mM NaCl (lanes 2 and 4). Remaining protein was solubilized 5(33mer)] was incubated with 0.01 pmol of human FEN-1 in a 15 μl total in denaturing SDS loading buffer, run on 8% PAGE, and immunoblotted to allow volume containing 50 mM Tris–HCl (pH 8.0), 10 mM MgCl , 25 mM NaCl, detection of human FEN-1 (see Materials and Methods). 0.5 mM β-mercaptoethanol, 500 μg/ml BSA. Human PCNA was added as indicated in pmol units of trimer. BSA is used to maintain the protein concentration constant. The arrow indicates the product, which is 20 nt in Oligonucleotides are CLH2 (24mer) GTAGGAGATGTCCCTT- length. The top band is the flap strand (SC5), which is 33 nt in length. Controls GATGAATT; CLH3 (16mer) CGAACCCAGATACGGC and AI4 in which PCNA was added in the absence of FEN-1 demonstrated the absence of any contaminating nuclease activities (not shown). (41mer) GGCCGTATCTGGGTTCGAATTCATCAAGGGACA- TCTCCTAC. In cases where we wanted to 3′ label the oligonucleo- tide downstream of a nick, we used HJ95, which is identical to vector, pEG202. The diploid progeny were streaked onto a CLH3 except that it is one nucleotide shorter at its 3′ end, permiting glucose/-ura/-his/-trp master plate, and then replica plated onto a fill-in with the Klenow fragment of DNA pol I using labeled galactose/-ura/-his/-trp/-leu plate. Interaction results in activation [α- P]dCTP. Control experiments showed no nuclease activity in of the Lex A op-Leu2 reporter and growth in the absence of all analogous experiments lacking FEN-1 (data not shown). leucine. Human FEN-1 causes strong growth in the presence of the human PCNA bait, and weak growth in the presence of the RESULTS Ku86 bait, bicoid bait, and pEG202 bait (Fig. 1A). Isolation and identification of human FEN-1 cDNA in a Physical interaction of human PCNA and human FEN-1 two-hybrid analysis using the human PCNA gene To test whether the strong genetic indication of an interaction could The modified yeast two-hybrid system was used to identify be documented physically, we bound human PCNA to protein G proteins encoded in the HeLa cell library that interact with human beads via an anti-human PCNA monoclonal antibody. As a control, PCNA. 700 000 diploids were screened. The 86 largest colonies we used anti-human c-myc antibodies. Soluble FEN-1 was then from galactose/-leu plates were gridded onto master plates and incubated with the beads and found to associate with the PCNA then tested on -ura/-his/-trp/X-gal/glucose plates and on galac- beads to a greater extent than to the anti-myc control beads (Fig. 1B). tose/raffinose plates to determine whether the leu+ phenotype is The interaction was stable at 300 mM NaCl and required 600 mM galactose-dependent and whether it correlates with galactose to elute. Hence, the physical interaction is detectable even at salt dependent β-galactosidase activity. Fifty-five colonies passed concentrations more than twice physiologic. these tests. The plasmids were extracted by a rapid yeast minipreparation method. A polymerase chain reaction was used to amplify the cDNA with primers derived from the vector Human PCNA stimulates FEN-1 endonucleolytic pJG4-5. The resulting PCR products were digested with HaeIII activity at 5′ DNA flap structures and MboI to identify those that contain identical library plasmids. In order to test the functional significance of this interaction, we All of the plasmids sequenced were human FEN-1. examined human FEN-1 cleavage at 5′-flap structures. In the various DNA metabolic transactions in which FEN-1 is known to Specific interaction of human PCNA with human FEN-1 function, DNA flap structures, nicks and gaps are involved. In the To prove that the human FEN1 specifically interacts with human first structures examined, we tested for endonucleolytic activity. PCNA, we transformed pJG-hFEN1 into the YPH499 strain and We found that human PCNA stimulates FEN-1 cleavage nearly mated with human PCNA bait and other strains expressing 10-fold at 5′ DNA flaps (Fig. 2). Stimulation begins to be unrelated baits, such as LexA-bicoid, LexA-Ku86 and the parent apparent at 12-fold molar excess of PCNA over FEN-1. The 2039 Nucleic Acids Research, 1996, Vol. 24, No. 11 2039 Nucleic Acids Research, 1994, Vol. 22, No. 1 Figure 4. Human PCNA stimulates yeast FEN-1 activity but yeast PCNA does Figure 3. Human PCNA stimulates FEN-1 exonucleolytic activity at nicks. not stimulate human FEN-1 activity. (A) Ten fmol of substrate were treated with Assays were as described for the flap substrates (Fig. 2), except for adjustment 50 fmol of yFEN-1 under the same conditions as in Figure 2, except in the to 10 mM Tris (pH 8), 5 mM MgCl and 8 mM NaCl. In addition, the amount 2 presence or absence of yeast or human PCNA (5 pmol). BSA is used to maintain of human FEN-1 was 62.5 fmol, and the amount of human PCNA was 2.5 pmol. the protein concentration constant in the absence of PCNA. Other experiments The oligonucleotides forming a nick configuration are CLH2, CLH3 and AI4. show that the amount of product increases with increasing FEN-1 addition The long arrow shows the position of mononucleotides, and the short arrow above what is used here (not shown). The arrow shows the position of the 20mer shows the position of dinucleotides. BSA is used to maintain the protein flap cleavage product. (B) Same as in (A), except with 50 fmol human FEN-1 concentration constant. in the presence or absence of 5 pmol yPCNA. highest levels of stimulation occur at the highest stoichiometric 5′ end could function as FEN-1 substrates when PCNA is ratios of the PCNA trimer to FEN-1 (800-fold). Equal concentra- provided. We tested heterologous DNA loops (Fig. 5). At the site tions of BSA in place of PCNA had absolutely no effect. where the loop departs from double-stranded DNA conformation, these substrates share some features with 5′ flap structures and Human PCNA stimulates FEN-1 exonucleolytic activity pseudo-Y branched DNA structures. Specifically, if the heterolo- at DNA nicks gous loop were nicked at its upstream attachment point to the double-stranded DNA, then it would become the 5′ flap structure FEN-1 is also a ds DNA exonuclease that is most active at nicks. optimal for FEN-1 cutting. The only difference then is that there Its activity and binding at gaps decreases with increasing gap size. is no free 5′ flap terminus. When tested, FEN-1 is able to We were interested in whether PCNA stimulates FEN-1 distinguish the heterologous loop from the 5′ flap structure, and exonucleolytic activity at a DNA nick. We find that it does. it does not cut the loop. We reasoned that in the cell, FEN-1 is However, the magnitude of the stimulation is somewhat smaller acting in the presence of PCNA. We wondered if this failure to cut than for the endonucleolytic activity (Fig. 3). The products are such a similar structure could be overcome by PCNA stimulation. predominantly mononucleotides but dinucleotides exonucleoly- We find that PCNA does not help FEN-1 to cleave heterologous tic products are also generated. loops. Hence, a free 5′ terminus is necessary for FEN-1 cleavage. The bubble structure (right side of Fig. 5) is similar to a branched Human PCNA stimulates yeast FEN-1 activity but pseudo-Y structure but with the two single-stranded arms annealed yeast PCNA does not stimulate human FEN-1 activity at there most distal points. We find that FEN-1 is sensitive to this difference also and does not cleave it. As was the case for Yeast PCNA stimulates yeast FEN-1. FEN-1 is 61% identical and heterologous loops, PCNA is unable to stimulate FEN-1 to 78% similar between yeast and human (3). PCNA is 30% identical between yeast and human. Hence, we were interested in overcome this structural requirement for a free 5′ terminus (Fig. 5). the extent to which these were interchangeable. We find that human PCNA can stimulate yeast FEN-1 to an extent that is Do FEN-1 and PCNA load from different portions of equivalent to human FEN-1 (Fig. 4A). However, yeast PCNA branched DNA substrates? does not stimulate human FEN-1 (Fig. 4B). PCNA loads onto linear DNA substrates by diffusion onto the double-stranded DNA termini (19). For FEN-1 loading, we Does PCNA broaden the substrate specificity of FEN-1? wondered if the 5′ flap had to be single-stranded over its entire FEN-1 acts on substrates with 5′ flaps as an endonuclease and at length, only near the site of cleavage, or only at its most 5′ nicks or recessed 5′ DNA ends as a 5′→3′ exonuclease. We were terminal end. Escherichia coli polymerase I has a 5′→3′ nuclease interested in whether substrates that lack a 5′ flap or a recessed domain that has very similar endonucleolytic and exonucleolytic 2040 Nucleic Acids Research, 1996, Vol. 24, No. 11 Figure 6. Human FEN-1 cleavage is prevented by double-stranded regions along the otherwise single-stranded DNA flap. In all lanes, the 44mer is HJ86 (labeled at its 5′-P), the 16mer is HJ43 and the 30mer is HJ41. A fourth oligonucleotide, shown in bold, is a 15mer; it is HJ87 in the case where it is positioned at the most distal end of the DNA flap (lanes 3 and 4 from the left), and it is HJ88 where it is annealed in the middle of the DNA flap (lanes 5 and Figure 5. Human FEN-1 fails to cleave at heterologous loops and DNA bubble 6 from the left). The total reaction volume was 15 μl, the amount of substrate structures with or without PCNA. The left three lanes show the analysis of a was 10 fmol, the amount of FEN-1 was 50 fmol, the amount of PCNA was 2.8 heterologous loop and the right three lanes show analysis of DNA bubble. The pmol. The substrate used in Figures 2 and 4 generates one predominant labeled reaction total volume was 15 μl, the amount of substrate was 10 fmol, the amount cleavage product that begins one nucleotide into the double-stranded region of FEN-1 where used was 50 fmol, and the amount of PCNA trimer where used adjacent to the elbow of the flap strand; in contrast, this substrate generates one was 2.8 pmol. The label was at the 5′-P of the 48mer. The oligonucleotides were predominant but several larger and smaller cleavage products, and overall, this gel purified. The 48mer is MY2, the 36mer is HJ90 and the 38mer is HJ91. substrate cleaves with lower efficiency. These qualitative and quantitative Human FEN-1 and PCNA are abbreviated as hFEN-1 and hPCNA in this and variations appear to be a function of the sequence at the elbow of the flap strand the remaining figures. Controls done in parallel demonstrate that the FEN-1 (i.e., at the junction of the single-stranded and the double-stranded portions of preparation is active on standard flap substrates (see Fig. 6). Except for a small the flap strand), as we have described previously (1). amount of liberated 5′-P label release to generate mononucleotide, there are no lower molecular weight cleavage products, indicating that there is no cleavage of the heterologous loop and DNA bubble structures. single-stranded DNA on each side, with the duplex portion located in the middle of the flap. We find that cleavage is still blocked (not properties to FEN-1. In fact, FEN-1 is the counterpart of this shown). Hence, FEN-1, like the 5′ nuclease domain of E.coli pol I domain for eukaryotic polymerases (1,7,20,21). There is signifi- (22) and unlike S.cerevisiae Rad2 (23), requires fully single- cant amino acid homology between the FEN-1 and E.coli pol I 5′ stranded character between the 5′ terminus and the branch point. nuclease domain (24% overall and 52% in a selected 63 aa region) Rad2 is able to circumvent the requirement for a fully (4). The 5′ nuclease of E.coli pol I appears to slide down the single-stranded region 5′ of the cleavage site, perhaps by binding single-stranded flap until it reaches the branch point where it more tightly to the branch point (23). If PCNA were to stabilize cleaves. Double-stranded character along this 5′ flap is known to FEN-1 sufficiently at its cleavage site, we considered that it might prevent E.coli pol I from acting (22). One might assume that convert FEN-1 to a Rad2-type of loading, thereby allowing it to FEN-1 would function in a similar fashion. However, S.cerevisiae circumvent the requirement for a fully single-stranded 5′ flap. RAD2 is a member of the highly conserved FEN-1 family of However, we find that this is not the case (Fig. 6). Hence, the nucleases (3), and it does not require a free 5′ terminus to cut at physiologic mechanism of FEN-1 loading onto its substrates the corresponding position as FEN-1 (23). appears to require an energy-independent (hence, nondirectional) We wondered which mechanism of loading FEN-1 uses and tracking along the entire length of the single-stranded region. This whether the manner of loading is modified by PCNA. In order to also means that FEN-1 and PCNA load from different portions of examine this issue, we generated 5′ flap structures as we have the substrate and meet at the branch point. described previously, and we tested the ability of oligonucleotides annealed to various locations along this flap to prevent FEN-1 action Interactions between FEN-1 and the 5′ terminus of (Fig. 6). In these cases, the flap is 30 nt long. The oligonucleotide DNA strands at flaps and nicks being annealed to the flap is 15 nt. When we anneal the 15 nt oligonucleotide to the most distal portion of the flap, cleavage is The data above indicate that FEN-1 loads at DNA flaps by entirely blocked. When we anneal in the middle of the flap 7 nt from energy-independent tracking from the 5′ terminus to the branch the 5′ terminus and leaving 8 nt of single-stranded character before point rather than by binding to the terminus and relying on the branch point, cleavage is also entirely blocked. We have done the collisional interaction with the DNA branch point. Given that same experiments with a 65 nt flap and a 15 nt oligonucleotide FEN-1 loads from the 5′ terminus, we considered what structural annealed in the middle of its length. This leaves 25 nt of features are critical for FEN-1 recognition there. We know that 2041 Nucleic Acids Research, 1996, Vol. 24, No. 11 2041 Nucleic Acids Research, 1994, Vol. 22, No. 1 Figure 8. Human FEN-1 exonucleolytic activity demonstrates limited sensitiv- ity to the phosphorylation status at a DNA nick. The total reaction volume was 15 μl, the amount of substrate was 10 fmol, the amount of FEN-1 was 0.1 pmol, and the amount of PCNA trimer where used was 5.6 pmol. The oligonucleotides were as follows: 24mer, CLH2; 15mer, HJ95; and 41mer, AI4. The 15mer was labeled at the 3′ end by Klenow fill-in of one nucleotide. The 5′ end of this now 16mer was either left unphosphorylated or was phosphorylated with unlabeled ATP and polynucleotide kinase prior to being annealed. Reaction conditions were 30C for 30 min in 10 mM Tris (pH 8), 5 mM MgCl , 0.5 mM β-mercaptoethanol. The top band is substrate and cleavage products migrate at the faster mobilities. The phosphorylated substrate has a slightly faster mobility than the unphosphorylated substrate. The ratio of product divided by (substrate + product) was determined by phosphorimager quantitation; these are 0, 5, 8; 0, 16 and 66% from left to right. conditions. [If the endonucleolytic activity were much greater, then one would see accummulation of the 15 nt flap cleavage product. If Figure 7. Human FEN-1 activity shows only limited sensitivitiy to the phosphorylation status of the single-stranded DNA flap with or without PCNA. the exonucleolytic activity were much greater, then one would see The total reaction volume was 15 μl, the amount of substrate was 10 fmol, the this 15 nt product rapidly chased predominantly to mononucleotides. amount of FEN-1 was 25 fmol, and the amount of PCNA trimer where used was The ratio of the endonucleolytic and exonucleolytic activities can 5.6 pmol. The oligonucleotides were as follows: 44mer, HJ86; 16mer, HJ43; vary dramatically, depending on the ionic conditions (1).] Therefore, and 32mer, HJ89. The 44mer (flap strand) was labeled at the 3′ end by Klenow fill-in of two nucleotides, making it a 46mer after labeling. The 5′ end of this FEN-1 recognizes the 5′ terminus and requires it for loading, yet it flap strand was either left unphosphorylated or was phosphorylated with has only limited sensitivity to the base and the 5′ phosphate regions unlabeled ATP and polynucleotide kinase. It is important to note that FEN-1, of the terminus. in addition to its endonucleolytic activity, has 5′→3′ exonucleolytic activity, [as In considering the similarities and differences in how FEN-1 illustrated in Fig. 3 and previously by us (1) and others (2,8,20,21)]. Therefore, loads onto substrates in its endo- and exonucleolytic modes, we with 3′-end-labeling of the flap strand, it is expected that one will see not only an initial set of endonucleolytic cleavage products (as in Fig. 6), but also the wondered if the exonucleolytic activity is also insensitive to the secondary products due to exonucleolytic shortening of these 3′-end-labeled 5′ phosphorylation status. We used a substrate identical to that strands. The exonucleolytic shortening can progress all the way until the flap described in Figure 3, except that we replaced the 16mer used in strand oligonucleotide dissociates because it becomes so short that it melts off that study with a 15mer (HJ95) and then used the Klenow at the temperature of these enzyme reactions. The arrow indicates the position of the largest of the range of cleavage products (15mer). The ratio of product fragment of DNA pol I to label the 3′ end with radioactive (integrated over the entire range of product bands) divided by (substrate + [α- P]dNTP. (Prior to this step, we either kinased the 5′ terminus product) was determined by phosphorimager quantitation; these are 2.1, 10.2, with cold phosphate or left it as a 5′-OH.) We find that the 3.3 and 12.4% from left to right. phosphorylated form is cleaved ~ 2.7–8-fold more efficiently under the reaction conditions of this study (Fig. 8). (As indicated in Figure 3, PCNA stimulates FEN-1 exonucleolytic activity to FEN-1 is insensitive to the base at the 5′ terminal flap position (1). some extent.) Hence, FEN-1 requires a free 5′ terminus for We wondered if FEN-1 is sensitive to the phosphorylation status of branched DNA substrate loading. However, it shows only limited the 5′ terminus. To test this, we used a flap substrate similar to that sensitivity to the phosphorylation status of the 5′ terminus at described in Figure 6. We radiolabeled the 3′ end of the flap strand which it loads. This limited sensitivity is greater for FEN-1 and then phosphorylated the 5′ flap terminus with cold phosphate or loading at a DNA nick. This may have its basis in isomerization left it as a 5′-OH (Fig. 7). We find that the percentage of substrate of the nicked substrate to a flap configuration (see Discussion). converted to product is similar regardless of the 5′ flap terminus phosphorylation status, though the phosphorylated form shows DISCUSSION ~ 1.2–1.5-fold greater cleavage. The arrow indicates cleavage at the branch point, one nucleotide into the double-stranded region. The Human FEN-1 and PCNA functional interaction in lower cleavage bands represent FEN-1 exonucleolytic processing of DNA metabolism the gapped product left after the flap cleavage. One can see from the exonucleolytic processing that the endonucleolytic and exonucleoly- In a two-hybrid search using human PCNA, we found that human tic activities are not dramatically dissimilar under these ionic FEN-1 is detected as the predominant interactor. However, does 2042 Nucleic Acids Research, 1996, Vol. 24, No. 11 this binding reflect a functional interaction in the nucleus? Based FEN-1 mutants are adversely affected in mismatch DNA repair on the enzymatic stimulation of FEN-1 by PCNA, we infer that (9). The specific enzymatic steps in eukaryotic mismatch repair it does. PCNA stimulates the endonucleolytic activity at 5′ DNA are not yet sufficiently well-defined to permit specification of the flap structures. It also stimulates the exonucleolytic activity of precise step for FEN-1 activity or the involvement of PCNA. FEN-1 at DNA nicks. However, the result is marked instability of dinucleotide repeats, Human FEN-1 in the absence of PCNA is markedly inhibited by just as is the case for the other mismatch repair components. In increasing concentrations of monovalent salt. The binding between another DNA repair process, nucleotide excision repair, PCNA is FEN-1 and PCNA results in substantially more endonucleolytic known to be important (24,25). Although FEN-1 itself has not and exonucleolytic activity than would otherwise occur at these salt been shown to be involved in this reaction, RAD2 (XP-G in concentrations (1). Therefore, the functional binding with PCNA higher eukaryotes) is absolutely required (26). Based on the explains how FEN-1 can be active at higher salt concentrations. involvement of PCNA in nucleotide excision repair and the In DNA replication, PCNA is localized to the 3′-OH of the primer presence of homology between FEN-1 and RAD2, it is possible DNA strand by RF-C (19). At the replication fork, there is no free that PCNA may also interact with RAD2 to facilitate its loading and thereby excision of damaged nucleotides. Though RAD2 has ds DNA end onto which PCNA can diffuse. Therefore, RF-C binds not specifically been shown to be the target of PCNA stimulation to the 3′-OH and then catalyzes PCNA assembly from monomer to in nucleotide excision repair, the work of Nichols and Sancar trimer around the axis of the ds DNA. It is reasonable that PCNA (1992) makes it clear that PCNA is stimulating some form of would then bind FEN-1 because this nuclease is required for nucleolytic activity in excision repair. Thus, there may be a Okazaki fragment processing. Specifically, RNase H degrades the common theme in various aspects of DNA metabolism, in addition RNA primer of each lagging strand down to a point where the last to DNA replication, in which a processivity factor stimulates a ribonucleotide remains (20,21). Pol δ extends the upstream strand structure-specific nuclease in processing nicked and branched to a nick. At that point, either of two pathways achieve the same DNA intermediates. We are currently investigating the role of result. In one pathway, the polymerase extends further to displace the FEN-1 in DNA end joining (double-strand break repair). In this downstream strand. This generates a 5′ flap structure, which FEN-1 case, PCNA could diffuse onto the free ds DNA end and stimulate can then cleave endonucleolytically. In the second pathway, FEN-1 FEN-1 action at a nick, gap or flap. The fact that PCNA stimulation functions exonucleolytically, cleaving the last ribo- and deoxy- of FEN-1 exonucleolytic activity can occur on linear substrates in ribonucleotide off exonucleolytically as a dinucleotide. The localiz- the absence of RF-C in human cells is potentially important in ation of FEN-1 to the replication fork by PCNA and the stimulation DNA end joining. We did not find such stimulation in yeast for this of FEN-1 activity by PCNA are consistent with their functions in particular substrate configuration. It is interesting that in yeast the replication. predominant mode of DNA end joining is different from We start to see endonucleolytic stimulation of FEN-1 by PCNA mammalian cells and procedes by homologous recombination at a molar ratio of 12 PCNA trimer molecules per each FEN-1 involving the homologous chromosome as a template. molecule. The stimulation continues for as far as we carried out the titration, which was a ratio of 800 PCNA trimers per FEN-1. In the absence of RF-C, PCNA loads onto DNA as a toroid Substrate structural features and the human diffuses onto the end of a rod. This is a diffusion-limited process FEN-1–PCNA interaction that has obvious steric requirements. This type of PCNA loading is much less efficient than that catalyzed by RF-C. The PCNA trimer loads diffusionally onto the end of double-stranded requirement for stoichiometric excess of PCNA under conditions DNA (19). Monomeric PCNA is unable to stimulate FEN-1 (15). for diffusional loading has been extensively documented (19). Therefore, the assembled trimer is important for FEN-1 stimula- Hence, it is not surprising that FEN-1 stimulation by PCNA tion. In the absence of a DNA terminus, RF-C catalyzes the would require a large stoichiometric excess and that it would assembly of PCNA monomers into trimers at a 3′-OH (19). increase progressively with increasing PCNA. Based on the failure of FEN-1 to cleave at DNA bubbles and It is noteworthy that this PCNA–FEN-1 interaction extends from heterologous loops, we inferred that a free 5′ terminus is yeast (15) to humans. The features of the stimulation are similar important for FEN-1 substrate recognition. We confirmed this by overall. However, there is one interesting difference that we have annealing oligonucleotides at various positions along the single- noted. We did not detect stimulation of yeast FEN-1 exonucleolytic stranded DNA flap. Whether annealed to the most 5′ portion of activity at linear ds nick sites by yeast PCNA even in the presence the flap or along the middle of the flap, FEN-1 endonucleolytic of yeast RF-C. We could only detect stimulation of yeast FEN-1 by activity was eliminated. Therefore, it appears that FEN-1 tracks PCNA and RF-C at nick sites on circular M13 molecules. We along the single-stranded DNA from the 5′ terminus to the reasoned that this was because the PCNA molecules diffused off cleavage point. of the linear DNA molecules too quickly. For human FEN-1 and Given these observations, it appears that FEN-1 and PCNA may PCNA, we do detect some stimulation of FEN-1 exonucleolytic load from different points of a branched DNA substrate (Fig. 9A), activity at simple nicked ds linear DNA molecules (this expands with PCNA loading from one end and FEN-1 loading along the the nick to a gap). Hence, the residence time of the human PCNA single-stranded 5′ flap. The simplest model is that PCNA stabilizes may be longer, allowing for stimulation of FEN-1. This could be FEN-1 at the branch point, increasing its residence time there, this due to a difference between yeast and human PCNA or a difference being the basis for PCNA stimulation of FEN-1 activity. between yeast and human FEN-1. The human PCNA may diffuse Within the E.coli pol I/FEN-1 nuclease family, there appear to across the nicked linear DNA slower or the human FEN-1 may be two mechanims of loading. One mechanism is by energy- bind more tightly to the nick site than the yeast FEN-1. independent diffusion down the single-stranded flap (Fig. 9A). The In addition to replication, the interaction between FEN-1 and second is direct binding to a DNA branch point. The first PCNA may have broader implications in DNA metabolism. mechanism appears to be used by E.coli pol I and by FEN-1. The 2043 Nucleic Acids Research, 1996, Vol. 24, No. 11 2043 Nucleic Acids Research, 1994, Vol. 22, No. 1 adjacent strand or primer) (27). This is also the case for E.coli pol I (28). Although a 5′ OH terminus is a good substrate for FEN-1 loading onto a 5′ flap substrate, it serves as a poor substrate when part of a double-stranded DNA nick. The electrostatic repulsion by the terminal phosphate may allow increased breathing of the substrate into a pseudo-flap configuration, providing the active form of the substrate for FEN-1 (Fig. 9B). Such an explanation would indicate a single active site and a single mechanism of loading of FEN-1 onto the 5′ ss-DNA terminus of the flap or pseudo-flap configuration of the nick. Consistent with this model are our observations that optimal activity at a nick requires very 2+ low Mg and monovalent salt, which destabilize base-pairing, 2+ whereas flap cleavage is optimal at moderate Mg and monovalent salt concentrations. Furthermore, we have previously shown that one nucleotide flaps are efficient substrates (1). ACKNOWLEDGEMENTS This work was supported by NIH grants CA51105 and GM43236 to M.R.L. and GM32431 to P.M.J.B. M.R.L. is a Leukemia Society of America Scholar. REFERENCES 1 Harrington,J.J. and Lieber,M.R. (1994) EMBO J. 13, 1235–1246. 2 Murante,R., Huang,L. Turchi,J. and Bambara,R. (1994) J. Biol. Chem. 269, 1191–1196. 3 Harrington,J.J. and Lieber,M.R. (1994) Genes Dev. 8, 1344–1355. 4 Robins,P., Pappin,D., Wood,R.D. and Lindahl,T. (1994) J. Biol. Chem. 269, 28535–28538. 5 Reagan,M.S., Pittenberger,C., Siede,W. and Friedberg,E.C. (1995) J. Bacteriol. 177, 364–371. 6 Sommers,C., Miller,E., Dujon,B., Prakash,S. and Prakash,L. (1995) J. Biol. Figure 9. Model for FEN-1 and PCNA loading onto DNA substrates. Chem. 270, 4193–4196. (A) FEN-1 tracks along the single-stranded 5′ flap of a branched DNA 7 Waga,S., Bauer,G. and Stillman,B. (1994) J. Biol. Chem. 269, structure. Without this 5′ single-stranded DNA entry point, FEN-1 is unable to 10923–10934. localize to the DNA branch point. Double-stranded interruptions of the 8 Ishimi,Y., Claude,A., Bullock,P. and Hurwitz,J. (1988) J. Biol. Chem. 263, single-stranded character at any point along the flap prevent FEN-1 from 19723–19733. reaching the branch point and cleavage is prevented. PCNA loads onto 9 Johnson,R., Kovvali,G., Prakash,L. and Prakash,S. (1995) Science 269, double-stranded DNA termini by diffusion. (PCNA is also able to load onto 238–240. long linear DNAs and circular DNA by PCNA monomer assembly into trimers 10 Murante,R.S., Rust,L. and Bambara,R.A. (1995) J. Biol. Chem. 270, catalyzed by RF-C and ATP.) PCNA stimulates FEN-1 by increasing the 30377–30383. residence time at the branch point. (B) FEN-1 action at a nick may occur by 11 Aboussekhra,A. and Wood,R.D. (1994) Curr. Opin. Genet. Dev. 4, 1–24. initial recognition and binding of the breathing pseudo-flap form of the nick. By 12 Krishna,T., Kong,X., Gary,S., Burgers,P.M. and Kuriyan,J. (1994) Cell 79, this model, cleavage at nicks would actually be flap cleavage that occurs as the 1233–1243. nick breathes, forming a transient 5′ flap. 13 Bauer,G. and Burgers,P.M.J. (1988) Biochim. Biophys. Acta 951, 274–279. 14 Li,R., Waga,S., Hannnon,G., Beach,D. and Stillman,B. (1994) Nature 371, 534–537. second appears to be used by S.cerevisiae Rad2. The only 15 Li,X., Li,J., Harrington,J., Lieber,M.R. and Burgers,P.M.J. (1995) J. Biol. substantial sequence difference between yeast FEN-1 and Rad2 is Chem. 270, 22109–22112. 16 Zervos,A., Gyuris,J. and Brent,R. (1993) Cell 72, 223–232. what we have previously termed the S region, which is located 17 Fien,K. and Stillman,B.(1992) Mol. Cell Biol. 12, 155–163. between two of the remaining three highly conserved regions. It 18 Bendixen,C., Gangloff,S. and Rothstein,R. (1994) Nucleic Acids Res. 22, may be that this region increases the affinity of Rad2 for the branch 1778–1779. point, making tracking down the single-stranded tail unnecessary. 19 Burgers,P.M. and Yoder,B.L. (1993) J. Biol. Chem. 268, 19923–19936. 20 Turchi,J.J. and Bambara,R.A. (1993) J. Biol. Chem. 268, 15136–15141. 21 Goulian,M., Richards,S.H., Heard,C.J. and Bigsby,B.M. (1990) J. Biol. Separability of the endonucleolytic and exonucleolytic Chem. 265, 18461–18571. activities of FEN-1 22 Lyamichev,V., Brow,M. and Dahlberg,J.E. (1993) Science 260, 778–783. 23 Habraken,Y., Sung,P., Prakash,L. and Prakash,S. (1995) J. Biol. Chem. Are the endonucleolytic and exonucleolytic activities of FEN-1 270, 30194–30198. related or distinct activities? One way of answering this question 24 Shivji,K., Kenny,M. and Wood,R. (1992) Cell 69, 367–374. is by considering the similarities and differences in binding and 25 Nichols,A.F. and Sancar,A. (1992) Nucleic Acids Res. 20, 2441–2446. 26 Guzder,S.N., Habraken,Y., Sung,P., Prakash,L. and Prakash,S. (1995) cleavage of exo- versus endonucleolytic substrates. Both activities J. Biol. Chem. 270, 12973–12976. show little sensitivity to the base at the 5′ most position at the flap 27 Harrington,J.J. and Lieber,M.R. (1995) J. Biol. Chem. 270, 4503–4508. or nick. Both FEN-1 endo- and exonucleolytic substrate binding 28 Cozzarelli,N.R., Kelly,R.B. and Kornberg,A. (1969) J. Mol. Biol. 45, and cutting are stimulated by an upstream oligonucleotide (flap 513–531.

Journal

Nucleic Acids Research – Oxford University Press

Published: Jun 1, 1996

There are no references for this article.