Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 7-Day Trial for You or Your Team.

Learn More →

RNA chaperoning and intrinsic disorder in the core proteins of Flaviviridae

RNA chaperoning and intrinsic disorder in the core proteins of Flaviviridae 712–725 Nucleic Acids Research, 2008, Vol. 36, No. 3 Published online 22 November 2007 doi:10.1093/nar/gkm1051 RNA chaperoning and intrinsic disorder in the core proteins of Flaviviridae 1 2 1 Roland Ivanyi-Nagy , Jean-Pierre Lavergne , Caroline Gabus , 2 1, Damien Ficheux and Jean-Luc Darlix * LaboRetro INSERM #758, Ecole Normale Superieure de Lyon, IFR 128 Biosciences Lyon-Gerland, 69364 Lyon Cedex 07 and Institut de Biologie et Chimie des Prote´ ines, CNRS-UMR 5086, Universite´ Claude Bernard Lyon I, IFR 128 Biosciences Lyon-Gerland, 69367 Lyon Cedex 07, France Received August 14, 2007; Revised October 8, 2007; Accepted November 6, 2007 a single-stranded RNA genome. Flaviviridae is classified ABSTRACT in three genera (Flavivirus, Pestivirus and Hepacivirus), RNA chaperone proteins are essential partners with important human and/or animal pathogens present of RNA in living organisms and viruses. They are in each genus, having considerable global health and thought to assist in the correct folding and struc- socio-economic impacts. Hepatitis C virus (HCV; a tural rearrangements of RNA molecules by resolving hepacivirus) is estimated to infect more than 120 million misfolded RNA species in an ATP-independent persons worldwide, corresponding to a prevalence of 2.2–2.5% in the human population (1). Chronic HCV manner. RNA chaperoning is probably an entropy- infection may entail serious progressive liver disease, driven process, mediated by the coupled binding including liver cirrhosis and hepatocellular carcinoma and folding of intrinsically disordered protein (HCC), and is the most important indication for liver regions and the kinetically trapped RNA. Previously, transplantation (2). Major arthropod-borne pathogens of we have shown that the core protein of hepatitis C the flaviviruses include West Nile virus (WNV), yellow virus (HCV) is a potent RNA chaperone that can fever virus (YFV), dengue virus (DEN) and tick-borne drive profound structural modifications of HCV RNA encephalitis virus (TBEV); while pestiviruses, including in vitro. We now examined the RNA chaperone bovine viral diarrhoea virus (BVDV) and classical swine activity and the disordered nature of core proteins fever virus (CSFV), are animal pathogens infecting live- from different Flaviviridae genera, namely that of stock and wild ruminants. Viruses from the three genera HCV, GBV-B (GB virus B), WNV (West Nile virus) share fundamental features in their genome organization, and BVDV (bovine viral diarrhoea virus). Despite replication strategy and virion morphology, but at the low-sequence similarities, all four proteins demon- same time they exhibit an impressive collection of genus- and virus-specific adaptations (3). strated general nucleic acid annealing and RNA The genome of Flaviviridae encodes a single, long chaperone activities. Furthermore, heat resistance polyprotein which is co- and post-translationally pro- of core proteins, as well as far-UV circular dichroism cessed by cellular and viral proteases to yield the mature spectroscopy suggested that a well-defined 3D structural and non-structural proteins of the virus (3). protein structure is not necessary for core-induced The core (capsid) protein, located at the N-terminal region RNA structural rearrangements. These data provide of the polyprotein, is a small, highly basic RNA-binding evidence that RNA chaperoning—possibly mediated protein that presumably encapsidates and coats the by intrinsically disordered protein segments—is genomic RNA in the viral particle. Besides their highly conserved in Flaviviridae core proteins. Thus, basic character, core proteins from the three Flaviviridae besides nucleocapsid formation, core proteins may genera do not exhibit significant sequence similarities or function in RNA structural rearrangements taking any apparent common features in domain organization. Hepacivirus core proteins (Figure 1) are generated in their place during virus replication. mature form via successive cleavages of the polyprotein by the endoplasmic reticulum-associated signal peptidase (SP) and signal peptide peptidase (SPP) enzymes (4–7). INTRODUCTION The mature proteins consist of two domains: the Members of the positive-strand RNA virus family N-terminal domain 1 (D1) which constitutes the RNA- Flaviviridae are small, enveloped viruses containing binding region, and the C-terminal hydrophobic domain *To whom correspondence should be addressed. Tel: +33 4 72 72 81 69; Fax: +33 4 72 72 81 37; Email: [email protected] 2007 The Author(s) This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research, 2008, Vol. 36, No. 3 713 1 50 100 150 200 amino acids HCV core Domain 1 Domain 2 RNA binding LD association disordered GBV-B core 0.5 Domain 1 Domain 2 ordered WNV core RNA binding RNA binding BVDV-1 core Figure 1. Disorder prediction in Flaviviridae core proteins. Disordered regions in HCV, GBV-B, WNV and BVDV core proteins (accession numbers D89872; AF179612; AF481864; and AF220247, respectively) were predicted using the DisProt VL3-H predictor (http://www.ist.temple.edu/disprot/ predictor.php). An amino acid with a disorder score above 0.5 is considered to be in a disordered environment, while below 0.5 to be ordered. The predicted disorder is illustrated by a colour scale, with highly flexible segments in red and well-folded domains in green. Basic and acidic amino acid residues are indicated by dark blue and mauve symbols, respectively. (D2) which targets HCV and GBV-B core proteins to According to the ‘entropy exchange model’, highly flexible intracellular lipid droplets (5,8,9). Flavivirus capsid protein regions would undergo disorder-to-order transi- proteins are released from the viral polyprotein by the tion upon binding to RNA, concomitantly melting the action of the virus-encoded NS2B–NS3 serine protease RNA structure through an entropy exchange process. The complex (10–12). In contrast to hepaci- and flaviviruses, de-stabilized RNA then could search the conformational where the core protein is located at the exact N-terminus space again, eventually reaching its most stable conforma- of the polyprotein, in pestiviruses core is preceded by the tion upon cyclic protein binding and release (24). pro N-terminal protease (N ). The N-terminus of mature We previously reported that the core protein of HCV pro core is generated by an autocatalytic cleavage of N , possesses RNA chaperone activities in vitro (25,26). In this while the C-terminus is processed successively by SP and study, we examined whether this activity is conserved in SPP, similarly to hepacivirus core processing (13–16). the Flaviviridae family. We found that the core proteins At present, pestivirus core proteins are biochemically and of the hepacivirus GBV-B, the pestivirus BVDV and structurally poorly characterized. the flavivirus WNV all exhibit RNA chaperone activities RNA chaperones are abundant proteins in all living in vitro. In addition, since core proteins from the three organisms and some viruses. They are thought to function genera show marked differences in their sequence and by providing assistance to the correct folding of RNA domain organization, their shared features may give molecules by preventing their misfolding or by resolving insights into the underlying common characteristics of misfolded RNA species (17). At every stage of cellular RNA chaperones. Thus, using the Flaviviridae core RNA metabolism, including transcription, RNA trans- proteins as a model system, we examined whether highly port, translation and storage, RNA molecules are associ- flexible, intrinsically unstructured protein regions play an ated with a distinct subset of chaperone molecules, which important role in mediating RNA chaperoning, as protect them and help in their folding process (18–20). predicted by the entropy exchange model. By a combina- Examples of cellular RNA chaperone proteins include the tion of far-UV circular dichroism (CD) spectroscopy, major messenger ribonucleoprotein particle (mRNP)- heat denaturation and in vitro chaperone assays, we show associated protein YB-1, the fragile X mental retardation that short, highly basic and flexible protein segments protein (FMRP), and several hnRNP proteins (18). are a hallmark of active RNA chaperone domains in In viruses, human immunodeficiency virus type 1 Flaviviridae core proteins. (HIV-1) nucleocapsid protein represents a canonical example of a multifunctional RNA chaperone (21–23). Importantly, RNA chaperones are able to promote MATERIALS AND METHODS profound structural rearrangements in RNA without ATP Proteins and peptides consumption. Based on the high proportion of intrinsi- cally unstructured regions in RNA chaperones, Tompa Recombinant HCV genotype 1b core (corresponding and Csermely (24) recently suggested an elegant model for to amino acids 2–169 and 2–117; accession number the ATP-independent mechanism of chaperone function. D89872) and GBV-B core (amino acids 2–155; accession 714 Nucleic Acids Research, 2008, Vol. 36, No. 3 number AF179612) proteins were expressed in Escherichia protein in 10ml of annealing buffer (20 mM Tris–HCl, coli and purified as previously described (25,27–28). HCV pH 7.0, 30 mM NaCl, 0.1 mM MgCl ,10mM ZnCl and 2 2 core proteolytic fragments (amino acids 2–54 and 90–159) 5 mM DTT). Standard reactions were performed at 378C were generated by endoproteinase Glu-C cleavage of HCV for 5 min, except for the heat-annealed positive control core(2–169) and purified by HPLC as previously reported which was incubated at 628C for 30 min. Protein (peptide)- (25). WNV core (amino acids 2–105; accession number to-nucleotide molar ratios are indicated in the figure AF481864) and BVDV core (amino acids 2–91; accession legends. In order to assess the resistance of RNA chaper- number AF220247) were cloned, expressed and purified one activity to heat denaturation, proteins were boiled as previously reported for HCV core (27) except that for 5 min and chilled on ice prior to incubation with the the proteins were purified from the E. coli soluble fraction ODNs. Annealing reactions were stopped with 5ml of 20% under non-denaturating conditions. All the purified glycerol, 20 mM EDTA, pH 8.0, 0.2% SDS, 0.25% proteins were stored in a buffer containing 20 mM bromophenol blue and 0.4 mg/ml calf liver tRNA (29). sodium phosphate (pH 7.4) and 5 mM 2-mercaptoethanol DNAs were resolved by 8% native PAGE in 50 mM and were >95% pure as revealed by SDS–PAGE (Supple- Tris–borate, pH 8.3, 1 mM EDTA (0.5 TBE). Double- mentary Figure 1). stranded versus single-stranded DNA ratios were WNV core peptides were synthesized on an ABI 433 determined by autoradiography and PhosporImager apparatus with Fmoc-OH/DCC/Hobt chemistry. The quantification. peptides were cleaved by a TFA solution with classical Hammerhead ribozyme cleavage scavengers and precipitated in diethyl ether. The pre- cipitate was centrifuged and the pellet was solubilized in R3 ribozyme and S14 substrate RNAs were independently water and lyophilized. The crude peptides were dissolved heated for 1 min at 908C in water. Reaction buffer was in water and purified on Vydac column (C18, 5mm, added to yield final concentrations of 5 mM MgCl , 250  10 mm) with an appropriate gradient of B 100 mM NaCl, 20 mM Tris–HCl, pH 7.5 and RNAs were (70% acetonitrile, 0.09% TFA solution in water). Purified slowly cooled down to 378C. Following a further 5 min peptides were characterized by electrospray mass spectrum incubation at 208C, 5 nmol R3 and 30 nmol S14 were (SCIEX API 165) at 2567 UMA for peptide WNV combined in a final volume of 10ml, and proteins were 1–24 and 3041 UMA for peptide WNV 80–105, and by added at a final protein-to-nucleotide ratio as indicated in HPLC apparatus HP 1100 on analytical column Vydac the figure legends. Standard reactions were incubated for (C18, 5 mm, 250  4.6 mm) in a gradient of 30 min from 25 min at 378C and stopped by adding 20ml of stop 10 to 90% of B. solution (0.5% SDS, 25 mM EDTA). RNAs were phenol– chloroform extracted, followed by ethanol precipitation Oligodeoxynucleotide (ODN) labelling and resuspension of the pellet in 10ml of loading buffer (45% formamide, 0.5 TBE, and 0.1% bromophenol Oligonucleotides corresponding to the HIV-1 TAR blue). RNAs were resolved on an 8% denaturing poly- sequence (MAL strain) in the sense and anti-sense acrylamide gel containing 7 M urea in 50 mM Tris–borate, orientation were purchased from Eurogentec (Belgium). pH 8.3 and 1 mM EDTA (0.5 TBE). Product-to- Tar(+): 5 GGTCTCTCTTGTTAG ACC A G substrate ratios were determined by autoradiography GTCG AG CCC GG GA GCTC TCTGG C TA and PhosporImager quantification. G C A A G G A A C C C; Tar(–): 5 GGG TTCCTT GCTAGCCAGAGAGCTCCCGGGCTCG CD spectroscopy ACCTGGTCTAACAAGAGAGACC. 32 32 Tar() was P-labelled with 50mCi of g P-ATP using T4 CD spectra were recorded on a Chirascan (Applied polynucleotide kinase (Invitrogen), and subsequently Photophysics) spectrophotometer. Routinely, measure- purified by 10% PAGE, 7 M urea in 0.5 TBE. ments were done at 208C in a 0.02 cm path-length quartz cuvette (Hellma) with protein concentration of 20mMin In vitro RNA synthesis 20 mM sodium phosphate buffer (pH 7.4) containing 5 mM 2-mercaptoethanol. Spectra were recorded in the In order to obtain template DNAs, plasmids pR3 and 180–260 nm wavelength range with 0.1 nm increments and pS14 were digested by PstI and treated with Klenow 2 s integration times. Protein secondary structure content polymerase (Invitrogen) to remove 3 overhangs. In vitro was determined by using the k2d method of spectral transcription was carried out using T7 RNA polymerase, deconvolution at the Dichroweb web facility (http:// according to the manufacturer’s instructions (Promega). www.cryst.bbk.ac.uk/cdweb/html/home.html). Denatura- RNAs were labelled by incorporation of a P-UMP tion and renaturation were recorded at 222 nm from 208C during in vitro transcription. RNAs were purified on a to 958C with a denaturation speed of 18C/min and with 8% denaturing polyacrylamide gel containing 7 M urea measurement each 0.58C. in 50 mM Tris–borate, pH 8.3, 1 mM EDTA (0.5 TBE) and recovered by elution in 0.3 M sodium acetate–0.1% SDS for 4 h at 378C, followed by ethanol precipitation. RESULTS DNA annealing Prediction of disordered regions in Flaviviridae core proteins Fifteen femtomoles of Tar(+) and equal amounts of RNA chaperone proteins do not share a consensus RNA- P-labelled Tar() ODNs were incubated with or without binding domain or motif that would make possible their Nucleic Acids Research, 2008, Vol. 36, No. 3 715 identification from amino acid sequences or structural per monomer, with distinct putative RNA binding and information alone. However, mostly disordered regions membrane interaction surfaces, proposed based on the with a highly basic character are probably a hallmark of asymmetric spatial charge distribution of the dimer (41). RNA chaperones (20,24) and, together with clues from According to this model, RNA binding is mediated by protein function, can be considered as an indication for the most C-terminal a-helix of the protein. In addition, RNA chaperone activities. Indeed, these flexible regions specific in vitro association of the isolated N- and may undergo disorder-to-order transition upon binding to C-terminal regions (32 and 26 amino acids, respectively) a misfolded RNA structure, and help in its folding process with viral RNA fragments has been reported (43). by an entropy exchange mechanism, as proposed by While hepaci- and flavivirus core proteins contain Tompa and Csermely (24). As a proof-of-concept, success- additional domains besides the markedly basic RNA- ful identification of an active RNA chaperone domain binding region(s), BVDV core protein seems to lack in the Gypsy retrotransposon Gag protein—based on distinct functional domains, and shows a uniform charge disorder prediction and charge distribution—has been distribution along its length. Interestingly, BVDV core is reported (30). predicted to be completely disordered (Figure 1), indicat- We used the DisProt VL3-H neural network predictor, ing that it may function as an intrinsically unstructured developed by Dunker et al. [http://www.ist.temple.edu/ protein. disprot/predictor.php (31)] to assess intrinsic disorder in core proteins from the three Flaviviridae genera (Figure 1). Flaviviridae core proteins possess DNA-annealing activity DisProt predictors can identify relatively long unstruc- tured regions with a reasonable accuracy from sequence Full-length Flaviviridae core proteins were expressed in information alone. The prediction gave a good overall E. coli with a C-terminal (His) -tag to facilitate their agreement with data available on the structural and purification (see Materials and Methods section). The domain organization of core proteins, and identified the ability of purified proteins to stably bind RNA and DNA known RNA-binding domains as highly flexible regions was verified by means of mobility shift assays. All four within the proteins (Figure 1). In order to increase the proteins bound both to RNA and DNA without a strict confidence of the prediction, the same sequences were also sequence specificity, and they caused complete retention of submitted to the IUPred [http://iupred.enzim.hu/index. the nucleic acids at the top of the gel (indicative of the html (32)] and FoldIndex [http://bip.weizmann.ac.il/ formation of large nucleoprotein complexes) at a protein- fldbin/findex (33)] servers, which use different parameters to-nucleotide molar ratio of 1:20 (data not shown). for disorder prediction, based on the estimated pair-wise In order to assess the putative nucleic acid chaperone energy content or the ratio of the hydrophobicity and net activity of Flaviviridae core proteins, their capacity to charge of a sequence, respectively (34,35). Both IUPred enhance the annealing of complementary ODNs was and FoldIndex gave similar disorder-order profiles to examined. The 56-mer Tar() ODN can form a stable that of the VL3-H predictor shown on Figure 1 (data not hairpin structure, which impedes its hybridization with the shown). complementary Tar(+) ODN. Strand annealing can occur HCV and GBV-B core proteins are believed to share a only at high temperatures or in the presence of a protein common domain organization (9,36), with an N-terminal, with nucleic acid chaperone activity [Figure 2A, (18)]. highly basic RNA-binding domain (domain 1 or D1) and The helix-destabilizing activity associated with nucleic a C-terminal, fairly hydrophobic domain (D2), which acid chaperones is essential for efficient hybridization, mediates lipid droplet association of the proteins (7,9). since molecular crowding or charge neutralization caused As shown in Figure 1, the two domains are clearly by basic peptides or single-stranded nucleic acid-binding separated by their disorder profile and their basic amino proteins without chaperone activity were shown not to be acid content, where the RNA-binding region is highly sufficient for duplex formation (25). P-labelled Tar() flexible and rich in basic residues. In its unbound state, and Tar(+) were incubated with increasing amounts of HCV core protein has been shown to lack considerable proteins at 378C for 5 min. After dissociation of the structure [(36) and Figure 5]. Interaction with intracellular DNA–protein complexes, duplex formation was analysed membranes was proposed to induce the formation of by native polyacrylamide gel electrophoresis. In the a helix-loop-helix structure in D2, which is thought to be absence of protein, no significant annealing was detected essential for the concomitant folding of the full-length at 378C (Figure 2A, lane 3), while complete hybridization (FL) protein into an a helix-rich conformation (36,37). was achieved upon 30 min incubation at 628C (lane 2). Importantly, the isolated N-terminal domain of HCV core Co-incubation of the complementary ODNs with any of was shown to mediate RNA-binding (5), RNA chaperon- the Flaviviridae core proteins (at increasing protein- ing (25,26) and in vitro particle assembly (38,39), indicat- to-nucleotide molar ratios) strongly enhanced annealing ing that D2-mediated folding is not essential for these at 378C (lanes 4–27), in all cases leading to complete processes. complex formation at a protein-to-nucleotide molar ratio The crystal structure of WNV core protein and the of 1:5. Annealing of Tar() and Tar(+) ODNs was found NMR structure of the related DEN core have recently to be extremely rapid with all core proteins tested, reach- been reported (40,41). With the exception of amino acid residues 1–20 and a short C-terminal tail, which appear to ing almost maximal duplex formation at very early time be highly flexible (40–42), these flavivirus core proteins points, after 10–30 s incubation with the proteins (data not adopt a compact dimeric fold consisting of four a-helices shown), indicating that core protein chaperoning probably 716 Nucleic Acids Research, 2008, Vol. 36, No. 3 5′ 3′ 5′ 3′ Tar(−) 3′ 5′ Tar(+) (−) 3′ 5′ Tar(+) nucleic acid chaperone HCV Core GBV-B Core WNV Core BVDV Core Tar(+) (−) Tar(−) 1 2 3 4 5 6 7 8 9 10 11 12 13 1415 16 17 18 19 2021 22 2324 25 26 27 Figure 2. Flaviviridae core proteins exhibit DNA annealing activity. (A) Schematic representation of the DNA annealing assay. Radioactively labelled Tar() and the complementary Tar(+) ODNs are incubated in the absence or presence of the putative nucleic acid chaperone. Efficient hybridization of the oligonucleotides takes place only at elevated temperatures or in the presence of a protein with nucleic acid chaperone activity. (B) Annealing of complementary oligonucleotides is promoted by core proteins. P-labelled Tar() ODN was incubated together with Tar(+) ODN in the presence of increasing amounts of the proteins, as indicated at the top of the figure. Protein-to-nucleotide molar ratios were 1:160, 1:80, 1: 40, 1:20, 1:10 and 1:5 for each protein tested (corresponding to 1, 2, 4, 8, 16 and 32 nM protein concentrations, respectively). Lane 1: labelled Tar() ODN alone; lane 2: Tar()/Tar(+) complex formed by heat annealing at 628C, without protein; lane 3: Tar()/Tar(+) complex formation at 378C in the absence of protein; lanes 4–9, 10–15, 16–21 and 22–27: complex formation at 378C in the presence of increasing concentrations of HCV, GBV-B, WNV and BVDV core proteins, respectively. Tar() migrates as two distinct bands due to its extensive secondary structures. involves only a limited number of binding-and-release of the substrate occurred slowly, yielding 15% of cycles. product in 25 min at 378C (Figure 3B, lane 2). In contrast, Overall, these results show that Flaviviridae core all Flaviviridae core proteins caused a clear activation proteins, despite their highly divergent sequences and of ribozyme-directed cleavage of the S14 RNA substrate markedly different domain organization, all facilitate (compare lanes 7–14 with lane 2). The nucleocapsid nucleic acid annealing. protein of HIV-1 (NCp7, aa 1–72) was included as a well-characterized RNA chaperone and, as expected, it greatly facilitated the cleavage reaction (lanes 3–4). Enhancement of hammerhead ribozyme cleavage Conversely, a deletion mutant of NCp7 (aa 12–53) was by Flaviviridae core proteins inactive in this assay (lanes 5 and 6), despite its highly RNA chaperone proteins can destabilize existing interac- basic nature, confirming that bona fide RNA chaperone tions within and between RNA molecules, thus allowing activity is necessary for the enhancement of ribozyme- formation of new contacts (44). Due to this mechanism, mediated cleavage. RNA chaperones can facilitate both the annealing of RNA strands and the unwinding of pre-formed helices. The chaperoning activity of Flaviviridae core proteins A canonical in vitro assay to examine both facets of is resistant to heat denaturation RNA chaperoning is the hammerhead ribozyme cleavage assay [(21,45–46), Figure 3A]. In the absence of protein As a first approach to assess whether RNA chaperone cofactors, hammerhead ribozyme-mediated cleavage is activity is really mediated by unstructured proteic regions relatively slow, limited either by the slow rate of substrate- (24), we examined the heat resistance of Flaviviridae core ribozyme complex formation, especially at subsaturating chaperone function. In contrast to well-folded proteins substrate concentrations (step 1 on Figure 3A), or by that usually undergo irreversible denaturation upon heat the slow release of the cleavage products (step 3). RNA treatment, intrinsically unstructured proteins (IUPs) are chaperones, such as hnRNP A1, the FMRP and HIV-1 known to be mostly heat resistant (48,49), a property that NCp7 were shown to accelerate both annealing and has been exploited for their purification (50) and large- product release, thus allowing fast recycling of the scale identification (51,52). ribozyme (21,45–47). FL HCV core protein and its deletion mutants, as well R3 hammerhead ribozyme and P-labelled S14 sub- as FL GBV-B, WNV and BVDV core proteins were boiled strate (with a 14-nt long region base-pairing with the for 5 min, followed by immediate quenching on ice. ribozyme) were incubated at 378C for 25 min, together Chaperone activity without and after boiling was analysed with Flaviviridae core proteins. Following incubation, by the capacity of proteins to promote strand anneal- proteins were removed by phenol–chloroform extraction ing of the complementary Tar() and Tar(+) ODNs and RNA products were analysed by PAGE under (Figure 2A). FL HCV and GBV-B core proteins retained denaturing conditions. In the absence of protein, cleavage most of their chaperone activity after boiling for 5 min Tar(−) 62°C 37°C + - Nucleic Acids Research, 2008, Vol. 36, No. 3 717 hammerhead ribozyme (R3) ′ ′ substrate ( S14) ′ ′ ′ ′ NCp7 NCp7 HCV WNV BVDV GBV-B (1–72) (12–53) core core core core S14 substrate RNA product 12 3 4 5 6 7 8 9 10 11 12 13 14 Figure 3. Enhancement of hammerhead ribozyme cleavage by Flaviviridae core proteins. (A) Schematic representation of the hammerhead ribozyme RNA cleavage reaction. Efficient cleavage of the P-labelled RNA substrate (S14) by the R3 hammerhead ribozyme necessitates hybridization of the substrate to the complementary region in the ribozyme sequence (step 1), and release of the cleaved products (step 3), allowing the cyclic reuse of the ribozyme. In the absence of a nucleic acid chaperone, steps 1 and 3 are slow, while both annealing and ribozyme turnover are greatly accelerated by proteins with nucleic acid chaperone activity. S14 RNA substrate cleavage is indicated by the arrow. (B) Hammerhead ribozyme-mediated cleavage is enhanced by Flaviviridae core proteins. R3 ribozyme and S14 substrate RNA were incubated and analysed as described in Materials and Methods section. Lanes 1 and 2: substrate cleavage in the absence of protein at 48C and 378C; lanes 3 and 4, 5 and 6, 7 and 8, 9 and 10, 11 and 12 and 13 and 14: substrate cleavage at 378C in the presence of proteins (as indicated at the top of the figure), at 1:18 and 1:9 protein-to-nucleotide molar ratios (corresponding to 16.6 and 33.3 nM protein concentrations), respectively. (75%, based on PhosporImager quantification, see lanes slightly reduced with heat treated core(2–117) but was 4–6 versus 7–9 in Figure 4A and lanes 29–31 versus 32–34 not affected with core(2–54) (lanes 13–15 and 19–21, in Figure 4B). Surprisingly, both WNV core, a protein respectively). with a well-defined 3D structure (40), and BVDV core, Since Tar()/Tar(+) complex formation reaches which was predicted to be completely unstructured a maximum level extremely rapidly in the presence of (Figure 1), retained their full activity upon boiling Flaviviridae cores, it was possible that a potential decrease (compare lanes 36–38 and 39–41, and 43–45 and 46–48 in RNA chaperone activity upon boiling of the proteins in Figure 4B). Kinetic analysis of the heat resistance of would be masked by the relatively long incubation time WNV core protein chaperone activity indicated that it in these assays. In order to compare the kinetics of remains fully active up to 10 min of boiling, but further chaperoning associated with core proteins before and incubation at 1008C led to rapid loss of strand annealing after boiling, we took advantage of the relatively slow reaction rates of the ribozyme cleavage reaction. activity (data not shown). C-terminally truncated HCV core proteins [core(2–117), R3 hammerhead ribozyme and P-labelled S14 substrate corresponding to the D1 domain of the protein, were incubated together with Flaviviridae core proteins and core(2–54)] exhibited potent annealing activities with or without prior boiling. Reactions were stopped (Figure 4A, lanes 10–12 and 16–18), in agreement after 2, 8, 16 or 30 min of incubation, and the ratio of with our earlier findings (25,26). Duplex formation was cleaved versus uncleaved substrate RNA was determined 4°C 37°C 718 Nucleic Acids Research, 2008, Vol. 36, No. 3 HCV core(2–169) HCV core(2–117) HCV core(2–54) HCV core(90–159) NNHH N H N H Tar(+) (−) Tar(−) 1 2 3 4 5 6 7 8 9 10 11 1213 1415 161718 19 20 21 2223 24 2526 27 GBV-B core WNV core BVDV core N H N HH N Tar(+) (−) Tar(−) 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 without boiling after boiling 2′ 8′ 16′ 30′ 2′ 8′ 16′ 30′ 2′ 8′ 16′ 30′ 2′ 8′ 16′ 30′ incubation time GBV-B core HCV core(2–169) WNV core BVDV core Figure 4. Heat resistance of Flaviviridae core protein chaperoning activity. (A) and (B) P-labelled Tar() ODN was incubated together with Tar(+) ODN in the presence of increasing amounts of the proteins, as indicated at the top of the figure. Proteins were either kept on ice (labelled with ‘N’ for native) or boiled (labelled with ‘H’ for heat) for 5 min before mixing with the ODNs. Protein-to-nucleotide molar ratios were 1:40, 1:20 and 1:10 for each protein tested (corresponding to 4, 8 and 16 nM protein concentrations, respectively). Lane 1: labelled Tar() ODN alone; lane 2: Tar()/Tar(+) complex formed by heat annealing at 628C, without protein; lanes 3, 28, 35 and 42: Tar()/Tar(+) complex formed at 378C in the absence of protein; lanes 4–6, 10–12, 16–18, 22–24, 29–31, 36–38 and 43–45: complex formation at 378C in the presence of increasing concentrations of proteins without prior boiling; lanes 7–9, 13–15, 19–21, 25–27, 32–34, 39–41 and 46–48: complex formation at 378C in the presence of increasing concentrations of proteins after boiling. (C) Kinetics of hammerhead ribozyme cleavage in the presence of Flaviviridae core proteins. R3 ribozyme and P-labelled S14 substrate were incubated with core proteins at 1:20 protein-to-nucleotide molar ratio (corresponding to 15 nM protein concentrations) at 378C. Reactions were stopped at different time points, as indicated in the figure. Proteins were either kept on ice (grey bars) or boiled for 5 min (black bars) before incubation with the RNAs. RNAs were resolved on an 8% denaturing polyacrylamide gel and the percentages of the cleaved S14 substrate were determined by autoradiography and PhosporImager quantification. As a control, R3 and S14 were co-incubated without protein either at 48Corat 378C (dark grey bars). Results of a representative experiment are shown. by autoradiography following denaturing gel electropho- not have an effect either on the kinetics or on the end- resis (Figure 4C). After 30 min incubation, 20% of the point of the reaction, indicating that heating does not lead substrate RNA was cleaved in the absence of protein. As to a decrease in the RNA chaperone activity of expected, all core proteins induced a considerable increase Flaviviridae core proteins. Overall, the potent strand annealing activity and in the cleavage rates, with hepacivirus core proteins demonstrating a higher activity compared to WNV and facilitation of ribozyme cleavage retained after boiling of BVDV cores (Figure 4C). Importantly, boiling of the the proteins provide convincing evidence that heat resis- proteins for 5 min before incubation with the RNAs did tance is a general feature of Flaviviridae cores. % cleaved S14 Tar(−) 37°C 62°C 4°C, 30′ 37°C 37°C, 30′ 37°C 37°C Nucleic Acids Research, 2008, Vol. 36, No. 3 719 secondary structures remained nearly the same as it was at 958C (Figure 6A). Similarly to HCV core, adding 0.1% DM to GBV-B core protein led to the formation of partly a-helical structure (Figure 6B). Ellipticity changes upon heating and cooling indicated that GBV-B core denaturation was mostly reversible in the presence of DM (Figure 6B). The denaturation was characterized by a decrease in a-helix content (from 39% to 26%), a decrease in the content of unordered structures (from 50% to 44%), and by an increase in b-sheet content (from 11% to 30%). After renaturation, the content of b-sheets and of unordered structures was nearly the same as it was before heating, while the content of a-helices remained the same as it was at 958C (Figure 6B). In agreement with the available stuctural data on Figure 5. Far-UV CD analysis of HCV and GBV-B core proteins. flavivirus capsid proteins (40–42), WNV core exhibited CD spectra were recorded at 208C, in 20 mM sodium phosphate buffer the characteristics of an a-helical protein, with local molar (pH 7.4) containing 5 mM 2-mercaptoethanol. ellipticity minima at 208 and 222 nm (Figure 6C). Estimating the secondary structure content of WNV Investigating the secondary structure content core by CD deconvolution gave 77% a-helix, in accor- of Flaviviridae core proteins dance with the published crystal structure of the protein (40). Ellipticity changes at 222 nm upon heating of the In order to get further insights into the structural require- protein showed a classical denaturation curve (Figure 6C). ments for RNA chaperoning, we carried out far-UV CD Surprisingly, denaturation of WNV core was mostly measurements on FL HCV, GBV-B, WNV and BVDV reversible, as shown by the renaturation curve and the core proteins, and on HCV core(2–117). The secondary spectrum recorded at 208C after cooling of the sample structure of HCV core has been well characterized (Figure 6C). In separate experiments, we obtained full before (36,53), and was included in these studies only for renaturation of WNV core protein after heating at 958C a direct comparison with other Flaviviridae core proteins (data not shown). The reason for this discrepancy is (Figure 5). The isolated N-terminal domain of HCV core currently unknown. The reversibility of the WNV core [core(2–117)], as well as the FL HCV and GBV-B core protein denaturation was confirmed by the determination proteins are mostly unstructured in solution, showing of similar secondary structure content prior to heating an ellipticity minimum at 198 nm, characteristically of and after cooling of the protein (Figure 6C). random-coil like peptides [(36) and Figure 5]. Indeed, BVDV core protein, in agreement with the disorder estimation of the secondary structure content by CD prediction (Figure 1), was found to be completely unstruc- deconvolution indicated <10% a-helical structure for tured at 208C, as evidenced by the pronounced minimum hepacivirus core proteins [(36) and data not shown]. in the CD spectrum observed at 200 nm (Figure 6D). As previously reported, FL HCV core [core(2–169)] requires the presence of mild, non-ionic detergents [such The chaperoning activity of the C-terminal RNA-binding as 0.1% n-dodecyl b-D-maltoside (DM)] for efficient region of WNV core solubilization, presumably mimicking the effect of lipid droplet association. Under these conditions HCV The isolated N- and C-terminal regions of the WNV core adopts a mostly a-helical conformation [(36), and core protein were found to independently bind RNA Figure 6A]. (43). Using the strand-annealing assay (Figure 2A), we In order to examine the effect of temperature on the examined the chaperoning activity of the N-terminal conformation of core proteins, far-UV CD spectra were (WNV 1–24) and C-terminal (WNV 80–105) core peptides. recorded at 208C, followed by slow (18C/min) heating The two peptides are similar in length and basic amino acid of the samples up to 958C, with constant monitoring content (7 basic residues for WNV 1–24 versus 8 for WNV of thermal unfolding at 222 nm (54,55). A second CD 80–105). As shown in Figure 7A, WNV 1–24 exhibited only spectrum was recorded at 958C, and conformational a low level of strand-annealing activity, while WNV 80–105 changes associated with the slow (18C/min) cooling of caused efficient DNA duplex formation. Incubation of the samples were followed again at 222 nm. Upon heating the ODNs with WNV 1–24 and WNV 80–105 together did of HCV core(2–169) in 0.1% DM, the protein underwent not result in a considerable increase in annealing compared irreversible denaturation, as indicated by the markedly to WNV 80–105 alone, indicating that the two peptides different spectra recorded at 222 nm upon heating and do not act in a cooperative manner (Figure 7A). cooling (Figure 6A). The denaturation was characterized The RNA chaperone activity of the WNV (80–105) by a decrease in a-helix content (from 44% to 28%), peptide was further confirmed with the ribozyme cleavage a decrease in the content of unordered structures (from assay, which requires both the strand annealing and helix 50% to 41%), and by an increase in b-sheet content unwinding activities of a chaperone. In agreement with the (from 6% to 31%). After renaturation, the content in results of the strand-annealing assay, WNV (80–105) 720 Nucleic Acids Research, 2008, Vol. 36, No. 3 A HCV core(2–169) - in 0.1% DM at 222 nm a-helix b-sheet unordered HCV core HCV core % % — 20 20 ˚ °CC 44 % 44 % 6 % 6 % 50 % 50 % — 95°C 28 % 28 % 3 31 % 1 % 4 41 % 1 % % % — 20 20 ˚ °CC 29 % 29 % 26 % 26 % 44 % 44 % after cooling after cooling B GBV-B core - in 0.1% DM at 222 nm a-helix b-sheet unordered GBV-B core GBV-B core % — % 20 ˚ 20°C C 39 % 39 % 11 % 11 % 50 % 50 % — 95 95°C 26 % 30 % 44 % % — % 20 ˚ 20°C C 29 % 29 % 17 % 17 % 54 % 54 % af aft te er c r coolin ooling g Figure 6. Far-UV CD analysis of core proteins. Far-UV CD spectra of HCV (A), GBV-B (B), WNV (C) and BVDV (D) core proteins. Measurements were done in 20 mM sodium phosphate buffer (pH 7.4) containing 5 mM 2-mercaptoethanol. For HCV and GBV-B core proteins, the buffer also contained 0.1% n-dodecyl b-D-maltoside (DM). Spectra were recorded at 208C, at 958C after slow heating of the protein, and again at 208C after slow cooling. Melting curves were recorded at 222 nm, during the heating and cooling processes. Secondary structure content was calculated by the k2d method of spectral deconvolution (http://www.cryst.bbk.ac.uk/cdweb/html/home.html). peptide caused a clear activation of the ribozyme-directed in this experiment (one protein molecule per 2.5 nt), the S14 RNA cleavage, while WNV peptide (1–24) did not FL WNV core protein demonstrated sub-optimal cleavage accelerate the cleavage reaction at all (Figure 7B). Interest- enhancement, emphasizing that RNA chaperoning occurs ingly, at the highest protein-to-nucleotide molar ratio used in a relatively narrow ‘window of activity’ (18,20). Nucleic Acids Research, 2008, Vol. 36, No. 3 721 C WNV core at 222 nm WNV WNV core core a-helix b-sheet unordered % — 20 ˚ 20°C C 77 % 77 % 0 % 0 % 23 % 23 % — 95°C 9 % 9 % 3 35 % 5 % 5 56 % 6 % % — 20 ˚ 20°C C 61 % 61 % 6 % 6 % 33 % 33 % af aft te er c r coolin ooling g D BVDV core B BVDV VDV c c oo re re a-helix b-sheet unordered % — 20 20 ˚ °C C 5 % 5 % 5 % 5 % 90 % 90 % — 95°C 6 % 6 % 2 26 % 6 % 6 68 % 8 % % — 20 20 ˚ °C C 19 % 19 % 27 % 27 % 54 % 54 % af aft te er c r co ool olin ing g Figure 6. Continued. While a low protein–RNA ratio probably favours high spatially regulated roles throughout the virus life cycle. affinity interactions (selection of RNA substrates) over It serves both as a template for minus-strand RNA or chaperoning, a high occupancy of RNA molecules by the DNA synthesis and as an mRNA directing the translation chaperone could ‘freeze’ RNA structure, hindering con- of viral proteins, and lastly, it is specifically packaged into formational rearrangements (18,20). newly made progeny virions. To accomplish these func- CD spectroscopy of WNV peptides (1–24) and (80–105) tions, the gRNA relies at least in part on short specific revealed that they are both completely unfolded cis-acting RNA elements (CREs), which regulate viral (Figure 7C; deconvolution data not shown), suggesting translation, replication with possible recombination events that RNA chaperone activity of WNV core protein does and virion assembly in infected cells (22–23,56–57). Thus, not require a well-defined structure. the gRNA and its CREs most probably undergo complex structural rearrangements, assisted by a virus-encoded protein with nucleic acid chaperone activities. The best- DISCUSSION characterized example of a viral nucleic acid chaperone is RNA chaperone activity of Flaviviridae core proteins the small nucleocapsid protein (NCp7) of human immu- and possible functional implications nodeficiency virus type 1 (HIV-1). NCp7 mediates several The genomic RNA (gRNA) of non-segmented positive RNA–RNA and RNA–DNA interactions and gRNA sense RNA viruses plays complex, temporally and rearrangements that are required at multiple stages of the 722 Nucleic Acids Research, 2008, Vol. 36, No. 3 FL WNV WNV WNV WNV1–24 + core 1–24 80–105 WNV 80–105 Tar(+) (−) Tar(−) 1 2 3 4 5 6 7 8 9 10 111213 14 1516 17 18 19 20 21 22 23 24 2526 protein/nt molar ratio FL WNV WNV WNV WNV1–24 + core 1–24 80–105 WNV 80–105 Figure 7. Strand-annealing activity of WNV core peptides. (A) P-labelled Tar() ODN was incubated together with Tar(+) ODN in the presence of increasing amounts of the proteins, as indicated at the top of the figure. Protein-to-nucleotide molar ratios were 1:160, 1:80, 1:40, 1:20, 1:10 and 1:5 for each protein tested (corresponding to 1, 2, 4, 8, 16 and 32 nM protein concentrations, respectively). Lane 1: Tar()/Tar(+) complex formed at 378C in the absence of protein; lane 2: Tar()/Tar(+) complex formed by heat annealing at 628C, without protein; lanes 3–8, 9–14, 15–20 and 21–26: complex formation at 378C in the presence of increasing concentrations of proteins. (B) Enhancement of hammerhead ribozyme cleavage by WNV core peptides. R3 ribozyme and P-labelled S14 RNA substrate were incubated at 378C for 25 min in the presence of increasing amounts of the proteins, as indicated in the figure. Protein-to-nucleotide molar ratios were 1:20, 1:10, 1:5 and 1:2.5 for each protein tested (corresponding to 15, 30, 60 and 120 nM protein concentrations, respectively). RNAs were resolved on an 8% denaturing polyacrylamide gel and the percentage of the cleaved S14 substrate was determined by autoradiography and PhosporImager quantification. As a control, R3 and S14 were co-incubated without protein either at 48Cor at378C (grey bars). Results of a representative experiment are shown. (C) Far-UV CD spectra of WNV core peptides. CD spectra were recorded at 208C, in 20 mM sodium phosphate buffer (pH 7.4) containing 5 mM 2-mercaptoethanol. virus replication cycle, such as initiation and completion The core protein of HCV exhibits striking similarities to of viral DNA synthesis, virus assembly, genome dimeriza- HIV-1 NCp7, as evidenced by its potent in vitro nucleic tion and packaging (22,23,56). In addition, NCp7 most acid chaperone activities, facilitating RNA–RNA inter- likely contributes to the genetic variability of HIV-1 by actions and structural rearrangements (25,26). Further promoting gRNA dimerization, thus enhancing the strengthening the analogy with retroviruses, the genomic frequency of copy-choice recombination (58). RNA of HCV contains a short palindromic CRE % cleaved S14 37°C 4°C 62°C 37°C 1:20 1:10 1:5 1:2.5 1:20 1:10 1:5 1:2.5 1:20 1:10 1:5 1:2.5 1:20 1:10 1:5 1:2.5 Nucleic Acids Research, 2008, Vol. 36, No. 3 723 mediating dimerization of the gRNA 3 untranslated chaperones is considerably higher than in any other region (UTR) upon core protein binding in vitro (25,26). protein class examined so far. However, in most cases Albeit the physiological relevance of this interaction is still the protein region responsible for the RNA chaperone not clear, it is tempting to speculate that RNA structural function is not precisely mapped, preventing the straight- rearrangements induced by HCV core chaperoning— forward assessments of the correlation between disorder and chaperoning. including genomic RNA dimerization—may constitute In spite of significant differences in their sequence and regulatory switch(es) between translation/replication or domain organization, Flaviviridae core proteins all possess replication/packaging of the viral RNA. RNA chaperone activities, thus providing an ideal model The closest relative of HCV is GB virus-B, a hepato- system to study the common (sequence and structural) tropic virus with unknown natural host range that requirements for chaperone function. In order to examine was shown to be infectious in New World monkeys (59). whether intrinsic disorder really plays an important role Even though the similarity between HCV and GBV-B is only 25–30% at the protein level (60), the two viruses in chaperone activity, we analysed the secondary struc- show striking resemblance in virtually every aspect of their ture content of Flaviviridae core proteins by far-UV CD replication strategy and structural features, including the spectroscopy both at room temperature, and during tripartite organization of the 3 UTR, IRES structure and thermal denaturation and renaturation. In agreement translation mechanism, and lipid droplet association of with in silico predictions (Figure 1), the four proteins the core protein (3). By means of classical in vitro RNA were found to contain various amounts of secondary chaperone assays (e.g. strand annealing, strand exchange structure. Hepacivirus (HCV and GBV-B) core proteins and ribozyme assays; Figures 2 and 3, and data not are mostly unstructured in solution (Figure 5), and they shown), we showed that nucleic acid chaperone activity is only gain an a-helical conformation in membrane-mimetic also conserved between the two hepacivirus core proteins, environments, provided in our experiments by 0.1% and that GBV-B core also efficiently facilitates the forma- dodecyl maltoside (Figure 6A and B). This property is tion of the most stable nucleic acid structure. In addition, due to the presence of hydrophobic domain D2 (Figure 1) similarly to HCV, GBV-B core protein binding induced involved in lipid droplet association (9,37). Nevertheless, dimerization of the 3 UTR of the GBV-B gRNA (R.I.-N. even in these conditions, approximately half of the protein and J.-L.D., unpublished data), suggesting that core- remained highly flexible, as shown by the estimation of mediated dimerization is a common feature in the hepaci- secondary structure content for both HCV and GBV-B virus genus. core (Figures 6A and B). In sharp constrast, WNV core Despite a lack of significant similarity with hepacivirus was found to be mostly structured by CD spectroscopy cores in amino acid sequence or domain organization (Figure 6C), in agreement with the published crystal (Figure 1), core proteins of the flavivirus WNV and the structure of the protein (40). Despite these structural pestivirus BVDV both demonstrated potent RNA chaper- differences between hepacivirus and flavivirus core one activities in vitro (Figures 2 and 3). Currently, we are proteins, relatively short unstructured peptides were investigating potential CREs in the WNV and BVDV shown to be responsible for the chaperone activity of genomic RNAs possibly regulated by core chaperoning. both HCV and WNV cores [(26), and Figures 4 and 7]. 0 0 Preliminary results show that the 5 and 3 conserved Surprisingly, BVDV core protein was found to completely sequence (CS) elements of the WNV genome—involved in lack a well-defined structure, as evidenced by its CD spectrum at 208C and 958C (Figure 6D). Further support- long-range RNA–RNA interaction, leading to genome ing the hypothesis that a well-defined structure is not cyclization necessary for viral replication (61–64)—require required for RNA chaperoning, Flaviviridae core proteins the strand annealing activity provided by RNA chaper- retained most of their chaperone activity after heat ones for efficient interaction (R.I-.N. and J.-L.D., ‘denaturation’, a characteristic feature of intrinsically unpublished data). unstructured proteins (Figure 4). Overall, these experiments show that even closely Intrinsic disorder and RNA chaperone activity related RNA chaperones may utilize different strategies The mechanism of action of RNA chaperone proteins and structural features to carry out the same function, is still not well understood. According to the recently and that RNA chaperone activity of Flaviviridae core proposed entropy exchange model, intrinsically unstruc- proteins is mediated by disordered, highly charged protein tured, highly flexible protein regions would play an segments, lending experimental support to the entropy essential role in facilitating RNA structural rearrange- exchange hypothesis. ments in an ATP-independent manner, probably by providing the energy necessary for partially melting the misfolded RNA structure through an entropy exchange SUPPLEMENTARY DATA process, coupled with the cyclic RNA binding and release Supplementary Data are available at NAR Online. of the protein (24). Experimental evidence for the role of unstructured domains in RNA chaperone function is still scattered and incomplete (20,24). Based on bioinformatic ACKNOWLEDGEMENTS analysis of a dataset consisting of 27 RNA chaperone proteins, Tompa and Csermely (24) found that the freq- R.I-N. is the recipient of an ANRS PhD fellowship. We uency of long, continuous disordered fragments in RNA are grateful to Roland Montserret (IBCP CNRS, Lyon) 724 Nucleic Acids Research, 2008, Vol. 36, No. 3 18. Cristofari,G. and Darlix,J.L. (2002) The ubiquitous nature of RNA for help and advice on CD spectroscopy measure- chaperone proteins. Prog. Nucleic Acid Res. Mol. Biol., 72, 223–268. ments and to Franc¸ ois Penin (IBCP CNRS, Lyon) for 19. Schroeder,R., Barta,A. and Semrad,K. (2004) Strategies for RNA his support and discussions. We thank Philippe Despres folding and assembly. Nat. Rev. Mol. Cell Biol., 5, 908–919. (Institut Pasteur, Paris), Jens Bukh (NIH, Bethesda, USA) 20. Ivanyi-Nagy,R., Davidovic,L., Khandjian,E.W. and Darlix,J.L. (2005) Disordered RNA chaperone proteins: from functions to and Till Ru¨ menapf (Justus-Liebig-Universita¨ t, Giesen, disease. Cell. Mol. Life Sci., 62, 1409–1417. Germany) for their kind gift of plasmids. This work was 21. Bertrand,E.L. and Rossi,J.J. (1994) Facilitation of hammerhead funded by Agence nationale de recherches sur le sida ribozyme catalysis by the nucleocapsid protein of HIV-1 and the (to J.-L.D. and J.-P.L.); CNRS and Universite´ Lyon I heterogeneous nuclear ribonucleoprotein A1. EMBO J., 13, (to J.-P.L.). Funding to pay the Open Access publication 2904–2912. 22. Darlix,J.L., Lapadat-Tapolsky,M., de Rocquigny,H. and charges for this article was provided by French ANRS. Roques,B.P. (1995) First glimpses at structure-function relationships of the nucleocapsid protein of retroviruses. J. Mol. Biol., 254, Conflict of interest statement. None declared. 523–537. 23. Rein,A., Henderson,L.E. and Levin,J.G. (1998) Nucleic-acid- chaperone activity of retroviral nucleocapsid proteins: significance for viral replication. Trends Biochem. Sci., 23, 297–301. REFERENCES 24. Tompa,P. and Csermely,P. (2004) The role of structural disorder in 1. Shepard,C.W., Finelli,L. and Alter,M.J. (2005) Global epidemiology the function of RNA and protein chaperones. FASEB J., 18, of hepatitis C virus infection. Lancet Infect. Dis., 5, 558–567. 1169–1175. 2. Brown,R.S. (2005) Hepatitis C and liver transplantation. Nature, 25. Cristofari,G., Ivanyi-Nagy,R., Gabus,C., Boulant,S., Lavergne,J.P., 436, 973–978. Penin,F. and Darlix,J.L. (2004) The hepatitis C virus Core protein 3. Lindenbach,B.D., Thiel,H.J. and Rice,C.M. (2007) Flaviviridae: the is a potent nucleic acid chaperone that directs dimerization of the viruses and their replication. In Knipe,D.M., Howley,P.M., viral (+) strand RNA in vitro. Nucleic Acids Res., 32, 2623–2631. Griffin,D.E., Lamb,R.A., Martin,M.A., Roizman,B. and Straus,S.E. 26. Ivanyi-Nagy,R., Kanevsky,I., Gabus,C., Lavergne,J.P., Ficheux,D., (eds), Fields Virology, Lippincott Williams & Wilkins, Philadelphia, Penin,F., Fosse´ ,P. and Darlix,J.L. (2006) Analysis of hepatitis C pp. 1101–1152. virus RNA dimerization and core-RNA interactions. 4. Hijikata,M., Kato,N., Ootsuyama,Y., Nakagawa,M. and Nucleic Acids Res., 34, 2618–2633. Shimotohno,K. (1991) Gene mapping of the putative structural 27. Boulant,S., Becchi,M., Penin,F. and Lavergne,J.P. (2003) Unusual region of the hepatitis C virus genome by in vitro processing multiple recoding events leading to alternative forms of hepatitis C analysis. Proc. Natl Acad. Sci. USA, 88, 5547–5551. virus core protein from genotype 1b. J. Biol. Chem., 278, 5. Santolini,E., Migliaccio,G. and La Monica,N. (1994) Biosynthesis 45785–45792. and biochemical properties of the hepatitis C virus core protein. 28. Boni,S., Lavergne,J.P., Boulant,S. and Cahour,A. (2005) J. Virol., 68, 3631–3641. Hepatitis C virus core protein acts as a trans-modulating factor on 6. Lemberg,M.K. and Martoglio,B. (2002) Requirements for signal internal translation initiation of the viral RNA. J. Biol. Chem., 280, peptide peptidase-catalyzed intramembrane proteolysis. Mol. Cell, 17737–17748. 10, 735–744. 29. Tsuchihashi,Z. and Brown,P.O. (1994) DNA strand exchange and 7. McLauchlan,J., Lemberg,M.K., Hope,G. and Martoglio,B. (2002) selective DNA annealing promoted by the human immunodeficiency Intramembrane proteolysis promotes trafficking of hepatitis C virus virus type 1 nucleocapsid protein. J. Virol., 68, 5863–5870. core protein to lipid droplets. EMBO J., 21, 3980–3988. 30. Gabus,C., Ivanyi-Nagy,R., Depollier,J., Bucheton,A., Pelisson,A. 8. Hope,R.G. and McLauchlan,J. (2000) Sequence motifs required for and Darlix,J.L. (2006) Characterization of a nucleocapsid-like Lys,2 lipid droplet association and protein stability are unique to the region and of two distinct primer tRNA binding sites in the hepatitis C virus core protein. J. Gen. Virol., 81, 1913–1925. endogenous retrovirus Gypsy. Nucleic Acids Res., 34, 5764–5777. 9. Hope,R.G., Murphy,D.J. and McLauchlan,J. (2002) The domains 31. Obradovic,Z., Peng,K., Vucetic,S., Radivojac,P., Brown,C.J. and required to direct core proteins of hepatitis C virus and GB virus-B Dunker,A.K. (2003) Predicting intrinsic disorder from amino acid to lipid droplets share common features with plant oleosin proteins. sequence. Proteins, 53(Suppl. 6), 566–572. J. Biol. Chem., 277, 4261–4270. 32. Doszta´ nyi,Z., Csizmo´ k,V., Tompa,P. and Simon,I. (2005) IUPred: 10. Lobigs,M. (1993) Flavivirus premembrane protein cleavage and web server for the prediction of intrinsically unstructured regions of spike heterodimer secretion require the function of the viral proteins based on estimated energy content. Bioinformatics, 21, proteinase NS3. Proc. Natl Acad. Sci. USA, 90, 6218–6222. 3433–3434. 11. Amberg,S.M., Nestorowicz,A., McCourt,D.W. and Rice,C.M. 33. Prilusky,J., Felder,C.E., Zeev-Ben-Mordehai,T., Rydberg,E.H., (1994) NS2B-3 proteinase-mediated processing in the yellow fever Man,O., Beckmann,J.S., Silman,I. and Sussman,J.L. (2005) virus structural region: in vitro and in vivo studies. J. Virol., 68, FoldIndex: a simple tool to predict whether a given protein 3794–3802. sequence is intrinsically unfolded. Bioinformatics, 21, 3435–3438. 12. Yamshchikov,V.F. and Compans,R.W. (1994) Processing of the 34. Doszta´ nyi,Z., Csizmo´ k,V., Tompa,P. and Simon,I. (2005) The intracellular form of the West Nile virus capsid protein by the viral pairwise energy content estimated from amino acid composition NS2B-NS3 protease: an in vitro study. J. Virol., 68, 5765–5771. discriminates between folded and intrinsically unstructured proteins. 13. Ru¨ menapf,T., Unger,G., Strauss,J.H. and Thiel,H.J. (1993) J. Mol. Biol., 347, 827–839. Processing of the envelope glycoproteins of pestiviruses. J. Virol., 35. Uversky,V.N., Gillespie,J.R. and Fink,A.L. (2000) Why are 67, 3288–3294. ‘‘natively unfolded’’ proteins unstructured under physiologic 14. Stark,R., Meyers,G., Ru¨ menapf,T. and Thiel,H.J. (1993) Processing conditions? Proteins, 41, 415–427. of pestivirus polyprotein: cleavage site between autoprotease and 36. Boulant,S., Vanbelle,C., Ebel,C., Penin,F. and Lavergne,J.P. (2005) nucleocapsid protein of classical swine fever virus. J. Virol., 67, Hepatitis C virus core protein is a dimeric alpha-helical protein 7088–7095. exhibiting membrane protein features. J. Virol., 79, 11353–11365. 15. Rumenapf,T., Stark,R., Heimann,M. and Thiel,H.J. (1998) ¨ 37. Boulant,S., Montserret,R., Hope,R.G., Ratinier,M., N-terminal protease of pestiviruses: identification of putative Targett-Adams,P., Lavergne,J.P., Penin,F. and McLauchlan,J. catalytic residues by site-directed mutagenesis. J. Virol., 72, (2006) Structural determinants that target the hepatitis C virus core 2544–2547. protein to lipid droplets. J. Biol. Chem., 281, 22236–22247. 16. Heimann,M., Roman-Sosa,G., Martoglio,B., Thiel,H.J. and 38. Klein,K.C., Polyak,S.J. and Lingappa,J.R. (2004) Unique features Ru¨ menapf,T. (2006) Core protein of pestiviruses is processed at the of hepatitis C virus capsid formation revealed by de novo cell-free C terminus by signal peptide peptidase. J. Virol., 80, 1915–1921. assembly. J. Virol., 78, 9257–9269. 17. Herschlag,D. (1995) RNA chaperones and the RNA folding 39. Majeau,N., Gagne,V., Boivin,A., Bolduc,M., Majeau,J.A., problem. J. Biol. Chem., 270, 20871–20874. Ouellet,D. and Leclerc,D. (2004) The N-terminal half of the core Nucleic Acids Research, 2008, Vol. 36, No. 3 725 protein of hepatitis C virus is sufficient for nucleocapsid formation. 53. Kunkel,M. and Watowich,S.J. (2004) Biophysical characterization J. Gen. Virol., 85, 971–981. of hepatitis C virus core protein: implications for interactions within 40. Dokland,T., Walsh,M., Mackenzie,J.M., Khromykh,A.A., Ee,K.H. the virus and host. FEBS Lett., 557, 174–180. and Wang,S. (2004) West Nile virus core protein; tetramer structure 54. Kim,T.D., Ryu,H.J., Cho,H.I., Yang,C.H. and Kim,J. (2000) and ribbon formation. Structure, 12, 1157–1163. Thermal behavior of proteins: heat-resistant proteins and their 41. Ma,L., Jones,C.T., Groesch,T.D., Kuhn,R.J. and Post,C.B. (2004) heat-induced secondary structural changes. Biochemistry, 39, Solution structure of dengue virus capsid protein reveals another 14839–14846. fold. Proc. Natl Acad. Sci. USA, 101, 3414–3419. 55. Uversky,V.N. (2002) What does it mean to be natively unfolded? 42. Jones,C.T., Ma,L., Burgner,J.W., Groesch,T.D., Post,C.B. and Eur. J. Biochem., 269, 2–12. Kuhn,R.J. (2003) Flavivirus capsid is a dimeric alpha-helical 56. Darlix,J.L., Garrido,J.L., Morellet,N., Me´ ly,Y. and Rocquigny,H. protein. J. Virol., 77, 7143–7149. (2007) Properties, functions, and drug targeting of the multi- 43. Khromykh,A.A. and Westaway,E.G. (1996) RNA binding functional nucleocapsid protein of the human immunodeficiency properties of core protein of the flavivirus Kunjin. Arch. Virol., virus. Adv. Pharmacol., 55, 299–346. 141, 685–699. 57. Moradpour,D., Penin,F. and Rice,C.M. (2007) Replication of 44. Waldsich,C., Grossberger,R. and Schroeder,R. (2002) RNA hepatitis C virus. Nat. Rev. Microbiol., 5, 453–463. chaperone StpA loosens interactions of the tertiary structure in the 58. Negroni,M. and Buc,H. (2000) Copy-choice recombination td group I intron in vivo. Genes Dev., 16, 2300–2312. by reverse transcriptases: reshuffling of genetic markers 45. Tsuchihashi,Z., Khosla,M. and Herschlag,D. (1993) Protein mediated by RNA chaperones. Proc. Natl Acad. Sci. USA, 97, enhancement of hammerhead ribozyme catalysis. Science, 262, 6385–6390. 99–102. 59. Bukh,J., Apgar,C.L., Govindarajan,S. and Purcell,R.H. (2001) 46. Herschlag,D., Khosla,M., Tsuchihashi,Z. and Karpel,R.L. (1994) Host range studies of GB virus-B hepatitis agent, the closest relative An RNA chaperone activity of non-specific RNA binding proteins of hepatitis C virus, in New World monkeys and chimpanzees. in hammerhead ribozyme catalysis. EMBO J., 13, 2913–2924. J. Med. Virol., 65, 694–697. 47. Gabus,C., Mazroui,R., Tremblay,S., Khandjian,E.W. and 60. Muerhoff,A.S., Leary,T.P, Simons,J.N., Pilot-Matias,T.J., Darlix,J.L. (2004) The fragile X mental retardation protein has Dawson,G.J., Erker,J.C., Chalmers,M.L., Schlauder,G.G., nucleic acid chaperone properties. Nucleic Acids Res., 32, Desai,S.M. et al. (1995) Genomic organization of GB viruses A and 2129–2137. B: two new members of the Flaviviridae associated with GB agent 48. Weinreb,P.H., Zhen,W., Poon,A.W., Conway,K.A. and hepatitis. J. Virol., 69, 5621–5630. Lansbury,P.T. Jr (1996) NACP, a protein implicated in Alzheimer’s 61. Khromykh,A.A., Meka,H., Guyatt,K.J. and Westaway,E.G. (2001) disease and learning, is natively unfolded. Biochemistry, 35, Essential role of cyclization sequences in flavivirus RNA replication. 13709–13715. J. Virol., 75, 6719–6728. 49. Receveur-Bre´ chot,V., Bourhis,J.M., Uversky,V.N., Canard,B. and 62. Lo,M.K., Tilgner,M., Bernard,K.A. and Shi,P.Y. (2003) Longhi,S. (2006) Assessing protein disorder and induced folding. Functional analysis of mosquito-borne flavivirus conserved Proteins, 62, 24–45. sequence elements within 3 untranslated region of West 50. Kalthoff,C. (2003) A novel strategy for the purification of Nile virus by use of a reporting replicon that differentiates recombinantly expressed unstructured protein domains. between viral translation and RNA replication. J. Virol., 77, J. Chromatogr. B Analyt. Technol. Biomed. Life Sci., 786, 247–254. 10004–10014. 51. Csizmo´ k,V., Szollosi,E., Friedrich,P. and Tompa,P. (2006) A novel 63. Alvarez,D.E., Lodeiro,M.F., Luduena,S.J., Pietrasanta,L.I. and two-dimensional electrophoresis technique for the identification of Gamarnik,A.V. (2005) Long-range RNA–RNA interactions circu- intrinsically unstructured proteins. Mol. Cell. Proteomics, 5, larize the dengue virus genome. J. Virol., 79, 6631–6643. 265–273. 64. Filomatori,C.V., Lodeiro,M.F., Alvarez,D.E., Samsa,M.M., 52. Csizmo´ k,V., Doszta´ nyi,Z., Simon,I. and Tompa,P. (2007) Towards Pietrasanta,L. and Gamarnik,A.V. (2006) A 5’ RNA element proteomic approaches for the identification of structural disorder. promotes dengue virus RNA synthesis on a circular genome. Curr. Protein Pept. Sci., 8, 173–179. Genes Dev., 20, 2238–2249. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nucleic Acids Research Oxford University Press

RNA chaperoning and intrinsic disorder in the core proteins of Flaviviridae

Download PDF
14 pages

Loading next page...
 
/lp/oxford-university-press/rna-chaperoning-and-intrinsic-disorder-in-the-core-proteins-of-j1lHrefdul

References (68)

Publisher
Oxford University Press
Copyright
© 2007 The Author(s)
ISSN
0305-1048
eISSN
1362-4962
DOI
10.1093/nar/gkm1051
pmid
18033802
Publisher site
See Article on Publisher Site

Abstract

712–725 Nucleic Acids Research, 2008, Vol. 36, No. 3 Published online 22 November 2007 doi:10.1093/nar/gkm1051 RNA chaperoning and intrinsic disorder in the core proteins of Flaviviridae 1 2 1 Roland Ivanyi-Nagy , Jean-Pierre Lavergne , Caroline Gabus , 2 1, Damien Ficheux and Jean-Luc Darlix * LaboRetro INSERM #758, Ecole Normale Superieure de Lyon, IFR 128 Biosciences Lyon-Gerland, 69364 Lyon Cedex 07 and Institut de Biologie et Chimie des Prote´ ines, CNRS-UMR 5086, Universite´ Claude Bernard Lyon I, IFR 128 Biosciences Lyon-Gerland, 69367 Lyon Cedex 07, France Received August 14, 2007; Revised October 8, 2007; Accepted November 6, 2007 a single-stranded RNA genome. Flaviviridae is classified ABSTRACT in three genera (Flavivirus, Pestivirus and Hepacivirus), RNA chaperone proteins are essential partners with important human and/or animal pathogens present of RNA in living organisms and viruses. They are in each genus, having considerable global health and thought to assist in the correct folding and struc- socio-economic impacts. Hepatitis C virus (HCV; a tural rearrangements of RNA molecules by resolving hepacivirus) is estimated to infect more than 120 million misfolded RNA species in an ATP-independent persons worldwide, corresponding to a prevalence of 2.2–2.5% in the human population (1). Chronic HCV manner. RNA chaperoning is probably an entropy- infection may entail serious progressive liver disease, driven process, mediated by the coupled binding including liver cirrhosis and hepatocellular carcinoma and folding of intrinsically disordered protein (HCC), and is the most important indication for liver regions and the kinetically trapped RNA. Previously, transplantation (2). Major arthropod-borne pathogens of we have shown that the core protein of hepatitis C the flaviviruses include West Nile virus (WNV), yellow virus (HCV) is a potent RNA chaperone that can fever virus (YFV), dengue virus (DEN) and tick-borne drive profound structural modifications of HCV RNA encephalitis virus (TBEV); while pestiviruses, including in vitro. We now examined the RNA chaperone bovine viral diarrhoea virus (BVDV) and classical swine activity and the disordered nature of core proteins fever virus (CSFV), are animal pathogens infecting live- from different Flaviviridae genera, namely that of stock and wild ruminants. Viruses from the three genera HCV, GBV-B (GB virus B), WNV (West Nile virus) share fundamental features in their genome organization, and BVDV (bovine viral diarrhoea virus). Despite replication strategy and virion morphology, but at the low-sequence similarities, all four proteins demon- same time they exhibit an impressive collection of genus- and virus-specific adaptations (3). strated general nucleic acid annealing and RNA The genome of Flaviviridae encodes a single, long chaperone activities. Furthermore, heat resistance polyprotein which is co- and post-translationally pro- of core proteins, as well as far-UV circular dichroism cessed by cellular and viral proteases to yield the mature spectroscopy suggested that a well-defined 3D structural and non-structural proteins of the virus (3). protein structure is not necessary for core-induced The core (capsid) protein, located at the N-terminal region RNA structural rearrangements. These data provide of the polyprotein, is a small, highly basic RNA-binding evidence that RNA chaperoning—possibly mediated protein that presumably encapsidates and coats the by intrinsically disordered protein segments—is genomic RNA in the viral particle. Besides their highly conserved in Flaviviridae core proteins. Thus, basic character, core proteins from the three Flaviviridae besides nucleocapsid formation, core proteins may genera do not exhibit significant sequence similarities or function in RNA structural rearrangements taking any apparent common features in domain organization. Hepacivirus core proteins (Figure 1) are generated in their place during virus replication. mature form via successive cleavages of the polyprotein by the endoplasmic reticulum-associated signal peptidase (SP) and signal peptide peptidase (SPP) enzymes (4–7). INTRODUCTION The mature proteins consist of two domains: the Members of the positive-strand RNA virus family N-terminal domain 1 (D1) which constitutes the RNA- Flaviviridae are small, enveloped viruses containing binding region, and the C-terminal hydrophobic domain *To whom correspondence should be addressed. Tel: +33 4 72 72 81 69; Fax: +33 4 72 72 81 37; Email: [email protected] 2007 The Author(s) This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research, 2008, Vol. 36, No. 3 713 1 50 100 150 200 amino acids HCV core Domain 1 Domain 2 RNA binding LD association disordered GBV-B core 0.5 Domain 1 Domain 2 ordered WNV core RNA binding RNA binding BVDV-1 core Figure 1. Disorder prediction in Flaviviridae core proteins. Disordered regions in HCV, GBV-B, WNV and BVDV core proteins (accession numbers D89872; AF179612; AF481864; and AF220247, respectively) were predicted using the DisProt VL3-H predictor (http://www.ist.temple.edu/disprot/ predictor.php). An amino acid with a disorder score above 0.5 is considered to be in a disordered environment, while below 0.5 to be ordered. The predicted disorder is illustrated by a colour scale, with highly flexible segments in red and well-folded domains in green. Basic and acidic amino acid residues are indicated by dark blue and mauve symbols, respectively. (D2) which targets HCV and GBV-B core proteins to According to the ‘entropy exchange model’, highly flexible intracellular lipid droplets (5,8,9). Flavivirus capsid protein regions would undergo disorder-to-order transi- proteins are released from the viral polyprotein by the tion upon binding to RNA, concomitantly melting the action of the virus-encoded NS2B–NS3 serine protease RNA structure through an entropy exchange process. The complex (10–12). In contrast to hepaci- and flaviviruses, de-stabilized RNA then could search the conformational where the core protein is located at the exact N-terminus space again, eventually reaching its most stable conforma- of the polyprotein, in pestiviruses core is preceded by the tion upon cyclic protein binding and release (24). pro N-terminal protease (N ). The N-terminus of mature We previously reported that the core protein of HCV pro core is generated by an autocatalytic cleavage of N , possesses RNA chaperone activities in vitro (25,26). In this while the C-terminus is processed successively by SP and study, we examined whether this activity is conserved in SPP, similarly to hepacivirus core processing (13–16). the Flaviviridae family. We found that the core proteins At present, pestivirus core proteins are biochemically and of the hepacivirus GBV-B, the pestivirus BVDV and structurally poorly characterized. the flavivirus WNV all exhibit RNA chaperone activities RNA chaperones are abundant proteins in all living in vitro. In addition, since core proteins from the three organisms and some viruses. They are thought to function genera show marked differences in their sequence and by providing assistance to the correct folding of RNA domain organization, their shared features may give molecules by preventing their misfolding or by resolving insights into the underlying common characteristics of misfolded RNA species (17). At every stage of cellular RNA chaperones. Thus, using the Flaviviridae core RNA metabolism, including transcription, RNA trans- proteins as a model system, we examined whether highly port, translation and storage, RNA molecules are associ- flexible, intrinsically unstructured protein regions play an ated with a distinct subset of chaperone molecules, which important role in mediating RNA chaperoning, as protect them and help in their folding process (18–20). predicted by the entropy exchange model. By a combina- Examples of cellular RNA chaperone proteins include the tion of far-UV circular dichroism (CD) spectroscopy, major messenger ribonucleoprotein particle (mRNP)- heat denaturation and in vitro chaperone assays, we show associated protein YB-1, the fragile X mental retardation that short, highly basic and flexible protein segments protein (FMRP), and several hnRNP proteins (18). are a hallmark of active RNA chaperone domains in In viruses, human immunodeficiency virus type 1 Flaviviridae core proteins. (HIV-1) nucleocapsid protein represents a canonical example of a multifunctional RNA chaperone (21–23). Importantly, RNA chaperones are able to promote MATERIALS AND METHODS profound structural rearrangements in RNA without ATP Proteins and peptides consumption. Based on the high proportion of intrinsi- cally unstructured regions in RNA chaperones, Tompa Recombinant HCV genotype 1b core (corresponding and Csermely (24) recently suggested an elegant model for to amino acids 2–169 and 2–117; accession number the ATP-independent mechanism of chaperone function. D89872) and GBV-B core (amino acids 2–155; accession 714 Nucleic Acids Research, 2008, Vol. 36, No. 3 number AF179612) proteins were expressed in Escherichia protein in 10ml of annealing buffer (20 mM Tris–HCl, coli and purified as previously described (25,27–28). HCV pH 7.0, 30 mM NaCl, 0.1 mM MgCl ,10mM ZnCl and 2 2 core proteolytic fragments (amino acids 2–54 and 90–159) 5 mM DTT). Standard reactions were performed at 378C were generated by endoproteinase Glu-C cleavage of HCV for 5 min, except for the heat-annealed positive control core(2–169) and purified by HPLC as previously reported which was incubated at 628C for 30 min. Protein (peptide)- (25). WNV core (amino acids 2–105; accession number to-nucleotide molar ratios are indicated in the figure AF481864) and BVDV core (amino acids 2–91; accession legends. In order to assess the resistance of RNA chaper- number AF220247) were cloned, expressed and purified one activity to heat denaturation, proteins were boiled as previously reported for HCV core (27) except that for 5 min and chilled on ice prior to incubation with the the proteins were purified from the E. coli soluble fraction ODNs. Annealing reactions were stopped with 5ml of 20% under non-denaturating conditions. All the purified glycerol, 20 mM EDTA, pH 8.0, 0.2% SDS, 0.25% proteins were stored in a buffer containing 20 mM bromophenol blue and 0.4 mg/ml calf liver tRNA (29). sodium phosphate (pH 7.4) and 5 mM 2-mercaptoethanol DNAs were resolved by 8% native PAGE in 50 mM and were >95% pure as revealed by SDS–PAGE (Supple- Tris–borate, pH 8.3, 1 mM EDTA (0.5 TBE). Double- mentary Figure 1). stranded versus single-stranded DNA ratios were WNV core peptides were synthesized on an ABI 433 determined by autoradiography and PhosporImager apparatus with Fmoc-OH/DCC/Hobt chemistry. The quantification. peptides were cleaved by a TFA solution with classical Hammerhead ribozyme cleavage scavengers and precipitated in diethyl ether. The pre- cipitate was centrifuged and the pellet was solubilized in R3 ribozyme and S14 substrate RNAs were independently water and lyophilized. The crude peptides were dissolved heated for 1 min at 908C in water. Reaction buffer was in water and purified on Vydac column (C18, 5mm, added to yield final concentrations of 5 mM MgCl , 250  10 mm) with an appropriate gradient of B 100 mM NaCl, 20 mM Tris–HCl, pH 7.5 and RNAs were (70% acetonitrile, 0.09% TFA solution in water). Purified slowly cooled down to 378C. Following a further 5 min peptides were characterized by electrospray mass spectrum incubation at 208C, 5 nmol R3 and 30 nmol S14 were (SCIEX API 165) at 2567 UMA for peptide WNV combined in a final volume of 10ml, and proteins were 1–24 and 3041 UMA for peptide WNV 80–105, and by added at a final protein-to-nucleotide ratio as indicated in HPLC apparatus HP 1100 on analytical column Vydac the figure legends. Standard reactions were incubated for (C18, 5 mm, 250  4.6 mm) in a gradient of 30 min from 25 min at 378C and stopped by adding 20ml of stop 10 to 90% of B. solution (0.5% SDS, 25 mM EDTA). RNAs were phenol– chloroform extracted, followed by ethanol precipitation Oligodeoxynucleotide (ODN) labelling and resuspension of the pellet in 10ml of loading buffer (45% formamide, 0.5 TBE, and 0.1% bromophenol Oligonucleotides corresponding to the HIV-1 TAR blue). RNAs were resolved on an 8% denaturing poly- sequence (MAL strain) in the sense and anti-sense acrylamide gel containing 7 M urea in 50 mM Tris–borate, orientation were purchased from Eurogentec (Belgium). pH 8.3 and 1 mM EDTA (0.5 TBE). Product-to- Tar(+): 5 GGTCTCTCTTGTTAG ACC A G substrate ratios were determined by autoradiography GTCG AG CCC GG GA GCTC TCTGG C TA and PhosporImager quantification. G C A A G G A A C C C; Tar(–): 5 GGG TTCCTT GCTAGCCAGAGAGCTCCCGGGCTCG CD spectroscopy ACCTGGTCTAACAAGAGAGACC. 32 32 Tar() was P-labelled with 50mCi of g P-ATP using T4 CD spectra were recorded on a Chirascan (Applied polynucleotide kinase (Invitrogen), and subsequently Photophysics) spectrophotometer. Routinely, measure- purified by 10% PAGE, 7 M urea in 0.5 TBE. ments were done at 208C in a 0.02 cm path-length quartz cuvette (Hellma) with protein concentration of 20mMin In vitro RNA synthesis 20 mM sodium phosphate buffer (pH 7.4) containing 5 mM 2-mercaptoethanol. Spectra were recorded in the In order to obtain template DNAs, plasmids pR3 and 180–260 nm wavelength range with 0.1 nm increments and pS14 were digested by PstI and treated with Klenow 2 s integration times. Protein secondary structure content polymerase (Invitrogen) to remove 3 overhangs. In vitro was determined by using the k2d method of spectral transcription was carried out using T7 RNA polymerase, deconvolution at the Dichroweb web facility (http:// according to the manufacturer’s instructions (Promega). www.cryst.bbk.ac.uk/cdweb/html/home.html). Denatura- RNAs were labelled by incorporation of a P-UMP tion and renaturation were recorded at 222 nm from 208C during in vitro transcription. RNAs were purified on a to 958C with a denaturation speed of 18C/min and with 8% denaturing polyacrylamide gel containing 7 M urea measurement each 0.58C. in 50 mM Tris–borate, pH 8.3, 1 mM EDTA (0.5 TBE) and recovered by elution in 0.3 M sodium acetate–0.1% SDS for 4 h at 378C, followed by ethanol precipitation. RESULTS DNA annealing Prediction of disordered regions in Flaviviridae core proteins Fifteen femtomoles of Tar(+) and equal amounts of RNA chaperone proteins do not share a consensus RNA- P-labelled Tar() ODNs were incubated with or without binding domain or motif that would make possible their Nucleic Acids Research, 2008, Vol. 36, No. 3 715 identification from amino acid sequences or structural per monomer, with distinct putative RNA binding and information alone. However, mostly disordered regions membrane interaction surfaces, proposed based on the with a highly basic character are probably a hallmark of asymmetric spatial charge distribution of the dimer (41). RNA chaperones (20,24) and, together with clues from According to this model, RNA binding is mediated by protein function, can be considered as an indication for the most C-terminal a-helix of the protein. In addition, RNA chaperone activities. Indeed, these flexible regions specific in vitro association of the isolated N- and may undergo disorder-to-order transition upon binding to C-terminal regions (32 and 26 amino acids, respectively) a misfolded RNA structure, and help in its folding process with viral RNA fragments has been reported (43). by an entropy exchange mechanism, as proposed by While hepaci- and flavivirus core proteins contain Tompa and Csermely (24). As a proof-of-concept, success- additional domains besides the markedly basic RNA- ful identification of an active RNA chaperone domain binding region(s), BVDV core protein seems to lack in the Gypsy retrotransposon Gag protein—based on distinct functional domains, and shows a uniform charge disorder prediction and charge distribution—has been distribution along its length. Interestingly, BVDV core is reported (30). predicted to be completely disordered (Figure 1), indicat- We used the DisProt VL3-H neural network predictor, ing that it may function as an intrinsically unstructured developed by Dunker et al. [http://www.ist.temple.edu/ protein. disprot/predictor.php (31)] to assess intrinsic disorder in core proteins from the three Flaviviridae genera (Figure 1). Flaviviridae core proteins possess DNA-annealing activity DisProt predictors can identify relatively long unstruc- tured regions with a reasonable accuracy from sequence Full-length Flaviviridae core proteins were expressed in information alone. The prediction gave a good overall E. coli with a C-terminal (His) -tag to facilitate their agreement with data available on the structural and purification (see Materials and Methods section). The domain organization of core proteins, and identified the ability of purified proteins to stably bind RNA and DNA known RNA-binding domains as highly flexible regions was verified by means of mobility shift assays. All four within the proteins (Figure 1). In order to increase the proteins bound both to RNA and DNA without a strict confidence of the prediction, the same sequences were also sequence specificity, and they caused complete retention of submitted to the IUPred [http://iupred.enzim.hu/index. the nucleic acids at the top of the gel (indicative of the html (32)] and FoldIndex [http://bip.weizmann.ac.il/ formation of large nucleoprotein complexes) at a protein- fldbin/findex (33)] servers, which use different parameters to-nucleotide molar ratio of 1:20 (data not shown). for disorder prediction, based on the estimated pair-wise In order to assess the putative nucleic acid chaperone energy content or the ratio of the hydrophobicity and net activity of Flaviviridae core proteins, their capacity to charge of a sequence, respectively (34,35). Both IUPred enhance the annealing of complementary ODNs was and FoldIndex gave similar disorder-order profiles to examined. The 56-mer Tar() ODN can form a stable that of the VL3-H predictor shown on Figure 1 (data not hairpin structure, which impedes its hybridization with the shown). complementary Tar(+) ODN. Strand annealing can occur HCV and GBV-B core proteins are believed to share a only at high temperatures or in the presence of a protein common domain organization (9,36), with an N-terminal, with nucleic acid chaperone activity [Figure 2A, (18)]. highly basic RNA-binding domain (domain 1 or D1) and The helix-destabilizing activity associated with nucleic a C-terminal, fairly hydrophobic domain (D2), which acid chaperones is essential for efficient hybridization, mediates lipid droplet association of the proteins (7,9). since molecular crowding or charge neutralization caused As shown in Figure 1, the two domains are clearly by basic peptides or single-stranded nucleic acid-binding separated by their disorder profile and their basic amino proteins without chaperone activity were shown not to be acid content, where the RNA-binding region is highly sufficient for duplex formation (25). P-labelled Tar() flexible and rich in basic residues. In its unbound state, and Tar(+) were incubated with increasing amounts of HCV core protein has been shown to lack considerable proteins at 378C for 5 min. After dissociation of the structure [(36) and Figure 5]. Interaction with intracellular DNA–protein complexes, duplex formation was analysed membranes was proposed to induce the formation of by native polyacrylamide gel electrophoresis. In the a helix-loop-helix structure in D2, which is thought to be absence of protein, no significant annealing was detected essential for the concomitant folding of the full-length at 378C (Figure 2A, lane 3), while complete hybridization (FL) protein into an a helix-rich conformation (36,37). was achieved upon 30 min incubation at 628C (lane 2). Importantly, the isolated N-terminal domain of HCV core Co-incubation of the complementary ODNs with any of was shown to mediate RNA-binding (5), RNA chaperon- the Flaviviridae core proteins (at increasing protein- ing (25,26) and in vitro particle assembly (38,39), indicat- to-nucleotide molar ratios) strongly enhanced annealing ing that D2-mediated folding is not essential for these at 378C (lanes 4–27), in all cases leading to complete processes. complex formation at a protein-to-nucleotide molar ratio The crystal structure of WNV core protein and the of 1:5. Annealing of Tar() and Tar(+) ODNs was found NMR structure of the related DEN core have recently to be extremely rapid with all core proteins tested, reach- been reported (40,41). With the exception of amino acid residues 1–20 and a short C-terminal tail, which appear to ing almost maximal duplex formation at very early time be highly flexible (40–42), these flavivirus core proteins points, after 10–30 s incubation with the proteins (data not adopt a compact dimeric fold consisting of four a-helices shown), indicating that core protein chaperoning probably 716 Nucleic Acids Research, 2008, Vol. 36, No. 3 5′ 3′ 5′ 3′ Tar(−) 3′ 5′ Tar(+) (−) 3′ 5′ Tar(+) nucleic acid chaperone HCV Core GBV-B Core WNV Core BVDV Core Tar(+) (−) Tar(−) 1 2 3 4 5 6 7 8 9 10 11 12 13 1415 16 17 18 19 2021 22 2324 25 26 27 Figure 2. Flaviviridae core proteins exhibit DNA annealing activity. (A) Schematic representation of the DNA annealing assay. Radioactively labelled Tar() and the complementary Tar(+) ODNs are incubated in the absence or presence of the putative nucleic acid chaperone. Efficient hybridization of the oligonucleotides takes place only at elevated temperatures or in the presence of a protein with nucleic acid chaperone activity. (B) Annealing of complementary oligonucleotides is promoted by core proteins. P-labelled Tar() ODN was incubated together with Tar(+) ODN in the presence of increasing amounts of the proteins, as indicated at the top of the figure. Protein-to-nucleotide molar ratios were 1:160, 1:80, 1: 40, 1:20, 1:10 and 1:5 for each protein tested (corresponding to 1, 2, 4, 8, 16 and 32 nM protein concentrations, respectively). Lane 1: labelled Tar() ODN alone; lane 2: Tar()/Tar(+) complex formed by heat annealing at 628C, without protein; lane 3: Tar()/Tar(+) complex formation at 378C in the absence of protein; lanes 4–9, 10–15, 16–21 and 22–27: complex formation at 378C in the presence of increasing concentrations of HCV, GBV-B, WNV and BVDV core proteins, respectively. Tar() migrates as two distinct bands due to its extensive secondary structures. involves only a limited number of binding-and-release of the substrate occurred slowly, yielding 15% of cycles. product in 25 min at 378C (Figure 3B, lane 2). In contrast, Overall, these results show that Flaviviridae core all Flaviviridae core proteins caused a clear activation proteins, despite their highly divergent sequences and of ribozyme-directed cleavage of the S14 RNA substrate markedly different domain organization, all facilitate (compare lanes 7–14 with lane 2). The nucleocapsid nucleic acid annealing. protein of HIV-1 (NCp7, aa 1–72) was included as a well-characterized RNA chaperone and, as expected, it greatly facilitated the cleavage reaction (lanes 3–4). Enhancement of hammerhead ribozyme cleavage Conversely, a deletion mutant of NCp7 (aa 12–53) was by Flaviviridae core proteins inactive in this assay (lanes 5 and 6), despite its highly RNA chaperone proteins can destabilize existing interac- basic nature, confirming that bona fide RNA chaperone tions within and between RNA molecules, thus allowing activity is necessary for the enhancement of ribozyme- formation of new contacts (44). Due to this mechanism, mediated cleavage. RNA chaperones can facilitate both the annealing of RNA strands and the unwinding of pre-formed helices. The chaperoning activity of Flaviviridae core proteins A canonical in vitro assay to examine both facets of is resistant to heat denaturation RNA chaperoning is the hammerhead ribozyme cleavage assay [(21,45–46), Figure 3A]. In the absence of protein As a first approach to assess whether RNA chaperone cofactors, hammerhead ribozyme-mediated cleavage is activity is really mediated by unstructured proteic regions relatively slow, limited either by the slow rate of substrate- (24), we examined the heat resistance of Flaviviridae core ribozyme complex formation, especially at subsaturating chaperone function. In contrast to well-folded proteins substrate concentrations (step 1 on Figure 3A), or by that usually undergo irreversible denaturation upon heat the slow release of the cleavage products (step 3). RNA treatment, intrinsically unstructured proteins (IUPs) are chaperones, such as hnRNP A1, the FMRP and HIV-1 known to be mostly heat resistant (48,49), a property that NCp7 were shown to accelerate both annealing and has been exploited for their purification (50) and large- product release, thus allowing fast recycling of the scale identification (51,52). ribozyme (21,45–47). FL HCV core protein and its deletion mutants, as well R3 hammerhead ribozyme and P-labelled S14 sub- as FL GBV-B, WNV and BVDV core proteins were boiled strate (with a 14-nt long region base-pairing with the for 5 min, followed by immediate quenching on ice. ribozyme) were incubated at 378C for 25 min, together Chaperone activity without and after boiling was analysed with Flaviviridae core proteins. Following incubation, by the capacity of proteins to promote strand anneal- proteins were removed by phenol–chloroform extraction ing of the complementary Tar() and Tar(+) ODNs and RNA products were analysed by PAGE under (Figure 2A). FL HCV and GBV-B core proteins retained denaturing conditions. In the absence of protein, cleavage most of their chaperone activity after boiling for 5 min Tar(−) 62°C 37°C + - Nucleic Acids Research, 2008, Vol. 36, No. 3 717 hammerhead ribozyme (R3) ′ ′ substrate ( S14) ′ ′ ′ ′ NCp7 NCp7 HCV WNV BVDV GBV-B (1–72) (12–53) core core core core S14 substrate RNA product 12 3 4 5 6 7 8 9 10 11 12 13 14 Figure 3. Enhancement of hammerhead ribozyme cleavage by Flaviviridae core proteins. (A) Schematic representation of the hammerhead ribozyme RNA cleavage reaction. Efficient cleavage of the P-labelled RNA substrate (S14) by the R3 hammerhead ribozyme necessitates hybridization of the substrate to the complementary region in the ribozyme sequence (step 1), and release of the cleaved products (step 3), allowing the cyclic reuse of the ribozyme. In the absence of a nucleic acid chaperone, steps 1 and 3 are slow, while both annealing and ribozyme turnover are greatly accelerated by proteins with nucleic acid chaperone activity. S14 RNA substrate cleavage is indicated by the arrow. (B) Hammerhead ribozyme-mediated cleavage is enhanced by Flaviviridae core proteins. R3 ribozyme and S14 substrate RNA were incubated and analysed as described in Materials and Methods section. Lanes 1 and 2: substrate cleavage in the absence of protein at 48C and 378C; lanes 3 and 4, 5 and 6, 7 and 8, 9 and 10, 11 and 12 and 13 and 14: substrate cleavage at 378C in the presence of proteins (as indicated at the top of the figure), at 1:18 and 1:9 protein-to-nucleotide molar ratios (corresponding to 16.6 and 33.3 nM protein concentrations), respectively. (75%, based on PhosporImager quantification, see lanes slightly reduced with heat treated core(2–117) but was 4–6 versus 7–9 in Figure 4A and lanes 29–31 versus 32–34 not affected with core(2–54) (lanes 13–15 and 19–21, in Figure 4B). Surprisingly, both WNV core, a protein respectively). with a well-defined 3D structure (40), and BVDV core, Since Tar()/Tar(+) complex formation reaches which was predicted to be completely unstructured a maximum level extremely rapidly in the presence of (Figure 1), retained their full activity upon boiling Flaviviridae cores, it was possible that a potential decrease (compare lanes 36–38 and 39–41, and 43–45 and 46–48 in RNA chaperone activity upon boiling of the proteins in Figure 4B). Kinetic analysis of the heat resistance of would be masked by the relatively long incubation time WNV core protein chaperone activity indicated that it in these assays. In order to compare the kinetics of remains fully active up to 10 min of boiling, but further chaperoning associated with core proteins before and incubation at 1008C led to rapid loss of strand annealing after boiling, we took advantage of the relatively slow reaction rates of the ribozyme cleavage reaction. activity (data not shown). C-terminally truncated HCV core proteins [core(2–117), R3 hammerhead ribozyme and P-labelled S14 substrate corresponding to the D1 domain of the protein, were incubated together with Flaviviridae core proteins and core(2–54)] exhibited potent annealing activities with or without prior boiling. Reactions were stopped (Figure 4A, lanes 10–12 and 16–18), in agreement after 2, 8, 16 or 30 min of incubation, and the ratio of with our earlier findings (25,26). Duplex formation was cleaved versus uncleaved substrate RNA was determined 4°C 37°C 718 Nucleic Acids Research, 2008, Vol. 36, No. 3 HCV core(2–169) HCV core(2–117) HCV core(2–54) HCV core(90–159) NNHH N H N H Tar(+) (−) Tar(−) 1 2 3 4 5 6 7 8 9 10 11 1213 1415 161718 19 20 21 2223 24 2526 27 GBV-B core WNV core BVDV core N H N HH N Tar(+) (−) Tar(−) 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 without boiling after boiling 2′ 8′ 16′ 30′ 2′ 8′ 16′ 30′ 2′ 8′ 16′ 30′ 2′ 8′ 16′ 30′ incubation time GBV-B core HCV core(2–169) WNV core BVDV core Figure 4. Heat resistance of Flaviviridae core protein chaperoning activity. (A) and (B) P-labelled Tar() ODN was incubated together with Tar(+) ODN in the presence of increasing amounts of the proteins, as indicated at the top of the figure. Proteins were either kept on ice (labelled with ‘N’ for native) or boiled (labelled with ‘H’ for heat) for 5 min before mixing with the ODNs. Protein-to-nucleotide molar ratios were 1:40, 1:20 and 1:10 for each protein tested (corresponding to 4, 8 and 16 nM protein concentrations, respectively). Lane 1: labelled Tar() ODN alone; lane 2: Tar()/Tar(+) complex formed by heat annealing at 628C, without protein; lanes 3, 28, 35 and 42: Tar()/Tar(+) complex formed at 378C in the absence of protein; lanes 4–6, 10–12, 16–18, 22–24, 29–31, 36–38 and 43–45: complex formation at 378C in the presence of increasing concentrations of proteins without prior boiling; lanes 7–9, 13–15, 19–21, 25–27, 32–34, 39–41 and 46–48: complex formation at 378C in the presence of increasing concentrations of proteins after boiling. (C) Kinetics of hammerhead ribozyme cleavage in the presence of Flaviviridae core proteins. R3 ribozyme and P-labelled S14 substrate were incubated with core proteins at 1:20 protein-to-nucleotide molar ratio (corresponding to 15 nM protein concentrations) at 378C. Reactions were stopped at different time points, as indicated in the figure. Proteins were either kept on ice (grey bars) or boiled for 5 min (black bars) before incubation with the RNAs. RNAs were resolved on an 8% denaturing polyacrylamide gel and the percentages of the cleaved S14 substrate were determined by autoradiography and PhosporImager quantification. As a control, R3 and S14 were co-incubated without protein either at 48Corat 378C (dark grey bars). Results of a representative experiment are shown. by autoradiography following denaturing gel electropho- not have an effect either on the kinetics or on the end- resis (Figure 4C). After 30 min incubation, 20% of the point of the reaction, indicating that heating does not lead substrate RNA was cleaved in the absence of protein. As to a decrease in the RNA chaperone activity of expected, all core proteins induced a considerable increase Flaviviridae core proteins. Overall, the potent strand annealing activity and in the cleavage rates, with hepacivirus core proteins demonstrating a higher activity compared to WNV and facilitation of ribozyme cleavage retained after boiling of BVDV cores (Figure 4C). Importantly, boiling of the the proteins provide convincing evidence that heat resis- proteins for 5 min before incubation with the RNAs did tance is a general feature of Flaviviridae cores. % cleaved S14 Tar(−) 37°C 62°C 4°C, 30′ 37°C 37°C, 30′ 37°C 37°C Nucleic Acids Research, 2008, Vol. 36, No. 3 719 secondary structures remained nearly the same as it was at 958C (Figure 6A). Similarly to HCV core, adding 0.1% DM to GBV-B core protein led to the formation of partly a-helical structure (Figure 6B). Ellipticity changes upon heating and cooling indicated that GBV-B core denaturation was mostly reversible in the presence of DM (Figure 6B). The denaturation was characterized by a decrease in a-helix content (from 39% to 26%), a decrease in the content of unordered structures (from 50% to 44%), and by an increase in b-sheet content (from 11% to 30%). After renaturation, the content of b-sheets and of unordered structures was nearly the same as it was before heating, while the content of a-helices remained the same as it was at 958C (Figure 6B). In agreement with the available stuctural data on Figure 5. Far-UV CD analysis of HCV and GBV-B core proteins. flavivirus capsid proteins (40–42), WNV core exhibited CD spectra were recorded at 208C, in 20 mM sodium phosphate buffer the characteristics of an a-helical protein, with local molar (pH 7.4) containing 5 mM 2-mercaptoethanol. ellipticity minima at 208 and 222 nm (Figure 6C). Estimating the secondary structure content of WNV Investigating the secondary structure content core by CD deconvolution gave 77% a-helix, in accor- of Flaviviridae core proteins dance with the published crystal structure of the protein (40). Ellipticity changes at 222 nm upon heating of the In order to get further insights into the structural require- protein showed a classical denaturation curve (Figure 6C). ments for RNA chaperoning, we carried out far-UV CD Surprisingly, denaturation of WNV core was mostly measurements on FL HCV, GBV-B, WNV and BVDV reversible, as shown by the renaturation curve and the core proteins, and on HCV core(2–117). The secondary spectrum recorded at 208C after cooling of the sample structure of HCV core has been well characterized (Figure 6C). In separate experiments, we obtained full before (36,53), and was included in these studies only for renaturation of WNV core protein after heating at 958C a direct comparison with other Flaviviridae core proteins (data not shown). The reason for this discrepancy is (Figure 5). The isolated N-terminal domain of HCV core currently unknown. The reversibility of the WNV core [core(2–117)], as well as the FL HCV and GBV-B core protein denaturation was confirmed by the determination proteins are mostly unstructured in solution, showing of similar secondary structure content prior to heating an ellipticity minimum at 198 nm, characteristically of and after cooling of the protein (Figure 6C). random-coil like peptides [(36) and Figure 5]. Indeed, BVDV core protein, in agreement with the disorder estimation of the secondary structure content by CD prediction (Figure 1), was found to be completely unstruc- deconvolution indicated <10% a-helical structure for tured at 208C, as evidenced by the pronounced minimum hepacivirus core proteins [(36) and data not shown]. in the CD spectrum observed at 200 nm (Figure 6D). As previously reported, FL HCV core [core(2–169)] requires the presence of mild, non-ionic detergents [such The chaperoning activity of the C-terminal RNA-binding as 0.1% n-dodecyl b-D-maltoside (DM)] for efficient region of WNV core solubilization, presumably mimicking the effect of lipid droplet association. Under these conditions HCV The isolated N- and C-terminal regions of the WNV core adopts a mostly a-helical conformation [(36), and core protein were found to independently bind RNA Figure 6A]. (43). Using the strand-annealing assay (Figure 2A), we In order to examine the effect of temperature on the examined the chaperoning activity of the N-terminal conformation of core proteins, far-UV CD spectra were (WNV 1–24) and C-terminal (WNV 80–105) core peptides. recorded at 208C, followed by slow (18C/min) heating The two peptides are similar in length and basic amino acid of the samples up to 958C, with constant monitoring content (7 basic residues for WNV 1–24 versus 8 for WNV of thermal unfolding at 222 nm (54,55). A second CD 80–105). As shown in Figure 7A, WNV 1–24 exhibited only spectrum was recorded at 958C, and conformational a low level of strand-annealing activity, while WNV 80–105 changes associated with the slow (18C/min) cooling of caused efficient DNA duplex formation. Incubation of the samples were followed again at 222 nm. Upon heating the ODNs with WNV 1–24 and WNV 80–105 together did of HCV core(2–169) in 0.1% DM, the protein underwent not result in a considerable increase in annealing compared irreversible denaturation, as indicated by the markedly to WNV 80–105 alone, indicating that the two peptides different spectra recorded at 222 nm upon heating and do not act in a cooperative manner (Figure 7A). cooling (Figure 6A). The denaturation was characterized The RNA chaperone activity of the WNV (80–105) by a decrease in a-helix content (from 44% to 28%), peptide was further confirmed with the ribozyme cleavage a decrease in the content of unordered structures (from assay, which requires both the strand annealing and helix 50% to 41%), and by an increase in b-sheet content unwinding activities of a chaperone. In agreement with the (from 6% to 31%). After renaturation, the content in results of the strand-annealing assay, WNV (80–105) 720 Nucleic Acids Research, 2008, Vol. 36, No. 3 A HCV core(2–169) - in 0.1% DM at 222 nm a-helix b-sheet unordered HCV core HCV core % % — 20 20 ˚ °CC 44 % 44 % 6 % 6 % 50 % 50 % — 95°C 28 % 28 % 3 31 % 1 % 4 41 % 1 % % % — 20 20 ˚ °CC 29 % 29 % 26 % 26 % 44 % 44 % after cooling after cooling B GBV-B core - in 0.1% DM at 222 nm a-helix b-sheet unordered GBV-B core GBV-B core % — % 20 ˚ 20°C C 39 % 39 % 11 % 11 % 50 % 50 % — 95 95°C 26 % 30 % 44 % % — % 20 ˚ 20°C C 29 % 29 % 17 % 17 % 54 % 54 % af aft te er c r coolin ooling g Figure 6. Far-UV CD analysis of core proteins. Far-UV CD spectra of HCV (A), GBV-B (B), WNV (C) and BVDV (D) core proteins. Measurements were done in 20 mM sodium phosphate buffer (pH 7.4) containing 5 mM 2-mercaptoethanol. For HCV and GBV-B core proteins, the buffer also contained 0.1% n-dodecyl b-D-maltoside (DM). Spectra were recorded at 208C, at 958C after slow heating of the protein, and again at 208C after slow cooling. Melting curves were recorded at 222 nm, during the heating and cooling processes. Secondary structure content was calculated by the k2d method of spectral deconvolution (http://www.cryst.bbk.ac.uk/cdweb/html/home.html). peptide caused a clear activation of the ribozyme-directed in this experiment (one protein molecule per 2.5 nt), the S14 RNA cleavage, while WNV peptide (1–24) did not FL WNV core protein demonstrated sub-optimal cleavage accelerate the cleavage reaction at all (Figure 7B). Interest- enhancement, emphasizing that RNA chaperoning occurs ingly, at the highest protein-to-nucleotide molar ratio used in a relatively narrow ‘window of activity’ (18,20). Nucleic Acids Research, 2008, Vol. 36, No. 3 721 C WNV core at 222 nm WNV WNV core core a-helix b-sheet unordered % — 20 ˚ 20°C C 77 % 77 % 0 % 0 % 23 % 23 % — 95°C 9 % 9 % 3 35 % 5 % 5 56 % 6 % % — 20 ˚ 20°C C 61 % 61 % 6 % 6 % 33 % 33 % af aft te er c r coolin ooling g D BVDV core B BVDV VDV c c oo re re a-helix b-sheet unordered % — 20 20 ˚ °C C 5 % 5 % 5 % 5 % 90 % 90 % — 95°C 6 % 6 % 2 26 % 6 % 6 68 % 8 % % — 20 20 ˚ °C C 19 % 19 % 27 % 27 % 54 % 54 % af aft te er c r co ool olin ing g Figure 6. Continued. While a low protein–RNA ratio probably favours high spatially regulated roles throughout the virus life cycle. affinity interactions (selection of RNA substrates) over It serves both as a template for minus-strand RNA or chaperoning, a high occupancy of RNA molecules by the DNA synthesis and as an mRNA directing the translation chaperone could ‘freeze’ RNA structure, hindering con- of viral proteins, and lastly, it is specifically packaged into formational rearrangements (18,20). newly made progeny virions. To accomplish these func- CD spectroscopy of WNV peptides (1–24) and (80–105) tions, the gRNA relies at least in part on short specific revealed that they are both completely unfolded cis-acting RNA elements (CREs), which regulate viral (Figure 7C; deconvolution data not shown), suggesting translation, replication with possible recombination events that RNA chaperone activity of WNV core protein does and virion assembly in infected cells (22–23,56–57). Thus, not require a well-defined structure. the gRNA and its CREs most probably undergo complex structural rearrangements, assisted by a virus-encoded protein with nucleic acid chaperone activities. The best- DISCUSSION characterized example of a viral nucleic acid chaperone is RNA chaperone activity of Flaviviridae core proteins the small nucleocapsid protein (NCp7) of human immu- and possible functional implications nodeficiency virus type 1 (HIV-1). NCp7 mediates several The genomic RNA (gRNA) of non-segmented positive RNA–RNA and RNA–DNA interactions and gRNA sense RNA viruses plays complex, temporally and rearrangements that are required at multiple stages of the 722 Nucleic Acids Research, 2008, Vol. 36, No. 3 FL WNV WNV WNV WNV1–24 + core 1–24 80–105 WNV 80–105 Tar(+) (−) Tar(−) 1 2 3 4 5 6 7 8 9 10 111213 14 1516 17 18 19 20 21 22 23 24 2526 protein/nt molar ratio FL WNV WNV WNV WNV1–24 + core 1–24 80–105 WNV 80–105 Figure 7. Strand-annealing activity of WNV core peptides. (A) P-labelled Tar() ODN was incubated together with Tar(+) ODN in the presence of increasing amounts of the proteins, as indicated at the top of the figure. Protein-to-nucleotide molar ratios were 1:160, 1:80, 1:40, 1:20, 1:10 and 1:5 for each protein tested (corresponding to 1, 2, 4, 8, 16 and 32 nM protein concentrations, respectively). Lane 1: Tar()/Tar(+) complex formed at 378C in the absence of protein; lane 2: Tar()/Tar(+) complex formed by heat annealing at 628C, without protein; lanes 3–8, 9–14, 15–20 and 21–26: complex formation at 378C in the presence of increasing concentrations of proteins. (B) Enhancement of hammerhead ribozyme cleavage by WNV core peptides. R3 ribozyme and P-labelled S14 RNA substrate were incubated at 378C for 25 min in the presence of increasing amounts of the proteins, as indicated in the figure. Protein-to-nucleotide molar ratios were 1:20, 1:10, 1:5 and 1:2.5 for each protein tested (corresponding to 15, 30, 60 and 120 nM protein concentrations, respectively). RNAs were resolved on an 8% denaturing polyacrylamide gel and the percentage of the cleaved S14 substrate was determined by autoradiography and PhosporImager quantification. As a control, R3 and S14 were co-incubated without protein either at 48Cor at378C (grey bars). Results of a representative experiment are shown. (C) Far-UV CD spectra of WNV core peptides. CD spectra were recorded at 208C, in 20 mM sodium phosphate buffer (pH 7.4) containing 5 mM 2-mercaptoethanol. virus replication cycle, such as initiation and completion The core protein of HCV exhibits striking similarities to of viral DNA synthesis, virus assembly, genome dimeriza- HIV-1 NCp7, as evidenced by its potent in vitro nucleic tion and packaging (22,23,56). In addition, NCp7 most acid chaperone activities, facilitating RNA–RNA inter- likely contributes to the genetic variability of HIV-1 by actions and structural rearrangements (25,26). Further promoting gRNA dimerization, thus enhancing the strengthening the analogy with retroviruses, the genomic frequency of copy-choice recombination (58). RNA of HCV contains a short palindromic CRE % cleaved S14 37°C 4°C 62°C 37°C 1:20 1:10 1:5 1:2.5 1:20 1:10 1:5 1:2.5 1:20 1:10 1:5 1:2.5 1:20 1:10 1:5 1:2.5 Nucleic Acids Research, 2008, Vol. 36, No. 3 723 mediating dimerization of the gRNA 3 untranslated chaperones is considerably higher than in any other region (UTR) upon core protein binding in vitro (25,26). protein class examined so far. However, in most cases Albeit the physiological relevance of this interaction is still the protein region responsible for the RNA chaperone not clear, it is tempting to speculate that RNA structural function is not precisely mapped, preventing the straight- rearrangements induced by HCV core chaperoning— forward assessments of the correlation between disorder and chaperoning. including genomic RNA dimerization—may constitute In spite of significant differences in their sequence and regulatory switch(es) between translation/replication or domain organization, Flaviviridae core proteins all possess replication/packaging of the viral RNA. RNA chaperone activities, thus providing an ideal model The closest relative of HCV is GB virus-B, a hepato- system to study the common (sequence and structural) tropic virus with unknown natural host range that requirements for chaperone function. In order to examine was shown to be infectious in New World monkeys (59). whether intrinsic disorder really plays an important role Even though the similarity between HCV and GBV-B is only 25–30% at the protein level (60), the two viruses in chaperone activity, we analysed the secondary struc- show striking resemblance in virtually every aspect of their ture content of Flaviviridae core proteins by far-UV CD replication strategy and structural features, including the spectroscopy both at room temperature, and during tripartite organization of the 3 UTR, IRES structure and thermal denaturation and renaturation. In agreement translation mechanism, and lipid droplet association of with in silico predictions (Figure 1), the four proteins the core protein (3). By means of classical in vitro RNA were found to contain various amounts of secondary chaperone assays (e.g. strand annealing, strand exchange structure. Hepacivirus (HCV and GBV-B) core proteins and ribozyme assays; Figures 2 and 3, and data not are mostly unstructured in solution (Figure 5), and they shown), we showed that nucleic acid chaperone activity is only gain an a-helical conformation in membrane-mimetic also conserved between the two hepacivirus core proteins, environments, provided in our experiments by 0.1% and that GBV-B core also efficiently facilitates the forma- dodecyl maltoside (Figure 6A and B). This property is tion of the most stable nucleic acid structure. In addition, due to the presence of hydrophobic domain D2 (Figure 1) similarly to HCV, GBV-B core protein binding induced involved in lipid droplet association (9,37). Nevertheless, dimerization of the 3 UTR of the GBV-B gRNA (R.I.-N. even in these conditions, approximately half of the protein and J.-L.D., unpublished data), suggesting that core- remained highly flexible, as shown by the estimation of mediated dimerization is a common feature in the hepaci- secondary structure content for both HCV and GBV-B virus genus. core (Figures 6A and B). In sharp constrast, WNV core Despite a lack of significant similarity with hepacivirus was found to be mostly structured by CD spectroscopy cores in amino acid sequence or domain organization (Figure 6C), in agreement with the published crystal (Figure 1), core proteins of the flavivirus WNV and the structure of the protein (40). Despite these structural pestivirus BVDV both demonstrated potent RNA chaper- differences between hepacivirus and flavivirus core one activities in vitro (Figures 2 and 3). Currently, we are proteins, relatively short unstructured peptides were investigating potential CREs in the WNV and BVDV shown to be responsible for the chaperone activity of genomic RNAs possibly regulated by core chaperoning. both HCV and WNV cores [(26), and Figures 4 and 7]. 0 0 Preliminary results show that the 5 and 3 conserved Surprisingly, BVDV core protein was found to completely sequence (CS) elements of the WNV genome—involved in lack a well-defined structure, as evidenced by its CD spectrum at 208C and 958C (Figure 6D). Further support- long-range RNA–RNA interaction, leading to genome ing the hypothesis that a well-defined structure is not cyclization necessary for viral replication (61–64)—require required for RNA chaperoning, Flaviviridae core proteins the strand annealing activity provided by RNA chaper- retained most of their chaperone activity after heat ones for efficient interaction (R.I-.N. and J.-L.D., ‘denaturation’, a characteristic feature of intrinsically unpublished data). unstructured proteins (Figure 4). Overall, these experiments show that even closely Intrinsic disorder and RNA chaperone activity related RNA chaperones may utilize different strategies The mechanism of action of RNA chaperone proteins and structural features to carry out the same function, is still not well understood. According to the recently and that RNA chaperone activity of Flaviviridae core proposed entropy exchange model, intrinsically unstruc- proteins is mediated by disordered, highly charged protein tured, highly flexible protein regions would play an segments, lending experimental support to the entropy essential role in facilitating RNA structural rearrange- exchange hypothesis. ments in an ATP-independent manner, probably by providing the energy necessary for partially melting the misfolded RNA structure through an entropy exchange SUPPLEMENTARY DATA process, coupled with the cyclic RNA binding and release Supplementary Data are available at NAR Online. of the protein (24). Experimental evidence for the role of unstructured domains in RNA chaperone function is still scattered and incomplete (20,24). Based on bioinformatic ACKNOWLEDGEMENTS analysis of a dataset consisting of 27 RNA chaperone proteins, Tompa and Csermely (24) found that the freq- R.I-N. is the recipient of an ANRS PhD fellowship. We uency of long, continuous disordered fragments in RNA are grateful to Roland Montserret (IBCP CNRS, Lyon) 724 Nucleic Acids Research, 2008, Vol. 36, No. 3 18. Cristofari,G. and Darlix,J.L. (2002) The ubiquitous nature of RNA for help and advice on CD spectroscopy measure- chaperone proteins. Prog. Nucleic Acid Res. Mol. Biol., 72, 223–268. ments and to Franc¸ ois Penin (IBCP CNRS, Lyon) for 19. Schroeder,R., Barta,A. and Semrad,K. (2004) Strategies for RNA his support and discussions. We thank Philippe Despres folding and assembly. Nat. Rev. Mol. Cell Biol., 5, 908–919. (Institut Pasteur, Paris), Jens Bukh (NIH, Bethesda, USA) 20. Ivanyi-Nagy,R., Davidovic,L., Khandjian,E.W. and Darlix,J.L. (2005) Disordered RNA chaperone proteins: from functions to and Till Ru¨ menapf (Justus-Liebig-Universita¨ t, Giesen, disease. Cell. Mol. Life Sci., 62, 1409–1417. Germany) for their kind gift of plasmids. This work was 21. Bertrand,E.L. and Rossi,J.J. (1994) Facilitation of hammerhead funded by Agence nationale de recherches sur le sida ribozyme catalysis by the nucleocapsid protein of HIV-1 and the (to J.-L.D. and J.-P.L.); CNRS and Universite´ Lyon I heterogeneous nuclear ribonucleoprotein A1. EMBO J., 13, (to J.-P.L.). Funding to pay the Open Access publication 2904–2912. 22. Darlix,J.L., Lapadat-Tapolsky,M., de Rocquigny,H. and charges for this article was provided by French ANRS. Roques,B.P. (1995) First glimpses at structure-function relationships of the nucleocapsid protein of retroviruses. J. Mol. Biol., 254, Conflict of interest statement. None declared. 523–537. 23. Rein,A., Henderson,L.E. and Levin,J.G. (1998) Nucleic-acid- chaperone activity of retroviral nucleocapsid proteins: significance for viral replication. Trends Biochem. Sci., 23, 297–301. REFERENCES 24. Tompa,P. and Csermely,P. (2004) The role of structural disorder in 1. Shepard,C.W., Finelli,L. and Alter,M.J. (2005) Global epidemiology the function of RNA and protein chaperones. FASEB J., 18, of hepatitis C virus infection. Lancet Infect. Dis., 5, 558–567. 1169–1175. 2. Brown,R.S. (2005) Hepatitis C and liver transplantation. Nature, 25. Cristofari,G., Ivanyi-Nagy,R., Gabus,C., Boulant,S., Lavergne,J.P., 436, 973–978. Penin,F. and Darlix,J.L. (2004) The hepatitis C virus Core protein 3. Lindenbach,B.D., Thiel,H.J. and Rice,C.M. (2007) Flaviviridae: the is a potent nucleic acid chaperone that directs dimerization of the viruses and their replication. In Knipe,D.M., Howley,P.M., viral (+) strand RNA in vitro. Nucleic Acids Res., 32, 2623–2631. Griffin,D.E., Lamb,R.A., Martin,M.A., Roizman,B. and Straus,S.E. 26. Ivanyi-Nagy,R., Kanevsky,I., Gabus,C., Lavergne,J.P., Ficheux,D., (eds), Fields Virology, Lippincott Williams & Wilkins, Philadelphia, Penin,F., Fosse´ ,P. and Darlix,J.L. (2006) Analysis of hepatitis C pp. 1101–1152. virus RNA dimerization and core-RNA interactions. 4. Hijikata,M., Kato,N., Ootsuyama,Y., Nakagawa,M. and Nucleic Acids Res., 34, 2618–2633. Shimotohno,K. (1991) Gene mapping of the putative structural 27. Boulant,S., Becchi,M., Penin,F. and Lavergne,J.P. (2003) Unusual region of the hepatitis C virus genome by in vitro processing multiple recoding events leading to alternative forms of hepatitis C analysis. Proc. Natl Acad. Sci. USA, 88, 5547–5551. virus core protein from genotype 1b. J. Biol. Chem., 278, 5. Santolini,E., Migliaccio,G. and La Monica,N. (1994) Biosynthesis 45785–45792. and biochemical properties of the hepatitis C virus core protein. 28. Boni,S., Lavergne,J.P., Boulant,S. and Cahour,A. (2005) J. Virol., 68, 3631–3641. Hepatitis C virus core protein acts as a trans-modulating factor on 6. Lemberg,M.K. and Martoglio,B. (2002) Requirements for signal internal translation initiation of the viral RNA. J. Biol. Chem., 280, peptide peptidase-catalyzed intramembrane proteolysis. Mol. Cell, 17737–17748. 10, 735–744. 29. Tsuchihashi,Z. and Brown,P.O. (1994) DNA strand exchange and 7. McLauchlan,J., Lemberg,M.K., Hope,G. and Martoglio,B. (2002) selective DNA annealing promoted by the human immunodeficiency Intramembrane proteolysis promotes trafficking of hepatitis C virus virus type 1 nucleocapsid protein. J. Virol., 68, 5863–5870. core protein to lipid droplets. EMBO J., 21, 3980–3988. 30. Gabus,C., Ivanyi-Nagy,R., Depollier,J., Bucheton,A., Pelisson,A. 8. Hope,R.G. and McLauchlan,J. (2000) Sequence motifs required for and Darlix,J.L. (2006) Characterization of a nucleocapsid-like Lys,2 lipid droplet association and protein stability are unique to the region and of two distinct primer tRNA binding sites in the hepatitis C virus core protein. J. Gen. Virol., 81, 1913–1925. endogenous retrovirus Gypsy. Nucleic Acids Res., 34, 5764–5777. 9. Hope,R.G., Murphy,D.J. and McLauchlan,J. (2002) The domains 31. Obradovic,Z., Peng,K., Vucetic,S., Radivojac,P., Brown,C.J. and required to direct core proteins of hepatitis C virus and GB virus-B Dunker,A.K. (2003) Predicting intrinsic disorder from amino acid to lipid droplets share common features with plant oleosin proteins. sequence. Proteins, 53(Suppl. 6), 566–572. J. Biol. Chem., 277, 4261–4270. 32. Doszta´ nyi,Z., Csizmo´ k,V., Tompa,P. and Simon,I. (2005) IUPred: 10. Lobigs,M. (1993) Flavivirus premembrane protein cleavage and web server for the prediction of intrinsically unstructured regions of spike heterodimer secretion require the function of the viral proteins based on estimated energy content. Bioinformatics, 21, proteinase NS3. Proc. Natl Acad. Sci. USA, 90, 6218–6222. 3433–3434. 11. Amberg,S.M., Nestorowicz,A., McCourt,D.W. and Rice,C.M. 33. Prilusky,J., Felder,C.E., Zeev-Ben-Mordehai,T., Rydberg,E.H., (1994) NS2B-3 proteinase-mediated processing in the yellow fever Man,O., Beckmann,J.S., Silman,I. and Sussman,J.L. (2005) virus structural region: in vitro and in vivo studies. J. Virol., 68, FoldIndex: a simple tool to predict whether a given protein 3794–3802. sequence is intrinsically unfolded. Bioinformatics, 21, 3435–3438. 12. Yamshchikov,V.F. and Compans,R.W. (1994) Processing of the 34. Doszta´ nyi,Z., Csizmo´ k,V., Tompa,P. and Simon,I. (2005) The intracellular form of the West Nile virus capsid protein by the viral pairwise energy content estimated from amino acid composition NS2B-NS3 protease: an in vitro study. J. Virol., 68, 5765–5771. discriminates between folded and intrinsically unstructured proteins. 13. Ru¨ menapf,T., Unger,G., Strauss,J.H. and Thiel,H.J. (1993) J. Mol. Biol., 347, 827–839. Processing of the envelope glycoproteins of pestiviruses. J. Virol., 35. Uversky,V.N., Gillespie,J.R. and Fink,A.L. (2000) Why are 67, 3288–3294. ‘‘natively unfolded’’ proteins unstructured under physiologic 14. Stark,R., Meyers,G., Ru¨ menapf,T. and Thiel,H.J. (1993) Processing conditions? Proteins, 41, 415–427. of pestivirus polyprotein: cleavage site between autoprotease and 36. Boulant,S., Vanbelle,C., Ebel,C., Penin,F. and Lavergne,J.P. (2005) nucleocapsid protein of classical swine fever virus. J. Virol., 67, Hepatitis C virus core protein is a dimeric alpha-helical protein 7088–7095. exhibiting membrane protein features. J. Virol., 79, 11353–11365. 15. Rumenapf,T., Stark,R., Heimann,M. and Thiel,H.J. (1998) ¨ 37. Boulant,S., Montserret,R., Hope,R.G., Ratinier,M., N-terminal protease of pestiviruses: identification of putative Targett-Adams,P., Lavergne,J.P., Penin,F. and McLauchlan,J. catalytic residues by site-directed mutagenesis. J. Virol., 72, (2006) Structural determinants that target the hepatitis C virus core 2544–2547. protein to lipid droplets. J. Biol. Chem., 281, 22236–22247. 16. Heimann,M., Roman-Sosa,G., Martoglio,B., Thiel,H.J. and 38. Klein,K.C., Polyak,S.J. and Lingappa,J.R. (2004) Unique features Ru¨ menapf,T. (2006) Core protein of pestiviruses is processed at the of hepatitis C virus capsid formation revealed by de novo cell-free C terminus by signal peptide peptidase. J. Virol., 80, 1915–1921. assembly. J. Virol., 78, 9257–9269. 17. Herschlag,D. (1995) RNA chaperones and the RNA folding 39. Majeau,N., Gagne,V., Boivin,A., Bolduc,M., Majeau,J.A., problem. J. Biol. Chem., 270, 20871–20874. Ouellet,D. and Leclerc,D. (2004) The N-terminal half of the core Nucleic Acids Research, 2008, Vol. 36, No. 3 725 protein of hepatitis C virus is sufficient for nucleocapsid formation. 53. Kunkel,M. and Watowich,S.J. (2004) Biophysical characterization J. Gen. Virol., 85, 971–981. of hepatitis C virus core protein: implications for interactions within 40. Dokland,T., Walsh,M., Mackenzie,J.M., Khromykh,A.A., Ee,K.H. the virus and host. FEBS Lett., 557, 174–180. and Wang,S. (2004) West Nile virus core protein; tetramer structure 54. Kim,T.D., Ryu,H.J., Cho,H.I., Yang,C.H. and Kim,J. (2000) and ribbon formation. Structure, 12, 1157–1163. Thermal behavior of proteins: heat-resistant proteins and their 41. Ma,L., Jones,C.T., Groesch,T.D., Kuhn,R.J. and Post,C.B. (2004) heat-induced secondary structural changes. Biochemistry, 39, Solution structure of dengue virus capsid protein reveals another 14839–14846. fold. Proc. Natl Acad. Sci. USA, 101, 3414–3419. 55. Uversky,V.N. (2002) What does it mean to be natively unfolded? 42. Jones,C.T., Ma,L., Burgner,J.W., Groesch,T.D., Post,C.B. and Eur. J. Biochem., 269, 2–12. Kuhn,R.J. (2003) Flavivirus capsid is a dimeric alpha-helical 56. Darlix,J.L., Garrido,J.L., Morellet,N., Me´ ly,Y. and Rocquigny,H. protein. J. Virol., 77, 7143–7149. (2007) Properties, functions, and drug targeting of the multi- 43. Khromykh,A.A. and Westaway,E.G. (1996) RNA binding functional nucleocapsid protein of the human immunodeficiency properties of core protein of the flavivirus Kunjin. Arch. Virol., virus. Adv. Pharmacol., 55, 299–346. 141, 685–699. 57. Moradpour,D., Penin,F. and Rice,C.M. (2007) Replication of 44. Waldsich,C., Grossberger,R. and Schroeder,R. (2002) RNA hepatitis C virus. Nat. Rev. Microbiol., 5, 453–463. chaperone StpA loosens interactions of the tertiary structure in the 58. Negroni,M. and Buc,H. (2000) Copy-choice recombination td group I intron in vivo. Genes Dev., 16, 2300–2312. by reverse transcriptases: reshuffling of genetic markers 45. Tsuchihashi,Z., Khosla,M. and Herschlag,D. (1993) Protein mediated by RNA chaperones. Proc. Natl Acad. Sci. USA, 97, enhancement of hammerhead ribozyme catalysis. Science, 262, 6385–6390. 99–102. 59. Bukh,J., Apgar,C.L., Govindarajan,S. and Purcell,R.H. (2001) 46. Herschlag,D., Khosla,M., Tsuchihashi,Z. and Karpel,R.L. (1994) Host range studies of GB virus-B hepatitis agent, the closest relative An RNA chaperone activity of non-specific RNA binding proteins of hepatitis C virus, in New World monkeys and chimpanzees. in hammerhead ribozyme catalysis. EMBO J., 13, 2913–2924. J. Med. Virol., 65, 694–697. 47. Gabus,C., Mazroui,R., Tremblay,S., Khandjian,E.W. and 60. Muerhoff,A.S., Leary,T.P, Simons,J.N., Pilot-Matias,T.J., Darlix,J.L. (2004) The fragile X mental retardation protein has Dawson,G.J., Erker,J.C., Chalmers,M.L., Schlauder,G.G., nucleic acid chaperone properties. Nucleic Acids Res., 32, Desai,S.M. et al. (1995) Genomic organization of GB viruses A and 2129–2137. B: two new members of the Flaviviridae associated with GB agent 48. Weinreb,P.H., Zhen,W., Poon,A.W., Conway,K.A. and hepatitis. J. Virol., 69, 5621–5630. Lansbury,P.T. Jr (1996) NACP, a protein implicated in Alzheimer’s 61. Khromykh,A.A., Meka,H., Guyatt,K.J. and Westaway,E.G. (2001) disease and learning, is natively unfolded. Biochemistry, 35, Essential role of cyclization sequences in flavivirus RNA replication. 13709–13715. J. Virol., 75, 6719–6728. 49. Receveur-Bre´ chot,V., Bourhis,J.M., Uversky,V.N., Canard,B. and 62. Lo,M.K., Tilgner,M., Bernard,K.A. and Shi,P.Y. (2003) Longhi,S. (2006) Assessing protein disorder and induced folding. Functional analysis of mosquito-borne flavivirus conserved Proteins, 62, 24–45. sequence elements within 3 untranslated region of West 50. Kalthoff,C. (2003) A novel strategy for the purification of Nile virus by use of a reporting replicon that differentiates recombinantly expressed unstructured protein domains. between viral translation and RNA replication. J. Virol., 77, J. Chromatogr. B Analyt. Technol. Biomed. Life Sci., 786, 247–254. 10004–10014. 51. Csizmo´ k,V., Szollosi,E., Friedrich,P. and Tompa,P. (2006) A novel 63. Alvarez,D.E., Lodeiro,M.F., Luduena,S.J., Pietrasanta,L.I. and two-dimensional electrophoresis technique for the identification of Gamarnik,A.V. (2005) Long-range RNA–RNA interactions circu- intrinsically unstructured proteins. Mol. Cell. Proteomics, 5, larize the dengue virus genome. J. Virol., 79, 6631–6643. 265–273. 64. Filomatori,C.V., Lodeiro,M.F., Alvarez,D.E., Samsa,M.M., 52. Csizmo´ k,V., Doszta´ nyi,Z., Simon,I. and Tompa,P. (2007) Towards Pietrasanta,L. and Gamarnik,A.V. (2006) A 5’ RNA element proteomic approaches for the identification of structural disorder. promotes dengue virus RNA synthesis on a circular genome. Curr. Protein Pept. Sci., 8, 173–179. Genes Dev., 20, 2238–2249.

Journal

Nucleic Acids Research – Oxford University Press

Published: Feb 22, 2008

There are no references for this article.